{ "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.159, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.937, "chi2": -163.911, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.944, "C1C1_dist": 10.697, "N1N9_dist": 8.788, "C6C8_dist": 9.513, "CNNC_torsion": -1.851, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.61],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.99]", "interBase_angle": 8.194, "planarity": 0.085, "simple_Shear": -0.784, "simple_Stretch": -0.434, "simple_Buckle": -6.613, "simple_Propeller": -4.838, "bp_simpleParams": [ -0.784, -0.434, -0.085, -6.613, -4.838, -8.352 ], "bp_params": [ -0.751, -0.490, -0.085, -6.243, -5.306, -8.348 ], "frame": { "rmsd": null, "origin": [ -21.442, 13.847, 13.157 ], "x_axis": [ 0.357, 0.595, 0.720 ], "y_axis": [ -0.400, -0.599, 0.694 ], "z_axis": [ 0.844, -0.536, 0.024 ], "quaternion": [ 0.442, 0.695, 0.070, 0.562 ] } }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.609, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.862, "chi2": -159.925, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.237, "C1C1_dist": 10.750, "N1N9_dist": 9.036, "C6C8_dist": 9.955, "CNNC_torsion": 6.909, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 2.854, "planarity": 0.040, "simple_Shear": 0.125, "simple_Stretch": -0.067, "simple_Buckle": -2.753, "simple_Propeller": 0.751, "bp_simpleParams": [ 0.125, -0.067, 0.074, -2.753, 0.751, -0.881 ], "bp_params": [ 0.124, -0.068, 0.074, -2.747, 0.773, -0.881 ], "frame": { "rmsd": null, "origin": [ -17.938, 13.284, 12.632 ], "x_axis": [ 0.043, 0.172, 0.984 ], "y_axis": [ -0.559, -0.813, 0.167 ], "z_axis": [ 0.828, -0.557, 0.061 ], "quaternion": [ 0.270, 0.670, -0.144, 0.676 ] } }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.325, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.587, "chi2": -158.050, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.828, "C1C1_dist": 10.348, "N1N9_dist": 8.721, "C6C8_dist": 9.738, "CNNC_torsion": -1.644, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.72],N2(amino)-O2(carbonyl)[2.51]", "interBase_angle": 3.387, "planarity": 0.040, "simple_Shear": -0.151, "simple_Stretch": -0.279, "simple_Buckle": -0.955, "simple_Propeller": -3.250, "bp_simpleParams": [ -0.151, -0.279, -0.052, -0.955, -3.250, 2.993 ], "bp_params": [ -0.148, -0.281, -0.052, -0.922, -3.259, 2.994 ], "frame": { "rmsd": null, "origin": [ -14.176, 13.146, 13.233 ], "x_axis": [ -0.281, -0.167, 0.945 ], "y_axis": [ -0.510, -0.809, -0.294 ], "z_axis": [ 0.813, -0.564, 0.142 ], "quaternion": [ 0.115, 0.589, -0.287, 0.747 ] } }, { "index": 4, "nt1": "///A/5", "nt2": "///B/41", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -178.480, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.641, "chi2": -158.894, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.290, "C1C1_dist": 9.775, "N1N9_dist": 8.013, "C6C8_dist": 8.899, "CNNC_torsion": 2.872, "hbonds_num": 2, "hbonds_desc": "N3(imino)-O2(carbonyl)[3.79],O4(carbonyl)-N3(imino)[2.90]", "interBase_angle": 12.165, "planarity": 0.167, "simple_Shear": -2.630, "simple_Stretch": -0.838, "simple_Buckle": -0.091, "simple_Propeller": -12.165, "bp_simpleParams": [ -2.630, -0.838, -0.533, -0.091, -12.165, -7.412 ], "bp_params": [ -2.319, -1.497, -0.533, 3.097, -11.765, -7.448 ], "frame": { "rmsd": null, "origin": [ -10.542, 12.927, 14.164 ], "x_axis": [ -0.485, -0.463, 0.742 ], "y_axis": [ -0.349, -0.676, -0.650 ], "z_axis": [ 0.802, -0.574, 0.166 ], "quaternion": [ -0.037, 0.506, -0.401, 0.763 ] } }, { "index": 5, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.980, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.745, "chi2": 173.942, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 52.355, "C1C1_dist": 10.530, "N1N9_dist": 8.812, "C6C8_dist": 9.736, "CNNC_torsion": 8.147, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.80],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 4.450, "planarity": 0.111, "simple_Shear": 0.395, "simple_Stretch": -0.287, "simple_Buckle": -3.432, "simple_Propeller": 2.833, "bp_simpleParams": [ 0.395, -0.287, -0.338, -3.432, 2.833, -0.978 ], "bp_params": [ 0.385, -0.301, -0.338, -3.332, 2.950, -0.978 ], "frame": { "rmsd": null, "origin": [ -7.922, 11.151, 17.328 ], "x_axis": [ -0.635, -0.770, 0.071 ], "y_axis": [ 0.079, -0.155, -0.985 ], "z_axis": [ 0.769, -0.619, 0.159 ], "quaternion": [ -0.304, 0.301, -0.575, 0.698 ] } }, { "index": 6, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.910, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.630, "chi2": -157.624, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.884, "C1C1_dist": 10.536, "N1N9_dist": 8.886, "C6C8_dist": 9.866, "CNNC_torsion": -8.365, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 15.756, "planarity": 0.184, "simple_Shear": 0.081, "simple_Stretch": -0.165, "simple_Buckle": 3.826, "simple_Propeller": -15.284, "bp_simpleParams": [ 0.081, -0.165, -0.008, 3.826, -15.284, 1.671 ], "bp_params": [ 0.081, -0.165, -0.008, 3.783, -15.295, 1.685 ], "frame": { "rmsd": null, "origin": [ -4.440, 4.721, 19.612 ], "x_axis": [ -0.400, -0.087, -0.912 ], "y_axis": [ 0.592, 0.735, -0.330 ], "z_axis": [ 0.699, -0.672, -0.243 ], "quaternion": [ 0.522, 0.164, 0.771, -0.325 ] } }, { "index": 7, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.632, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.969, "chi2": -159.589, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.457, "C1C1_dist": 10.386, "N1N9_dist": 8.757, "C6C8_dist": 9.760, "CNNC_torsion": -15.558, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.72]", "interBase_angle": 16.941, "planarity": 0.214, "simple_Shear": 0.294, "simple_Stretch": -0.179, "simple_Buckle": 4.121, "simple_Propeller": -16.432, "bp_simpleParams": [ 0.294, -0.179, 0.021, 4.121, -16.432, 2.591 ], "bp_params": [ 0.288, -0.189, 0.021, 3.565, -16.562, 2.617 ], "frame": { "rmsd": null, "origin": [ -3.273, 1.579, 18.806 ], "x_axis": [ -0.139, 0.460, -0.877 ], "y_axis": [ 0.757, 0.620, 0.205 ], "z_axis": [ 0.638, -0.636, -0.434 ], "quaternion": [ 0.512, 0.411, 0.741, -0.145 ] } }, { "index": 8, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.204, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.777, "chi2": -170.327, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.261, "C1C1_dist": 10.549, "N1N9_dist": 8.969, "C6C8_dist": 10.018, "CNNC_torsion": -13.170, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[3.20]", "interBase_angle": 20.137, "planarity": 0.242, "simple_Shear": 0.246, "simple_Stretch": 0.008, "simple_Buckle": 5.682, "simple_Propeller": -19.318, "bp_simpleParams": [ 0.246, 0.008, 0.058, 5.682, -19.318, 5.060 ], "bp_params": [ 0.247, 0.004, 0.058, 5.345, -19.414, 5.128 ], "frame": { "rmsd": null, "origin": [ -2.693, -0.772, 15.763 ], "x_axis": [ 0.211, 0.715, -0.667 ], "y_axis": [ 0.757, 0.313, 0.574 ], "z_axis": [ 0.619, -0.625, -0.475 ], "quaternion": [ 0.512, 0.586, 0.628, -0.020 ] } }, { "index": 9, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.298, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.720, "chi2": -164.095, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.945, "C1C1_dist": 10.542, "N1N9_dist": 8.828, "C6C8_dist": 9.773, "CNNC_torsion": -4.633, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.75]", "interBase_angle": 11.845, "planarity": 0.130, "simple_Shear": -0.169, "simple_Stretch": -0.232, "simple_Buckle": 6.849, "simple_Propeller": -9.664, "bp_simpleParams": [ -0.169, -0.232, -0.175, 6.849, -9.664, 0.803 ], "bp_params": [ -0.163, -0.236, -0.175, 7.074, -9.501, 0.804 ], "frame": { "rmsd": null, "origin": [ -2.324, -3.694, 13.224 ], "x_axis": [ 0.495, 0.832, -0.250 ], "y_axis": [ 0.555, -0.082, 0.828 ], "z_axis": [ 0.669, -0.548, -0.502 ], "quaternion": [ 0.477, 0.721, 0.481, 0.145 ] } }, { "index": 10, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.168, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.510, "chi2": -159.943, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.700, "C1C1_dist": 10.811, "N1N9_dist": 9.077, "C6C8_dist": 9.978, "CNNC_torsion": -8.682, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[2.99]", "interBase_angle": 14.793, "planarity": 0.171, "simple_Shear": -0.229, "simple_Stretch": -0.036, "simple_Buckle": -6.149, "simple_Propeller": -13.454, "bp_simpleParams": [ -0.229, -0.036, -0.303, -6.149, -13.454, -0.834 ], "bp_params": [ -0.228, -0.039, -0.303, -5.922, -13.556, -0.838 ], "frame": { "rmsd": null, "origin": [ -0.429, -5.016, 9.969 ], "x_axis": [ 0.581, 0.754, 0.307 ], "y_axis": [ 0.260, -0.529, 0.807 ], "z_axis": [ 0.771, -0.389, -0.504 ], "quaternion": [ 0.370, 0.808, 0.314, 0.334 ] } }, { "index": 11, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.481, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.849, "chi2": -164.268, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.439, "C1C1_dist": 10.546, "N1N9_dist": 8.898, "C6C8_dist": 9.872, "CNNC_torsion": -9.630, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 12.855, "planarity": 0.160, "simple_Shear": -0.087, "simple_Stretch": -0.156, "simple_Buckle": -3.078, "simple_Propeller": -12.481, "bp_simpleParams": [ -0.087, -0.156, 0.162, -3.078, -12.481, 1.078 ], "bp_params": [ -0.087, -0.156, 0.162, -3.024, -12.494, 1.084 ], "frame": { "rmsd": null, "origin": [ 2.322, -4.374, 7.815 ], "x_axis": [ 0.500, 0.430, 0.752 ], "y_axis": [ -0.058, -0.849, 0.525 ], "z_axis": [ 0.864, -0.306, -0.399 ], "quaternion": [ 0.251, 0.829, 0.112, 0.487 ] } }, { "index": 12, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.532, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.174, "chi2": -158.881, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.512, "C1C1_dist": 10.579, "N1N9_dist": 8.873, "C6C8_dist": 9.813, "CNNC_torsion": -9.470, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 19.447, "planarity": 0.231, "simple_Shear": 0.173, "simple_Stretch": -0.100, "simple_Buckle": -9.880, "simple_Propeller": -16.750, "bp_simpleParams": [ 0.173, -0.100, 0.222, -9.880, -16.750, -0.144 ], "bp_params": [ 0.171, -0.103, 0.222, -10.168, -16.577, -0.145 ], "frame": { "rmsd": null, "origin": [ 5.446, -4.033, 5.873 ], "x_axis": [ 0.348, -0.108, 0.931 ], "y_axis": [ -0.311, -0.950, 0.006 ], "z_axis": [ 0.884, -0.292, -0.364 ], "quaternion": [ 0.091, 0.816, -0.128, 0.557 ] } }, { "index": 13, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.235, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.334, "chi2": -163.593, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.624, "C1C1_dist": 10.627, "N1N9_dist": 8.948, "C6C8_dist": 9.926, "CNNC_torsion": -5.352, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 8.969, "planarity": 0.108, "simple_Shear": 0.103, "simple_Stretch": -0.085, "simple_Buckle": -3.431, "simple_Propeller": -8.287, "bp_simpleParams": [ 0.103, -0.085, 0.101, -3.431, -8.287, 1.525 ], "bp_params": [ 0.102, -0.087, 0.101, -3.558, -8.233, 1.528 ], "frame": { "rmsd": null, "origin": [ 8.763, -3.495, 5.783 ], "x_axis": [ 0.005, -0.554, 0.833 ], "y_axis": [ -0.358, -0.779, -0.516 ], "z_axis": [ 0.934, -0.295, -0.202 ], "quaternion": [ -0.078, 0.705, -0.323, 0.627 ] } }, { "index": 14, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.711, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.125, "chi2": 177.385, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.772, "C1C1_dist": 10.579, "N1N9_dist": 8.938, "C6C8_dist": 9.950, "CNNC_torsion": 3.681, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 5.310, "planarity": 0.129, "simple_Shear": -0.005, "simple_Stretch": -0.075, "simple_Buckle": 4.385, "simple_Propeller": -2.995, "bp_simpleParams": [ -0.005, -0.075, -0.288, 4.385, -2.995, 3.453 ], "bp_params": [ -0.005, -0.075, -0.288, 4.374, -3.011, 3.452 ], "frame": { "rmsd": null, "origin": [ 15.529, -4.755, 9.212 ], "x_axis": [ -0.414, -0.849, -0.330 ], "y_axis": [ 0.381, 0.168, -0.909 ], "z_axis": [ 0.827, -0.502, 0.254 ], "quaternion": [ 0.502, -0.203, 0.576, -0.612 ] } }, { "index": 15, "nt1": "///A/19", "nt2": "///B/27", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.794, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.501, "chi2": -161.886, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.391, "C1C1_dist": 9.629, "N1N9_dist": 7.810, "C6C8_dist": 8.635, "CNNC_torsion": -2.215, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[3.55],N3(imino)-O4(carbonyl)[2.59]", "interBase_angle": 9.740, "planarity": 0.124, "simple_Shear": 2.661, "simple_Stretch": -1.074, "simple_Buckle": 1.489, "simple_Propeller": -9.626, "bp_simpleParams": [ 2.661, -1.074, -0.262, 1.489, -9.626, -10.384 ], "bp_params": [ 2.283, -1.738, -0.262, -1.109, -9.677, -10.420 ], "frame": { "rmsd": null, "origin": [ 17.681, -6.659, 12.352 ], "x_axis": [ -0.113, -0.522, -0.846 ], "y_axis": [ 0.573, 0.661, -0.485 ], "z_axis": [ 0.812, -0.539, 0.224 ], "quaternion": [ 0.666, 0.021, 0.623, -0.411 ] } }, { "index": 16, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.709, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.000, "chi2": -170.642, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.487, "C1C1_dist": 10.512, "N1N9_dist": 8.760, "C6C8_dist": 9.666, "CNNC_torsion": 1.760, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.67],N4(amino)-O6(carbonyl)[2.64]", "interBase_angle": 2.742, "planarity": 0.042, "simple_Shear": -0.035, "simple_Stretch": -0.353, "simple_Buckle": -1.041, "simple_Propeller": -2.537, "bp_simpleParams": [ -0.035, -0.353, -0.016, -1.041, -2.537, -1.322 ], "bp_params": [ -0.032, -0.353, -0.016, -1.020, -2.545, -1.323 ], "frame": { "rmsd": null, "origin": [ 18.869, -10.367, 13.490 ], "x_axis": [ 0.073, -0.207, -0.976 ], "y_axis": [ 0.596, 0.793, -0.124 ], "z_axis": [ 0.800, -0.572, 0.181 ], "quaternion": [ 0.716, 0.157, 0.620, -0.281 ] } }, { "index": 17, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.962, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.863, "chi2": -171.287, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.369, "C1C1_dist": 10.610, "N1N9_dist": 8.818, "C6C8_dist": 9.648, "CNNC_torsion": -1.337, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.58],N1(imino)-N3[2.74],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 0.979, "planarity": 0.028, "simple_Shear": -0.150, "simple_Stretch": -0.354, "simple_Buckle": -0.490, "simple_Propeller": -0.848, "bp_simpleParams": [ -0.150, -0.354, 0.076, -0.490, -0.848, -4.989 ], "bp_params": [ -0.146, -0.356, 0.076, -0.481, -0.853, -4.989 ], "frame": { "rmsd": null, "origin": [ 20.432, -13.577, 13.529 ], "x_axis": [ 0.308, 0.301, -0.902 ], "y_axis": [ 0.476, 0.773, 0.420 ], "z_axis": [ 0.824, -0.559, 0.095 ], "quaternion": [ 0.737, 0.332, 0.585, -0.059 ] } }, { "index": 18, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.129, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.712, "chi2": -173.678, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.401, "C1C1_dist": 10.725, "N1N9_dist": 8.928, "C6C8_dist": 9.758, "CNNC_torsion": 2.987, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.73]", "interBase_angle": 6.630, "planarity": 0.082, "simple_Shear": 0.345, "simple_Stretch": -0.251, "simple_Buckle": 4.693, "simple_Propeller": -4.682, "bp_simpleParams": [ 0.345, -0.251, -0.306, 4.693, -4.682, -4.449 ], "bp_params": [ 0.337, -0.261, -0.306, 4.554, -4.818, -4.449 ], "frame": { "rmsd": null, "origin": [ 22.287, -16.687, 12.005 ], "x_axis": [ 0.495, 0.643, -0.584 ], "y_axis": [ 0.331, 0.482, 0.811 ], "z_axis": [ 0.803, -0.595, 0.026 ], "quaternion": [ 0.708, 0.497, 0.490, 0.110 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GCGUCCACCGGUGGUCGC", "strand2": "CGCUGGUGGCCACCUGCG", "bp_type": "|||.||||||||||.|||", "helix_form": "AA..xAAAAAAAx..AA", "helical_rise": 2.992, "helical_rise_std": 1.272, "helical_radius": 9.592, "helical_radius_std": 2.277, "helical_axis": [ 0.811, -0.504, -0.296 ], "point1": [ -19.781, 12.018, 20.102 ], "point2": [ 21.288, -13.489, 5.101 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.751, -0.490, -0.085, -6.243, -5.306, -8.348 ], "step_params": [ 0.060, -1.589, 3.216, -2.264, 1.219, 34.268 ], "heli_params": [ -2.876, -0.446, 3.149, 2.065, 3.836, 34.362 ], "bp2_params": [ 0.124, -0.068, 0.074, -2.747, 0.773, -0.881 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 29.645, "simple_hRise": 3.136, "simple_hTwist": 29.753 }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.068, 0.074, -2.747, 0.773, -0.881 ], "step_params": [ 0.140, -2.022, 3.229, -0.524, 4.719, 26.813 ], "heli_params": [ -5.400, -0.420, 2.835, 10.075, 1.120, 27.222 ], "bp2_params": [ -0.148, -0.281, -0.052, -0.922, -3.259, 2.994 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.229, "simple_Twist": 28.455, "simple_hRise": 2.860, "simple_hTwist": 28.840 }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.281, -0.052, -0.922, -3.259, 2.994 ], "step_params": [ -0.550, -1.886, 3.203, -0.044, 1.640, 23.786 ], "heli_params": [ -5.081, 1.316, 3.068, 3.974, 0.107, 23.841 ], "bp2_params": [ -2.319, -1.497, -0.533, 3.097, -11.765, -7.448 ], "groove_widths": [ 18.082, null, 15.091, null ], "simple_Rise": 3.203, "simple_Twist": 36.782, "simple_hRise": 3.119, "simple_hTwist": 36.818 }, { "index": 4, "nt1": "///A/5", "nt2": "///B/41", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.319, -1.497, -0.533, 3.097, -11.765, -7.448 ], "step_params": [ 1.008, -2.411, 3.633, -1.808, 2.677, 44.163 ], "heli_params": [ -3.469, -1.520, 3.447, 3.555, 2.401, 44.275 ], "bp2_params": [ 0.385, -0.301, -0.338, -3.332, 2.950, -0.978 ], "groove_widths": [ 19.394, 13.305, 14.426, 14.387 ], "simple_Rise": 3.633, "simple_Twist": 28.350, "simple_hRise": 3.327, "simple_hTwist": 28.530 }, { "index": 5, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.385, -0.301, -0.338, -3.332, 2.950, -0.978 ], "step_params": [ 0.699, -3.540, 6.758, -16.701, 16.886, 74.452 ], "heli_params": [ -3.767, -1.490, 5.736, 13.628, 13.478, 77.623 ], "bp2_params": [ 0.081, -0.165, -0.008, 3.783, -15.295, 1.685 ], "groove_widths": [ 20.637, 15.071, 12.556, 11.223 ], "simple_Rise": 6.758, "simple_Twist": 76.099, "simple_hRise": 5.770, "simple_hTwist": 79.180 }, { "index": 6, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.165, -0.008, 3.783, -15.295, 1.685 ], "step_params": [ -0.191, -1.445, 3.125, 0.264, 11.707, 33.359 ], "heli_params": [ -3.915, 0.349, 2.491, 19.655, -0.444, 35.299 ], "bp2_params": [ 0.288, -0.189, 0.021, 3.565, -16.562, 2.617 ], "groove_widths": [ 22.531, 17.154, 11.815, 9.976 ], "simple_Rise": 3.125, "simple_Twist": 32.307, "simple_hRise": 2.466, "simple_hTwist": 34.310 }, { "index": 7, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.288, -0.189, 0.021, 3.565, -16.562, 2.617 ], "step_params": [ 1.008, -1.914, 3.231, 1.503, 2.189, 27.786 ], "heli_params": [ -4.476, -1.742, 3.123, 4.546, -3.121, 27.910 ], "bp2_params": [ 0.247, 0.004, 0.058, 5.345, -19.414, 5.128 ], "groove_widths": [ 19.639, 15.579, 17.977, 13.277 ], "simple_Rise": 3.231, "simple_Twist": 28.257, "simple_hRise": 3.125, "simple_hTwist": 28.379 }, { "index": 8, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.247, 0.004, 0.058, 5.345, -19.414, 5.128 ], "step_params": [ -0.991, -1.979, 3.197, -1.323, 5.294, 29.570 ], "heli_params": [ -4.828, 1.657, 2.848, 10.262, 2.565, 30.059 ], "bp2_params": [ -0.163, -0.236, -0.175, 7.074, -9.501, 0.804 ], "groove_widths": [ 16.103, 14.479, 18.292, 14.683 ], "simple_Rise": 3.197, "simple_Twist": 31.349, "simple_hRise": 2.871, "simple_hTwist": 31.808 }, { "index": 9, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.163, -0.236, -0.175, 7.074, -9.501, 0.804 ], "step_params": [ -0.132, -1.638, 3.638, 0.480, 10.885, 31.249 ], "heli_params": [ -4.780, 0.316, 2.917, 19.480, -0.859, 33.049 ], "bp2_params": [ -0.228, -0.039, -0.303, -5.922, -13.556, -0.838 ], "groove_widths": [ 16.619, 15.529, 17.216, 14.517 ], "simple_Rise": 3.638, "simple_Twist": 31.558, "simple_hRise": 2.925, "simple_hTwist": 33.341 }, { "index": 10, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, -0.039, -0.303, -5.922, -13.556, -0.838 ], "step_params": [ 0.765, -1.726, 3.008, -1.302, 9.222, 30.968 ], "heli_params": [ -4.477, -1.569, 2.376, 16.801, 2.372, 32.306 ], "bp2_params": [ -0.087, -0.156, 0.162, -3.024, -12.494, 1.084 ], "groove_widths": [ 16.676, 15.213, 15.884, 12.223 ], "simple_Rise": 3.008, "simple_Twist": 30.434, "simple_hRise": 2.363, "simple_hTwist": 31.795 }, { "index": 11, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.156, 0.162, -3.024, -12.494, 1.084 ], "step_params": [ -0.272, -1.486, 3.371, 0.410, 2.441, 34.058 ], "heli_params": [ -2.923, 0.529, 3.257, 4.160, -0.699, 34.145 ], "bp2_params": [ 0.171, -0.103, 0.222, -10.168, -16.577, -0.145 ], "groove_widths": [ 20.747, 15.895, 15.833, 10.346 ], "simple_Rise": 3.371, "simple_Twist": 32.237, "simple_hRise": 3.249, "simple_hTwist": 32.329 }, { "index": 12, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.171, -0.103, 0.222, -10.168, -16.577, -0.145 ], "step_params": [ 0.320, -1.681, 2.894, 3.304, 9.138, 31.948 ], "heli_params": [ -4.175, -0.107, 2.357, 16.141, -5.837, 33.356 ], "bp2_params": [ 0.102, -0.087, 0.101, -3.558, -8.233, 1.528 ], "groove_widths": [ 23.617, 17.475, 11.255, 9.170 ], "simple_Rise": 2.894, "simple_Twist": 32.546, "simple_hRise": 2.369, "simple_hTwist": 33.928 }, { "index": 13, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.102, -0.087, 0.101, -3.558, -8.233, 1.528 ], "step_params": [ -0.436, -3.613, 6.774, 20.242, 21.673, 77.799 ], "heli_params": [ -3.802, 1.321, 5.569, 16.706, -15.603, 82.414 ], "bp2_params": [ -0.005, -0.075, -0.288, 4.374, -3.011, 3.452 ], "groove_widths": [ 21.245, 15.902, 11.820, 10.250 ], "simple_Rise": 6.774, "simple_Twist": 78.541, "simple_hRise": 5.587, "simple_hTwist": 83.098 }, { "index": 14, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.075, -0.288, 4.374, -3.011, 3.452 ], "step_params": [ -1.180, -2.106, 3.505, 0.101, 2.869, 39.687 ], "heli_params": [ -3.443, 1.746, 3.348, 4.219, -0.148, 39.787 ], "bp2_params": [ 2.283, -1.738, -0.262, -1.109, -9.677, -10.420 ], "groove_widths": [ 19.924, 14.043, 14.100, 14.099 ], "simple_Rise": 3.505, "simple_Twist": 25.909, "simple_hRise": 3.253, "simple_hTwist": 26.065 }, { "index": 15, "nt1": "///A/19", "nt2": "///B/27", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.283, -1.738, -0.262, -1.109, -9.677, -10.420 ], "step_params": [ 0.292, -2.410, 3.250, 1.079, 2.988, 22.176 ], "heli_params": [ -7.254, -0.371, 2.915, 7.716, -2.787, 22.399 ], "bp2_params": [ -0.032, -0.353, -0.016, -1.020, -2.545, -1.323 ], "groove_widths": [ 17.940, null, 16.853, null ], "simple_Rise": 3.250, "simple_Twist": 35.948, "simple_hRise": 3.054, "simple_hTwist": 36.083 }, { "index": 16, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.353, -0.016, -1.020, -2.545, -1.323 ], "step_params": [ 0.119, -1.780, 3.093, -0.657, 5.192, 32.406 ], "heli_params": [ -3.956, -0.313, 2.779, 9.228, 1.169, 32.814 ], "bp2_params": [ -0.146, -0.356, 0.076, -0.481, -0.853, -4.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 33.126, "simple_hRise": 2.786, "simple_hTwist": 33.526 }, { "index": 17, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.146, -0.356, 0.076, -0.481, -0.853, -4.989 ], "step_params": [ 0.392, -2.225, 3.215, 4.375, 1.490, 29.108 ], "heli_params": [ -4.684, 0.139, 3.123, 2.940, -8.636, 29.464 ], "bp2_params": [ 0.337, -0.261, -0.306, 4.554, -4.818, -4.449 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.215, "simple_Twist": 26.479, "simple_hRise": 3.110, "simple_hTwist": 26.872 }, { "index": 18, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCG", "strand2": "CGC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.509, "helical_rise_std": 0.111, "helical_radius": 9.114, "helical_radius_std": 0.697, "helical_axis": [ 0.846, -0.533, 0.016 ], "point1": [ -20.684, 15.604, 15.805 ], "point2": [ -14.664, 11.811, 15.920 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.751, -0.490, -0.085, -6.243, -5.306, -8.348 ], "step_params": [ 0.060, -1.589, 3.216, -2.264, 1.219, 34.268 ], "heli_params": [ -2.876, -0.446, 3.149, 2.065, 3.836, 34.362 ], "bp2_params": [ 0.124, -0.068, 0.074, -2.747, 0.773, -0.881 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 29.645, "simple_hRise": 3.136, "simple_hTwist": 29.753 }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.068, 0.074, -2.747, 0.773, -0.881 ], "step_params": [ 0.140, -2.022, 3.229, -0.524, 4.719, 26.813 ], "heli_params": [ -5.400, -0.420, 2.835, 10.075, 1.120, 27.222 ], "bp2_params": [ -0.148, -0.281, -0.052, -0.922, -3.259, 2.994 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.229, "simple_Twist": 28.455, "simple_hRise": 2.860, "simple_hTwist": 28.840 }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CACCGGUG", "strand2": "GUGGCCAC", "bp_type": "||||||||", "helix_form": "AAAAAAA", "helical_rise": 2.672, "helical_rise_std": 0.233, "helical_radius": 9.445, "helical_radius_std": 0.561, "helical_axis": [ 0.806, -0.506, -0.309 ], "point1": [ -6.387, 4.059, 15.072 ], "point2": [ 8.648, -5.384, 9.312 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.165, -0.008, 3.783, -15.295, 1.685 ], "step_params": [ -0.191, -1.445, 3.125, 0.264, 11.707, 33.359 ], "heli_params": [ -3.915, 0.349, 2.491, 19.655, -0.444, 35.299 ], "bp2_params": [ 0.288, -0.189, 0.021, 3.565, -16.562, 2.617 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.125, "simple_Twist": 32.307, "simple_hRise": 2.466, "simple_hTwist": 34.310 }, { "index": 2, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.288, -0.189, 0.021, 3.565, -16.562, 2.617 ], "step_params": [ 1.008, -1.914, 3.231, 1.503, 2.189, 27.786 ], "heli_params": [ -4.476, -1.742, 3.123, 4.546, -3.121, 27.910 ], "bp2_params": [ 0.247, 0.004, 0.058, 5.345, -19.414, 5.128 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.231, "simple_Twist": 28.257, "simple_hRise": 3.125, "simple_hTwist": 28.379 }, { "index": 3, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.247, 0.004, 0.058, 5.345, -19.414, 5.128 ], "step_params": [ -0.991, -1.979, 3.197, -1.323, 5.294, 29.570 ], "heli_params": [ -4.828, 1.657, 2.848, 10.262, 2.565, 30.059 ], "bp2_params": [ -0.163, -0.236, -0.175, 7.074, -9.501, 0.804 ], "groove_widths": [ 16.103, null, 18.292, null ], "simple_Rise": 3.197, "simple_Twist": 31.349, "simple_hRise": 2.871, "simple_hTwist": 31.808 }, { "index": 4, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.163, -0.236, -0.175, 7.074, -9.501, 0.804 ], "step_params": [ -0.132, -1.638, 3.638, 0.480, 10.885, 31.249 ], "heli_params": [ -4.780, 0.316, 2.917, 19.480, -0.859, 33.049 ], "bp2_params": [ -0.228, -0.039, -0.303, -5.922, -13.556, -0.838 ], "groove_widths": [ 16.619, 15.529, 17.216, 14.517 ], "simple_Rise": 3.638, "simple_Twist": 31.558, "simple_hRise": 2.925, "simple_hTwist": 33.341 }, { "index": 5, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, -0.039, -0.303, -5.922, -13.556, -0.838 ], "step_params": [ 0.765, -1.726, 3.008, -1.302, 9.222, 30.968 ], "heli_params": [ -4.477, -1.569, 2.376, 16.801, 2.372, 32.306 ], "bp2_params": [ -0.087, -0.156, 0.162, -3.024, -12.494, 1.084 ], "groove_widths": [ 16.676, null, 15.884, null ], "simple_Rise": 3.008, "simple_Twist": 30.434, "simple_hRise": 2.363, "simple_hTwist": 31.795 }, { "index": 6, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.156, 0.162, -3.024, -12.494, 1.084 ], "step_params": [ -0.272, -1.486, 3.371, 0.410, 2.441, 34.058 ], "heli_params": [ -2.923, 0.529, 3.257, 4.160, -0.699, 34.145 ], "bp2_params": [ 0.171, -0.103, 0.222, -10.168, -16.577, -0.145 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.371, "simple_Twist": 32.237, "simple_hRise": 3.249, "simple_hTwist": 32.329 }, { "index": 7, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.171, -0.103, 0.222, -10.168, -16.577, -0.145 ], "step_params": [ 0.320, -1.681, 2.894, 3.304, 9.138, 31.948 ], "heli_params": [ -4.175, -0.107, 2.357, 16.141, -5.837, 33.356 ], "bp2_params": [ 0.102, -0.087, 0.101, -3.558, -8.233, 1.528 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.894, "simple_Twist": 32.546, "simple_hRise": 2.369, "simple_hTwist": 33.928 }, { "index": 8, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "CGC", "strand2": "GCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.582, "helical_rise_std": 0.054, "helical_radius": 9.339, "helical_radius_std": 0.366, "helical_axis": [ 0.916, -0.363, 0.172 ], "point1": [ 19.644, -10.738, 8.498 ], "point2": [ 24.323, -12.590, 9.379 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.353, -0.016, -1.020, -2.545, -1.323 ], "step_params": [ 0.119, -1.780, 3.093, -0.657, 5.192, 32.406 ], "heli_params": [ -3.956, -0.313, 2.779, 9.228, 1.169, 32.814 ], "bp2_params": [ -0.146, -0.356, 0.076, -0.481, -0.853, -4.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 33.126, "simple_hRise": 2.786, "simple_hTwist": 33.526 }, { "index": 2, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.146, -0.356, 0.076, -0.481, -0.853, -4.989 ], "step_params": [ 0.392, -2.225, 3.215, 4.375, 1.490, 29.108 ], "heli_params": [ -4.684, 0.139, 3.123, 2.940, -8.636, 29.464 ], "bp2_params": [ 0.337, -0.261, -0.306, 4.554, -4.818, -4.449 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.215, "simple_Twist": 26.479, "simple_hRise": 3.110, "simple_hTwist": 26.872 }, { "index": 3, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 2, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 1, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/38,///B/39" }, { "index": 2, "num_nts": 3, "nts_short": "GUC", "nts_long": "///A/4,///A/5,///A/6" }, { "index": 3, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/26,///B/27,///B/28" }, { "index": 4, "num_nts": 5, "nts_short": "CAGUC", "nts_long": "///A/8,///A/7,///B/40,///B/41,///B/42" }, { "index": 5, "num_nts": 5, "nts_short": "CUGAC", "nts_long": "///A/20,///A/19,///A/18,///B/29,///B/30" } ], "nonStack": { "num_nts": 2, "nts_short": "AA", "nts_long": "///A/16,///A/17" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/45/O31", "nt": "///A/15", "vert_dist": 3.311 }, { "index": 2, "type": "other", "atom": "///A/45/O61", "nt": "///A/18", "vert_dist": 3.430 }, { "index": 3, "type": "other", "atom": "///A/46/O31", "nt": "///B/37", "vert_dist": 3.406 } ], "num_iloops": 4, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, -1 ], "summary": "[2] 1 1 [A.4 B.42 A.6 B.40] 3 1", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/4,///A/5,///A/6,///B/40,///B/41,///B/42", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/5" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/41" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ -2, 3 ], "summary": "[2] 1 1 [A.18 B.28 A.20 B.26] 1 3", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/18,///A/19,///A/20,///B/26,///B/27,///B/28", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/19" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/27" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ -1, 2 ], "summary": "[2] 1 2 [A.6 B.40 A.8 B.37] 1 8", "num_nts": 7, "nts_short": "CACGAAG", "nts_long": "///A/6,///A/7,///A/8,///B/37,///B/38,///B/39,///B/40", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/7" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/38,///B/39" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 2, 1 ], "stem_indices": [ 2, -2 ], "summary": "[2] 2 1 [A.15 B.30 A.18 B.28] 8 1", "num_nts": 7, "nts_short": "GAAGCAC", "nts_long": "///A/15,///A/16,///A/17,///A/18,///B/28,///B/29,///B/30", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/16,///A/17" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/29" } ] } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/15,///A/16" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/17,///A/18" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/37,///B/38" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/39,///B/40" } ], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "GCGUCACACCGGUGAAGUCGC&GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((&))).).))))))))..).)))", "form": "AA..AAAAAAAAA...AAAA-&AA..AAAAAAAAA...AAAA-" }, "chain_A": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA..AAAAAAAAA...AAAA-" }, "chain_B": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AA..AAAAAAAAA...AAAA-" } }, "chains": { "chain_A": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA..AAAAAAAAA...AAAA-", "helical_rise": 2.654, "helical_rise_std": 1.512, "helical_axis": [ 0.795, -0.597, 0.103 ], "point1": [ -17.827, 16.866, 4.769 ], "point2": [ 24.415, -14.871, 10.225 ], "num_chars": 61, "suite": "G1aC1aG1cU1aC1aA1aC1aA1aC1aC1aG1aG1aU1aG!!A7aA!!G1aU1aC1aG1aC" }, "chain_B": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AA..AAAAAAAAA...AAAA-", "helical_rise": 2.693, "helical_rise_std": 1.221, "helical_axis": [ -0.815, 0.578, -0.036 ], "point1": [ 23.185, -15.475, 18.516 ], "point2": [ -20.733, 15.634, 16.587 ], "num_chars": 61, "suite": "G1aC1aG!!U1cC1aA1aC1aA1aC1aC1aG1aG1aU1aG!!A1aA1aG1aU1aC1aG1aC" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ null, "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -170.660, "gamma": 54.016, "delta": 85.057, "epsilon": -163.852, "zeta": -65.563, "epsilon_zeta": -98.289, "bb_type": "BI", "chi": -168.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.661, 1.003 ], "P_xyz": [ 1.430, 8.967, 1.479 ], "form": "A", "ssZp": 4.660, "Dp": 4.603, "splay_angle": 24.195, "splay_distance": 3.662, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": null, "theta": -146.777, "eta_prime": null, "theta_prime": -144.678, "eta_base": null, "theta_base": -111.529, "v0": -0.028, "v1": -25.903, "v2": 40.602, "v3": -41.361, "v4": 26.229, "amplitude": 42.805, "phase_angle": 18.460, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -21.514, 13.793, 12.716 ], "x_axis": [ 0.427, 0.609, 0.669 ], "y_axis": [ -0.415, -0.525, 0.743 ], "z_axis": [ 0.803, -0.595, 0.029 ], "quaternion": [ 0.482, 0.693, 0.070, 0.531 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.725, "beta": -175.309, "gamma": 49.950, "delta": 85.581, "epsilon": -156.671, "zeta": -74.128, "epsilon_zeta": -82.543, "bb_type": "BI", "chi": -168.609, "glyco_bond": "anti", "C5prime_xyz": [ -1.045, 8.536, 1.081 ], "P_xyz": [ 1.562, 8.636, 1.395 ], "form": "A", "ssZp": 4.708, "Dp": 4.673, "splay_angle": 24.820, "splay_distance": 3.815, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 164.705, "theta": -148.252, "eta_prime": 178.198, "theta_prime": -146.366, "eta_base": -131.495, "theta_base": -126.802, "v0": 4.153, "v1": -29.244, "v2": 42.200, "v3": -40.618, "v4": 22.881, "amplitude": 43.319, "phase_angle": 13.049, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -17.885, 13.301, 12.689 ], "x_axis": [ 0.042, 0.182, 0.982 ], "y_axis": [ -0.578, -0.798, 0.173 ], "z_axis": [ 0.815, -0.575, 0.072 ], "quaternion": [ 0.281, 0.665, -0.149, 0.676 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -53.288, "beta": 176.480, "gamma": 43.331, "delta": 81.355, "epsilon": -176.844, "zeta": -71.919, "epsilon_zeta": -104.924, "bb_type": "BI", "chi": -167.325, "glyco_bond": "anti", "C5prime_xyz": [ -1.217, 8.586, 1.028 ], "P_xyz": [ 1.335, 8.874, 1.441 ], "form": ".", "ssZp": 4.549, "Dp": 4.518, "splay_angle": 26.539, "splay_distance": 4.290, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 172.675, "theta": -148.016, "eta_prime": -173.616, "theta_prime": -153.456, "eta_base": -137.366, "theta_base": -148.139, "v0": 4.591, "v1": -31.110, "v2": 44.931, "v3": -42.998, "v4": 24.341, "amplitude": 46.092, "phase_angle": 12.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.721, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -14.105, 13.286, 13.201 ], "x_axis": [ -0.271, -0.204, 0.941 ], "y_axis": [ -0.509, -0.799, -0.320 ], "z_axis": [ 0.817, -0.566, 0.113 ], "quaternion": [ 0.103, 0.595, -0.300, 0.739 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -175.939, "beta": -177.495, "gamma": 154.021, "delta": 83.819, "epsilon": -118.090, "zeta": -71.555, "epsilon_zeta": -46.535, "bb_type": "--", "chi": -178.480, "glyco_bond": "anti", "C5prime_xyz": [ -0.910, 7.980, 1.833 ], "P_xyz": [ 1.021, 9.468, 0.992 ], "form": ".", "ssZp": 4.847, "Dp": 4.832, "splay_angle": 32.438, "splay_distance": 5.080, "splay_ratio": 0.285, "d22": 3.826, "d64": 4.521, "eta": 174.599, "theta": -140.098, "eta_prime": 178.527, "theta_prime": -132.975, "eta_base": -164.952, "theta_base": -94.907, "v0": 11.627, "v1": -32.479, "v2": 40.507, "v3": -35.016, "v4": 14.516, "amplitude": 40.545, "phase_angle": 2.492, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.052, "filter_rmsd": 0.106, "frame": { "rmsd": 0.012, "origin": [ -9.932, 14.122, 13.745 ], "x_axis": [ -0.378, -0.472, 0.796 ], "y_axis": [ -0.352, -0.722, -0.595 ], "z_axis": [ 0.856, -0.505, 0.107 ], "quaternion": [ -0.041, 0.556, -0.370, 0.743 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -41.645, "beta": 166.340, "gamma": 40.756, "delta": 81.813, "epsilon": -161.201, "zeta": -72.180, "epsilon_zeta": -89.021, "bb_type": "BI", "chi": -169.980, "glyco_bond": "anti", "C5prime_xyz": [ -1.522, 8.716, 1.076 ], "P_xyz": [ 0.995, 9.255, 1.543 ], "form": "A", "ssZp": 4.623, "Dp": 4.605, "splay_angle": 25.862, "splay_distance": 4.041, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 165.587, "theta": -153.256, "eta_prime": -169.686, "theta_prime": -149.779, "eta_base": -111.237, "theta_base": -127.823, "v0": -0.512, "v1": -26.900, "v2": 42.611, "v3": -43.850, "v4": 27.981, "amplitude": 45.097, "phase_angle": 19.112, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.274, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -8.186, 11.131, 17.462 ], "x_axis": [ -0.655, -0.752, 0.075 ], "y_axis": [ 0.051, -0.143, -0.988 ], "z_axis": [ 0.754, -0.643, 0.132 ], "quaternion": [ -0.289, 0.299, -0.587, 0.695 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -57.435, "beta": 178.037, "gamma": 52.852, "delta": 85.606, "epsilon": -148.025, "zeta": -65.533, "epsilon_zeta": -82.492, "bb_type": "BI", "chi": -161.160, "glyco_bond": "anti", "C5prime_xyz": [ -1.584, 8.698, 0.472 ], "P_xyz": [ 0.959, 9.173, 0.809 ], "form": "A", "ssZp": 4.312, "Dp": 4.625, "splay_angle": 28.248, "splay_distance": 4.448, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": -177.817, "theta": -133.702, "eta_prime": -166.236, "theta_prime": -131.966, "eta_base": -135.482, "theta_base": -91.671, "v0": -1.510, "v1": -24.263, "v2": 39.392, "v3": -41.261, "v4": 26.857, "amplitude": 42.059, "phase_angle": 20.516, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.833, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -6.010, 8.831, 19.974 ], "x_axis": [ -0.493, -0.777, -0.392 ], "y_axis": [ 0.381, 0.212, -0.900 ], "z_axis": [ 0.782, -0.593, 0.191 ], "quaternion": [ 0.477, -0.161, 0.615, -0.607 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -70.650, "beta": -178.074, "gamma": 45.291, "delta": 86.779, "epsilon": -151.469, "zeta": -75.354, "epsilon_zeta": -76.116, "bb_type": "BI", "chi": -161.910, "glyco_bond": "anti", "C5prime_xyz": [ -1.347, 8.690, 0.684 ], "P_xyz": [ 1.176, 9.079, 1.163 ], "form": "A", "ssZp": 4.533, "Dp": 4.627, "splay_angle": 21.620, "splay_distance": 3.422, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 163.096, "theta": -145.443, "eta_prime": 179.599, "theta_prime": -142.511, "eta_base": -123.605, "theta_base": -115.862, "v0": 3.087, "v1": -27.878, "v2": 40.419, "v3": -39.752, "v4": 23.205, "amplitude": 41.734, "phase_angle": 14.423, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.785, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -4.507, 4.660, 19.603 ], "x_axis": [ -0.296, -0.166, -0.941 ], "y_axis": [ 0.620, 0.715, -0.322 ], "z_axis": [ 0.726, -0.679, -0.109 ], "quaternion": [ 0.572, 0.156, 0.728, -0.344 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.645, "beta": 174.788, "gamma": 42.114, "delta": 86.834, "epsilon": -152.534, "zeta": -63.346, "epsilon_zeta": -89.188, "bb_type": "BI", "chi": -154.632, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.712, 0.181 ], "P_xyz": [ 1.160, 9.177, 0.427 ], "form": "A", "ssZp": 4.254, "Dp": 4.609, "splay_angle": 22.456, "splay_distance": 3.825, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 166.124, "theta": -135.137, "eta_prime": 178.966, "theta_prime": -135.195, "eta_base": -141.479, "theta_base": -110.963, "v0": 1.964, "v1": -27.481, "v2": 41.172, "v3": -40.921, "v4": 24.442, "amplitude": 42.794, "phase_angle": 15.826, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.692, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -3.358, 1.579, 18.655 ], "x_axis": [ -0.030, 0.375, -0.926 ], "y_axis": [ 0.778, 0.591, 0.214 ], "z_axis": [ 0.628, -0.714, -0.310 ], "quaternion": [ 0.559, 0.415, 0.695, -0.180 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.693, "beta": 163.741, "gamma": 68.285, "delta": 80.451, "epsilon": -166.355, "zeta": -80.067, "epsilon_zeta": -86.288, "bb_type": "BI", "chi": -165.204, "glyco_bond": "anti", "C5prime_xyz": [ -1.999, 8.899, 0.696 ], "P_xyz": [ 0.283, 9.978, 0.056 ], "form": "A", "ssZp": 4.634, "Dp": 4.540, "splay_angle": 24.464, "splay_distance": 3.896, "splay_ratio": 0.215, "d22": 4.881, "d64": 4.915, "eta": 166.905, "theta": -166.524, "eta_prime": -171.583, "theta_prime": -166.923, "eta_base": -127.498, "theta_base": -150.348, "v0": -11.456, "v1": -19.486, "v2": 40.780, "v3": -48.314, "v4": 37.988, "amplitude": 48.060, "phase_angle": 31.950, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.580, "filter_rmsd": 0.061, "frame": { "rmsd": 0.010, "origin": [ -2.648, -0.702, 15.668 ], "x_axis": [ 0.344, 0.610, -0.714 ], "y_axis": [ 0.769, 0.253, 0.587 ], "z_axis": [ 0.539, -0.751, -0.382 ], "quaternion": [ 0.551, 0.607, 0.568, -0.072 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.201, "beta": -178.663, "gamma": 52.759, "delta": 82.519, "epsilon": -158.020, "zeta": -69.777, "epsilon_zeta": -88.243, "bb_type": "BI", "chi": -157.298, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.835, 0.308 ], "P_xyz": [ 1.139, 9.314, 0.585 ], "form": "A", "ssZp": 4.252, "Dp": 4.551, "splay_angle": 24.634, "splay_distance": 3.935, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 171.591, "theta": -148.061, "eta_prime": 176.963, "theta_prime": -147.299, "eta_base": -158.662, "theta_base": -122.749, "v0": 0.568, "v1": -27.931, "v2": 43.753, "v3": -44.062, "v4": 27.350, "amplitude": 45.921, "phase_angle": 17.676, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.749, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -2.488, -3.704, 13.190 ], "x_axis": [ 0.551, 0.783, -0.287 ], "y_axis": [ 0.590, -0.123, 0.798 ], "z_axis": [ 0.590, -0.609, -0.530 ], "quaternion": [ 0.474, 0.742, 0.462, 0.102 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.184, "beta": 179.933, "gamma": 47.435, "delta": 83.961, "epsilon": -153.314, "zeta": -69.000, "epsilon_zeta": -84.314, "bb_type": "BI", "chi": -162.168, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.758, 0.600 ], "P_xyz": [ 1.106, 9.289, 0.869 ], "form": "A", "ssZp": 4.477, "Dp": 4.658, "splay_angle": 23.177, "splay_distance": 3.826, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 166.295, "theta": -142.076, "eta_prime": 177.618, "theta_prime": -139.488, "eta_base": -143.785, "theta_base": -111.268, "v0": -0.369, "v1": -27.094, "v2": 42.940, "v3": -43.922, "v4": 27.785, "amplitude": 45.359, "phase_angle": 18.797, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -0.617, -5.033, 9.994 ], "x_axis": [ 0.667, 0.705, 0.242 ], "y_axis": [ 0.227, -0.501, 0.835 ], "z_axis": [ 0.710, -0.502, -0.494 ], "quaternion": [ 0.410, 0.816, 0.286, 0.292 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.494, "beta": 172.210, "gamma": 50.068, "delta": 83.977, "epsilon": -167.100, "zeta": -71.707, "epsilon_zeta": -95.394, "bb_type": "BI", "chi": -161.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.834, 8.832, 0.520 ], "P_xyz": [ 0.650, 9.644, 0.683 ], "form": "A", "ssZp": 4.392, "Dp": 4.473, "splay_angle": 23.556, "splay_distance": 3.697, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 168.951, "theta": -155.073, "eta_prime": -173.015, "theta_prime": -155.979, "eta_base": -127.956, "theta_base": -127.611, "v0": -4.243, "v1": -23.122, "v2": 40.036, "v3": -43.479, "v4": 29.963, "amplitude": 43.786, "phase_angle": 23.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 2.375, -4.351, 7.709 ], "x_axis": [ 0.590, 0.385, 0.710 ], "y_axis": [ -0.086, -0.844, 0.530 ], "z_axis": [ 0.803, -0.373, -0.465 ], "quaternion": [ 0.265, 0.851, 0.088, 0.444 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.268, "beta": -179.300, "gamma": 44.791, "delta": 84.067, "epsilon": -163.722, "zeta": -60.313, "epsilon_zeta": -103.409, "bb_type": "BI", "chi": -161.532, "glyco_bond": "anti", "C5prime_xyz": [ -1.271, 8.668, 0.709 ], "P_xyz": [ 1.305, 9.094, 0.935 ], "form": "A", "ssZp": 4.620, "Dp": 4.622, "splay_angle": 20.099, "splay_distance": 3.279, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 168.606, "theta": -144.584, "eta_prime": 178.867, "theta_prime": -143.532, "eta_base": -138.199, "theta_base": -117.886, "v0": 1.829, "v1": -27.623, "v2": 41.696, "v3": -41.521, "v4": 25.022, "amplitude": 43.402, "phase_angle": 16.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.694, "filter_rmsd": 0.104, "frame": { "rmsd": 0.009, "origin": [ 5.589, -4.026, 5.912 ], "x_axis": [ 0.470, -0.153, 0.869 ], "y_axis": [ -0.385, -0.922, 0.046 ], "z_axis": [ 0.794, -0.356, -0.492 ], "quaternion": [ 0.118, 0.849, -0.159, 0.490 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -68.558, "beta": -167.802, "gamma": 41.603, "delta": 82.331, "epsilon": -174.382, "zeta": -93.098, "epsilon_zeta": -81.284, "bb_type": "BI", "chi": -151.235, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.733, -0.023 ], "P_xyz": [ 1.245, 9.372, 0.324 ], "form": ".", "ssZp": 4.231, "Dp": 4.527, "splay_angle": 95.109, "splay_distance": 14.441, "splay_ratio": 0.740, "d22": null, "d64": null, "eta": 169.327, "theta": -154.728, "eta_prime": -178.170, "theta_prime": 177.294, "eta_base": -138.721, "theta_base": 151.578, "v0": 1.057, "v1": -26.695, "v2": 40.677, "v3": -41.409, "v4": 25.444, "amplitude": 42.615, "phase_angle": 17.345, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.594, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 8.826, -3.504, 5.838 ], "x_axis": [ 0.066, -0.585, 0.809 ], "y_axis": [ -0.387, -0.762, -0.519 ], "z_axis": [ 0.920, -0.279, -0.277 ], "quaternion": [ -0.083, 0.726, -0.335, 0.596 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": 124.894, "beta": 114.246, "gamma": 162.547, "delta": 90.817, "epsilon": -150.353, "zeta": -117.235, "epsilon_zeta": -33.118, "bb_type": "BI", "chi": -154.657, "glyco_bond": "anti", "C5prime_xyz": [ -1.207, 8.651, 0.237 ], "P_xyz": [ -1.180, 10.405, -1.722 ], "form": ".", "ssZp": 4.157, "Dp": 4.502, "splay_angle": 32.957, "splay_distance": 5.079, "splay_ratio": 0.288, "d22": null, "d64": null, "eta": 82.820, "theta": 120.829, "eta_prime": 77.466, "theta_prime": 140.961, "eta_base": 56.243, "theta_base": 129.424, "v0": 4.059, "v1": -25.268, "v2": 35.554, "v3": -34.398, "v4": 19.183, "amplitude": 36.417, "phase_angle": 12.498, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 12.979, -1.433, -7.837 ], "x_axis": [ -0.788, 0.605, 0.115 ], "y_axis": [ -0.320, -0.562, 0.763 ], "z_axis": [ 0.526, 0.564, 0.636 ], "quaternion": [ 0.268, 0.186, 0.384, 0.864 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -65.549, "beta": 162.037, "gamma": 60.263, "delta": 88.317, "epsilon": -175.599, "zeta": 69.366, "epsilon_zeta": 115.034, "bb_type": "--", "chi": -102.299, "glyco_bond": "anti", "C5prime_xyz": [ -2.122, 7.778, -2.598 ], "P_xyz": [ -0.075, 7.291, -4.165 ], "form": ".", "ssZp": 1.662, "Dp": 4.269, "splay_angle": 118.587, "splay_distance": 16.736, "splay_ratio": 0.860, "d22": null, "d64": null, "eta": 175.874, "theta": -10.317, "eta_prime": 176.959, "theta_prime": -30.534, "eta_base": 157.560, "theta_base": -18.825, "v0": -1.242, "v1": -22.192, "v2": 35.820, "v3": -37.590, "v4": 24.507, "amplitude": 38.233, "phase_angle": 20.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.509, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 17.805, -2.907, -7.255 ], "x_axis": [ -0.380, 0.915, 0.137 ], "y_axis": [ 0.146, -0.087, 0.985 ], "z_axis": [ 0.914, 0.394, -0.100 ], "quaternion": [ 0.329, 0.449, 0.590, 0.585 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -142.286, "beta": -140.737, "gamma": 48.498, "delta": 83.246, "epsilon": -160.225, "zeta": -68.470, "epsilon_zeta": -91.755, "bb_type": "BI", "chi": -173.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.745, 8.699, 1.266 ], "P_xyz": [ 0.350, 9.110, 2.774 ], "form": "A", "ssZp": 4.677, "Dp": 4.560, "splay_angle": 26.780, "splay_distance": 4.293, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 146.946, "theta": -151.091, "eta_prime": -173.803, "theta_prime": -143.765, "eta_base": -145.580, "theta_base": -114.282, "v0": -5.739, "v1": -21.803, "v2": 39.511, "v3": -43.702, "v4": 31.140, "amplitude": 43.885, "phase_angle": 25.798, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 15.397, -4.687, 9.210 ], "x_axis": [ -0.379, -0.857, -0.350 ], "y_axis": [ 0.424, 0.175, -0.889 ], "z_axis": [ 0.822, -0.485, 0.297 ], "quaternion": [ 0.523, -0.193, 0.561, -0.613 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -63.519, "beta": -174.014, "gamma": 49.829, "delta": 84.975, "epsilon": -149.537, "zeta": -87.170, "epsilon_zeta": -62.367, "bb_type": "BI", "chi": -161.794, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 8.753, 0.597 ], "P_xyz": [ 0.774, 9.420, 1.193 ], "form": "A", "ssZp": 4.409, "Dp": 4.559, "splay_angle": 23.118, "splay_distance": 3.720, "splay_ratio": 0.202, "d22": 4.501, "d64": 4.637, "eta": 178.610, "theta": -155.522, "eta_prime": -170.233, "theta_prime": -152.900, "eta_base": -134.393, "theta_base": -132.356, "v0": -2.919, "v1": -22.708, "v2": 38.389, "v3": -41.019, "v4": 27.591, "amplitude": 41.537, "phase_angle": 22.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.838, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 16.948, -7.758, 11.779 ], "x_axis": [ -0.095, -0.623, -0.776 ], "y_axis": [ 0.558, 0.612, -0.560 ], "z_axis": [ 0.824, -0.487, 0.290 ], "quaternion": [ 0.672, -0.027, 0.595, -0.440 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -55.295, "beta": 161.780, "gamma": 49.910, "delta": 82.888, "epsilon": -164.530, "zeta": -65.174, "epsilon_zeta": -99.356, "bb_type": "BI", "chi": -162.709, "glyco_bond": "anti", "C5prime_xyz": [ -1.583, 8.852, 0.598 ], "P_xyz": [ 0.981, 9.379, 0.626 ], "form": "A", "ssZp": 4.427, "Dp": 4.495, "splay_angle": 22.179, "splay_distance": 3.630, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 167.824, "theta": -146.077, "eta_prime": 179.582, "theta_prime": -148.481, "eta_base": -148.711, "theta_base": -124.803, "v0": -5.188, "v1": -22.050, "v2": 39.481, "v3": -43.258, "v4": 30.567, "amplitude": 43.604, "phase_angle": 25.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.735, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 18.756, -10.499, 13.526 ], "x_axis": [ 0.084, -0.229, -0.970 ], "y_axis": [ 0.590, 0.796, -0.137 ], "z_axis": [ 0.803, -0.561, 0.202 ], "quaternion": [ 0.721, 0.147, 0.614, -0.284 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.267, "beta": 177.479, "gamma": 49.504, "delta": 83.463, "epsilon": -155.928, "zeta": -65.840, "epsilon_zeta": -90.087, "bb_type": "BI", "chi": -164.962, "glyco_bond": "anti", "C5prime_xyz": [ -1.649, 8.804, 0.680 ], "P_xyz": [ 0.835, 9.508, 1.163 ], "form": "A", "ssZp": 4.409, "Dp": 4.562, "splay_angle": 21.611, "splay_distance": 3.768, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 168.965, "theta": -142.253, "eta_prime": -177.714, "theta_prime": -140.838, "eta_base": -137.389, "theta_base": -116.704, "v0": -4.229, "v1": -22.507, "v2": 39.358, "v3": -42.675, "v4": 29.505, "amplitude": 43.079, "phase_angle": 23.988, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.800, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 20.356, -13.758, 13.523 ], "x_axis": [ 0.293, 0.263, -0.919 ], "y_axis": [ 0.485, 0.787, 0.380 ], "z_axis": [ 0.824, -0.558, 0.103 ], "quaternion": [ 0.739, 0.317, 0.590, -0.075 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///A/22", "linked_nts": [ "///A/21", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -58.345, "beta": 173.962, "gamma": 50.281, "delta": 72.742, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.129, "glyco_bond": "anti", "C5prime_xyz": [ -2.009, 9.006, 0.116 ], "P_xyz": [ 0.373, 10.095, 0.205 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.623, "v1": -15.236, "v2": 36.760, "v3": -45.507, "v4": 37.058, "amplitude": 45.201, "phase_angle": 35.585, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 22.204, -16.551, 11.796 ], "x_axis": [ 0.514, 0.598, -0.614 ], "y_axis": [ 0.383, 0.481, 0.789 ], "z_axis": [ 0.768, -0.641, 0.018 ], "quaternion": [ 0.709, 0.504, 0.487, 0.076 ] } }, { "index": 22, "index_chain": 1, "chain_name": "B", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///B/24", "linked_nts": [ null, "///B/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -168.284, "gamma": 58.464, "delta": 85.985, "epsilon": -146.663, "zeta": -79.493, "epsilon_zeta": -67.171, "bb_type": "BI", "chi": -173.678, "glyco_bond": "anti", "C5prime_xyz": [ -1.140, 8.431, 1.356 ], "P_xyz": [ 1.484, 8.451, 1.839 ], "form": "A", "ssZp": 4.767, "Dp": 4.719, "splay_angle": 26.323, "splay_distance": 4.118, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": null, "theta": -143.697, "eta_prime": null, "theta_prime": -140.481, "eta_base": null, "theta_base": -121.656, "v0": 4.798, "v1": -29.443, "v2": 41.851, "v3": -40.001, "v4": 22.123, "amplitude": 42.820, "phase_angle": 12.215, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 22.369, -16.824, 12.213 ], "x_axis": [ 0.472, 0.686, -0.554 ], "y_axis": [ -0.281, -0.479, -0.832 ], "z_axis": [ -0.836, 0.548, -0.034 ], "quaternion": [ -0.490, 0.704, 0.144, -0.493 ] } }, { "index": 23, "index_chain": 2, "chain_name": "B", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.001, "beta": 168.807, "gamma": 48.352, "delta": 84.007, "epsilon": -154.492, "zeta": -76.850, "epsilon_zeta": -77.642, "bb_type": "BI", "chi": -171.287, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.669, 1.153 ], "P_xyz": [ 1.045, 9.100, 1.529 ], "form": "A", "ssZp": 4.647, "Dp": 4.613, "splay_angle": 22.755, "splay_distance": 3.511, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 173.969, "theta": -150.573, "eta_prime": -172.565, "theta_prime": -150.028, "eta_base": -138.626, "theta_base": -123.250, "v0": -2.848, "v1": -24.134, "v2": 40.547, "v3": -43.103, "v4": 28.891, "amplitude": 43.766, "phase_angle": 22.114, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.779, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 20.508, -13.397, 13.534 ], "x_axis": [ 0.322, 0.339, -0.884 ], "y_axis": [ -0.466, -0.756, -0.460 ], "z_axis": [ -0.824, 0.560, -0.086 ], "quaternion": [ -0.346, 0.736, -0.043, -0.581 ] } }, { "index": 24, "index_chain": 3, "chain_name": "B", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -73.188, "beta": 175.228, "gamma": 53.610, "delta": 84.527, "epsilon": -150.534, "zeta": -86.504, "epsilon_zeta": -64.030, "bb_type": "BI", "chi": -170.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.215, 8.584, 1.175 ], "P_xyz": [ 1.374, 8.864, 1.319 ], "form": ".", "ssZp": 4.768, "Dp": 4.719, "splay_angle": 27.275, "splay_distance": 4.740, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 165.247, "theta": -138.987, "eta_prime": 175.250, "theta_prime": -148.568, "eta_base": -143.394, "theta_base": -145.823, "v0": 2.195, "v1": -28.500, "v2": 42.640, "v3": -42.175, "v4": 25.255, "amplitude": 44.279, "phase_angle": 15.638, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 18.982, -10.235, 13.454 ], "x_axis": [ 0.062, -0.185, -0.981 ], "y_axis": [ -0.602, -0.790, 0.111 ], "z_axis": [ -0.796, 0.584, -0.161 ], "quaternion": [ -0.167, 0.709, -0.278, -0.626 ] } }, { "index": 25, "index_chain": 4, "chain_name": "B", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": 53.557, "beta": -160.217, "gamma": -72.972, "delta": 97.152, "epsilon": -158.005, "zeta": -60.357, "epsilon_zeta": -97.648, "bb_type": "BI", "chi": -161.886, "glyco_bond": "anti", "C5prime_xyz": [ -0.506, 8.064, 0.698 ], "P_xyz": [ 0.903, 10.096, 1.477 ], "form": ".", "ssZp": 4.544, "Dp": 4.644, "splay_angle": 29.382, "splay_distance": 4.680, "splay_ratio": 0.258, "d22": 3.595, "d64": 4.205, "eta": -175.443, "theta": -142.438, "eta_prime": -172.214, "theta_prime": -135.796, "eta_base": -154.412, "theta_base": -88.055, "v0": 21.090, "v1": -37.618, "v2": 39.235, "v3": -27.980, "v4": 4.400, "amplitude": 40.157, "phase_angle": 347.700, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 18.414, -5.560, 12.926 ], "x_axis": [ -0.128, -0.413, -0.902 ], "y_axis": [ -0.595, -0.696, 0.402 ], "z_axis": [ -0.794, 0.588, -0.157 ], "quaternion": [ -0.070, 0.657, -0.383, -0.646 ] } }, { "index": 26, "index_chain": 5, "chain_name": "B", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": 154.388, "beta": -161.313, "gamma": 167.685, "delta": 90.125, "epsilon": -131.220, "zeta": -77.536, "epsilon_zeta": -53.684, "bb_type": "BI", "chi": 177.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.008, 7.988, 1.969 ], "P_xyz": [ 1.078, 9.371, 1.200 ], "form": "A", "ssZp": 4.770, "Dp": 4.733, "splay_angle": 25.193, "splay_distance": 3.927, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 161.926, "theta": -153.932, "eta_prime": -170.044, "theta_prime": -150.756, "eta_base": -105.827, "theta_base": -129.421, "v0": 11.633, "v1": -30.281, "v2": 36.784, "v3": -31.123, "v4": 12.291, "amplitude": 36.787, "phase_angle": 0.760, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.276, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 15.661, -4.824, 9.214 ], "x_axis": [ -0.446, -0.840, -0.308 ], "y_axis": [ -0.336, -0.162, 0.928 ], "z_axis": [ -0.830, 0.517, -0.210 ], "quaternion": [ -0.213, -0.481, 0.611, 0.591 ] } }, { "index": 27, "index_chain": 6, "chain_name": "B", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -64.392, "beta": 174.057, "gamma": 47.202, "delta": 82.027, "epsilon": -138.669, "zeta": -78.408, "epsilon_zeta": -60.262, "bb_type": "BI", "chi": -165.826, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.650, 0.807 ], "P_xyz": [ 1.166, 9.061, 1.140 ], "form": "A", "ssZp": 4.525, "Dp": 4.730, "splay_angle": 30.381, "splay_distance": 4.707, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": 166.110, "theta": -141.340, "eta_prime": 179.618, "theta_prime": -135.897, "eta_base": -147.703, "theta_base": -101.390, "v0": -0.242, "v1": -27.336, "v2": 43.079, "v3": -44.322, "v4": 28.074, "amplitude": 45.525, "phase_angle": 18.864, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.674, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 13.324, -3.146, 6.541 ], "x_axis": [ -0.499, -0.828, 0.256 ], "y_axis": [ -0.075, 0.336, 0.939 ], "z_axis": [ -0.863, 0.450, -0.229 ], "quaternion": [ -0.390, -0.314, 0.718, 0.483 ] } }, { "index": 28, "index_chain": 7, "chain_name": "B", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -51.002, "beta": 175.744, "gamma": 38.004, "delta": 84.164, "epsilon": -157.548, "zeta": -67.809, "epsilon_zeta": -89.739, "bb_type": "BI", "chi": -163.593, "glyco_bond": "anti", "C5prime_xyz": [ -1.188, 8.655, 0.803 ], "P_xyz": [ 1.323, 8.888, 1.502 ], "form": "A", "ssZp": 4.503, "Dp": 4.602, "splay_angle": 21.742, "splay_distance": 3.445, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 170.452, "theta": -146.032, "eta_prime": -176.321, "theta_prime": -143.489, "eta_base": -130.138, "theta_base": -120.792, "v0": 3.649, "v1": -27.901, "v2": 40.321, "v3": -39.279, "v4": 22.494, "amplitude": 41.500, "phase_angle": 13.688, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.517, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 8.700, -3.485, 5.728 ], "x_axis": [ -0.058, -0.521, 0.851 ], "y_axis": [ 0.329, 0.795, 0.509 ], "z_axis": [ -0.942, 0.310, 0.125 ], "quaternion": [ 0.682, 0.073, -0.657, -0.312 ] } }, { "index": 29, "index_chain": 8, "chain_name": "B", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.251, "beta": -178.077, "gamma": 44.592, "delta": 84.353, "epsilon": -157.143, "zeta": -69.757, "epsilon_zeta": -87.387, "bb_type": "BI", "chi": -158.881, "glyco_bond": "anti", "C5prime_xyz": [ -1.279, 8.710, 0.426 ], "P_xyz": [ 1.261, 9.167, 0.794 ], "form": "A", "ssZp": 4.446, "Dp": 4.625, "splay_angle": 23.443, "splay_distance": 3.699, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 168.497, "theta": -146.885, "eta_prime": -179.613, "theta_prime": -144.512, "eta_base": -144.484, "theta_base": -113.183, "v0": 0.714, "v1": -26.807, "v2": 41.108, "v3": -41.695, "v4": 26.016, "amplitude": 43.132, "phase_angle": 17.623, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.802, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 5.302, -4.040, 5.834 ], "x_axis": [ 0.214, -0.072, 0.974 ], "y_axis": [ 0.230, 0.973, 0.021 ], "z_axis": [ -0.949, 0.220, 0.225 ], "quaternion": [ 0.777, -0.064, -0.619, -0.097 ] } }, { "index": 30, "index_chain": 9, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.583, "beta": 169.206, "gamma": 49.289, "delta": 85.346, "epsilon": -156.489, "zeta": -73.552, "epsilon_zeta": -82.937, "bb_type": "BI", "chi": -164.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.734, 0.779 ], "P_xyz": [ 1.283, 9.102, 0.949 ], "form": "A", "ssZp": 4.541, "Dp": 4.583, "splay_angle": 20.551, "splay_distance": 3.278, "splay_ratio": 0.181, "d22": 4.449, "d64": 4.304, "eta": 169.350, "theta": -148.957, "eta_prime": -174.499, "theta_prime": -149.303, "eta_base": -127.705, "theta_base": -131.267, "v0": -0.566, "v1": -24.519, "v2": 38.882, "v3": -40.293, "v4": 25.766, "amplitude": 41.219, "phase_angle": 19.385, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.876, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 2.269, -4.397, 7.922 ], "x_axis": [ 0.403, 0.468, 0.787 ], "y_axis": [ 0.031, 0.852, -0.523 ], "z_axis": [ -0.915, 0.235, 0.329 ], "quaternion": [ 0.804, -0.236, -0.529, 0.136 ] } }, { "index": 31, "index_chain": 10, "chain_name": "B", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.380, "beta": 178.124, "gamma": 54.059, "delta": 84.448, "epsilon": -150.767, "zeta": -70.998, "epsilon_zeta": -79.769, "bb_type": "BI", "chi": -159.943, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.790, 0.436 ], "P_xyz": [ 1.264, 9.234, 0.560 ], "form": "A", "ssZp": 4.370, "Dp": 4.646, "splay_angle": 25.095, "splay_distance": 4.049, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 165.729, "theta": -143.036, "eta_prime": 176.202, "theta_prime": -142.806, "eta_base": -152.431, "theta_base": -117.861, "v0": -0.805, "v1": -25.238, "v2": 40.389, "v3": -41.780, "v4": 26.835, "amplitude": 42.864, "phase_angle": 19.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.848, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -0.240, -5.000, 9.943 ], "x_axis": [ 0.489, 0.789, 0.373 ], "y_axis": [ -0.298, 0.552, -0.779 ], "z_axis": [ -0.820, 0.269, 0.505 ], "quaternion": [ 0.798, -0.328, -0.374, 0.341 ] } }, { "index": 32, "index_chain": 11, "chain_name": "B", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.066, "beta": 176.986, "gamma": 44.133, "delta": 82.928, "epsilon": -159.487, "zeta": -66.953, "epsilon_zeta": -92.534, "bb_type": "BI", "chi": -164.095, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.779, 0.783 ], "P_xyz": [ 1.084, 9.400, 1.031 ], "form": "A", "ssZp": 4.606, "Dp": 4.612, "splay_angle": 24.126, "splay_distance": 3.895, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 160.190, "theta": -147.625, "eta_prime": 173.856, "theta_prime": -145.232, "eta_base": -143.768, "theta_base": -117.378, "v0": -0.475, "v1": -28.459, "v2": 45.157, "v3": -46.080, "v4": 29.304, "amplitude": 47.711, "phase_angle": 18.833, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.823, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -2.160, -3.683, 13.257 ], "x_axis": [ 0.433, 0.875, -0.215 ], "y_axis": [ -0.514, 0.044, -0.856 ], "z_axis": [ -0.740, 0.482, 0.469 ], "quaternion": [ 0.697, -0.480, -0.188, 0.498 ] } }, { "index": 33, "index_chain": 12, "chain_name": "B", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.866, "beta": 168.276, "gamma": 68.930, "delta": 82.715, "epsilon": -162.677, "zeta": -73.542, "epsilon_zeta": -89.136, "bb_type": "BI", "chi": -170.327, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.745, 0.969 ], "P_xyz": [ 0.958, 9.436, 0.682 ], "form": "A", "ssZp": 4.526, "Dp": 4.585, "splay_angle": 24.934, "splay_distance": 3.957, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 172.600, "theta": -155.298, "eta_prime": -168.887, "theta_prime": -156.669, "eta_base": -123.342, "theta_base": -141.951, "v0": -3.699, "v1": -25.111, "v2": 42.885, "v3": -45.779, "v4": 31.196, "amplitude": 46.530, "phase_angle": 22.830, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.568, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -2.739, -0.843, 15.858 ], "x_axis": [ 0.068, 0.793, -0.605 ], "y_axis": [ -0.730, -0.374, -0.572 ], "z_axis": [ -0.680, 0.481, 0.554 ], "quaternion": [ 0.558, -0.471, -0.033, 0.682 ] } }, { "index": 34, "index_chain": 13, "chain_name": "B", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.720, "beta": -174.253, "gamma": 51.873, "delta": 83.304, "epsilon": -154.917, "zeta": -69.507, "epsilon_zeta": -85.411, "bb_type": "BI", "chi": -159.589, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.754, 0.403 ], "P_xyz": [ 1.097, 9.295, 0.689 ], "form": "A", "ssZp": 4.359, "Dp": 4.630, "splay_angle": 21.608, "splay_distance": 3.481, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 172.759, "theta": -146.348, "eta_prime": -179.517, "theta_prime": -144.241, "eta_base": -153.476, "theta_base": -115.644, "v0": 0.854, "v1": -29.272, "v2": 45.103, "v3": -45.275, "v4": 27.918, "amplitude": 47.224, "phase_angle": 17.237, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.820, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ -3.188, 1.578, 18.956 ], "x_axis": [ -0.248, 0.530, -0.811 ], "y_axis": [ -0.732, -0.651, -0.202 ], "z_axis": [ -0.635, 0.543, 0.550 ], "quaternion": [ 0.403, -0.462, 0.109, 0.782 ] } }, { "index": 35, "index_chain": 14, "chain_name": "B", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -69.127, "beta": 178.581, "gamma": 52.248, "delta": 86.227, "epsilon": -126.248, "zeta": -139.778, "epsilon_zeta": 13.530, "bb_type": "--", "chi": -157.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.487, 8.798, 0.415 ], "P_xyz": [ 1.076, 9.374, 0.486 ], "form": ".", "ssZp": 4.231, "Dp": 4.677, "splay_angle": 96.691, "splay_distance": 15.304, "splay_ratio": 0.750, "d22": null, "d64": null, "eta": 175.114, "theta": -159.458, "eta_prime": -174.661, "theta_prime": -177.822, "eta_base": -136.663, "theta_base": 160.524, "v0": -0.991, "v1": -24.180, "v2": 38.787, "v3": -40.351, "v4": 25.980, "amplitude": 41.242, "phase_angle": 19.870, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.895, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -4.372, 4.783, 19.621 ], "x_axis": [ -0.499, -0.009, -0.866 ], "y_axis": [ -0.563, -0.757, 0.332 ], "z_axis": [ -0.659, 0.653, 0.373 ], "quaternion": [ 0.171, -0.470, 0.304, 0.811 ] } }, { "index": 36, "index_chain": 15, "chain_name": "B", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": 72.281, "beta": 147.193, "gamma": -164.691, "delta": 87.516, "epsilon": -134.627, "zeta": -96.892, "epsilon_zeta": -37.735, "bb_type": "--", "chi": -147.852, "glyco_bond": "anti", "C5prime_xyz": [ -1.522, 8.709, -0.379 ], "P_xyz": [ -1.604, 10.847, -1.891 ], "form": ".", "ssZp": 3.546, "Dp": 4.531, "splay_angle": 17.188, "splay_distance": 2.998, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 86.917, "theta": 156.669, "eta_prime": 76.267, "theta_prime": 177.115, "eta_base": 55.640, "theta_base": -142.232, "v0": -2.140, "v1": -22.094, "v2": 35.924, "v3": -38.644, "v4": 25.913, "amplitude": 38.737, "phase_angle": 21.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.012, "origin": [ -6.617, 7.481, 34.517 ], "x_axis": [ 0.960, -0.275, -0.050 ], "y_axis": [ -0.171, -0.436, -0.884 ], "z_axis": [ 0.221, 0.857, -0.466 ], "quaternion": [ 0.514, -0.846, 0.132, -0.051 ] } }, { "index": 37, "index_chain": 16, "chain_name": "B", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -51.660, "beta": 154.619, "gamma": 50.825, "delta": 93.820, "epsilon": -111.406, "zeta": -66.271, "epsilon_zeta": -45.135, "bb_type": "--", "chi": -113.025, "glyco_bond": "anti", "C5prime_xyz": [ -1.856, 8.139, -1.994 ], "P_xyz": [ 0.590, 7.947, -2.903 ], "form": ".", "ssZp": 1.292, "Dp": 4.361, "splay_angle": 110.781, "splay_distance": 15.445, "splay_ratio": 0.826, "d22": null, "d64": null, "eta": -174.566, "theta": -94.430, "eta_prime": -164.348, "theta_prime": -89.770, "eta_base": -131.937, "theta_base": -63.432, "v0": 1.787, "v1": -20.806, "v2": 30.360, "v3": -30.536, "v4": 18.355, "amplitude": 31.540, "phase_angle": 15.719, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.291, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ -5.621, 9.349, 32.394 ], "x_axis": [ 0.761, -0.463, -0.454 ], "y_axis": [ -0.448, 0.131, -0.884 ], "z_axis": [ 0.469, 0.876, -0.108 ], "quaternion": [ 0.668, -0.659, 0.346, -0.006 ] } }, { "index": 38, "index_chain": 17, "chain_name": "B", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": -55.325, "beta": -163.484, "gamma": 67.621, "delta": 91.425, "epsilon": -154.601, "zeta": -57.775, "epsilon_zeta": -96.826, "bb_type": "BI", "chi": 173.942, "glyco_bond": "--", "C5prime_xyz": [ -1.161, 8.002, 2.019 ], "P_xyz": [ 1.384, 7.641, 2.569 ], "form": "A", "ssZp": 4.697, "Dp": 4.689, "splay_angle": 28.722, "splay_distance": 4.397, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": -161.055, "theta": -124.972, "eta_prime": -134.264, "theta_prime": -123.557, "eta_base": -115.508, "theta_base": -101.080, "v0": 8.697, "v1": -29.955, "v2": 38.602, "v3": -34.500, "v4": 16.383, "amplitude": 38.806, "phase_angle": 5.877, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.120, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -7.659, 11.171, 17.193 ], "x_axis": [ -0.614, -0.787, 0.067 ], "y_axis": [ -0.106, 0.166, 0.980 ], "z_axis": [ -0.782, 0.595, -0.186 ], "quaternion": [ -0.303, -0.319, 0.701, 0.562 ] } }, { "index": 39, "index_chain": 18, "chain_name": "B", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -77.378, "beta": -159.892, "gamma": 52.422, "delta": 88.717, "epsilon": -149.670, "zeta": -83.070, "epsilon_zeta": -66.600, "bb_type": "BI", "chi": -158.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.659, 0.431 ], "P_xyz": [ 1.107, 9.003, 1.201 ], "form": "A", "ssZp": 4.325, "Dp": 4.585, "splay_angle": 22.591, "splay_distance": 3.596, "splay_ratio": 0.196, "d22": 4.476, "d64": 4.378, "eta": 178.387, "theta": -149.121, "eta_prime": -165.997, "theta_prime": -146.727, "eta_base": -126.169, "theta_base": -123.715, "v0": -0.479, "v1": -22.829, "v2": 35.888, "v3": -37.424, "v4": 23.917, "amplitude": 38.059, "phase_angle": 19.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.454, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ -11.152, 11.732, 14.582 ], "x_axis": [ -0.587, -0.442, 0.678 ], "y_axis": [ 0.332, 0.632, 0.700 ], "z_axis": [ -0.738, 0.636, -0.224 ], "quaternion": [ -0.453, -0.035, 0.781, 0.428 ] } }, { "index": 40, "index_chain": 19, "chain_name": "B", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -56.673, "beta": 164.411, "gamma": 45.770, "delta": 86.310, "epsilon": -160.763, "zeta": -69.612, "epsilon_zeta": -91.151, "bb_type": "BI", "chi": -158.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.762, 0.316 ], "P_xyz": [ 1.243, 9.159, 0.279 ], "form": "A", "ssZp": 4.319, "Dp": 4.562, "splay_angle": 23.229, "splay_distance": 3.816, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 165.130, "theta": -146.466, "eta_prime": 179.148, "theta_prime": -148.255, "eta_base": -144.286, "theta_base": -134.413, "v0": 0.310, "v1": -25.670, "v2": 39.701, "v3": -40.610, "v4": 25.391, "amplitude": 41.776, "phase_angle": 18.136, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.065, "frame": { "rmsd": 0.010, "origin": [ -14.247, 13.005, 13.266 ], "x_axis": [ -0.291, -0.129, 0.948 ], "y_axis": [ 0.511, 0.817, 0.268 ], "z_axis": [ -0.809, 0.562, -0.171 ], "quaternion": [ 0.582, -0.126, -0.755, -0.275 ] } }, { "index": 41, "index_chain": 20, "chain_name": "B", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.671, "beta": -178.494, "gamma": 52.465, "delta": 84.234, "epsilon": -164.966, "zeta": -75.630, "epsilon_zeta": -89.337, "bb_type": "BI", "chi": -159.925, "glyco_bond": "anti", "C5prime_xyz": [ -1.667, 8.859, 0.499 ], "P_xyz": [ 0.837, 9.621, 0.582 ], "form": "A", "ssZp": 4.556, "Dp": 4.546, "splay_angle": 22.498, "splay_distance": 3.588, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 166.504, "theta": -155.481, "eta_prime": 179.059, "theta_prime": -154.614, "eta_base": -151.793, "theta_base": -126.936, "v0": -5.076, "v1": -22.295, "v2": 39.519, "v3": -43.159, "v4": 30.612, "amplitude": 43.582, "phase_angle": 24.937, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.820, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -17.991, 13.266, 12.574 ], "x_axis": [ 0.045, 0.162, 0.986 ], "y_axis": [ 0.539, 0.827, -0.160 ], "z_axis": [ -0.841, 0.538, -0.050 ], "quaternion": [ 0.675, -0.259, -0.677, -0.140 ] } }, { "index": 42, "index_chain": 21, "chain_name": "B", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///B/44", "linked_nts": [ "///B/43", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -55.056, "beta": 164.862, "gamma": 54.967, "delta": 78.479, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -163.911, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.834, 0.629 ], "P_xyz": [ 1.110, 9.276, 0.686 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.584, "v1": -22.334, "v2": 38.404, "v3": -41.330, "v4": 28.176, "amplitude": 41.795, "phase_angle": 23.240, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.754, "filter_rmsd": 0.066, "frame": { "rmsd": 0.010, "origin": [ -21.370, 13.901, 13.598 ], "x_axis": [ 0.291, 0.571, 0.767 ], "y_axis": [ 0.376, 0.670, -0.641 ], "z_axis": [ -0.880, 0.475, -0.020 ], "quaternion": [ 0.697, -0.400, -0.591, 0.070 ] } } ], "num_hbonds": 83, "hbonds": [ { "index": 1, "atom1_serNum": 18, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/2/O6", "atom2_id": "///B/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 19, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/2/N1", "atom2_id": "///B/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 21, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/2/N2", "atom2_id": "///B/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 38, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/3/O2", "atom2_id": "///B/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 39, "atom2_serNum": 942, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/3/N3", "atom2_id": "///B/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 41, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/3/N4", "atom2_id": "///B/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 46, "atom2_serNum": 1029, "donAcc_type": "unknown", "distance": 2.918, "atom1_id": "///A/4/OP2", "atom2_id": "///A/46/N33", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 8, "atom1_serNum": 58, "atom2_serNum": 1029, "donAcc_type": "unknown", "distance": 2.782, "atom1_id": "///A/4/N7", "atom2_id": "///A/46/N33", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 9, "atom1_serNum": 61, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/4/O6", "atom2_id": "///B/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 1027, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///A/4/O6", "atom2_id": "///A/46/O23", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 11, "atom1_serNum": 62, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/4/N1", "atom2_id": "///B/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 64, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.510, "atom1_id": "///A/4/N2", "atom2_id": "///B/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 69, "atom2_serNum": 1032, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///A/5/OP2", "atom2_id": "///A/46/O43", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 14, "atom1_serNum": 82, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///A/5/N3", "atom2_id": "///B/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 84, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/5/O4", "atom2_id": "///B/41/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 101, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/6/O2", "atom2_id": "///B/40/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 102, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/6/N3", "atom2_id": "///B/40/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 104, "atom2_serNum": 878, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/6/N4", "atom2_id": "///B/40/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 104, "atom2_serNum": 1035, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/6/N4", "atom2_id": "///A/46/O53", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 20, "atom1_serNum": 124, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/7/N6", "atom2_id": "///A/46/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 21, "atom1_serNum": 125, "atom2_serNum": 1013, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///A/7/N1", "atom2_id": "///A/46/O61", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 22, "atom1_serNum": 143, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/8/O2", "atom2_id": "///B/37/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 144, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/8/N3", "atom2_id": "///B/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 146, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/8/N4", "atom2_id": "///B/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 166, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/9/N6", "atom2_id": "///B/36/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 167, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/9/N1", "atom2_id": "///B/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 185, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/10/O2", "atom2_id": "///B/35/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 186, "atom2_serNum": 769, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/10/N3", "atom2_id": "///B/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 188, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/10/N4", "atom2_id": "///B/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 205, "atom2_serNum": 748, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///A/11/O2", "atom2_id": "///B/34/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 206, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/11/N3", "atom2_id": "///B/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 208, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/11/N4", "atom2_id": "///B/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 228, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/12/O6", "atom2_id": "///B/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 229, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/12/N1", "atom2_id": "///B/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 231, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/12/N2", "atom2_id": "///B/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 244, "atom2_serNum": 263, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///A/13/O2'", "atom2_id": "///A/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 251, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/13/O6", "atom2_id": "///B/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 252, "atom2_serNum": 703, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/13/N1", "atom2_id": "///B/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 254, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/13/N2", "atom2_id": "///B/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 272, "atom2_serNum": 684, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/14/N3", "atom2_id": "///B/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 274, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/14/O4", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 294, "atom2_serNum": 663, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/15/O6", "atom2_id": "///B/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 295, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/15/N1", "atom2_id": "///B/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 297, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/15/N2", "atom2_id": "///B/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 304, "atom2_serNum": 973, "donAcc_type": "acceptable", "distance": 2.429, "atom1_id": "///A/16/OP2", "atom2_id": "///A/45/O31", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 46, "atom1_serNum": 320, "atom2_serNum": 356, "donAcc_type": "acceptable", "distance": 3.479, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 346, "atom2_serNum": 985, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/17/OP1", "atom2_id": "///A/45/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 48, "atom1_serNum": 364, "atom2_serNum": 390, "donAcc_type": "acceptable", "distance": 3.019, "atom1_id": "///A/17/O2'", "atom2_id": "///A/18/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 416, "atom2_serNum": 985, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/18/N7", "atom2_id": "///A/45/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 50, "atom1_serNum": 422, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/18/O6", "atom2_id": "///B/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 422, "atom2_serNum": 988, "donAcc_type": "acceptable", "distance": 3.686, "atom1_id": "///A/18/O6", "atom2_id": "///A/45/O52", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 52, "atom1_serNum": 424, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/18/N1", "atom2_id": "///B/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 428, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/18/N2", "atom2_id": "///B/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 444, "atom2_serNum": 460, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///A/19/O2'", "atom2_id": "///A/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 448, "atom2_serNum": 599, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///A/19/O2", "atom2_id": "///B/27/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 449, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/19/N3", "atom2_id": "///B/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 451, "atom2_serNum": 982, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///A/19/O4", "atom2_id": "///A/45/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 58, "atom1_serNum": 468, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///A/20/O2", "atom2_id": "///B/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 469, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/20/N3", "atom2_id": "///B/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 471, "atom2_serNum": 578, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/20/N4", "atom2_id": "///B/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 491, "atom2_serNum": 558, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///A/21/O6", "atom2_id": "///B/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 492, "atom2_serNum": 556, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/21/N1", "atom2_id": "///B/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 494, "atom2_serNum": 555, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/21/N2", "atom2_id": "///B/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 511, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/22/O2", "atom2_id": "///B/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 512, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/22/N3", "atom2_id": "///B/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 514, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/22/N4", "atom2_id": "///B/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 563, "atom2_serNum": 995, "donAcc_type": "unknown", "distance": 2.904, "atom1_id": "///B/26/OP2", "atom2_id": "///A/45/N33", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 68, "atom1_serNum": 575, "atom2_serNum": 995, "donAcc_type": "unknown", "distance": 2.878, "atom1_id": "///B/26/N7", "atom2_id": "///A/45/N33", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 69, "atom1_serNum": 578, "atom2_serNum": 993, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///B/26/O6", "atom2_id": "///A/45/O23", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 70, "atom1_serNum": 586, "atom2_serNum": 998, "donAcc_type": "acceptable", "distance": 2.839, "atom1_id": "///B/27/OP2", "atom2_id": "///A/45/O43", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 71, "atom1_serNum": 621, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/28/N4", "atom2_id": "///A/45/O53", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 72, "atom1_serNum": 641, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/29/N6", "atom2_id": "///A/45/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 73, "atom1_serNum": 642, "atom2_serNum": 979, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///B/29/N1", "atom2_id": "///A/45/O61", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 74, "atom1_serNum": 819, "atom2_serNum": 1007, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///B/38/OP2", "atom2_id": "///A/46/O31", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 75, "atom1_serNum": 840, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/39/OP1", "atom2_id": "///A/46/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 76, "atom1_serNum": 841, "atom2_serNum": 1009, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///B/39/OP2", "atom2_id": "///A/46/O41", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 77, "atom1_serNum": 863, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/40/OP2", "atom2_id": "///A/46/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 78, "atom1_serNum": 875, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/40/N7", "atom2_id": "///A/46/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 79, "atom1_serNum": 878, "atom2_serNum": 1022, "donAcc_type": "acceptable", "distance": 3.728, "atom1_id": "///B/40/O6", "atom2_id": "///A/46/O52", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 80, "atom1_serNum": 894, "atom2_serNum": 910, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///B/41/O2'", "atom2_id": "///B/42/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 901, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///B/41/O4", "atom2_id": "///A/46/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 82, "atom1_serNum": 982, "atom2_serNum": 993, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///A/45/N12", "atom2_id": "///A/45/O23", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 83, "atom1_serNum": 1016, "atom2_serNum": 1027, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///A/46/N12", "atom2_id": "///A/46/O23", "atom_pair": "N:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1mwl", "num_naChains": 2, "naChains": "A=21,B=21", "num_atoms": 1005, "num_waters": 39, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }