{ "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 165.556, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.429, "chi2": -118.181, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.044, "C1C1_dist": 11.004, "N1N9_dist": 9.218, "C6C8_dist": 10.032, "CNNC_torsion": -3.909, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[3.10],N2(amino)-O2(carbonyl)[3.09]", "interBase_angle": 4.199, "planarity": 0.066, "simple_Shear": -0.068, "simple_Stretch": 0.043, "simple_Buckle": 4.014, "simple_Propeller": -1.232, "bp_simpleParams": [ -0.068, 0.043, 0.336, 4.014, -1.232, -3.326 ], "bp_params": [ -0.068, 0.043, 0.336, 4.019, -1.217, -3.324 ], "frame": { "rmsd": null, "origin": [ 49.544, 8.915, -19.859 ], "x_axis": [ 0.594, 0.542, 0.594 ], "y_axis": [ -0.729, 0.051, 0.682 ], "z_axis": [ 0.339, -0.839, 0.426 ], "quaternion": [ 0.720, 0.528, -0.089, 0.442 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.382, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.400, "chi2": -172.100, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.145, "C1C1_dist": 10.851, "N1N9_dist": 8.947, "C6C8_dist": 9.622, "CNNC_torsion": -3.416, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.43],N1(imino)-N3[2.78],N2(amino)-O2(carbonyl)[3.03]", "interBase_angle": 2.743, "planarity": 0.039, "simple_Shear": -0.096, "simple_Stretch": -0.338, "simple_Buckle": -0.045, "simple_Propeller": -2.742, "bp_simpleParams": [ -0.096, -0.338, 0.079, -0.045, -2.742, -9.479 ], "bp_params": [ -0.093, -0.338, 0.079, -0.026, -2.743, -9.481 ], "frame": { "rmsd": null, "origin": [ 51.252, 5.088, -19.426 ], "x_axis": [ -0.221, 0.703, 0.676 ], "y_axis": [ -0.951, -0.310, 0.013 ], "z_axis": [ 0.219, -0.640, 0.737 ], "quaternion": [ 0.549, 0.297, -0.208, 0.753 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.841, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.828, "chi2": -146.122, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.478, "C1C1_dist": 11.137, "N1N9_dist": 9.154, "C6C8_dist": 9.705, "CNNC_torsion": 8.222, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.43],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[3.37]", "interBase_angle": 13.686, "planarity": 0.174, "simple_Shear": 0.461, "simple_Stretch": -0.163, "simple_Buckle": -13.175, "simple_Propeller": -3.706, "bp_simpleParams": [ 0.461, -0.163, -0.803, -13.175, -3.706, -14.315 ], "bp_params": [ 0.452, -0.186, -0.803, -13.348, -3.025, -14.224 ], "frame": { "rmsd": null, "origin": [ 54.526, 4.532, -15.680 ], "x_axis": [ -0.634, 0.697, 0.336 ], "y_axis": [ -0.760, -0.642, -0.104 ], "z_axis": [ 0.143, -0.321, 0.936 ], "quaternion": [ 0.406, 0.134, -0.119, 0.896 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.252, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.505, "chi2": 179.050, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.201, "C1C1_dist": 11.203, "N1N9_dist": 9.328, "C6C8_dist": 10.014, "CNNC_torsion": 3.155, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[3.13]", "interBase_angle": 11.263, "planarity": 0.122, "simple_Shear": 0.847, "simple_Stretch": 0.187, "simple_Buckle": 8.786, "simple_Propeller": 7.047, "bp_simpleParams": [ 0.847, 0.187, 0.258, 8.786, 7.047, -10.417 ], "bp_params": [ 0.861, 0.110, 0.258, 9.392, 6.216, -10.397 ], "frame": { "rmsd": null, "origin": [ 55.012, 4.818, -12.622 ], "x_axis": [ -0.911, 0.013, 0.412 ], "y_axis": [ -0.190, -0.900, -0.392 ], "z_axis": [ 0.365, -0.436, 0.823 ], "quaternion": [ 0.053, 0.204, -0.217, 0.953 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -142.292, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.786, "chi2": -143.941, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.044, "C1C1_dist": 10.713, "N1N9_dist": 9.000, "C6C8_dist": 9.874, "CNNC_torsion": 3.459, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 5.656, "planarity": 0.153, "simple_Shear": 0.608, "simple_Stretch": -0.097, "simple_Buckle": 5.589, "simple_Propeller": -0.867, "bp_simpleParams": [ 0.608, -0.097, -0.399, 5.589, -0.867, -0.731 ], "bp_params": [ 0.600, -0.136, -0.399, 5.522, -1.224, -0.730 ], "frame": { "rmsd": null, "origin": [ 56.645, 5.054, -8.734 ], "x_axis": [ -0.953, -0.264, 0.150 ], "y_axis": [ 0.184, -0.895, -0.407 ], "z_axis": [ 0.242, -0.360, 0.901 ], "quaternion": [ -0.116, 0.101, -0.198, 0.968 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.869, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.728, "chi2": -176.817, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.105, "C1C1_dist": 10.685, "N1N9_dist": 8.751, "C6C8_dist": 9.385, "CNNC_torsion": -8.688, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.06],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.43]", "interBase_angle": 15.191, "planarity": 0.184, "simple_Shear": 0.667, "simple_Stretch": -0.496, "simple_Buckle": 10.987, "simple_Propeller": -10.490, "bp_simpleParams": [ 0.667, -0.496, 0.006, 10.987, -10.490, -10.807 ], "bp_params": [ 0.636, -0.535, 0.006, 10.335, -11.134, -10.815 ], "frame": { "rmsd": null, "origin": [ 57.297, 5.283, -5.350 ], "x_axis": [ -0.706, -0.656, -0.267 ], "y_axis": [ 0.697, -0.577, -0.426 ], "z_axis": [ 0.125, -0.488, 0.864 ], "quaternion": [ -0.381, -0.040, -0.258, 0.887 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/10", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -136.224, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 71.847, "chi2": -174.322, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.027, "C1C1_dist": 7.702, "N1N9_dist": 6.182, "C6C8_dist": 5.902, "CNNC_torsion": -12.526, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.67],O4(carbonyl)-N6(amino)[2.69]", "interBase_angle": 27.493, "planarity": 0.353, "simple_Shear": -2.264, "simple_Stretch": 0.927, "simple_Buckle": -20.112, "simple_Propeller": -18.745, "bp_simpleParams": [ -2.264, 0.927, 2.198, -20.112, -18.745, -68.592 ], "bp_params": [ -0.157, 2.442, 2.198, -25.648, 9.903, -67.453 ], "frame": { "rmsd": null, "origin": [ 56.880, 2.936, 1.808 ], "x_axis": [ -0.088, -0.640, -0.763 ], "y_axis": [ 0.991, 0.024, -0.134 ], "z_axis": [ 0.104, -0.768, 0.632 ], "quaternion": [ 0.626, 0.253, 0.346, -0.651 ] } }, { "index": 8, "nt1": "///A/9", "nt2": "///A/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.158, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.137, "chi2": -174.441, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.058, "C1C1_dist": 10.863, "N1N9_dist": 8.952, "C6C8_dist": 9.622, "CNNC_torsion": -7.506, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.50],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[3.04]", "interBase_angle": 2.692, "planarity": 0.070, "simple_Shear": -0.293, "simple_Stretch": -0.336, "simple_Buckle": -0.034, "simple_Propeller": -2.691, "bp_simpleParams": [ -0.293, -0.336, 0.268, -0.034, -2.691, -9.239 ], "bp_params": [ -0.284, -0.344, 0.268, 0.035, -2.691, -9.242 ], "frame": { "rmsd": null, "origin": [ 56.618, 6.101, -0.724 ], "x_axis": [ 0.141, -0.773, -0.618 ], "y_axis": [ 0.990, 0.106, 0.092 ], "z_axis": [ -0.006, -0.625, 0.781 ], "quaternion": [ 0.712, 0.252, 0.215, -0.619 ] } }, { "index": 9, "nt1": "///A/10", "nt2": "///A/27", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.322, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.290, "chi2": -154.178, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.774, "C1C1_dist": 10.146, "N1N9_dist": 8.563, "C6C8_dist": 9.557, "CNNC_torsion": 3.170, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.87],N1-N3(imino)[2.65]", "interBase_angle": 18.068, "planarity": 0.229, "simple_Shear": -0.051, "simple_Stretch": -0.253, "simple_Buckle": 17.690, "simple_Propeller": 3.675, "bp_simpleParams": [ -0.051, -0.253, -0.007, 17.690, 3.675, 3.594 ], "bp_params": [ -0.052, -0.253, -0.007, 17.705, 3.601, 3.553 ], "frame": { "rmsd": null, "origin": [ 55.674, 3.726, 1.240 ], "x_axis": [ 0.447, -0.692, -0.566 ], "y_axis": [ 0.894, 0.355, 0.272 ], "z_axis": [ 0.013, -0.628, 0.778 ], "quaternion": [ 0.803, 0.280, 0.180, -0.494 ] } }, { "index": 10, "nt1": "///A/11", "nt2": "///A/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.005, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.879, "chi2": -174.089, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.978, "C1C1_dist": 10.668, "N1N9_dist": 8.977, "C6C8_dist": 9.886, "CNNC_torsion": 0.871, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 1.030, "planarity": 0.016, "simple_Shear": -0.583, "simple_Stretch": -0.030, "simple_Buckle": -0.613, "simple_Propeller": -0.829, "bp_simpleParams": [ -0.583, -0.030, -0.025, -0.613, -0.829, -0.874 ], "bp_params": [ -0.580, -0.067, -0.025, -0.559, -0.866, -0.874 ], "frame": { "rmsd": null, "origin": [ 53.384, 0.265, 4.508 ], "x_axis": [ 0.865, -0.479, -0.151 ], "y_axis": [ 0.488, 0.731, 0.476 ], "z_axis": [ -0.118, -0.485, 0.866 ], "quaternion": [ 0.930, 0.258, 0.009, -0.260 ] } }, { "index": 11, "nt1": "///A/12", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 172.149, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.072, "chi2": -169.481, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.235, "C1C1_dist": 10.995, "N1N9_dist": 9.063, "C6C8_dist": 9.722, "CNNC_torsion": -0.787, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.12],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.48]", "interBase_angle": 1.235, "planarity": 0.035, "simple_Shear": -0.160, "simple_Stretch": -0.231, "simple_Buckle": 0.402, "simple_Propeller": -1.167, "bp_simpleParams": [ -0.160, -0.231, -0.148, 0.402, -1.167, -10.027 ], "bp_params": [ -0.156, -0.234, -0.148, 0.424, -1.160, -10.028 ], "frame": { "rmsd": null, "origin": [ 53.167, -2.860, 6.353 ], "x_axis": [ 0.993, -0.017, -0.120 ], "y_axis": [ 0.074, 0.867, 0.493 ], "z_axis": [ 0.096, -0.498, 0.862 ], "quaternion": [ 0.965, 0.257, 0.056, -0.024 ] } }, { "index": 12, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.216, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.705, "chi2": -153.792, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.710, "C1C1_dist": 10.042, "N1N9_dist": 8.326, "C6C8_dist": 9.172, "CNNC_torsion": -8.609, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[2.62],N4(amino)-O6(carbonyl)[2.46]", "interBase_angle": 23.443, "planarity": 0.435, "simple_Shear": 0.772, "simple_Stretch": -0.759, "simple_Buckle": -10.997, "simple_Propeller": -20.704, "bp_simpleParams": [ 0.772, -0.759, -0.741, -10.997, -20.704, 1.067 ], "bp_params": [ 0.706, -0.821, -0.741, -12.621, -19.756, 1.076 ], "frame": { "rmsd": null, "origin": [ 56.804, -4.126, 9.058 ], "x_axis": [ 0.452, 0.886, 0.105 ], "y_axis": [ -0.831, 0.375, 0.410 ], "z_axis": [ 0.324, -0.272, 0.906 ], "quaternion": [ 0.827, 0.206, 0.066, 0.519 ] } }, { "index": 13, "nt1": "///A/14", "nt2": "///A/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -140.026, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.387, "chi2": -125.289, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.171, "C1C1_dist": 10.799, "N1N9_dist": 9.079, "C6C8_dist": 9.953, "CNNC_torsion": 9.021, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 16.429, "planarity": 0.179, "simple_Shear": -0.077, "simple_Stretch": -0.006, "simple_Buckle": -10.029, "simple_Propeller": 13.013, "bp_simpleParams": [ -0.077, -0.006, 0.348, -10.029, 13.013, 0.095 ], "bp_params": [ -0.077, -0.007, 0.348, -10.232, 12.854, 0.095 ], "frame": { "rmsd": null, "origin": [ 58.769, -4.469, 11.581 ], "x_axis": [ -0.058, 0.977, -0.205 ], "y_axis": [ -0.939, 0.016, 0.343 ], "z_axis": [ 0.338, 0.212, 0.917 ], "quaternion": [ 0.685, 0.048, 0.198, 0.700 ] } }, { "index": 14, "nt1": "///A/15", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.581, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.315, "chi2": 179.780, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.336, "C1C1_dist": 10.071, "N1N9_dist": 8.246, "C6C8_dist": 8.804, "CNNC_torsion": 25.994, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.50],N1(imino)-N3[2.58],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 53.641, "planarity": 0.670, "simple_Shear": -0.126, "simple_Stretch": -0.378, "simple_Buckle": 43.972, "simple_Propeller": 30.723, "bp_simpleParams": [ -0.126, -0.378, -0.159, 43.972, 30.723, -13.916 ], "bp_params": [ -0.141, -0.373, -0.159, 45.560, 28.313, -13.307 ], "frame": { "rmsd": null, "origin": [ 60.493, -4.458, 13.249 ], "x_axis": [ -0.431, 0.897, 0.097 ], "y_axis": [ -0.847, -0.439, 0.301 ], "z_axis": [ 0.312, 0.047, 0.949 ], "quaternion": [ 0.519, 0.122, 0.104, 0.839 ] } }, { "index": 15, "nt1": "///A/16", "nt2": "///A/19", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -152.167, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 90.421, "chi2": -145.497, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.512, "C1C1_dist": 9.417, "N1N9_dist": 8.136, "C6C8_dist": 8.324, "CNNC_torsion": -137.389, "hbonds_num": 4, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.05],N1(imino)-OP2[3.28],N2(amino)-OP2[2.33],N2(amino)-N7[2.62]", "interBase_angle": 28.997, "planarity": 0.356, "simple_Shear": 7.862, "simple_Stretch": 2.744, "simple_Buckle": 26.882, "simple_Propeller": -10.872, "bp_simpleParams": [ 7.862, 2.744, 0.201, 26.882, -10.872, -17.753 ], "bp_params": [ 6.810, -4.793, 0.201, 6.972, -28.147, -18.262 ], "frame": { "rmsd": null, "origin": [ 64.563, -4.495, 18.433 ], "x_axis": [ -0.956, 0.219, 0.196 ], "y_axis": [ -0.195, -0.971, 0.136 ], "z_axis": [ 0.220, 0.091, 0.971 ], "quaternion": [ 0.105, 0.105, 0.057, 0.987 ] } }, { "index": 16, "nt1": "///A/23", "nt2": "///A/26", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -122.987, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.989, "chi2": -174.089, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.739, "C1C1_dist": 8.601, "N1N9_dist": 6.792, "C6C8_dist": 6.326, "CNNC_torsion": -17.996, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.76],O4(carbonyl)-N6(amino)[2.52]", "interBase_angle": 11.512, "planarity": 0.225, "simple_Shear": -3.079, "simple_Stretch": 0.958, "simple_Buckle": 0.058, "simple_Propeller": -11.512, "bp_simpleParams": [ -3.079, 0.958, 1.099, 0.058, -11.512, -77.585 ], "bp_params": [ -0.805, 3.122, 1.099, -9.760, -6.105, -77.462 ], "frame": { "rmsd": null, "origin": [ 53.546, -1.087, 3.319 ], "x_axis": [ 0.984, 0.116, 0.135 ], "y_axis": [ 0.160, -0.904, -0.396 ], "z_axis": [ 0.076, 0.412, -0.908 ], "quaternion": [ -0.207, 0.974, 0.071, 0.054 ] } } ], "num_multiplets": 2, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAU", "nts_long": "///A/7,///A/10,///A/27", "planarity": 0.315 }, { "index": 2, "num_nts": 3, "nts_short": "UUA", "nts_long": "///A/11,///A/23,///A/26", "planarity": 0.212 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GGGAGCGAUCCCGG", "strand2": "CCCUCGCUAGGGCA", "bp_type": "|||||||||||||.", "helix_form": "..A.Ax..Ax...", "helical_rise": 3.156, "helical_rise_std": 0.964, "helical_radius": 10.026, "helical_radius_std": 2.922, "helical_axis": [ 0.083, -0.550, 0.831 ], "point1": [ 54.036, 13.368, -17.839 ], "point2": [ 57.438, -9.321, 16.404 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, 0.043, 0.336, 4.019, -1.217, -3.324 ], "step_params": [ -1.822, -1.133, 3.626, -11.718, 19.101, 45.964 ], "heli_params": [ -2.817, 1.202, 3.291, 22.929, 14.067, 50.868 ], "bp2_params": [ -0.093, -0.338, 0.079, -0.026, -2.743, -9.481 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.626, "simple_Twist": 46.103, "simple_hRise": 3.293, "simple_hTwist": 50.992 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, -0.338, 0.079, -0.026, -2.743, -9.481 ], "step_params": [ 0.083, -2.917, 4.068, 5.749, 21.332, 22.743 ], "heli_params": [ -8.963, 0.821, 1.018, 43.175, -11.635, 31.605 ], "bp2_params": [ 0.452, -0.186, -0.803, -13.348, -3.025, -14.224 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.068, "simple_Twist": 19.850, "simple_hRise": 0.680, "simple_hTwist": 29.618 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.452, -0.186, -0.803, -13.348, -3.025, -14.224 ], "step_params": [ 0.942, -1.153, 2.730, -0.671, -15.787, 40.709 ], "heli_params": [ -0.183, -1.328, 2.946, -21.731, 0.923, 43.547 ], "bp2_params": [ 0.861, 0.110, 0.258, 9.392, 6.216, -10.397 ], "groove_widths": [ 16.390, null, 20.601, null ], "simple_Rise": 2.730, "simple_Twist": 38.471, "simple_hRise": 2.948, "simple_hTwist": 41.476 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.861, 0.110, 0.258, 9.392, 6.216, -10.397 ], "step_params": [ -0.501, -1.848, 3.765, 5.769, 7.485, 20.824 ], "heli_params": [ -7.436, 3.401, 2.712, 19.467, -15.005, 22.847 ], "bp2_params": [ 0.600, -0.136, -0.399, 5.522, -1.224, -0.730 ], "groove_widths": [ 16.180, 14.096, 22.235, 20.957 ], "simple_Rise": 3.765, "simple_Twist": 22.241, "simple_hRise": 2.788, "simple_hTwist": 24.142 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.600, -0.136, -0.399, 5.522, -1.224, -0.730 ], "step_params": [ -0.861, -1.436, 3.020, -3.484, 9.483, 35.114 ], "heli_params": [ -3.449, 0.951, 2.628, 15.329, 5.633, 36.495 ], "bp2_params": [ 0.636, -0.535, 0.006, 10.335, -11.134, -10.815 ], "groove_widths": [ 16.867, 13.602, 17.717, 16.963 ], "simple_Rise": 3.020, "simple_Twist": 34.884, "simple_hRise": 2.625, "simple_hTwist": 36.273 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.636, -0.535, 0.006, 10.335, -11.134, -10.815 ], "step_params": [ -2.811, -1.888, 3.327, 4.162, 11.143, 54.019 ], "heli_params": [ -2.651, 3.262, 2.712, 12.103, -4.520, 55.217 ], "bp2_params": [ -0.284, -0.344, 0.268, 0.035, -2.691, -9.242 ], "groove_widths": [ 16.834, 14.746, 15.780, 14.695 ], "simple_Rise": 3.327, "simple_Twist": 58.913, "simple_hRise": 2.775, "simple_hTwist": 59.996 }, { "index": 7, "nt1": "///A/9", "nt2": "///A/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.284, -0.344, 0.268, 0.035, -2.691, -9.242 ], "step_params": [ 0.310, -1.096, 3.015, -0.920, 0.526, 18.491 ], "heli_params": [ -3.668, -1.419, 2.964, 1.636, 2.859, 18.521 ], "bp2_params": [ -0.052, -0.253, -0.007, 17.705, 3.601, 3.553 ], "groove_widths": [ 15.892, 14.718, 16.101, 16.005 ], "simple_Rise": 3.015, "simple_Twist": 17.126, "simple_hRise": 2.960, "simple_hTwist": 17.159 }, { "index": 8, "nt1": "///A/10", "nt2": "///A/27", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.052, -0.253, -0.007, 17.705, 3.601, 3.553 ], "step_params": [ -0.663, -2.188, 4.762, -1.203, -12.146, 34.472 ], "heli_params": [ -0.848, 0.796, 5.232, -19.745, 1.955, 36.507 ], "bp2_params": [ -0.580, -0.067, -0.025, -0.559, -0.866, -0.874 ], "groove_widths": [ 15.256, 14.493, 24.909, 21.624 ], "simple_Rise": 4.762, "simple_Twist": 37.304, "simple_hRise": 5.216, "simple_hTwist": 39.183 }, { "index": 9, "nt1": "///A/11", "nt2": "///A/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.580, -0.067, -0.025, -0.559, -0.866, -0.874 ], "step_params": [ 0.349, -1.779, 3.151, -2.839, 11.968, 25.169 ], "heli_params": [ -6.067, -1.288, 2.057, 25.604, 6.073, 27.970 ], "bp2_params": [ -0.156, -0.234, -0.148, 0.424, -1.160, -10.028 ], "groove_widths": [ 15.586, 13.739, 14.953, 14.785 ], "simple_Rise": 3.151, "simple_Twist": 22.809, "simple_hRise": 1.933, "simple_hTwist": 25.875 }, { "index": 10, "nt1": "///A/12", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, -0.234, -0.148, 0.424, -1.160, -10.028 ], "step_params": [ 2.536, -1.450, 3.691, -5.048, 17.974, 62.931 ], "heli_params": [ -2.123, -2.567, 3.034, 16.828, 4.727, 65.368 ], "bp2_params": [ 0.706, -0.821, -0.741, -12.621, -19.756, 1.076 ], "groove_widths": [ 17.640, 14.599, 13.446, 11.233 ], "simple_Rise": 3.691, "simple_Twist": 57.474, "simple_hRise": 2.949, "simple_hTwist": 60.183 }, { "index": 11, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.706, -0.821, -0.741, -12.621, -19.756, 1.076 ], "step_params": [ -0.041, -1.015, 3.051, -5.231, 27.564, 21.982 ], "heli_params": [ -4.903, -0.547, 1.136, 51.731, 9.818, 35.506 ], "bp2_params": [ -0.077, -0.007, 0.348, -10.232, 12.854, 0.095 ], "groove_widths": [ 19.671, null, 17.692, null ], "simple_Rise": 3.051, "simple_Twist": 27.312, "simple_hRise": 1.461, "simple_hTwist": 38.963 }, { "index": 12, "nt1": "///A/14", "nt2": "///A/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.007, 0.348, -10.232, 12.854, 0.095 ], "step_params": [ -0.497, -0.994, 2.127, -4.058, -8.877, 26.754 ], "heli_params": [ -0.577, 0.350, 2.376, -18.423, 8.421, 28.448 ], "bp2_params": [ -0.141, -0.373, -0.159, 45.560, 28.313, -13.307 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.127, "simple_Twist": 23.862, "simple_hRise": 2.388, "simple_hTwist": 25.754 }, { "index": 13, "nt1": "///A/15", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.373, -0.159, 45.560, 28.313, -13.307 ], "step_params": [ -2.275, -1.214, 6.065, -1.398, 5.840, 50.840 ], "heli_params": [ -2.149, 2.456, 5.957, 6.775, 1.622, 51.170 ], "bp2_params": [ 6.810, -4.793, 0.201, 6.972, -28.147, -18.262 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 6.065, "simple_Twist": 7.918, "simple_hRise": 4.443, "simple_hTwist": 9.935 }, { "index": 14, "nt1": "///A/16", "nt2": "///A/19", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGGAGC", "strand2": "CCCUCG", "bp_type": "||||||", "helix_form": "..A.A", "helical_rise": 2.555, "helical_rise_std": 0.943, "helical_radius": 10.309, "helical_radius_std": 1.258, "helical_axis": [ -0.013, -0.698, 0.716 ], "point1": [ 52.125, 11.211, -17.452 ], "point2": [ 51.957, 2.361, -8.383 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, 0.043, 0.336, 4.019, -1.217, -3.324 ], "step_params": [ -1.822, -1.133, 3.626, -11.718, 19.101, 45.964 ], "heli_params": [ -2.817, 1.202, 3.291, 22.929, 14.067, 50.868 ], "bp2_params": [ -0.093, -0.338, 0.079, -0.026, -2.743, -9.481 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.626, "simple_Twist": 46.103, "simple_hRise": 3.293, "simple_hTwist": 50.992 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, -0.338, 0.079, -0.026, -2.743, -9.481 ], "step_params": [ 0.083, -2.917, 4.068, 5.749, 21.332, 22.743 ], "heli_params": [ -8.963, 0.821, 1.018, 43.175, -11.635, 31.605 ], "bp2_params": [ 0.452, -0.186, -0.803, -13.348, -3.025, -14.224 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.068, "simple_Twist": 19.850, "simple_hRise": 0.680, "simple_hTwist": 29.618 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.452, -0.186, -0.803, -13.348, -3.025, -14.224 ], "step_params": [ 0.942, -1.153, 2.730, -0.671, -15.787, 40.709 ], "heli_params": [ -0.183, -1.328, 2.946, -21.731, 0.923, 43.547 ], "bp2_params": [ 0.861, 0.110, 0.258, 9.392, 6.216, -10.397 ], "groove_widths": [ 16.390, null, 20.601, null ], "simple_Rise": 2.730, "simple_Twist": 38.471, "simple_hRise": 2.948, "simple_hTwist": 41.476 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.861, 0.110, 0.258, 9.392, 6.216, -10.397 ], "step_params": [ -0.501, -1.848, 3.765, 5.769, 7.485, 20.824 ], "heli_params": [ -7.436, 3.401, 2.712, 19.467, -15.005, 22.847 ], "bp2_params": [ 0.600, -0.136, -0.399, 5.522, -1.224, -0.730 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.765, "simple_Twist": 22.241, "simple_hRise": 2.788, "simple_hTwist": 24.142 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.600, -0.136, -0.399, 5.522, -1.224, -0.730 ], "step_params": [ -0.861, -1.436, 3.020, -3.484, 9.483, 35.114 ], "heli_params": [ -3.449, 0.951, 2.628, 15.329, 5.633, 36.495 ], "bp2_params": [ 0.636, -0.535, 0.006, 10.335, -11.134, -10.815 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.020, "simple_Twist": 34.884, "simple_hRise": 2.625, "simple_hTwist": 36.273 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GAUC", "strand2": "CUAG", "bp_type": "||||", "helix_form": "..A", "helical_rise": 3.909, "helical_rise_std": 0.191, "helical_radius": 9.879, "helical_radius_std": 0.609, "helical_axis": [ -0.164, -0.591, 0.790 ], "point1": [ 56.893, 3.961, -2.102 ], "point2": [ 54.951, -3.021, 7.229 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///A/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.284, -0.344, 0.268, 0.035, -2.691, -9.242 ], "step_params": [ 0.310, -1.096, 3.015, -0.920, 0.526, 18.491 ], "heli_params": [ -3.668, -1.419, 2.964, 1.636, 2.859, 18.521 ], "bp2_params": [ -0.052, -0.253, -0.007, 17.705, 3.601, 3.553 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.015, "simple_Twist": 17.126, "simple_hRise": 2.960, "simple_hTwist": 17.159 }, { "index": 2, "nt1": "///A/10", "nt2": "///A/27", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.052, -0.253, -0.007, 17.705, 3.601, 3.553 ], "step_params": [ -0.663, -2.188, 4.762, -1.203, -12.146, 34.472 ], "heli_params": [ -0.848, 0.796, 5.232, -19.745, 1.955, 36.507 ], "bp2_params": [ -0.580, -0.067, -0.025, -0.559, -0.866, -0.874 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.762, "simple_Twist": 37.304, "simple_hRise": 5.216, "simple_hTwist": 39.183 }, { "index": 3, "nt1": "///A/11", "nt2": "///A/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.580, -0.067, -0.025, -0.559, -0.866, -0.874 ], "step_params": [ 0.349, -1.779, 3.151, -2.839, 11.968, 25.169 ], "heli_params": [ -6.067, -1.288, 2.057, 25.604, 6.073, 27.970 ], "bp2_params": [ -0.156, -0.234, -0.148, 0.424, -1.160, -10.028 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.151, "simple_Twist": 22.809, "simple_hRise": 1.933, "simple_hTwist": 25.875 }, { "index": 4, "nt1": "///A/12", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "CCG", "strand2": "GGC", "bp_type": "|||", "helix_form": "..", "helical_rise": 4.451, "helical_rise_std": 0.360, "helical_radius": 9.341, "helical_radius_std": 0.938, "helical_axis": [ 0.660, 0.038, 0.750 ], "point1": [ 56.254, -6.185, 7.594 ], "point2": [ 62.516, -5.827, 14.707 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.706, -0.821, -0.741, -12.621, -19.756, 1.076 ], "step_params": [ -0.041, -1.015, 3.051, -5.231, 27.564, 21.982 ], "heli_params": [ -4.903, -0.547, 1.136, 51.731, 9.818, 35.506 ], "bp2_params": [ -0.077, -0.007, 0.348, -10.232, 12.854, 0.095 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.051, "simple_Twist": 27.312, "simple_hRise": 1.461, "simple_hTwist": 38.963 }, { "index": 2, "nt1": "///A/14", "nt2": "///A/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.007, 0.348, -10.232, 12.854, 0.095 ], "step_params": [ -0.497, -0.994, 2.127, -4.058, -8.877, 26.754 ], "heli_params": [ -0.577, 0.350, 2.376, -18.423, 8.421, 28.448 ], "bp2_params": [ -0.141, -0.373, -0.159, 45.560, 28.313, -13.307 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.127, "simple_Twist": 23.862, "simple_hRise": 2.388, "simple_hTwist": 25.754 }, { "index": 3, "nt1": "///A/15", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/9,///A/29" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/12,///A/13" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/15,///A/16" }, { "index": 4, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/17,///A/18,///A/19" } ], "nonStack": { "num_nts": 6, "nts_short": "GUUUCC", "nts_long": "///A/1,///A/7,///A/8,///A/23,///A/24,///A/32" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/35/NE", "nt": "///A/6", "vert_dist": 3.331 }, { "index": 2, "type": "other", "atom": "///A/36/NE", "nt": "///A/22", "vert_dist": 3.145 }, { "index": 3, "type": "other", "atom": "///A/36/NH2", "nt": "///A/23", "vert_dist": 3.245 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 3 ], "summary": "[1] 4 [A.15 A.20] 3", "num_nts": 6, "nts_short": "GGAAAC", "nts_long": "///A/15,///A/16,///A/17,///A/18,///A/19,///A/20", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/16,///A/17,///A/18,///A/19" } ] } ], "num_bulges": 2, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 0 [A.6 A.29 A.9 A.28] 6 4", "num_nts": 6, "nts_short": "CUUGCG", "nts_long": "///A/6,///A/7,///A/8,///A/9,///A/28,///A/29", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/7,///A/8" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 0, 2 ], "stem_indices": [ 2, 3 ], "summary": "[2] 0 2 [A.12 A.25 A.13 A.22] 4 3", "num_nts": 6, "nts_short": "CCGUCG", "nts_long": "///A/12,///A/13,///A/22,///A/23,///A/24,///A/25", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/23,///A/24" } ] } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "UUG", "nts_long": "///A/7,///A/8,///A/9" }, { "index": 2, "num_nts": 3, "nts_short": "UCG", "nts_long": "///A/23,///A/24,///A/25" } ], "dbn": { "all_chains": { "num_nts": 34, "num_chars": 34, "bseq": "GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC", "sstr": "((((((..(((((((....)))..))))))))))", "form": "...AA..............A....A...A.A..-" }, "chain_A": { "num_nts": 36, "num_chars": 34, "bseq": "GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC", "sstr": "((((((..(((((((....)))..))))))))))", "form": "...AA..............A....A...A.A..-" } }, "chains": { "chain_A": { "num_nts": 34, "bseq": "GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC", "sstr": "((((((..(((((((....)))..))))))))))", "form": "...AA..............A....A...A.A..-", "helical_rise": 0.223, "helical_rise_std": 3.182, "helical_axis": [ 0.485, -0.701, -0.523 ], "point1": [ 59.026, 2.967, 2.610 ], "point2": [ null, null, null ], "num_chars": 100, "suite": "G1aG!!G!!A1aG1cC!!U!!U!!G!!A1aU!!C!!C1aC1cG!!G!!A!!A!!A!!C1aG1cG!!U!!C!!G!!A1aU!!C1cG1aC!!U1aC1cC1mC" } }, "num_nts": 34, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,non-stack,canonical,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -167.998, "delta": 95.474, "epsilon": -115.030, "zeta": -89.755, "epsilon_zeta": -25.275, "bb_type": "--", "chi": 165.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.535, 8.239, 2.234 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 3.657, "Dp": 3.804, "splay_angle": 25.751, "splay_distance": 4.137, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -15.906, "v1": 0.005, "v2": 14.669, "v3": -25.208, "v4": 25.769, "amplitude": 26.220, "phase_angle": 55.982, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 49.565, 8.757, -19.793 ], "x_axis": [ 0.618, 0.532, 0.578 ], "y_axis": [ -0.700, 0.037, 0.714 ], "z_axis": [ 0.358, -0.846, 0.395 ], "quaternion": [ 0.716, 0.544, -0.077, 0.430 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -97.357, "beta": -176.472, "gamma": 48.576, "delta": 97.755, "epsilon": -162.558, "zeta": -58.071, "epsilon_zeta": -104.486, "bb_type": "BI", "chi": -154.382, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.708, 0.440 ], "P_xyz": [ 1.194, 9.029, 1.232 ], "form": ".", "ssZp": 4.106, "Dp": 4.221, "splay_angle": 22.219, "splay_distance": 4.562, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 137.608, "theta": -98.245, "eta_prime": 158.668, "theta_prime": -113.931, "eta_base": -161.342, "theta_base": -106.912, "v0": 2.891, "v1": -16.914, "v2": 23.231, "v3": -22.870, "v4": 12.635, "amplitude": 23.785, "phase_angle": 12.386, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.011, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 51.431, 5.083, -19.431 ], "x_axis": [ -0.136, 0.711, 0.690 ], "y_axis": [ -0.965, -0.252, 0.070 ], "z_axis": [ 0.224, -0.656, 0.721 ], "quaternion": [ 0.577, 0.315, -0.202, 0.726 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 116.142, "beta": 179.900, "gamma": -144.188, "delta": 95.776, "epsilon": -172.139, "zeta": -65.000, "epsilon_zeta": -107.138, "bb_type": "BI", "chi": -162.841, "glyco_bond": "anti", "C5prime_xyz": [ -2.030, 8.903, 0.737 ], "P_xyz": [ -1.676, 11.399, -0.053 ], "form": ".", "ssZp": 3.774, "Dp": 3.769, "splay_angle": 21.997, "splay_distance": 3.623, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 168.550, "theta": 175.720, "eta_prime": -175.855, "theta_prime": -170.991, "eta_base": -148.503, "theta_base": -121.235, "v0": -14.948, "v1": -0.768, "v2": 14.982, "v3": -24.952, "v4": 25.018, "amplitude": 25.669, "phase_angle": 54.293, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 54.396, 4.878, -15.970 ], "x_axis": [ -0.531, 0.756, 0.384 ], "y_axis": [ -0.845, -0.509, -0.166 ], "z_axis": [ 0.070, -0.412, 0.909 ], "quaternion": [ 0.466, 0.132, -0.168, 0.859 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -124.988, "beta": 179.828, "gamma": 102.605, "delta": 92.746, "epsilon": -173.712, "zeta": -68.404, "epsilon_zeta": -105.308, "bb_type": "BI", "chi": -150.252, "glyco_bond": "anti", "C5prime_xyz": [ -1.758, 8.844, 0.099 ], "P_xyz": [ 0.627, 9.601, -0.747 ], "form": "A", "ssZp": 3.958, "Dp": 4.033, "splay_angle": 23.033, "splay_distance": 3.904, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 162.617, "theta": -150.660, "eta_prime": -173.263, "theta_prime": -156.700, "eta_base": -114.938, "theta_base": -142.880, "v0": -7.300, "v1": -10.119, "v2": 22.263, "v3": -28.038, "v4": 22.188, "amplitude": 27.073, "phase_angle": 34.679, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.018, "origin": [ 54.656, 4.718, -12.360 ], "x_axis": [ -0.912, 0.119, 0.393 ], "y_axis": [ -0.245, -0.926, -0.289 ], "z_axis": [ 0.330, -0.359, 0.873 ], "quaternion": [ 0.094, 0.188, -0.168, 0.963 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -87.315, "beta": -170.462, "gamma": 63.831, "delta": 93.044, "epsilon": 176.473, "zeta": -84.388, "epsilon_zeta": -99.139, "bb_type": "BI", "chi": -142.292, "glyco_bond": "anti", "C5prime_xyz": [ -1.988, 8.949, -0.384 ], "P_xyz": [ 0.448, 9.962, -0.220 ], "form": "A", "ssZp": 3.727, "Dp": 3.823, "splay_angle": 21.335, "splay_distance": 3.573, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 169.116, "theta": -146.015, "eta_prime": -175.674, "theta_prime": -158.602, "eta_base": -148.926, "theta_base": -136.075, "v0": -12.550, "v1": -5.296, "v2": 19.740, "v3": -28.503, "v4": 25.739, "amplitude": 28.088, "phase_angle": 45.349, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.200, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 56.299, 5.108, -8.841 ], "x_axis": [ -0.951, -0.262, 0.162 ], "y_axis": [ 0.189, -0.913, -0.362 ], "z_axis": [ 0.243, -0.314, 0.918 ], "quaternion": [ -0.116, 0.104, -0.174, 0.972 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-acceptor", "alpha": 162.322, "beta": -177.078, "gamma": 165.426, "delta": 98.852, "epsilon": -109.572, "zeta": -147.517, "epsilon_zeta": 37.945, "bb_type": "--", "chi": -166.869, "glyco_bond": "anti", "C5prime_xyz": [ -0.967, 8.305, 1.218 ], "P_xyz": [ 0.978, 9.739, 0.150 ], "form": ".", "ssZp": 4.350, "Dp": 4.561, "splay_angle": 53.704, "splay_distance": 8.405, "splay_ratio": 0.452, "d22": 6.350, "d64": 7.048, "eta": 170.924, "theta": -168.456, "eta_prime": 173.828, "theta_prime": -148.074, "eta_base": -152.419, "theta_base": -130.206, "v0": 12.191, "v1": -25.138, "v2": 27.252, "v3": -21.557, "v4": 6.023, "amplitude": 27.436, "phase_angle": 353.370, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.171, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 56.886, 5.228, -5.318 ], "x_axis": [ -0.757, -0.636, -0.147 ], "y_axis": [ 0.640, -0.678, -0.361 ], "z_axis": [ 0.130, -0.368, 0.921 ], "quaternion": [ -0.348, -0.005, -0.199, 0.916 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-canonical,multiplet,bulge,splayed-apart", "alpha": 22.995, "beta": 117.744, "gamma": 33.009, "delta": 121.904, "epsilon": -92.863, "zeta": 121.057, "epsilon_zeta": 146.079, "bb_type": "--", "chi": -136.224, "glyco_bond": "anti", "C5prime_xyz": [ -2.347, 8.822, -0.552 ], "P_xyz": [ 0.124, 9.138, 0.322 ], "form": ".", "ssZp": 1.734, "Dp": 1.828, "splay_angle": 152.015, "splay_distance": 18.929, "splay_ratio": 0.970, "d22": 11.961, "d64": 14.851, "eta": -140.490, "theta": 125.038, "eta_prime": -129.113, "theta_prime": 86.036, "eta_base": -127.604, "theta_base": 59.860, "v0": -28.517, "v1": 28.881, "v2": -17.826, "v3": 1.739, "v4": 16.452, "amplitude": 29.441, "phase_angle": 127.265, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 58.210, 2.171, 2.399 ], "x_axis": [ -0.612, -0.587, -0.530 ], "y_axis": [ 0.726, -0.152, -0.671 ], "z_axis": [ 0.313, -0.796, 0.519 ], "quaternion": [ -0.434, -0.072, -0.485, 0.755 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,bulge,splayed-apart", "alpha": -115.366, "beta": 169.757, "gamma": -101.325, "delta": 152.720, "epsilon": -121.722, "zeta": 69.806, "epsilon_zeta": 168.472, "bb_type": "--", "chi": -35.563, "glyco_bond": "--", "C5prime_xyz": [ -3.628, 5.533, -3.052 ], "P_xyz": [ -4.422, 5.841, -5.552 ], "form": ".", "ssZp": -0.298, "Dp": 1.625, "splay_angle": 143.026, "splay_distance": 19.492, "splay_ratio": 0.948, "d22": null, "d64": null, "eta": 43.164, "theta": 28.246, "eta_prime": 37.666, "theta_prime": -45.500, "eta_base": 40.091, "theta_base": -57.260, "v0": -10.767, "v1": 29.780, "v2": -35.223, "v3": 30.858, "v4": -12.578, "amplitude": 35.236, "phase_angle": 181.527, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.016, "origin": [ 75.579, 5.858, -4.161 ], "x_axis": [ 0.076, -0.256, -0.964 ], "y_axis": [ -0.973, 0.191, -0.128 ], "z_axis": [ 0.217, 0.948, -0.235 ], "quaternion": [ 0.508, -0.529, 0.581, 0.353 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": -142.841, "beta": -73.391, "gamma": -145.029, "delta": 95.171, "epsilon": -124.404, "zeta": -66.230, "epsilon_zeta": -58.174, "bb_type": "--", "chi": -161.158, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.678, 0.816 ], "P_xyz": [ -1.459, 9.922, -1.506 ], "form": ".", "ssZp": 4.202, "Dp": 4.444, "splay_angle": 18.342, "splay_distance": 3.112, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 32.689, "theta": 174.525, "eta_prime": 94.268, "theta_prime": -175.662, "eta_base": 114.469, "theta_base": -147.801, "v0": 2.640, "v1": -18.252, "v2": 25.538, "v3": -25.491, "v4": 14.438, "amplitude": 26.277, "phase_angle": 13.615, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 56.427, 6.109, -0.547 ], "x_axis": [ 0.060, -0.794, -0.605 ], "y_axis": [ 0.998, 0.042, 0.044 ], "z_axis": [ -0.009, -0.607, 0.795 ], "quaternion": [ 0.689, 0.236, 0.216, -0.650 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -100.187, "beta": 117.195, "gamma": 117.166, "delta": 91.076, "epsilon": -155.660, "zeta": -85.709, "epsilon_zeta": -69.951, "bb_type": "BI", "chi": -174.322, "glyco_bond": "anti", "C5prime_xyz": [ -1.907, 8.573, 1.434 ], "P_xyz": [ -0.235, 9.858, -0.150 ], "form": ".", "ssZp": 4.250, "Dp": 4.259, "splay_angle": 34.639, "splay_distance": 5.276, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 163.476, "theta": -175.563, "eta_prime": -173.848, "theta_prime": -173.288, "eta_base": -131.917, "theta_base": -145.535, "v0": -5.780, "v1": -12.560, "v2": 24.563, "v3": -29.572, "v4": 22.194, "amplitude": 28.583, "phase_angle": 30.755, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.019, "origin": [ 55.549, 3.701, 1.217 ], "x_axis": [ 0.476, -0.663, -0.577 ], "y_axis": [ 0.872, 0.273, 0.405 ], "z_axis": [ -0.111, -0.696, 0.709 ], "quaternion": [ 0.784, 0.351, 0.149, -0.490 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -78.119, "beta": 179.509, "gamma": 69.513, "delta": 94.786, "epsilon": -132.211, "zeta": -14.035, "epsilon_zeta": -118.175, "bb_type": "--", "chi": -163.005, "glyco_bond": "anti", "C5prime_xyz": [ -1.274, 8.522, 0.935 ], "P_xyz": [ 1.352, 8.663, 1.167 ], "form": ".", "ssZp": 4.393, "Dp": 4.550, "splay_angle": 21.180, "splay_distance": 3.728, "splay_ratio": 0.191, "d22": 3.443, "d64": 4.491, "eta": -173.515, "theta": -100.339, "eta_prime": -165.298, "theta_prime": -120.711, "eta_base": -134.836, "theta_base": -108.732, "v0": 6.490, "v1": -22.287, "v2": 28.129, "v3": -25.846, "v4": 12.246, "amplitude": 28.291, "phase_angle": 6.141, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.254, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 53.119, 0.386, 4.525 ], "x_axis": [ 0.860, -0.489, -0.148 ], "y_axis": [ 0.496, 0.730, 0.471 ], "z_axis": [ -0.122, -0.478, 0.870 ], "quaternion": [ 0.930, 0.255, 0.007, -0.265 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -116.845, "beta": 59.532, "gamma": 174.083, "delta": 98.512, "epsilon": -170.517, "zeta": -12.357, "epsilon_zeta": -158.160, "bb_type": "BI", "chi": 172.149, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 7.721, 2.250 ], "P_xyz": [ -1.466, 10.110, 1.132 ], "form": ".", "ssZp": 3.991, "Dp": 4.350, "splay_angle": 29.745, "splay_distance": 4.829, "splay_ratio": 0.269, "d22": 3.259, "d64": 3.029, "eta": -169.485, "theta": -166.511, "eta_prime": -171.463, "theta_prime": -140.677, "eta_base": -133.905, "theta_base": -72.638, "v0": 16.365, "v1": -29.566, "v2": 30.075, "v3": -21.929, "v4": 3.687, "amplitude": 30.791, "phase_angle": 347.622, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 53.073, -2.923, 6.240 ], "x_axis": [ 0.983, -0.098, -0.154 ], "y_axis": [ 0.161, 0.860, 0.484 ], "z_axis": [ 0.085, -0.501, 0.861 ], "quaternion": [ 0.962, 0.256, 0.062, -0.067 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -119.969, "beta": -154.791, "gamma": 43.660, "delta": 90.429, "epsilon": -120.237, "zeta": -84.676, "epsilon_zeta": -35.562, "bb_type": "--", "chi": -151.216, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.811, 0.179 ], "P_xyz": [ 0.731, 9.597, 1.376 ], "form": ".", "ssZp": 3.845, "Dp": 4.480, "splay_angle": 20.883, "splay_distance": 3.611, "splay_ratio": 0.182, "d22": 3.723, "d64": 3.405, "eta": 147.082, "theta": -126.914, "eta_prime": 179.902, "theta_prime": -122.669, "eta_base": -95.628, "theta_base": -106.065, "v0": -0.353, "v1": -18.315, "v2": 28.384, "v3": -30.273, "v4": 19.288, "amplitude": 30.184, "phase_angle": 19.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 57.185, -3.866, 8.591 ], "x_axis": [ 0.484, 0.834, 0.265 ], "y_axis": [ -0.862, 0.403, 0.307 ], "z_axis": [ 0.149, -0.377, 0.914 ], "quaternion": [ 0.837, 0.204, -0.035, 0.507 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.541, "beta": 161.804, "gamma": 35.894, "delta": 89.633, "epsilon": 175.932, "zeta": -87.398, "epsilon_zeta": -96.670, "bb_type": "BI", "chi": -140.026, "glyco_bond": "anti", "C5prime_xyz": [ -2.069, 8.934, -0.520 ], "P_xyz": [ 0.312, 10.066, -0.397 ], "form": ".", "ssZp": 3.755, "Dp": 3.869, "splay_angle": 13.172, "splay_distance": 2.277, "splay_ratio": 0.118, "d22": null, "d64": null, "eta": 144.562, "theta": -148.714, "eta_prime": 166.712, "theta_prime": -165.326, "eta_base": -164.642, "theta_base": -160.091, "v0": -14.601, "v1": -4.931, "v2": 21.066, "v3": -31.219, "v4": 28.695, "amplitude": 30.902, "phase_angle": 47.023, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.239, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 58.833, -4.470, 11.747 ], "x_axis": [ -0.091, 0.947, -0.308 ], "y_axis": [ -0.965, -0.008, 0.261 ], "z_axis": [ 0.245, 0.321, 0.915 ], "quaternion": [ 0.674, -0.022, 0.205, 0.710 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 149.707, "beta": -171.382, "gamma": 163.924, "delta": 89.660, "epsilon": 48.350, "zeta": 113.442, "epsilon_zeta": -65.092, "bb_type": "--", "chi": -158.581, "glyco_bond": "anti", "C5prime_xyz": [ -0.923, 8.519, 0.619 ], "P_xyz": [ 0.583, 9.848, -1.102 ], "form": ".", "ssZp": 2.916, "Dp": 2.937, "splay_angle": 42.018, "splay_distance": 6.609, "splay_ratio": 0.362, "d22": null, "d64": null, "eta": -157.403, "theta": -177.108, "eta_prime": -171.097, "theta_prime": -151.789, "eta_base": -157.548, "theta_base": -107.184, "v0": 13.312, "v1": -31.710, "v2": 36.266, "v3": -30.280, "v4": 10.843, "amplitude": 36.288, "phase_angle": 358.000, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.354, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 60.656, -4.443, 13.111 ], "x_axis": [ -0.450, 0.872, -0.191 ], "y_axis": [ -0.739, -0.244, 0.628 ], "z_axis": [ 0.501, 0.424, 0.755 ], "quaternion": [ 0.515, 0.099, 0.336, 0.782 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -114.426, "beta": 130.142, "gamma": 48.024, "delta": 87.537, "epsilon": -163.958, "zeta": -20.750, "epsilon_zeta": -143.207, "bb_type": "BI", "chi": -152.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.803, 0.262 ], "P_xyz": [ 1.157, 8.591, -0.359 ], "form": ".", "ssZp": 4.338, "Dp": 4.472, "splay_angle": 68.667, "splay_distance": 10.163, "splay_ratio": 0.564, "d22": null, "d64": null, "eta": 153.267, "theta": -57.618, "eta_prime": -168.910, "theta_prime": -114.272, "eta_base": -116.369, "theta_base": -178.035, "v0": 2.788, "v1": -23.182, "v2": 32.981, "v3": -33.229, "v4": 19.124, "amplitude": 34.077, "phase_angle": 14.570, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 61.797, -1.411, 18.872 ], "x_axis": [ -0.834, 0.392, 0.389 ], "y_axis": [ -0.310, -0.915, 0.257 ], "z_axis": [ 0.457, 0.094, 0.885 ], "quaternion": [ 0.184, 0.222, 0.092, 0.953 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 105.862, "beta": 130.376, "gamma": 79.908, "delta": 96.153, "epsilon": 169.006, "zeta": 2.742, "epsilon_zeta": 166.264, "bb_type": "--", "chi": -177.150, "glyco_bond": "anti", "C5prime_xyz": [ -1.899, 8.461, 1.606 ], "P_xyz": [ 0.689, 8.859, 1.219 ], "form": ".", "ssZp": 3.456, "Dp": 3.760, "splay_angle": 32.438, "splay_distance": 5.476, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": -31.449, "theta": -77.187, "eta_prime": 32.025, "theta_prime": -99.197, "eta_base": 32.665, "theta_base": -35.223, "v0": -5.407, "v1": -10.052, "v2": 20.443, "v3": -24.955, "v4": 19.130, "amplitude": 24.128, "phase_angle": 32.081, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.019, "origin": [ 70.629, -3.107, 23.606 ], "x_axis": [ 0.535, -0.746, -0.397 ], "y_axis": [ -0.765, -0.627, 0.148 ], "z_axis": [ -0.360, 0.224, -0.906 ], "quaternion": [ -0.022, 0.876, -0.431, -0.216 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -145.343, "beta": 175.324, "gamma": 76.447, "delta": 96.827, "epsilon": -173.238, "zeta": -81.530, "epsilon_zeta": -91.709, "bb_type": "BI", "chi": -149.545, "glyco_bond": "anti", "C5prime_xyz": [ -2.398, 8.946, -0.019 ], "P_xyz": [ -0.080, 10.207, -0.143 ], "form": ".", "ssZp": 3.720, "Dp": 3.613, "splay_angle": 23.733, "splay_distance": 3.769, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 131.049, "theta": -159.068, "eta_prime": 179.872, "theta_prime": -163.053, "eta_base": -77.998, "theta_base": -88.601, "v0": -21.667, "v1": 6.262, "v2": 10.498, "v3": -24.228, "v4": 28.699, "amplitude": 28.291, "phase_angle": 68.218, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.019, "origin": [ 70.153, -7.584, 20.488 ], "x_axis": [ -0.540, -0.834, 0.115 ], "y_axis": [ -0.789, 0.549, 0.276 ], "z_axis": [ -0.294, 0.058, -0.954 ], "quaternion": [ -0.117, -0.465, 0.872, 0.096 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -102.576, "beta": 164.110, "gamma": 84.605, "delta": 98.757, "epsilon": -145.080, "zeta": 4.608, "epsilon_zeta": 210.312, "bb_type": "--", "chi": -145.497, "glyco_bond": "anti", "C5prime_xyz": [ -0.639, 8.305, -0.085 ], "P_xyz": [ 1.762, 7.867, -1.113 ], "form": ".", "ssZp": 3.943, "Dp": 4.621, "splay_angle": 51.596, "splay_distance": 8.935, "splay_ratio": 0.440, "d22": null, "d64": null, "eta": 164.309, "theta": -61.793, "eta_prime": -178.913, "theta_prime": -75.841, "eta_base": -91.131, "theta_base": -68.161, "v0": 17.165, "v1": -29.875, "v2": 29.862, "v3": -21.246, "v4": 2.802, "amplitude": 30.782, "phase_angle": 345.955, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.019, "origin": [ 67.328, -7.578, 17.993 ], "x_axis": [ -0.999, 0.040, -0.035 ], "y_axis": [ 0.043, 0.996, -0.082 ], "z_axis": [ 0.031, -0.083, -0.996 ], "quaternion": [ 0.016, 0.021, 0.999, -0.041 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -155.462, "beta": 133.390, "gamma": 162.432, "delta": 94.317, "epsilon": -145.499, "zeta": -87.381, "epsilon_zeta": -58.118, "bb_type": "BI", "chi": 179.780, "glyco_bond": "anti", "C5prime_xyz": [ -1.896, 8.449, 1.753 ], "P_xyz": [ -1.079, 10.815, 0.909 ], "form": "A", "ssZp": 4.164, "Dp": 4.214, "splay_angle": 15.192, "splay_distance": 2.556, "splay_ratio": 0.137, "d22": null, "d64": null, "eta": -175.506, "theta": 171.849, "eta_prime": -144.297, "theta_prime": -173.346, "eta_base": -98.378, "theta_base": -141.535, "v0": -5.918, "v1": -10.630, "v2": 21.742, "v3": -26.655, "v4": 20.469, "amplitude": 25.742, "phase_angle": 32.368, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 60.330, -4.473, 13.388 ], "x_axis": [ -0.488, 0.811, 0.323 ], "y_axis": [ 0.871, 0.477, 0.120 ], "z_axis": [ -0.057, 0.340, -0.939 ], "quaternion": [ -0.111, 0.493, 0.852, 0.135 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.375, "beta": 166.651, "gamma": 35.754, "delta": 94.550, "epsilon": 177.336, "zeta": -80.234, "epsilon_zeta": -102.429, "bb_type": "BI", "chi": -125.289, "glyco_bond": "anti", "C5prime_xyz": [ -1.848, 8.681, -1.291 ], "P_xyz": [ 0.647, 9.524, -1.516 ], "form": ".", "ssZp": 3.233, "Dp": 3.898, "splay_angle": 16.279, "splay_distance": 2.963, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 170.393, "theta": -134.831, "eta_prime": -169.782, "theta_prime": -151.964, "eta_base": -133.260, "theta_base": -140.577, "v0": -6.542, "v1": -9.915, "v2": 21.237, "v3": -26.471, "v4": 20.742, "amplitude": 25.571, "phase_angle": 33.852, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.116, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 58.704, -4.469, 11.415 ], "x_axis": [ -0.014, 0.995, -0.103 ], "y_axis": [ 0.905, -0.031, -0.424 ], "z_axis": [ -0.425, -0.100, -0.900 ], "quaternion": [ -0.117, 0.692, 0.686, -0.191 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-acceptor", "alpha": 127.434, "beta": -168.683, "gamma": -167.321, "delta": 94.227, "epsilon": -99.710, "zeta": -104.416, "epsilon_zeta": 4.706, "bb_type": "--", "chi": -153.792, "glyco_bond": "anti", "C5prime_xyz": [ -1.148, 8.653, 0.395 ], "P_xyz": [ 0.072, 10.442, -1.116 ], "form": ".", "ssZp": 3.758, "Dp": 4.548, "splay_angle": 49.080, "splay_distance": 8.221, "splay_ratio": 0.415, "d22": null, "d64": null, "eta": 168.972, "theta": -165.319, "eta_prime": 171.776, "theta_prime": -147.902, "eta_base": -163.886, "theta_base": -136.494, "v0": 7.177, "v1": -23.250, "v2": 29.032, "v3": -26.380, "v4": 12.147, "amplitude": 29.151, "phase_angle": 5.180, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.145, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 56.424, -4.385, 9.525 ], "x_axis": [ 0.389, 0.920, -0.053 ], "y_axis": [ 0.783, -0.360, -0.507 ], "z_axis": [ -0.485, 0.156, -0.860 ], "quaternion": [ -0.205, 0.808, 0.527, -0.167 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "U", "nt_code": "U", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-canonical,multiplet,bulge,cap-acceptor,splayed-apart", "alpha": -72.891, "beta": 169.689, "gamma": 81.263, "delta": 119.233, "epsilon": -82.343, "zeta": 100.283, "epsilon_zeta": 177.374, "bb_type": "--", "chi": -122.987, "glyco_bond": "anti", "C5prime_xyz": [ -2.639, 8.649, -1.299 ], "P_xyz": [ -0.322, 9.729, -1.964 ], "form": ".", "ssZp": 1.219, "Dp": 1.554, "splay_angle": 108.599, "splay_distance": 18.058, "splay_ratio": 0.813, "d22": 10.986, "d64": 14.085, "eta": -145.695, "theta": 93.940, "eta_prime": -137.484, "theta_prime": 70.128, "eta_base": -139.209, "theta_base": 60.129, "v0": -31.447, "v1": 29.893, "v2": -16.643, "v3": -1.237, "v4": 20.122, "amplitude": 31.607, "phase_angle": 121.773, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 53.441, -2.319, 2.148 ], "x_axis": [ 0.673, 0.691, 0.265 ], "y_axis": [ 0.739, -0.645, -0.194 ], "z_axis": [ 0.037, 0.327, -0.944 ], "quaternion": [ -0.144, 0.903, 0.396, 0.084 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,splayed-apart", "alpha": -125.038, "beta": -177.183, "gamma": -65.593, "delta": 115.544, "epsilon": -161.624, "zeta": 102.198, "epsilon_zeta": 96.178, "bb_type": "--", "chi": -124.397, "glyco_bond": "anti", "C5prime_xyz": [ -2.565, 8.728, -1.277 ], "P_xyz": [ -2.981, 11.323, -1.567 ], "form": ".", "ssZp": 2.754, "Dp": 2.843, "splay_angle": 119.047, "splay_distance": 17.133, "splay_ratio": 0.862, "d22": null, "d64": null, "eta": 57.796, "theta": -0.429, "eta_prime": 47.233, "theta_prime": -105.607, "eta_base": 41.720, "theta_base": -105.098, "v0": -32.339, "v1": 28.841, "v2": -14.222, "v3": -4.363, "v4": 22.654, "amplitude": 31.992, "phase_angle": 116.395, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 56.912, -19.535, 6.345 ], "x_axis": [ 0.932, 0.096, 0.350 ], "y_axis": [ 0.124, 0.822, -0.556 ], "z_axis": [ -0.341, 0.562, 0.753 ], "quaternion": [ 0.936, -0.299, -0.185, -0.008 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -144.846, "beta": -70.588, "gamma": -145.252, "delta": 97.525, "epsilon": -131.197, "zeta": -66.602, "epsilon_zeta": -64.595, "bb_type": "BI", "chi": -169.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.119, 8.354, 1.326 ], "P_xyz": [ -1.125, 9.982, -0.755 ], "form": "A", "ssZp": 4.550, "Dp": 4.590, "splay_angle": 21.482, "splay_distance": 3.564, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 48.274, "theta": 178.258, "eta_prime": 150.413, "theta_prime": -171.928, "eta_base": 178.547, "theta_base": -147.906, "v0": 11.026, "v1": -25.075, "v2": 28.205, "v3": -23.164, "v4": 7.768, "amplitude": 28.255, "phase_angle": 356.592, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 53.260, -2.797, 6.465 ], "x_axis": [ 0.994, 0.064, -0.085 ], "y_axis": [ 0.013, -0.867, -0.499 ], "z_axis": [ -0.106, 0.495, -0.862 ], "quaternion": [ -0.258, 0.965, 0.020, -0.050 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -120.446, "beta": 147.036, "gamma": 110.197, "delta": 91.856, "epsilon": -170.557, "zeta": -54.479, "epsilon_zeta": -116.078, "bb_type": "BI", "chi": -174.089, "glyco_bond": "anti", "C5prime_xyz": [ -1.741, 8.507, 1.486 ], "P_xyz": [ 0.403, 9.708, 0.514 ], "form": ".", "ssZp": 4.235, "Dp": 4.207, "splay_angle": 33.073, "splay_distance": 5.296, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": 151.708, "theta": -145.938, "eta_prime": 178.544, "theta_prime": -149.659, "eta_base": -141.398, "theta_base": -125.945, "v0": -2.132, "v1": -15.699, "v2": 26.023, "v3": -28.874, "v4": 19.484, "amplitude": 28.372, "phase_angle": 23.481, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.019, "origin": [ 53.650, 0.145, 4.491 ], "x_axis": [ 0.869, -0.470, -0.153 ], "y_axis": [ -0.481, -0.732, -0.482 ], "z_axis": [ 0.114, 0.493, -0.863 ], "quaternion": [ -0.262, 0.931, -0.256, -0.011 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -80.518, "beta": -159.660, "gamma": 60.472, "delta": 93.228, "epsilon": -123.527, "zeta": -120.162, "epsilon_zeta": -3.365, "bb_type": "--", "chi": -154.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.742, 8.826, 0.338 ], "P_xyz": [ 0.624, 9.553, 1.260 ], "form": ".", "ssZp": 3.877, "Dp": 4.249, "splay_angle": 18.499, "splay_distance": 3.344, "splay_ratio": 0.164, "d22": 4.234, "d64": 4.943, "eta": -167.113, "theta": -129.767, "eta_prime": -153.417, "theta_prime": -135.642, "eta_base": -120.893, "theta_base": -129.176, "v0": -6.456, "v1": -10.663, "v2": 22.318, "v3": -27.561, "v4": 21.377, "amplitude": 26.633, "phase_angle": 33.073, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.239, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 55.799, 3.751, 1.262 ], "x_axis": [ 0.422, -0.724, -0.545 ], "y_axis": [ -0.896, -0.424, -0.131 ], "z_axis": [ -0.136, 0.544, -0.828 ], "quaternion": [ -0.206, 0.818, -0.496, -0.208 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 84.506, "beta": -99.091, "gamma": -145.645, "delta": 90.067, "epsilon": 177.976, "zeta": -31.645, "epsilon_zeta": -150.379, "bb_type": "BI", "chi": -174.441, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.721, 1.295 ], "P_xyz": [ -1.382, 10.417, -0.612 ], "form": ".", "ssZp": 3.632, "Dp": 3.890, "splay_angle": 24.953, "splay_distance": 4.632, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": -157.678, "theta": -153.794, "eta_prime": -157.497, "theta_prime": -151.259, "eta_base": -138.655, "theta_base": -90.736, "v0": -11.108, "v1": -7.974, "v2": 22.498, "v3": -30.626, "v4": 26.218, "amplitude": 29.765, "phase_angle": 40.899, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 56.809, 6.093, -0.900 ], "x_axis": [ 0.220, -0.748, -0.627 ], "y_axis": [ -0.975, -0.167, -0.143 ], "z_axis": [ 0.002, 0.643, -0.766 ], "quaternion": [ -0.268, 0.734, -0.587, -0.213 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 126.210, "beta": 163.449, "gamma": -177.952, "delta": 95.304, "epsilon": -128.909, "zeta": -75.536, "epsilon_zeta": -53.372, "bb_type": "BI", "chi": -176.817, "glyco_bond": "anti", "C5prime_xyz": [ -1.436, 8.331, 1.702 ], "P_xyz": [ -0.272, 10.663, 1.276 ], "form": "A", "ssZp": 4.561, "Dp": 4.531, "splay_angle": 19.201, "splay_distance": 3.340, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 145.094, "theta": -158.768, "eta_prime": 168.208, "theta_prime": -147.866, "eta_base": -109.000, "theta_base": -105.119, "v0": 5.706, "v1": -21.198, "v2": 27.220, "v3": -25.386, "v4": 12.454, "amplitude": 27.451, "phase_angle": 7.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.032, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 57.707, 5.339, -5.381 ], "x_axis": [ -0.650, -0.650, -0.394 ], "y_axis": [ -0.751, 0.468, 0.466 ], "z_axis": [ -0.119, 0.599, -0.792 ], "quaternion": [ 0.081, -0.410, 0.853, 0.312 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.506, "beta": 166.054, "gamma": 28.069, "delta": 91.164, "epsilon": -151.451, "zeta": -97.211, "epsilon_zeta": -54.241, "bb_type": "BI", "chi": -143.941, "glyco_bond": "anti", "C5prime_xyz": [ -1.875, 8.921, -0.296 ], "P_xyz": [ 0.438, 10.042, 0.304 ], "form": ".", "ssZp": 3.755, "Dp": 4.146, "splay_angle": 24.586, "splay_distance": 4.557, "splay_ratio": 0.220, "d22": 3.892, "d64": 5.058, "eta": 160.520, "theta": -129.665, "eta_prime": -176.947, "theta_prime": -136.992, "eta_base": -124.826, "theta_base": -123.811, "v0": -10.574, "v1": -7.911, "v2": 21.916, "v3": -29.675, "v4": 25.258, "amplitude": 28.819, "phase_angle": 40.493, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.036, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 56.992, 5.001, -8.627 ], "x_axis": [ -0.954, -0.265, 0.138 ], "y_axis": [ -0.178, 0.874, 0.451 ], "z_axis": [ -0.240, 0.406, -0.882 ], "quaternion": [ -0.098, -0.115, 0.963, 0.222 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 106.884, "beta": -132.494, "gamma": -143.341, "delta": 92.272, "epsilon": 179.758, "zeta": -69.439, "epsilon_zeta": -110.804, "bb_type": "BI", "chi": 179.050, "glyco_bond": "anti", "C5prime_xyz": [ -2.259, 8.490, 1.710 ], "P_xyz": [ -1.479, 10.815, 0.734 ], "form": "A", "ssZp": 3.663, "Dp": 3.910, "splay_angle": 17.062, "splay_distance": 2.706, "splay_ratio": 0.153, "d22": 5.141, "d64": 4.734, "eta": -169.367, "theta": 158.794, "eta_prime": -162.210, "theta_prime": 174.427, "eta_base": -134.128, "theta_base": -152.483, "v0": -11.642, "v1": -6.434, "v2": 20.652, "v3": -28.926, "v4": 25.433, "amplitude": 28.304, "phase_angle": 43.142, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 55.367, 4.918, -12.883 ], "x_axis": [ -0.907, -0.091, 0.411 ], "y_axis": [ 0.140, 0.857, 0.497 ], "z_axis": [ -0.397, 0.508, -0.764 ], "quaternion": [ -0.215, 0.013, 0.939, 0.268 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -91.901, "beta": -159.016, "gamma": 58.681, "delta": 94.105, "epsilon": -162.161, "zeta": -66.370, "epsilon_zeta": -95.792, "bb_type": "BI", "chi": -146.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.714, -0.078 ], "P_xyz": [ 1.363, 9.056, 0.483 ], "form": ".", "ssZp": 4.016, "Dp": 4.340, "splay_angle": 30.064, "splay_distance": 5.470, "splay_ratio": 0.270, "d22": 4.428, "d64": 5.416, "eta": 171.411, "theta": -110.284, "eta_prime": -179.095, "theta_prime": -122.530, "eta_base": -143.526, "theta_base": -111.411, "v0": 3.452, "v1": -19.642, "v2": 26.926, "v3": -26.420, "v4": 14.503, "amplitude": 27.542, "phase_angle": 12.142, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.086, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 54.656, 4.186, -15.390 ], "x_axis": [ -0.725, 0.615, 0.309 ], "y_axis": [ 0.654, 0.755, 0.033 ], "z_axis": [ -0.213, 0.226, -0.950 ], "quaternion": [ -0.141, 0.343, 0.926, 0.070 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 141.423, "beta": -179.334, "gamma": -165.204, "delta": 94.006, "epsilon": -148.230, "zeta": -45.859, "epsilon_zeta": -102.371, "bb_type": "BI", "chi": -172.100, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.556, 1.388 ], "P_xyz": [ -0.516, 10.880, 0.760 ], "form": ".", "ssZp": 4.311, "Dp": 4.318, "splay_angle": 25.798, "splay_distance": 4.300, "splay_ratio": 0.227, "d22": 4.611, "d64": 3.968, "eta": 169.168, "theta": -143.066, "eta_prime": -176.667, "theta_prime": -134.826, "eta_base": -147.191, "theta_base": -90.619, "v0": -1.518, "v1": -14.936, "v2": 24.299, "v3": -26.688, "v4": 17.760, "amplitude": 26.308, "phase_angle": 22.535, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.263, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 51.072, 5.094, -19.422 ], "x_axis": [ -0.304, 0.690, 0.657 ], "y_axis": [ 0.929, 0.369, 0.042 ], "z_axis": [ -0.213, 0.623, -0.753 ], "quaternion": [ -0.279, 0.520, 0.779, 0.213 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///A/34", "linked_nts": [ "///A/33", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -101.767, "beta": -152.114, "gamma": 47.139, "delta": 90.717, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -118.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.928, 8.515, -1.672 ], "P_xyz": [ 0.423, 9.720, -1.685 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -7.186, "v1": -10.405, "v2": 22.572, "v3": -28.324, "v4": 22.344, "amplitude": 27.335, "phase_angle": 34.334, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.111, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 49.523, 9.074, -19.925 ], "x_axis": [ 0.569, 0.553, 0.609 ], "y_axis": [ 0.758, -0.065, -0.649 ], "z_axis": [ -0.320, 0.831, -0.456 ], "quaternion": [ 0.512, -0.723, -0.453, -0.100 ] } } ], "num_hbonds": 78, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/1/O6", "atom2_id": "///A/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 1076, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/1/N1", "atom2_id": "///A/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 1075, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/1/N2", "atom2_id": "///A/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 50, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 2.429, "atom1_id": "///A/2/O6", "atom2_id": "///A/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 51, "atom2_serNum": 1045, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/2/N1", "atom2_id": "///A/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 53, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/2/N2", "atom2_id": "///A/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 77, "atom2_serNum": 104, "donAcc_type": "acceptable", "distance": 2.309, "atom1_id": "///A/3/O2'", "atom2_id": "///A/4/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 77, "atom2_serNum": 107, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///A/3/O2'", "atom2_id": "///A/4/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 84, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.426, "atom1_id": "///A/3/O6", "atom2_id": "///A/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 85, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/3/N1", "atom2_id": "///A/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 87, "atom2_serNum": 1013, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/3/N2", "atom2_id": "///A/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 111, "atom2_serNum": 140, "donAcc_type": "acceptable", "distance": 2.805, "atom1_id": "///A/4/O2'", "atom2_id": "///A/5/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 118, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/4/N6", "atom2_id": "///A/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 119, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/4/N1", "atom2_id": "///A/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 144, "atom2_serNum": 171, "donAcc_type": "acceptable", "distance": 2.204, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 144, "atom2_serNum": 174, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 151, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/5/O6", "atom2_id": "///A/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 152, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/5/N1", "atom2_id": "///A/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 154, "atom2_serNum": 952, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/5/N2", "atom2_id": "///A/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 182, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/6/O2", "atom2_id": "///A/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 183, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/6/N3", "atom2_id": "///A/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 185, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.427, "atom1_id": "///A/6/N4", "atom2_id": "///A/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 205, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/7/O4'", "atom2_id": "///A/35/NH1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 24, "atom1_serNum": 214, "atom2_serNum": 307, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/7/N3", "atom2_id": "///A/10/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 216, "atom2_serNum": 310, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/7/O4", "atom2_id": "///A/10/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 273, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.431, "atom1_id": "///A/9/N7", "atom2_id": "///A/35/NH2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 27, "atom1_serNum": 276, "atom2_serNum": 890, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///A/9/O6", "atom2_id": "///A/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 276, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///A/9/O6", "atom2_id": "///A/35/NH2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 29, "atom1_serNum": 277, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/9/N1", "atom2_id": "///A/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 279, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/9/N2", "atom2_id": "///A/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 303, "atom2_serNum": 329, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///A/10/O2'", "atom2_id": "///A/11/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 303, "atom2_serNum": 332, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///A/10/O2'", "atom2_id": "///A/11/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 310, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/10/N6", "atom2_id": "///A/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 311, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///A/10/N1", "atom2_id": "///A/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 341, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/11/N3", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 343, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/11/O4", "atom2_id": "///A/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 343, "atom2_serNum": 1131, "donAcc_type": "questionable", "distance": 2.565, "atom1_id": "///A/11/O4", "atom2_id": "///A/36/O", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 38, "atom1_serNum": 370, "atom2_serNum": 796, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/12/O2", "atom2_id": "///A/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 371, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/12/N3", "atom2_id": "///A/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 373, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 2.476, "atom1_id": "///A/12/N4", "atom2_id": "///A/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 393, "atom2_serNum": 796, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/13/O4'", "atom2_id": "///A/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 401, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/13/O2", "atom2_id": "///A/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 402, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///A/13/N3", "atom2_id": "///A/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 404, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///A/13/N4", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 428, "atom2_serNum": 452, "donAcc_type": "acceptable", "distance": 2.261, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 428, "atom2_serNum": 455, "donAcc_type": "acceptable", "distance": 2.498, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 432, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/14/O2", "atom2_id": "///A/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 433, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/14/N3", "atom2_id": "///A/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 435, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/14/N4", "atom2_id": "///A/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 435, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/14/N4", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 459, "atom2_serNum": 484, "donAcc_type": "acceptable", "distance": 2.209, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 459, "atom2_serNum": 486, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 459, "atom2_serNum": 489, "donAcc_type": "acceptable", "distance": 2.268, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 466, "atom2_serNum": 633, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///A/15/O6", "atom2_id": "///A/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 467, "atom2_serNum": 631, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/15/N1", "atom2_id": "///A/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 469, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/15/N2", "atom2_id": "///A/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 493, "atom2_serNum": 564, "donAcc_type": "acceptable", "distance": 3.297, "atom1_id": "///A/16/O2'", "atom2_id": "///A/18/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 493, "atom2_serNum": 600, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///A/16/O2'", "atom2_id": "///A/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 501, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/16/N1", "atom2_id": "///A/19/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 503, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 2.333, "atom1_id": "///A/16/N2", "atom2_id": "///A/19/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 503, "atom2_serNum": 597, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/16/N2", "atom2_id": "///A/19/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 560, "atom2_serNum": 586, "donAcc_type": "acceptable", "distance": 2.225, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 560, "atom2_serNum": 589, "donAcc_type": "acceptable", "distance": 2.264, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 626, "atom2_serNum": 653, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/20/O2'", "atom2_id": "///A/21/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 657, "atom2_serNum": 684, "donAcc_type": "acceptable", "distance": 2.213, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 657, "atom2_serNum": 687, "donAcc_type": "acceptable", "distance": 2.415, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 718, "atom2_serNum": 1127, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/23/O5'", "atom2_id": "///A/36/NH1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 68, "atom1_serNum": 721, "atom2_serNum": 1127, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/23/O4'", "atom2_id": "///A/36/NH1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 69, "atom1_serNum": 730, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/23/N3", "atom2_id": "///A/26/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 732, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///A/23/O4", "atom2_id": "///A/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 755, "atom2_serNum": 777, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///A/24/O2'", "atom2_id": "///A/25/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 790, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 2.457, "atom1_id": "///A/25/N7", "atom2_id": "///A/36/NH2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 73, "atom1_serNum": 793, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/25/O6", "atom2_id": "///A/36/NH2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 74, "atom1_serNum": 860, "atom2_serNum": 1104, "donAcc_type": "questionable", "distance": 2.511, "atom1_id": "///A/27/O4", "atom2_id": "///A/35/O", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 75, "atom1_serNum": 890, "atom2_serNum": 1103, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/28/N4", "atom2_id": "///A/35/OXT", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 76, "atom1_serNum": 948, "atom2_serNum": 972, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///A/30/O2'", "atom2_id": "///A/31/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 979, "atom2_serNum": 1002, "donAcc_type": "acceptable", "distance": 2.208, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 979, "atom2_serNum": 1005, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1nbk", "num_naChains": 1, "naChains": "A=36", "num_atoms": 1146, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }