{ "num_pairs": 24, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.192, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.587, "chi2": -147.443, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.917, "C1C1_dist": 10.255, "N1N9_dist": 8.911, "C6C8_dist": 10.202, "CNNC_torsion": -18.959, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.09],O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[3.35]", "interBase_angle": 17.820, "planarity": 0.247, "simple_Shear": 1.420, "simple_Stretch": 0.375, "simple_Buckle": 3.589, "simple_Propeller": -17.455, "bp_simpleParams": [ 1.420, 0.375, 0.630, 3.589, -17.455, 16.828 ], "bp_params": [ 1.458, 0.178, 0.630, 1.148, -17.783, 17.029 ], "frame": { "rmsd": null, "origin": [ 1.567, -15.898, 31.215 ], "x_axis": [ -0.011, -0.993, 0.120 ], "y_axis": [ 0.197, -0.120, -0.973 ], "z_axis": [ 0.980, 0.013, 0.197 ], "quaternion": [ 0.516, -0.477, 0.417, -0.576 ] } }, { "index": 2, "nt1": "///C/2", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.542, "chi2": -158.170, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 70.260, "C1C1_dist": 10.201, "N1N9_dist": 8.691, "C6C8_dist": 9.738, "CNNC_torsion": -15.502, "hbonds_num": 3, "hbonds_desc": "N6(amino)*N3(imino)[3.00],N1*O2(carbonyl)[2.55],N1-N3(imino)[3.42]", "unusual_base2base_hbonds": 2, "interBase_angle": 18.732, "planarity": 0.228, "simple_Shear": -2.126, "simple_Stretch": 0.057, "simple_Buckle": 5.318, "simple_Propeller": -17.961, "bp_simpleParams": [ -2.126, 0.057, 0.475, 5.318, -17.961, 6.043 ], "bp_params": [ -2.089, -0.401, 0.475, 9.015, -16.420, 6.087 ], "frame": { "rmsd": null, "origin": [ 4.024, -14.963, 33.514 ], "x_axis": [ -0.161, -0.949, -0.270 ], "y_axis": [ 0.139, 0.249, -0.959 ], "z_axis": [ 0.977, -0.192, 0.092 ], "quaternion": [ 0.543, -0.353, 0.574, -0.501 ] } }, { "index": 3, "nt1": "///C/3", "nt2": "///C/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.725, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.483, "chi2": -164.947, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.258, "C1C1_dist": 11.165, "N1N9_dist": 9.393, "C6C8_dist": 10.150, "CNNC_torsion": -16.848, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*N1[2.56]", "interBase_angle": 37.817, "planarity": 0.411, "simple_Shear": -2.037, "simple_Stretch": 0.560, "simple_Buckle": 12.536, "simple_Propeller": -35.678, "bp_simpleParams": [ -2.037, 0.560, -0.612, 12.536, -35.678, -4.615 ], "bp_params": [ -2.112, 0.064, -0.612, 20.309, -31.900, -4.730 ], "frame": { "rmsd": null, "origin": [ 6.654, -16.168, 35.016 ], "x_axis": [ -0.097, -0.668, -0.738 ], "y_axis": [ 0.312, 0.684, -0.659 ], "z_axis": [ 0.945, -0.294, 0.143 ], "quaternion": [ 0.658, -0.139, 0.640, -0.373 ] } }, { "index": 4, "nt1": "///C/4", "nt2": "///C/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.086, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.140, "chi2": -156.899, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.064, "C1C1_dist": 10.537, "N1N9_dist": 8.911, "C6C8_dist": 9.933, "CNNC_torsion": -6.219, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.94]", "interBase_angle": 10.979, "planarity": 0.129, "simple_Shear": 1.176, "simple_Stretch": 0.067, "simple_Buckle": -5.237, "simple_Propeller": -9.649, "bp_simpleParams": [ 1.176, 0.067, -0.134, -5.237, -9.649, 3.521 ], "bp_params": [ 1.175, -0.081, -0.134, -6.403, -8.918, 3.526 ], "frame": { "rmsd": null, "origin": [ 10.430, -18.388, 35.344 ], "x_axis": [ -0.144, 0.118, -0.982 ], "y_axis": [ 0.300, 0.951, 0.070 ], "z_axis": [ 0.943, -0.284, -0.173 ], "quaternion": [ 0.639, 0.139, 0.753, -0.071 ] } }, { "index": 5, "nt1": "///C/5", "nt2": "///C/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.915, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.882, "chi2": -173.200, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.798, "C1C1_dist": 10.788, "N1N9_dist": 9.002, "C6C8_dist": 9.846, "CNNC_torsion": -4.183, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.07],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 6.674, "planarity": 0.077, "simple_Shear": 0.791, "simple_Stretch": -0.146, "simple_Buckle": 3.760, "simple_Propeller": -5.513, "bp_simpleParams": [ 0.791, -0.146, -0.028, 3.760, -5.513, -3.798 ], "bp_params": [ 0.778, -0.204, -0.028, 3.340, -5.778, -3.801 ], "frame": { "rmsd": null, "origin": [ 12.926, -20.517, 34.367 ], "x_axis": [ -0.018, 0.610, -0.792 ], "y_axis": [ 0.354, 0.745, 0.565 ], "z_axis": [ 0.935, -0.270, -0.230 ], "quaternion": [ 0.612, 0.342, 0.706, 0.104 ] } }, { "index": 6, "nt1": "///C/6", "nt2": "///C/24", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -171.200, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 81.295, "chi2": -174.783, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 8.356, "C1C1_dist": 10.461, "N1N9_dist": 8.878, "C6C8_dist": 9.279, "CNNC_torsion": 103.769, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[2.78]", "interBase_angle": 13.898, "planarity": 0.228, "simple_Shear": 6.673, "simple_Stretch": 1.851, "simple_Buckle": 13.519, "simple_Propeller": -3.223, "bp_simpleParams": [ 6.673, 1.851, -1.292, 13.519, -3.223, -20.848 ], "bp_params": [ 6.199, -3.086, -1.292, 7.908, -11.428, -20.902 ], "frame": { "rmsd": null, "origin": [ 15.196, -22.397, 31.812 ], "x_axis": [ 0.326, 0.924, -0.198 ], "y_axis": [ 0.365, 0.071, 0.928 ], "z_axis": [ 0.872, -0.375, -0.315 ], "quaternion": [ 0.520, 0.626, 0.515, 0.269 ] } }, { "index": 7, "nt1": "///C/9", "nt2": "///C/22", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -168.372, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 20.461, "chi2": -140.027, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 115.020, "C1C1_dist": 8.232, "N1N9_dist": 7.559, "C6C8_dist": 8.141, "CNNC_torsion": -72.792, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.24],N6(amino)-N3[3.13]", "interBase_angle": 37.524, "planarity": 0.597, "simple_Shear": -7.437, "simple_Stretch": 2.540, "simple_Buckle": -22.783, "simple_Propeller": 29.815, "bp_simpleParams": [ -7.437, 2.540, 1.136, -22.783, 29.815, 14.928 ], "bp_params": [ -6.481, -4.445, 1.136, -37.523, -0.268, 14.143 ], "frame": { "rmsd": null, "origin": [ 18.073, -23.850, 17.946 ], "x_axis": [ 0.899, 0.128, -0.419 ], "y_axis": [ 0.291, -0.890, 0.352 ], "z_axis": [ -0.328, -0.438, -0.837 ], "quaternion": [ 0.207, 0.952, 0.110, -0.196 ] } }, { "index": 8, "nt1": "///C/10", "nt2": "///C/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.317, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.951, "chi2": -150.677, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.748, "C1C1_dist": 9.763, "N1N9_dist": 8.474, "C6C8_dist": 9.721, "CNNC_torsion": 4.986, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.65],N1-N3(imino)[2.99]", "interBase_angle": 32.387, "planarity": 0.384, "simple_Shear": -0.547, "simple_Stretch": 0.269, "simple_Buckle": -31.683, "simple_Propeller": 6.714, "bp_simpleParams": [ -0.547, 0.269, -0.231, -31.683, 6.714, 16.951 ], "bp_params": [ -0.562, 0.237, -0.231, -32.035, 4.756, 16.317 ], "frame": { "rmsd": null, "origin": [ 16.844, -25.318, 15.355 ], "x_axis": [ 0.811, -0.525, 0.257 ], "y_axis": [ -0.582, -0.686, 0.437 ], "z_axis": [ -0.053, -0.504, -0.862 ], "quaternion": [ 0.257, 0.916, -0.302, 0.056 ] } }, { "index": 9, "nt1": "///C/11", "nt2": "///C/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.652, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.662, "chi2": -157.114, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.551, "C1C1_dist": 10.397, "N1N9_dist": 8.723, "C6C8_dist": 9.693, "CNNC_torsion": -6.314, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.68]", "interBase_angle": 11.426, "planarity": 0.138, "simple_Shear": 0.500, "simple_Stretch": -0.210, "simple_Buckle": -8.372, "simple_Propeller": -7.776, "bp_simpleParams": [ 0.500, -0.210, 0.006, -8.372, -7.776, 1.119 ], "bp_params": [ 0.487, -0.239, 0.006, -8.811, -7.276, 1.118 ], "frame": { "rmsd": null, "origin": [ 18.630, -25.443, 12.142 ], "x_axis": [ 0.535, -0.709, 0.459 ], "y_axis": [ -0.841, -0.502, 0.204 ], "z_axis": [ 0.086, -0.495, -0.864 ], "quaternion": [ 0.205, 0.852, -0.455, 0.160 ] } }, { "index": 10, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.118, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.132, "chi2": -158.107, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.803, "C1C1_dist": 10.655, "N1N9_dist": 8.976, "C6C8_dist": 9.957, "CNNC_torsion": -13.811, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[3.12]", "interBase_angle": 12.138, "planarity": 0.168, "simple_Shear": 0.345, "simple_Stretch": -0.056, "simple_Buckle": -7.626, "simple_Propeller": -9.443, "bp_simpleParams": [ 0.345, -0.056, 0.548, -7.626, -9.443, 1.940 ], "bp_params": [ 0.343, -0.067, 0.548, -7.925, -9.194, 1.942 ], "frame": { "rmsd": null, "origin": [ 19.954, -27.033, 9.486 ], "x_axis": [ 0.015, -0.787, 0.617 ], "y_axis": [ -0.998, -0.054, -0.045 ], "z_axis": [ 0.068, -0.615, -0.786 ], "quaternion": [ 0.209, 0.681, -0.655, 0.252 ] } }, { "index": 11, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.449, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.020, "chi2": -167.397, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.739, "C1C1_dist": 10.349, "N1N9_dist": 8.762, "C6C8_dist": 9.692, "CNNC_torsion": -8.382, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.71],N3(imino)-O6(carbonyl)[2.84]", "interBase_angle": 10.392, "planarity": 0.164, "simple_Shear": 2.529, "simple_Stretch": 0.025, "simple_Buckle": 9.827, "simple_Propeller": -3.379, "bp_simpleParams": [ 2.529, 0.025, 0.291, 9.827, -3.379, 0.317 ], "bp_params": [ 2.457, -0.602, 0.291, 8.689, -5.700, 0.316 ], "frame": { "rmsd": null, "origin": [ 21.074, -28.852, 7.230 ], "x_axis": [ -0.606, -0.670, 0.429 ], "y_axis": [ -0.792, 0.457, -0.405 ], "z_axis": [ 0.076, -0.585, -0.807 ], "quaternion": [ -0.104, -0.431, 0.847, -0.292 ] } }, { "index": 12, "nt1": "///C/14", "nt2": "///C/17", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": ".SH", "DSSR": ".m-M", "intra_chain": true, "chi1": -134.811, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 117.727, "chi2": -130.382, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 25.946, "C1C1_dist": 8.529, "N1N9_dist": 7.932, "C6C8_dist": 8.751, "CNNC_torsion": -36.685, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[2.60]", "interBase_angle": 33.877, "planarity": 0.532, "simple_Shear": 6.833, "simple_Stretch": 2.517, "simple_Buckle": 22.983, "simple_Propeller": 24.889, "bp_simpleParams": [ 6.833, 2.517, 0.993, 22.983, 24.889, 26.308 ], "bp_params": [ 6.455, -3.370, 0.993, 33.876, -0.262, 25.204 ], "frame": { "rmsd": null, "origin": [ 20.681, -30.976, 5.101 ], "x_axis": [ -0.940, -0.248, 0.234 ], "y_axis": [ -0.341, 0.681, -0.648 ], "z_axis": [ 0.001, -0.689, -0.725 ], "quaternion": [ -0.064, -0.161, 0.915, -0.365 ] } }, { "index": 13, "nt1": "///D/1", "nt2": "///D/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.743, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.799, "chi2": -146.673, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.038, "C1C1_dist": 10.735, "N1N9_dist": 8.991, "C6C8_dist": 9.886, "CNNC_torsion": 0.751, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 11.033, "planarity": 0.138, "simple_Shear": 0.174, "simple_Stretch": -0.098, "simple_Buckle": -10.896, "simple_Propeller": 1.732, "bp_simpleParams": [ 0.174, -0.098, 0.124, -10.896, 1.732, -1.528 ], "bp_params": [ 0.173, -0.101, 0.124, -10.875, 1.860, -1.521 ], "frame": { "rmsd": null, "origin": [ 22.996, 0.080, 45.082 ], "x_axis": [ -0.328, 0.919, 0.221 ], "y_axis": [ 0.834, 0.391, -0.390 ], "z_axis": [ -0.444, 0.056, -0.894 ], "quaternion": [ -0.206, 0.542, 0.808, -0.103 ] } }, { "index": 14, "nt1": "///D/2", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.482, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.792, "chi2": -154.151, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.338, "C1C1_dist": 10.687, "N1N9_dist": 8.926, "C6C8_dist": 9.814, "CNNC_torsion": -9.601, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.85]", "interBase_angle": 16.598, "planarity": 0.202, "simple_Shear": -0.043, "simple_Stretch": -0.112, "simple_Buckle": -7.630, "simple_Propeller": -14.740, "bp_simpleParams": [ -0.043, -0.112, 0.037, -7.630, -14.740, -2.327 ], "bp_params": [ -0.044, -0.112, 0.037, -7.669, -14.720, -2.341 ], "frame": { "rmsd": null, "origin": [ 19.927, -0.564, 43.081 ], "x_axis": [ 0.266, 0.942, 0.204 ], "y_axis": [ 0.881, -0.151, -0.449 ], "z_axis": [ -0.392, 0.299, -0.870 ], "quaternion": [ -0.247, 0.756, 0.603, -0.062 ] } }, { "index": 15, "nt1": "///D/3", "nt2": "///D/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.392, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.206, "chi2": -156.990, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.222, "C1C1_dist": 10.582, "N1N9_dist": 8.876, "C6C8_dist": 9.823, "CNNC_torsion": -22.362, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 26.841, "planarity": 0.326, "simple_Shear": -0.163, "simple_Stretch": -0.119, "simple_Buckle": 4.920, "simple_Propeller": -26.387, "bp_simpleParams": [ -0.163, -0.119, 0.148, 4.920, -26.387, 0.254 ], "bp_params": [ -0.160, -0.123, 0.148, 5.529, -26.266, 0.261 ], "frame": { "rmsd": null, "origin": [ 18.371, 1.373, 41.261 ], "x_axis": [ 0.732, 0.681, 0.005 ], "y_axis": [ 0.568, -0.607, -0.556 ], "z_axis": [ -0.376, 0.410, -0.831 ], "quaternion": [ -0.271, 0.890, 0.351, -0.104 ] } }, { "index": 16, "nt1": "///D/4", "nt2": "///D/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.573, "chi2": -165.590, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.906, "C1C1_dist": 10.381, "N1N9_dist": 8.798, "C6C8_dist": 9.838, "CNNC_torsion": -13.672, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.80]", "interBase_angle": 13.687, "planarity": 0.174, "simple_Shear": 0.167, "simple_Stretch": -0.104, "simple_Buckle": 3.778, "simple_Propeller": -13.155, "bp_simpleParams": [ 0.167, -0.104, 0.299, 3.778, -13.155, 3.729 ], "bp_params": [ 0.165, -0.107, 0.299, 3.499, -13.232, 3.752 ], "frame": { "rmsd": null, "origin": [ 17.131, 4.092, 39.230 ], "x_axis": [ 0.964, 0.155, -0.214 ], "y_axis": [ 0.035, -0.877, -0.479 ], "z_axis": [ -0.262, 0.455, -0.851 ], "quaternion": [ -0.243, 0.961, 0.049, -0.124 ] } }, { "index": 17, "nt1": "///D/5", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.917, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.769, "chi2": 171.835, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.897, "C1C1_dist": 10.852, "N1N9_dist": 9.081, "C6C8_dist": 9.960, "CNNC_torsion": -10.510, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.94],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 11.507, "planarity": 0.152, "simple_Shear": 0.112, "simple_Stretch": -0.064, "simple_Buckle": 4.682, "simple_Propeller": -10.512, "bp_simpleParams": [ 0.112, -0.064, 0.175, 4.682, -10.512, -2.612 ], "bp_params": [ 0.112, -0.064, 0.175, 4.622, -10.538, -2.621 ], "frame": { "rmsd": null, "origin": [ 17.372, 6.751, 36.827 ], "x_axis": [ 0.804, -0.403, -0.438 ], "y_axis": [ -0.565, -0.748, -0.348 ], "z_axis": [ -0.187, 0.527, -0.829 ], "quaternion": [ -0.238, 0.919, -0.263, -0.170 ] } }, { "index": 18, "nt1": "///D/6", "nt2": "///D/24", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -174.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 81.182, "chi2": -166.966, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.163, "C1C1_dist": 10.343, "N1N9_dist": 8.750, "C6C8_dist": 9.149, "CNNC_torsion": -173.736, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[2.57]", "interBase_angle": 15.636, "planarity": 0.193, "simple_Shear": 6.764, "simple_Stretch": 1.863, "simple_Buckle": 15.377, "simple_Propeller": -2.835, "bp_simpleParams": [ 6.764, 1.863, -0.828, 15.377, -2.835, -21.256 ], "bp_params": [ 6.236, -3.215, -0.828, 9.397, -12.497, -21.311 ], "frame": { "rmsd": null, "origin": [ 17.994, 10.538, 35.147 ], "x_axis": [ 0.233, -0.762, -0.604 ], "y_axis": [ -0.956, -0.292, -0.001 ], "z_axis": [ -0.176, 0.578, -0.797 ], "quaternion": [ -0.190, 0.762, -0.564, -0.256 ] } }, { "index": 19, "nt1": "///D/9", "nt2": "///D/22", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -163.448, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 22.464, "chi2": -143.892, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 111.670, "C1C1_dist": 8.198, "N1N9_dist": 7.478, "C6C8_dist": 8.137, "CNNC_torsion": -76.592, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.17],N6(amino)-N3[3.02]", "interBase_angle": 34.824, "planarity": 0.564, "simple_Shear": -7.433, "simple_Stretch": 2.282, "simple_Buckle": -30.722, "simple_Propeller": 16.397, "bp_simpleParams": [ -7.433, 2.282, 1.365, -30.722, 16.397, 15.608 ], "bp_params": [ -6.439, -4.359, 1.365, -31.935, -13.887, 15.131 ], "frame": { "rmsd": null, "origin": [ 27.967, 17.455, 27.558 ], "x_axis": [ -0.078, 0.227, -0.971 ], "y_axis": [ -0.594, 0.771, 0.228 ], "z_axis": [ 0.801, 0.594, 0.075 ], "quaternion": [ 0.665, -0.138, 0.666, 0.309 ] } }, { "index": 20, "nt1": "///D/10", "nt2": "///D/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.733, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.755, "chi2": -161.944, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.310, "C1C1_dist": 10.097, "N1N9_dist": 8.612, "C6C8_dist": 9.725, "CNNC_torsion": 7.409, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[2.76]", "interBase_angle": 17.614, "planarity": 0.235, "simple_Shear": 0.003, "simple_Stretch": -0.126, "simple_Buckle": -14.409, "simple_Propeller": 10.131, "bp_simpleParams": [ 0.003, -0.126, 0.112, -14.409, 10.131, 7.829 ], "bp_params": [ 0.003, -0.126, 0.112, -14.415, 10.123, 7.798 ], "frame": { "rmsd": null, "origin": [ 30.465, 19.156, 28.272 ], "x_axis": [ -0.665, 0.655, -0.358 ], "y_axis": [ -0.228, 0.278, 0.933 ], "z_axis": [ 0.711, 0.702, -0.036 ], "quaternion": [ 0.380, 0.152, 0.703, 0.581 ] } }, { "index": 21, "nt1": "///D/11", "nt2": "///D/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.357, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.529, "chi2": -153.654, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.313, "C1C1_dist": 10.269, "N1N9_dist": 8.690, "C6C8_dist": 9.760, "CNNC_torsion": -5.386, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.72]", "interBase_angle": 7.090, "planarity": 0.090, "simple_Shear": 0.027, "simple_Stretch": -0.179, "simple_Buckle": -1.091, "simple_Propeller": -7.006, "bp_simpleParams": [ 0.027, -0.179, -0.147, -1.091, -7.006, 5.478 ], "bp_params": [ 0.025, -0.179, -0.147, -1.150, -6.997, 5.488 ], "frame": { "rmsd": null, "origin": [ 31.901, 21.423, 25.623 ], "x_axis": [ -0.797, 0.602, -0.045 ], "y_axis": [ 0.098, 0.202, 0.974 ], "z_axis": [ 0.596, 0.772, -0.220 ], "quaternion": [ 0.215, 0.235, 0.745, 0.586 ] } }, { "index": 22, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.981, "chi2": -156.154, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.981, "C1C1_dist": 10.642, "N1N9_dist": 8.961, "C6C8_dist": 9.950, "CNNC_torsion": -9.914, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 13.669, "planarity": 0.181, "simple_Shear": 0.243, "simple_Stretch": -0.073, "simple_Buckle": 0.539, "simple_Propeller": -13.659, "bp_simpleParams": [ 0.243, -0.073, -0.146, 0.539, -13.659, 2.943 ], "bp_params": [ 0.242, -0.078, -0.146, 0.271, -13.667, 2.964 ], "frame": { "rmsd": null, "origin": [ 33.408, 23.882, 24.012 ], "x_axis": [ -0.672, 0.526, 0.521 ], "y_axis": [ 0.547, -0.123, 0.828 ], "z_axis": [ 0.500, 0.841, -0.205 ], "quaternion": [ -0.008, 0.405, 0.662, 0.630 ] } }, { "index": 23, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.445, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.089, "chi2": -167.117, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.073, "C1C1_dist": 10.813, "N1N9_dist": 9.188, "C6C8_dist": 10.115, "CNNC_torsion": 1.139, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.27],N3(imino)-O6(carbonyl)[3.37]", "interBase_angle": 17.106, "planarity": 0.187, "simple_Shear": 1.837, "simple_Stretch": 0.368, "simple_Buckle": 17.104, "simple_Propeller": -0.294, "bp_simpleParams": [ 1.837, 0.368, -0.569, 17.104, -0.294, 0.292 ], "bp_params": [ 1.873, 0.033, -0.569, 16.775, -3.350, 0.289 ], "frame": { "rmsd": null, "origin": [ 34.304, 26.547, 22.822 ], "x_axis": [ -0.215, 0.343, 0.914 ], "y_axis": [ 0.860, -0.377, 0.344 ], "z_axis": [ 0.463, 0.860, -0.214 ], "quaternion": [ -0.220, 0.587, 0.513, 0.587 ] } }, { "index": 24, "nt1": "///D/14", "nt2": "///D/18", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -134.552, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 122.525, "chi2": -167.117, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.550, "C1C1_dist": 8.678, "N1N9_dist": 8.491, "C6C8_dist": 9.807, "CNNC_torsion": -36.338, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O6(carbonyl)[2.93]", "interBase_angle": 56.836, "planarity": 0.870, "simple_Shear": 5.149, "simple_Stretch": 3.614, "simple_Buckle": 55.785, "simple_Propeller": 10.878, "bp_simpleParams": [ 5.149, 3.614, 2.503, 55.785, 10.878, 59.100 ], "bp_params": [ 6.286, -0.233, 2.503, 50.641, -25.803, 55.606 ], "frame": { "rmsd": null, "origin": [ 35.436, 28.478, 24.505 ], "x_axis": [ 0.242, 0.252, 0.937 ], "y_axis": [ 0.961, -0.195, -0.195 ], "z_axis": [ 0.133, 0.948, -0.289 ], "quaternion": [ -0.435, 0.657, 0.462, 0.407 ] } } ], "num_helices": 4, "helices": [ { "index": 1, "num_stems": 1, "strand1": "CAUACU", "strand2": "GUAUGC", "bp_type": "|||||.", "helix_form": "...A.", "helical_rise": 2.582, "helical_rise_std": 0.157, "helical_radius": 8.815, "helical_radius_std": 0.449, "helical_axis": [ 0.990, 0.034, -0.139 ], "point1": [ 2.084, -18.198, 32.589 ], "point2": [ 14.640, -17.765, 30.823 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.458, 0.178, 0.630, 1.148, -17.783, 17.029 ], "step_params": [ -1.303, -1.834, 2.671, -5.190, 12.169, 21.033 ], "heli_params": [ -6.906, 1.910, 1.649, 29.831, 12.723, 24.808 ], "bp2_params": [ -2.089, -0.401, 0.475, 9.015, -16.420, 6.087 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.671, "simple_Twist": 41.331, "simple_hRise": 2.211, "simple_hTwist": 43.308 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.089, -0.401, 0.475, 9.015, -16.420, 6.087 ], "step_params": [ -0.169, -1.260, 3.002, 5.740, 3.656, 31.790 ], "heli_params": [ -2.823, 1.200, 2.771, 6.581, -10.332, 32.492 ], "bp2_params": [ -2.112, 0.064, -0.612, 20.309, -31.900, -4.730 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.002, "simple_Twist": 31.993, "simple_hRise": 2.773, "simple_hTwist": 32.690 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.112, 0.064, -0.612, 20.309, -31.900, -4.730 ], "step_params": [ -0.043, -1.089, 4.255, -6.347, 17.001, 45.816 ], "heli_params": [ -2.916, -0.548, 3.635, 20.898, 7.802, 49.099 ], "bp2_params": [ 1.175, -0.081, -0.134, -6.403, -8.918, 3.526 ], "groove_widths": [ 17.058, null, 14.626, null ], "simple_Rise": 4.255, "simple_Twist": 26.892, "simple_hRise": 2.999, "simple_hTwist": 32.349 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.175, -0.081, -0.134, -6.403, -8.918, 3.526 ], "step_params": [ -0.119, -1.375, 3.133, 0.524, 3.357, 31.313 ], "heli_params": [ -3.120, 0.311, 2.971, 6.197, -0.968, 31.493 ], "bp2_params": [ 0.778, -0.204, -0.028, 3.340, -5.778, -3.801 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.133, "simple_Twist": 33.804, "simple_hRise": 2.984, "simple_hTwist": 33.969 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.778, -0.204, -0.028, 3.340, -5.778, -3.801 ], "step_params": [ 0.088, -1.976, 3.362, 7.983, -2.965, 44.377 ], "heli_params": [ -2.295, 0.636, 3.446, -3.884, -10.454, 45.146 ], "bp2_params": [ 6.199, -3.086, -1.292, 7.908, -11.428, -20.902 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.362, "simple_Twist": 12.275, "simple_hRise": 3.205, "simple_hTwist": 14.931 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/24", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 2, "num_stems": 1, "strand1": "AAACUG", "strand2": "GUUGGA", "bp_type": ".||||.", "helix_form": "..A..", "helical_rise": 3.673, "helical_rise_std": 0.339, "helical_radius": 9.313, "helical_radius_std": 1.813, "helical_axis": [ 0.030, -0.549, -0.835 ], "point1": [ 18.589, -22.079, 19.706 ], "point2": [ 19.143, -32.387, 4.023 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///C/9", "nt2": "///C/22", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.481, -4.445, 1.136, -37.523, -0.268, 14.143 ], "step_params": [ -0.621, 0.123, 3.159, -0.118, 16.304, 54.125 ], "heli_params": [ -0.769, 0.652, 3.078, 17.477, 0.126, 56.349 ], "bp2_params": [ -0.562, 0.237, -0.231, -32.035, 4.756, 16.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.159, "simple_Twist": 5.834, "simple_hRise": 1.189, "simple_hTwist": 17.310 }, { "index": 2, "nt1": "///C/10", "nt2": "///C/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.562, 0.237, -0.231, -32.035, 4.756, 16.317 ], "step_params": [ 0.103, -2.295, 2.872, 6.119, 5.104, 21.852 ], "heli_params": [ -7.113, 1.440, 2.231, 12.924, -15.493, 23.243 ], "bp2_params": [ 0.487, -0.239, 0.006, -8.811, -7.276, 1.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.872, "simple_Twist": 15.495, "simple_hRise": 1.925, "simple_hTwist": 17.412 }, { "index": 3, "nt1": "///C/11", "nt2": "///C/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.487, -0.239, 0.006, -8.811, -7.276, 1.118 ], "step_params": [ 0.154, -1.083, 3.184, -3.307, 7.561, 30.988 ], "heli_params": [ -3.234, -0.834, 2.817, 13.846, 6.055, 32.042 ], "bp2_params": [ 0.343, -0.067, 0.548, -7.925, -9.194, 1.942 ], "groove_widths": [ 17.812, null, 22.326, null ], "simple_Rise": 3.184, "simple_Twist": 31.895, "simple_hRise": 2.831, "simple_hTwist": 32.918 }, { "index": 4, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.067, 0.548, -7.925, -9.194, 1.942 ], "step_params": [ -0.194, -0.893, 2.970, -0.248, -2.116, 38.433 ], "heli_params": [ -1.115, 0.265, 3.014, -3.212, 0.377, 38.490 ], "bp2_params": [ 2.457, -0.602, 0.291, 8.689, -5.700, 0.316 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.970, "simple_Twist": 26.703, "simple_hRise": 3.032, "simple_hTwist": 26.787 }, { "index": 5, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.457, -0.602, 0.291, 8.689, -5.700, 0.316 ], "step_params": [ 0.571, 0.081, 2.977, 3.589, 7.912, 32.316 ], "heli_params": [ -1.068, -0.444, 2.959, 13.904, -6.307, 33.433 ], "bp2_params": [ 6.455, -3.370, 0.993, 33.876, -0.262, 25.204 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.977, "simple_Twist": -3.519, "simple_hRise": 0.832, "simple_hTwist": -9.372 }, { "index": 6, "nt1": "///C/14", "nt2": "///C/17", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": ".SH", "DSSR": ".m-M" } ] }, { "index": 3, "num_stems": 1, "strand1": "CAUACU", "strand2": "GUAUGC", "bp_type": "|||||.", "helix_form": "AAAA.", "helical_rise": 2.380, "helical_rise_std": 0.292, "helical_radius": 9.089, "helical_radius_std": 0.532, "helical_axis": [ -0.103, 0.128, -0.986 ], "point1": [ 21.597, 3.755, 46.036 ], "point2": [ 20.394, 5.247, 34.500 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, -0.101, 0.124, -10.875, 1.860, -1.521 ], "step_params": [ -0.949, -2.048, 2.956, -3.836, 13.773, 31.790 ], "heli_params": [ -5.102, 1.121, 2.021, 23.704, 6.602, 34.781 ], "bp2_params": [ -0.044, -0.112, 0.037, -7.669, -14.720, -2.341 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.956, "simple_Twist": 32.608, "simple_hRise": 2.047, "simple_hTwist": 35.527 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.112, 0.037, -7.669, -14.720, -2.341 ], "step_params": [ 0.611, -1.032, 2.837, 2.997, 6.153, 32.580 ], "heli_params": [ -2.672, -0.643, 2.648, 10.818, -5.270, 33.272 ], "bp2_params": [ -0.160, -0.123, 0.148, 5.529, -26.266, 0.261 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.837, "simple_Twist": 33.804, "simple_hRise": 2.657, "simple_hTwist": 34.470 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.160, -0.123, 0.148, 5.529, -26.266, 0.261 ], "step_params": [ 0.318, -1.470, 3.286, -0.693, 7.063, 35.169 ], "heli_params": [ -3.361, -0.612, 2.939, 11.544, 1.133, 35.855 ], "bp2_params": [ 0.165, -0.107, 0.299, 3.499, -13.232, 3.752 ], "groove_widths": [ 16.984, null, 15.577, null ], "simple_Rise": 3.286, "simple_Twist": 33.360, "simple_hRise": 2.916, "simple_hTwist": 34.086 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.107, 0.299, 3.499, -13.232, 3.752 ], "step_params": [ 0.652, -1.324, 3.274, 5.313, 3.017, 36.193 ], "heli_params": [ -2.516, -0.309, 3.218, 4.814, -8.477, 36.688 ], "bp2_params": [ 0.112, -0.064, 0.175, 4.622, -10.538, -2.621 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 36.403, "simple_hRise": 3.218, "simple_hTwist": 36.895 }, { "index": 5, "nt1": "///D/5", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.064, 0.175, 4.622, -10.538, -2.621 ], "step_params": [ -1.102, -2.266, 3.347, 2.452, -2.482, 40.531 ], "heli_params": [ -2.976, 1.866, 3.405, -3.575, -3.532, 40.674 ], "bp2_params": [ 6.236, -3.215, -0.828, 9.397, -12.497, -21.311 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.347, "simple_Twist": 4.254, "simple_hRise": 3.120, "simple_hTwist": 5.502 }, { "index": 6, "nt1": "///D/6", "nt2": "///D/24", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 4, "num_stems": 1, "strand1": "AAACU", "strand2": "GUUGG", "bp_type": ".||||", "helix_form": "..A.", "helical_rise": 3.369, "helical_rise_std": 0.245, "helical_radius": 9.590, "helical_radius_std": 1.550, "helical_axis": [ 0.546, 0.836, -0.054 ], "point1": [ 26.184, 16.258, 25.903 ], "point2": [ 33.639, 27.684, 25.167 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///D/9", "nt2": "///D/22", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.439, -4.359, 1.365, -31.935, -13.887, 15.131 ], "step_params": [ -0.715, 0.178, 3.017, -1.923, 10.060, 55.937 ], "heli_params": [ -0.334, 0.652, 3.026, 10.626, 2.031, 56.792 ], "bp2_params": [ 0.003, -0.126, 0.112, -14.415, 10.123, 7.798 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.017, "simple_Twist": 6.287, "simple_hRise": 1.844, "simple_hTwist": 12.014 }, { "index": 2, "nt1": "///D/10", "nt2": "///D/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.003, -0.126, 0.112, -14.415, 10.123, 7.798 ], "step_params": [ 0.895, -2.147, 2.969, 8.877, 9.662, 17.329 ], "heli_params": [ -8.803, 0.471, 1.790, 27.510, -25.275, 21.705 ], "bp2_params": [ 0.025, -0.179, -0.147, -1.150, -6.997, 5.488 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.969, "simple_Twist": 16.938, "simple_hRise": 1.761, "simple_hTwist": 21.396 }, { "index": 3, "nt1": "///D/11", "nt2": "///D/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.179, -0.147, -1.150, -6.997, 5.488 ], "step_params": [ -0.115, -0.962, 3.158, 0.880, 6.788, 33.371 ], "heli_params": [ -2.657, 0.327, 2.908, 11.668, -1.513, 34.046 ], "bp2_params": [ 0.242, -0.078, -0.146, 0.271, -13.667, 2.964 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.158, "simple_Twist": 32.209, "simple_hRise": 2.896, "simple_hTwist": 32.909 }, { "index": 4, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.242, -0.078, -0.146, 0.271, -13.667, 2.964 ], "step_params": [ -0.116, -0.783, 2.949, 2.170, 1.100, 36.694 ], "heli_params": [ -1.376, 0.449, 2.913, 1.745, -3.443, 36.772 ], "bp2_params": [ 1.873, 0.033, -0.569, 16.775, -3.350, 0.289 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.949, "simple_Twist": 28.074, "simple_hRise": 2.899, "simple_hTwist": 28.177 }, { "index": 5, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CAUAC", "strand2": "GUAUG", "bp_type": "|||||", "helix_form": "...A", "helical_rise": 2.640, "helical_rise_std": 0.150, "helical_radius": 8.988, "helical_radius_std": 0.176, "helical_axis": [ 0.992, 0.028, -0.123 ], "point1": [ 2.016, -18.349, 32.532 ], "point2": [ 12.420, -18.058, 31.243 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.458, 0.178, 0.630, 1.148, -17.783, 17.029 ], "step_params": [ -1.303, -1.834, 2.671, -5.190, 12.169, 21.033 ], "heli_params": [ -6.906, 1.910, 1.649, 29.831, 12.723, 24.808 ], "bp2_params": [ -2.089, -0.401, 0.475, 9.015, -16.420, 6.087 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.671, "simple_Twist": 41.331, "simple_hRise": 2.211, "simple_hTwist": 43.308 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.089, -0.401, 0.475, 9.015, -16.420, 6.087 ], "step_params": [ -0.169, -1.260, 3.002, 5.740, 3.656, 31.790 ], "heli_params": [ -2.823, 1.200, 2.771, 6.581, -10.332, 32.492 ], "bp2_params": [ -2.112, 0.064, -0.612, 20.309, -31.900, -4.730 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.002, "simple_Twist": 31.993, "simple_hRise": 2.773, "simple_hTwist": 32.690 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.112, 0.064, -0.612, 20.309, -31.900, -4.730 ], "step_params": [ -0.043, -1.089, 4.255, -6.347, 17.001, 45.816 ], "heli_params": [ -2.916, -0.548, 3.635, 20.898, 7.802, 49.099 ], "bp2_params": [ 1.175, -0.081, -0.134, -6.403, -8.918, 3.526 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.255, "simple_Twist": 26.892, "simple_hRise": 2.999, "simple_hTwist": 32.349 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.175, -0.081, -0.134, -6.403, -8.918, 3.526 ], "step_params": [ -0.119, -1.375, 3.133, 0.524, 3.357, 31.313 ], "heli_params": [ -3.120, 0.311, 2.971, 6.197, -0.968, 31.493 ], "bp2_params": [ 0.778, -0.204, -0.028, 3.340, -5.778, -3.801 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.133, "simple_Twist": 33.804, "simple_hRise": 2.984, "simple_hTwist": 33.969 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "AACU", "strand2": "UUGG", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 3.526, "helical_rise_std": 0.288, "helical_radius": 9.960, "helical_radius_std": 0.735, "helical_axis": [ 0.023, -0.607, -0.794 ], "point1": [ 20.126, -25.264, 17.674 ], "point2": [ 20.377, -31.800, 9.127 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/10", "nt2": "///C/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.562, 0.237, -0.231, -32.035, 4.756, 16.317 ], "step_params": [ 0.103, -2.295, 2.872, 6.119, 5.104, 21.852 ], "heli_params": [ -7.113, 1.440, 2.231, 12.924, -15.493, 23.243 ], "bp2_params": [ 0.487, -0.239, 0.006, -8.811, -7.276, 1.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.872, "simple_Twist": 15.495, "simple_hRise": 1.925, "simple_hTwist": 17.412 }, { "index": 2, "nt1": "///C/11", "nt2": "///C/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.487, -0.239, 0.006, -8.811, -7.276, 1.118 ], "step_params": [ 0.154, -1.083, 3.184, -3.307, 7.561, 30.988 ], "heli_params": [ -3.234, -0.834, 2.817, 13.846, 6.055, 32.042 ], "bp2_params": [ 0.343, -0.067, 0.548, -7.925, -9.194, 1.942 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.184, "simple_Twist": 31.895, "simple_hRise": 2.831, "simple_hTwist": 32.918 }, { "index": 3, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.067, 0.548, -7.925, -9.194, 1.942 ], "step_params": [ -0.194, -0.893, 2.970, -0.248, -2.116, 38.433 ], "heli_params": [ -1.115, 0.265, 3.014, -3.212, 0.377, 38.490 ], "bp2_params": [ 2.457, -0.602, 0.291, 8.689, -5.700, 0.316 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.970, "simple_Twist": 26.703, "simple_hRise": 3.032, "simple_hTwist": 26.787 }, { "index": 4, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 3, "strand1": "CAUAC", "strand2": "GUAUG", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.408, "helical_rise_std": 0.297, "helical_radius": 8.902, "helical_radius_std": 0.616, "helical_axis": [ -0.111, 0.126, -0.986 ], "point1": [ 21.328, 3.158, 46.000 ], "point2": [ 20.272, 4.353, 36.630 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, -0.101, 0.124, -10.875, 1.860, -1.521 ], "step_params": [ -0.949, -2.048, 2.956, -3.836, 13.773, 31.790 ], "heli_params": [ -5.102, 1.121, 2.021, 23.704, 6.602, 34.781 ], "bp2_params": [ -0.044, -0.112, 0.037, -7.669, -14.720, -2.341 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.956, "simple_Twist": 32.608, "simple_hRise": 2.047, "simple_hTwist": 35.527 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.112, 0.037, -7.669, -14.720, -2.341 ], "step_params": [ 0.611, -1.032, 2.837, 2.997, 6.153, 32.580 ], "heli_params": [ -2.672, -0.643, 2.648, 10.818, -5.270, 33.272 ], "bp2_params": [ -0.160, -0.123, 0.148, 5.529, -26.266, 0.261 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.837, "simple_Twist": 33.804, "simple_hRise": 2.657, "simple_hTwist": 34.470 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.160, -0.123, 0.148, 5.529, -26.266, 0.261 ], "step_params": [ 0.318, -1.470, 3.286, -0.693, 7.063, 35.169 ], "heli_params": [ -3.361, -0.612, 2.939, 11.544, 1.133, 35.855 ], "bp2_params": [ 0.165, -0.107, 0.299, 3.499, -13.232, 3.752 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.286, "simple_Twist": 33.360, "simple_hRise": 2.916, "simple_hTwist": 34.086 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.107, 0.299, 3.499, -13.232, 3.752 ], "step_params": [ 0.652, -1.324, 3.274, 5.313, 3.017, 36.193 ], "heli_params": [ -2.516, -0.309, 3.218, 4.814, -8.477, 36.688 ], "bp2_params": [ 0.112, -0.064, 0.175, 4.622, -10.538, -2.621 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 36.403, "simple_hRise": 3.218, "simple_hTwist": 36.895 }, { "index": 5, "nt1": "///D/5", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 4, "strand1": "AACU", "strand2": "UUGG", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 3.104, "helical_rise_std": 0.261, "helical_radius": 10.419, "helical_radius_std": 0.782, "helical_axis": [ 0.576, 0.817, 0.032 ], "point1": [ 26.372, 20.859, 25.996 ], "point2": [ 31.787, 28.532, 26.298 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///D/10", "nt2": "///D/21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.003, -0.126, 0.112, -14.415, 10.123, 7.798 ], "step_params": [ 0.895, -2.147, 2.969, 8.877, 9.662, 17.329 ], "heli_params": [ -8.803, 0.471, 1.790, 27.510, -25.275, 21.705 ], "bp2_params": [ 0.025, -0.179, -0.147, -1.150, -6.997, 5.488 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.969, "simple_Twist": 16.938, "simple_hRise": 1.761, "simple_hTwist": 21.396 }, { "index": 2, "nt1": "///D/11", "nt2": "///D/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.179, -0.147, -1.150, -6.997, 5.488 ], "step_params": [ -0.115, -0.962, 3.158, 0.880, 6.788, 33.371 ], "heli_params": [ -2.657, 0.327, 2.908, 11.668, -1.513, 34.046 ], "bp2_params": [ 0.242, -0.078, -0.146, 0.271, -13.667, 2.964 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.158, "simple_Twist": 32.209, "simple_hRise": 2.896, "simple_hTwist": 32.909 }, { "index": 3, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.242, -0.078, -0.146, 0.271, -13.667, 2.964 ], "step_params": [ -0.116, -0.783, 2.949, 2.170, 1.100, 36.694 ], "heli_params": [ -1.376, 0.449, 2.913, 1.745, -3.443, 36.772 ], "bp2_params": [ 1.873, 0.033, -0.569, 16.775, -3.350, 0.289 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.949, "simple_Twist": 28.074, "simple_hRise": 2.899, "simple_hTwist": 28.177 }, { "index": 4, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 12, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///C/13,///C/14" }, { "index": 2, "num_nts": 2, "nts_short": "UG", "nts_long": "///C/21,///C/22" }, { "index": 3, "num_nts": 2, "nts_short": "CG", "nts_long": "///C/24,///C/25" }, { "index": 4, "num_nts": 2, "nts_short": "AA", "nts_long": "///D/9,///D/10" }, { "index": 5, "num_nts": 2, "nts_short": "UG", "nts_long": "///D/13,///D/14" }, { "index": 6, "num_nts": 2, "nts_short": "CG", "nts_long": "///D/24,///D/25" }, { "index": 7, "num_nts": 3, "nts_short": "CUU", "nts_long": "///C/5,///C/6,///C/7" }, { "index": 8, "num_nts": 3, "nts_short": "UAG", "nts_long": "///C/15,///C/17,///C/18" }, { "index": 9, "num_nts": 3, "nts_short": "CUU", "nts_long": "///D/5,///D/6,///D/7" }, { "index": 10, "num_nts": 3, "nts_short": "UAG", "nts_long": "///D/15,///D/17,///D/18" }, { "index": 11, "num_nts": 4, "nts_short": "GGAA", "nts_long": "///C/8,///C/23,///C/9,///C/10" }, { "index": 12, "num_nts": 4, "nts_short": "GGGU", "nts_long": "///D/8,///D/23,///D/22,///D/21" } ], "nonStack": { "num_nts": 4, "nts_short": "CACA", "nts_long": "///C/1,///C/16,///D/1,///D/16" }, "num_atom2bases": 5, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///C/23/O4'", "nt": "///C/9", "vert_dist": 3.030 }, { "index": 2, "type": "sugar", "atom": "///C/15/O4'", "nt": "///C/17", "vert_dist": 2.994 }, { "index": 3, "type": "sugar", "atom": "///C/7/O2'", "nt": "///C/24", "vert_dist": 3.288 }, { "index": 4, "type": "sugar", "atom": "///D/23/O4'", "nt": "///D/9", "vert_dist": 3.431 }, { "index": 5, "type": "sugar", "atom": "///D/7/O2'", "nt": "///D/24", "vert_dist": 3.143 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 2 ], "summary": "[1] 4 [C.13 C.18] 4", "num_nts": 6, "nts_short": "UGUAAG", "nts_long": "///C/13,///C/14,///C/15,///C/16,///C/17,///C/18", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUAA", "nts_long": "///C/14,///C/15,///C/16,///C/17" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 4 ], "summary": "[1] 4 [D.13 D.18] 4", "num_nts": 6, "nts_short": "UGUAAG", "nts_long": "///D/13,///D/14,///D/15,///D/16,///D/17,///D/18", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUAA", "nts_long": "///D/14,///D/15,///D/16,///D/17" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 4, 3 ], "stem_indices": [ 1, 2 ], "summary": "[2] 4 3 [C.5 C.25 C.10 C.21] 5 4 k-turn:reverse", "num_nts": 11, "nts_short": "CUUGAAUGGCG", "nts_long": "///C/5,///C/6,///C/7,///C/8,///C/9,///C/10,///C/21,///C/22,///C/23,///C/24,///C/25", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UUGA", "nts_long": "///C/6,///C/7,///C/8,///C/9" }, { "index": 2, "num_nts": 3, "nts_short": "GGC", "nts_long": "///C/22,///C/23,///C/24" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 4, 3 ], "stem_indices": [ 3, 4 ], "summary": "[2] 4 3 [D.5 D.25 D.10 D.21] 5 4 k-turn:reverse", "num_nts": 11, "nts_short": "CUUGAAUGGCG", "nts_long": "///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///D/21,///D/22,///D/23,///D/24,///D/25", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UUGA", "nts_long": "///D/6,///D/7,///D/8,///D/9" }, { "index": 2, "num_nts": 3, "nts_short": "GGC", "nts_long": "///D/22,///D/23,///D/24" } ] } ], "num_Kturns": 2, "Kturns": [ { "index": 1, "type": "REVERSE k-turn [A-G]", "iloop_index": 1, "bounding_stems": [ 1, 2 ], "Cstem_index": 1, "NCstem_index": 2, "Cstem_pair": "C-G (///C/5,///C/25) WC", "NCstem_pair": "A-U (///C/10,///C/21) WC", "GA_pair": "A-G (///C/9,///C/22) Sheared", "bending_angle": 84.031, "strand1": { "num_nts": 13, "nts_short": "CAUACUUGAAACU", "nts_long": "///C/1,///C/2,///C/3,///C/4,///C/5,///C/6,///C/7,///C/8,///C/9,///C/10,///C/11,///C/12,///C/13" }, "strand2": { "num_nts": 12, "nts_short": "GGUUGGCGUAUG", "nts_long": "///C/18,///C/19,///C/20,///C/21,///C/22,///C/23,///C/24,///C/25,///C/26,///C/27,///C/28,///C/29" } }, { "index": 2, "type": "REVERSE k-turn [A-G]", "iloop_index": 2, "bounding_stems": [ 3, 4 ], "Cstem_index": 3, "NCstem_index": 4, "Cstem_pair": "C-G (///D/5,///D/25) WC", "NCstem_pair": "A-U (///D/10,///D/21) WC", "GA_pair": "A-G (///D/9,///D/22) Sheared", "bending_angle": 89.603, "strand1": { "num_nts": 13, "nts_short": "CAUACUUGAAACU", "nts_long": "///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///D/11,///D/12,///D/13" }, "strand2": { "num_nts": 12, "nts_short": "GGUUGGCGUAUG", "nts_long": "///D/18,///D/19,///D/20,///D/21,///D/22,///D/23,///D/24,///D/25,///D/26,///D/27,///D/28,///D/29" } } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///C/15,///C/16" }, { "index": 2, "num_nts": 2, "nts_short": "UA", "nts_long": "///D/15,///D/16" } ], "dbn": { "all_chains": { "num_nts": 58, "num_chars": 59, "bseq": "CAUACUUGAAACUGUAAGGUUGGCGUAUG&CAUACUUGAAACUGUAAGGUUGGCGUAUG", "sstr": "(((((....((((....))))...)))))&(((((....((((....))))...)))))", "form": ".A.A.A....AA.....AAA....A.AA-&AAAA.A....A......AAA....AAAA-" }, "chain_C": { "num_nts": 29, "num_chars": 29, "bseq": "CAUACUUGAAACUGUAAGGUUGGCGUAUG", "sstr": "(((((....((((....))))...)))))", "form": ".A.A.A....AA.....AAA....A.AA-" }, "chain_D": { "num_nts": 29, "num_chars": 29, "bseq": "CAUACUUGAAACUGUAAGGUUGGCGUAUG", "sstr": "(((((....((((....))))...)))))", "form": "AAAA.A....A......AAA....AAAA-" } }, "chains": { "chain_C": { "num_nts": 29, "bseq": "CAUACUUGAAACUGUAAGGUUGGCGUAUG", "sstr": "(((((....((((....))))...)))))", "form": ".A.A.A....AA.....AAA....A.AA-", "helical_rise": 0.045, "helical_rise_std": 2.169, "helical_axis": [ 0.519, 0.855, -0.008 ], "point1": [ 23.623, -26.988, 19.116 ], "point2": [ 24.336, -25.815, 19.105 ], "num_chars": 85, "suite": "C1aA1cU1aA1aC1cU1aU!!G1eA1aA!!A1aC1aU!!G&aU!!A!!A1cG1aG1aU1aU1aG!!G!!C1aG1aU1aA1aU1aG" }, "chain_D": { "num_nts": 29, "bseq": "CAUACUUGAAACUGUAAGGUUGGCGUAUG", "sstr": "(((((....((((....))))...)))))", "form": "AAAA.A....A......AAA....AAAA-", "helical_rise": 0.020, "helical_rise_std": 2.025, "helical_axis": [ 0.063, 0.555, 0.829 ], "point1": [ 25.714, 18.257, 30.867 ], "point2": [ 25.753, 18.600, 31.381 ], "num_chars": 85, "suite": "C1aA1cU1aA1aC1cU1aU!!G1eA1aA!!A1aC1aU1cG1cU!!A1cA1cG1aG1aU1aU1aG!!G!!C1cG1aU1aA1aU1aG" } }, "num_nts": 58, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "C", "nt_code": "C", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 179.511, "delta": 85.685, "epsilon": -159.859, "zeta": -79.945, "epsilon_zeta": -79.915, "bb_type": "BI", "chi": -161.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.736, 0.589 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.337, "Dp": 4.473, "splay_angle": 28.113, "splay_distance": 4.508, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.216, "v1": -24.889, "v2": 35.829, "v3": -35.058, "v4": 20.124, "amplitude": 36.893, "phase_angle": 13.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 1.885, -16.628, 31.278 ], "x_axis": [ 0.169, -0.986, 0.004 ], "y_axis": [ 0.184, 0.027, -0.983 ], "z_axis": [ 0.968, 0.167, 0.186 ], "quaternion": [ 0.588, -0.489, 0.410, -0.497 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.738, "beta": -168.185, "gamma": 48.017, "delta": 81.745, "epsilon": -169.206, "zeta": -82.191, "epsilon_zeta": -87.015, "bb_type": "BI", "chi": -151.242, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.761, 0.001 ], "P_xyz": [ 1.139, 9.384, 0.443 ], "form": "A", "ssZp": 4.196, "Dp": 4.468, "splay_angle": 17.695, "splay_distance": 2.990, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 165.837, "theta": -139.390, "eta_prime": 169.485, "theta_prime": -145.701, "eta_base": 176.239, "theta_base": -126.961, "v0": 1.860, "v1": -24.973, "v2": 37.279, "v3": -37.271, "v4": 22.363, "amplitude": 38.773, "phase_angle": 15.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.037, "frame": { "rmsd": 0.001, "origin": [ 4.397, -14.067, 34.009 ], "x_axis": [ -0.009, -0.954, -0.299 ], "y_axis": [ 0.217, 0.290, -0.932 ], "z_axis": [ 0.976, -0.073, 0.204 ], "quaternion": [ 0.609, -0.353, 0.523, -0.481 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 154.883, "beta": -155.446, "gamma": 171.781, "delta": 85.914, "epsilon": -130.353, "zeta": -66.922, "epsilon_zeta": -63.431, "bb_type": "BI", "chi": -159.725, "glyco_bond": "anti", "C5prime_xyz": [ -1.036, 8.555, 0.572 ], "P_xyz": [ 0.502, 9.688, -1.230 ], "form": ".", "ssZp": 4.345, "Dp": 4.740, "splay_angle": 31.253, "splay_distance": 4.922, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": 166.623, "theta": -144.505, "eta_prime": 179.262, "theta_prime": -141.236, "eta_base": -147.112, "theta_base": -101.624, "v0": 8.363, "v1": -28.854, "v2": 37.307, "v3": -33.579, "v4": 15.988, "amplitude": 37.522, "phase_angle": 6.140, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.787, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 6.476, -15.351, 35.731 ], "x_axis": [ 0.138, -0.765, -0.629 ], "y_axis": [ 0.480, 0.607, -0.633 ], "z_axis": [ 0.866, -0.215, 0.451 ], "quaternion": [ 0.741, -0.141, 0.504, -0.420 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.662, "beta": 179.551, "gamma": 44.124, "delta": 83.567, "epsilon": -148.285, "zeta": -75.794, "epsilon_zeta": -72.491, "bb_type": "BI", "chi": -159.086, "glyco_bond": "anti", "C5prime_xyz": [ -1.235, 8.673, 0.498 ], "P_xyz": [ 1.271, 8.994, 1.192 ], "form": "A", "ssZp": 4.307, "Dp": 4.602, "splay_angle": 20.817, "splay_distance": 3.378, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 162.675, "theta": -145.905, "eta_prime": -176.939, "theta_prime": -144.191, "eta_base": -123.121, "theta_base": -124.244, "v0": 4.663, "v1": -26.651, "v2": 37.220, "v3": -35.650, "v4": 19.615, "amplitude": 38.025, "phase_angle": 11.810, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.702, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 10.269, -18.338, 34.775 ], "x_axis": [ -0.063, 0.127, -0.990 ], "y_axis": [ 0.248, 0.963, 0.108 ], "z_axis": [ 0.967, -0.239, -0.092 ], "quaternion": [ 0.672, 0.129, 0.727, -0.045 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -60.676, "beta": 168.077, "gamma": 49.471, "delta": 78.243, "epsilon": -158.441, "zeta": -69.721, "epsilon_zeta": -88.720, "bb_type": "BI", "chi": -153.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.883, 0.130 ], "P_xyz": [ 1.154, 9.415, -0.024 ], "form": ".", "ssZp": 4.288, "Dp": 4.592, "splay_angle": 26.956, "splay_distance": 4.699, "splay_ratio": 0.244, "d22": 3.994, "d64": 5.021, "eta": 162.689, "theta": -116.161, "eta_prime": 176.628, "theta_prime": -119.643, "eta_base": -149.253, "theta_base": -87.642, "v0": -0.299, "v1": -24.980, "v2": 39.525, "v3": -40.535, "v4": 25.750, "amplitude": 41.772, "phase_angle": 18.881, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 12.870, -20.352, 34.004 ], "x_axis": [ 0.016, 0.570, -0.821 ], "y_axis": [ 0.382, 0.756, 0.532 ], "z_axis": [ 0.924, -0.322, -0.206 ], "quaternion": [ 0.626, 0.341, 0.697, 0.075 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 145.310, "beta": -144.266, "gamma": -172.793, "delta": 82.499, "epsilon": -135.057, "zeta": -81.035, "epsilon_zeta": -54.022, "bb_type": "BI", "chi": -171.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.597, 1.166 ], "P_xyz": [ -0.375, 10.329, -0.460 ], "form": "A", "ssZp": 4.642, "Dp": 4.707, "splay_angle": 22.485, "splay_distance": 3.531, "splay_ratio": 0.196, "d22": 4.144, "d64": 3.930, "eta": 177.208, "theta": -169.794, "eta_prime": -158.562, "theta_prime": -160.956, "eta_base": -101.948, "theta_base": -120.080, "v0": 2.196, "v1": -26.176, "v2": 38.997, "v3": -38.655, "v4": 23.005, "amplitude": 40.469, "phase_angle": 15.501, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.716, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 15.079, -19.399, 29.968 ], "x_axis": [ 0.326, 0.860, -0.392 ], "y_axis": [ 0.490, 0.201, 0.848 ], "z_axis": [ 0.808, -0.469, -0.356 ], "quaternion": [ 0.541, 0.609, 0.555, 0.171 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,non-pair-contact,internal-loop,cap-donor", "alpha": -62.193, "beta": 158.687, "gamma": 68.223, "delta": 79.794, "epsilon": 61.744, "zeta": 47.736, "epsilon_zeta": 14.009, "bb_type": "--", "chi": -157.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.832, 8.798, 0.171 ], "P_xyz": [ 0.762, 9.175, 0.056 ], "form": ".", "ssZp": 1.931, "Dp": 2.349, "splay_angle": 43.299, "splay_distance": 7.054, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": -156.718, "theta": -147.248, "eta_prime": -136.775, "theta_prime": -151.590, "eta_base": -92.878, "theta_base": -109.666, "v0": -2.182, "v1": -19.394, "v2": 32.366, "v3": -34.485, "v4": 22.953, "amplitude": 34.905, "phase_angle": 21.989, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1a", "suiteness": 0.557, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ 17.653, -19.218, 27.558 ], "x_axis": [ 0.476, 0.836, 0.272 ], "y_axis": [ 0.339, -0.460, 0.820 ], "z_axis": [ 0.811, -0.298, -0.503 ], "quaternion": [ 0.358, 0.781, 0.376, 0.347 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate", "alpha": 104.405, "beta": -154.117, "gamma": 178.838, "delta": 83.323, "epsilon": -161.545, "zeta": -57.265, "epsilon_zeta": -104.280, "bb_type": "BI", "chi": -110.272, "glyco_bond": "anti", "C5prime_xyz": [ -1.568, 7.941, -2.260 ], "P_xyz": [ -1.716, 7.623, -4.839 ], "form": ".", "ssZp": 1.883, "Dp": 4.615, "splay_angle": 63.230, "splay_distance": 10.652, "splay_ratio": 0.527, "d22": null, "d64": null, "eta": -171.686, "theta": 174.156, "eta_prime": -148.790, "theta_prime": 157.513, "eta_base": -95.555, "theta_base": 146.425, "v0": 9.072, "v1": -32.364, "v2": 42.590, "v3": -38.121, "v4": 18.372, "amplitude": 42.870, "phase_angle": 6.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 22.701, -23.160, 24.602 ], "x_axis": [ 0.694, -0.630, -0.348 ], "y_axis": [ -0.572, -0.777, 0.265 ], "z_axis": [ -0.437, 0.015, -0.899 ], "quaternion": [ 0.068, 0.918, -0.327, -0.214 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate", "alpha": -144.314, "beta": 99.076, "gamma": 172.862, "delta": 89.752, "epsilon": -150.115, "zeta": -50.909, "epsilon_zeta": -99.207, "bb_type": "BI", "chi": -168.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.021, 8.417, 1.049 ], "P_xyz": [ -1.210, 10.648, -0.324 ], "form": ".", "ssZp": 4.418, "Dp": 4.566, "splay_angle": 28.609, "splay_distance": 4.340, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -165.970, "theta": 174.084, "eta_prime": 172.817, "theta_prime": -164.903, "eta_base": 161.068, "theta_base": -101.317, "v0": 11.169, "v1": -31.292, "v2": 38.269, "v3": -32.961, "v4": 13.855, "amplitude": 38.295, "phase_angle": 2.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.168, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 14.328, -22.537, 18.046 ], "x_axis": [ 0.938, 0.039, -0.343 ], "y_axis": [ 0.268, -0.712, 0.650 ], "z_axis": [ -0.219, -0.701, -0.678 ], "quaternion": [ 0.370, 0.912, 0.084, -0.154 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -79.143, "beta": 179.369, "gamma": 50.558, "delta": 75.837, "epsilon": 148.574, "zeta": 60.897, "epsilon_zeta": 87.677, "bb_type": "--", "chi": -163.317, "glyco_bond": "anti", "C5prime_xyz": [ -0.875, 8.498, 0.719 ], "P_xyz": [ 1.730, 8.553, 0.952 ], "form": ".", "ssZp": 4.240, "Dp": 4.264, "splay_angle": 18.597, "splay_distance": 3.968, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 155.973, "theta": -97.584, "eta_prime": -171.690, "theta_prime": -123.328, "eta_base": -90.605, "theta_base": -129.790, "v0": 12.880, "v1": -35.313, "v2": 42.811, "v3": -36.527, "v4": 15.062, "amplitude": 42.825, "phase_angle": 1.476, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.543, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 16.554, -25.194, 15.434 ], "x_axis": [ 0.730, -0.569, 0.380 ], "y_axis": [ -0.660, -0.441, 0.608 ], "z_axis": [ -0.178, -0.695, -0.697 ], "quaternion": [ 0.385, 0.847, -0.363, 0.059 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -60.553, "beta": -91.487, "gamma": -84.291, "delta": 95.734, "epsilon": -174.648, "zeta": -54.535, "epsilon_zeta": -120.113, "bb_type": "BI", "chi": -147.652, "glyco_bond": "anti", "C5prime_xyz": [ -0.848, 8.437, -0.220 ], "P_xyz": [ -1.523, 10.937, -0.750 ], "form": "A", "ssZp": 4.097, "Dp": 4.371, "splay_angle": 22.301, "splay_distance": 3.548, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 173.542, "theta": 151.410, "eta_prime": -178.266, "theta_prime": 172.751, "eta_base": -161.743, "theta_base": -148.957, "v0": 13.415, "v1": -30.875, "v2": 35.253, "v3": -28.509, "v4": 9.675, "amplitude": 35.309, "phase_angle": 356.779, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 18.861, -25.557, 12.227 ], "x_axis": [ 0.529, -0.745, 0.407 ], "y_axis": [ -0.849, -0.457, 0.267 ], "z_axis": [ -0.013, -0.486, -0.874 ], "quaternion": [ 0.223, 0.845, -0.471, 0.116 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -91.802, "beta": 179.444, "gamma": 68.013, "delta": 85.682, "epsilon": -147.753, "zeta": -78.004, "epsilon_zeta": -69.749, "bb_type": "BI", "chi": -164.118, "glyco_bond": "anti", "C5prime_xyz": [ -1.333, 8.745, 0.752 ], "P_xyz": [ 1.270, 9.142, 0.758 ], "form": "A", "ssZp": 4.474, "Dp": 4.605, "splay_angle": 19.889, "splay_distance": 3.084, "splay_ratio": 0.173, "d22": 4.132, "d64": 3.846, "eta": 164.651, "theta": -144.941, "eta_prime": -177.188, "theta_prime": -144.944, "eta_base": -133.259, "theta_base": -107.100, "v0": 3.472, "v1": -25.497, "v2": 36.551, "v3": -35.553, "v4": 20.218, "amplitude": 37.574, "phase_angle": 13.401, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.113, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 20.009, -27.334, 9.378 ], "x_axis": [ 0.001, -0.834, 0.552 ], "y_axis": [ -1.000, 0.001, 0.002 ], "z_axis": [ -0.002, -0.552, -0.834 ], "quaternion": [ -0.205, -0.677, 0.677, -0.203 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -64.008, "beta": 160.862, "gamma": 56.524, "delta": 84.314, "epsilon": -124.833, "zeta": -103.176, "epsilon_zeta": -21.657, "bb_type": "--", "chi": -160.449, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.666, 0.519 ], "P_xyz": [ 1.299, 8.847, 0.194 ], "form": ".", "ssZp": 4.350, "Dp": 4.779, "splay_angle": 27.362, "splay_distance": 4.276, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 169.294, "theta": -130.111, "eta_prime": -175.714, "theta_prime": -120.266, "eta_base": -122.792, "theta_base": -76.316, "v0": 4.617, "v1": -27.691, "v2": 38.880, "v3": -37.218, "v4": 20.656, "amplitude": 39.757, "phase_angle": 12.061, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.863, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 20.579, -29.898, 7.762 ], "x_axis": [ -0.602, -0.698, 0.388 ], "y_axis": [ -0.781, 0.414, -0.467 ], "z_axis": [ 0.165, -0.584, -0.795 ], "quaternion": [ -0.066, -0.441, 0.838, -0.314 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -10.570, "beta": 123.842, "gamma": 60.317, "delta": 96.136, "epsilon": 167.348, "zeta": -100.543, "epsilon_zeta": -92.109, "bb_type": "BI", "chi": -134.811, "glyco_bond": "anti", "C5prime_xyz": [ -2.305, 8.724, -1.221 ], "P_xyz": [ 0.317, 8.805, -1.570 ], "form": ".", "ssZp": 2.533, "Dp": 2.990, "splay_angle": 39.744, "splay_distance": 6.460, "splay_ratio": 0.340, "d22": null, "d64": null, "eta": 175.965, "theta": -171.899, "eta_prime": -139.429, "theta_prime": 173.634, "eta_base": -83.168, "theta_base": -173.213, "v0": -14.012, "v1": -3.028, "v2": 17.499, "v3": -26.316, "v4": 25.251, "amplitude": 26.820, "phase_angle": 49.271, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 18.223, -33.268, 6.588 ], "x_axis": [ -0.988, -0.146, 0.046 ], "y_axis": [ -0.113, 0.495, -0.862 ], "z_axis": [ 0.103, -0.857, -0.506 ], "quaternion": [ 0.016, -0.075, 0.864, -0.497 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -92.413, "beta": -160.578, "gamma": 75.566, "delta": 91.635, "epsilon": 60.815, "zeta": 96.992, "epsilon_zeta": -36.177, "bb_type": "--", "chi": -154.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.630, 8.831, 0.068 ], "P_xyz": [ 0.864, 9.221, 0.874 ], "form": ".", "ssZp": 1.086, "Dp": 1.438, "splay_angle": 127.195, "splay_distance": 14.249, "splay_ratio": 0.901, "d22": null, "d64": null, "eta": -150.868, "theta": -93.401, "eta_prime": -152.056, "theta_prime": -147.059, "eta_base": -145.072, "theta_base": 143.794, "v0": -3.561, "v1": -11.505, "v2": 21.262, "v3": -24.114, "v4": 17.312, "amplitude": 23.883, "phase_angle": 27.097, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "&a", "suiteness": 0.019, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 23.360, -36.991, 5.372 ], "x_axis": [ -0.999, -0.012, -0.052 ], "y_axis": [ 0.027, 0.732, -0.681 ], "z_axis": [ 0.046, -0.681, -0.730 ], "quaternion": [ 0.026, 0.004, 0.930, -0.366 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 35.809, "beta": 159.667, "gamma": 41.829, "delta": 80.953, "epsilon": -158.557, "zeta": 86.568, "epsilon_zeta": 114.875, "bb_type": "--", "chi": 43.443, "glyco_bond": "syn", "C5prime_xyz": [ -5.666, 3.905, 1.003 ], "P_xyz": [ -5.826, 1.295, 1.346 ], "form": ".", "ssZp": -3.453, "Dp": 4.242, "splay_angle": 74.327, "splay_distance": 11.823, "splay_ratio": 0.615, "d22": null, "d64": null, "eta": -60.318, "theta": -12.165, "eta_prime": -12.154, "theta_prime": -27.909, "eta_base": 38.391, "theta_base": -42.900, "v0": -8.387, "v1": -16.053, "v2": 32.862, "v3": -38.619, "v4": 29.555, "amplitude": 38.294, "phase_angle": 30.891, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 34.643, -29.468, 0.999 ], "x_axis": [ 0.956, 0.290, -0.040 ], "y_axis": [ 0.263, -0.913, -0.313 ], "z_axis": [ -0.127, 0.288, -0.949 ], "quaternion": [ -0.154, 0.977, 0.141, -0.043 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -168.839, "beta": 121.189, "gamma": -176.246, "delta": 84.421, "epsilon": -162.310, "zeta": -96.356, "epsilon_zeta": -65.954, "bb_type": "BI", "chi": -130.382, "glyco_bond": "anti", "C5prime_xyz": [ -2.246, 8.639, -1.397 ], "P_xyz": [ -3.445, 9.925, -3.343 ], "form": ".", "ssZp": 3.051, "Dp": 4.209, "splay_angle": 20.051, "splay_distance": 3.570, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -142.681, "theta": 164.797, "eta_prime": -117.406, "theta_prime": 177.143, "eta_base": -81.740, "theta_base": -152.268, "v0": -9.903, "v1": -15.984, "v2": 34.304, "v3": -40.786, "v4": 31.776, "amplitude": 40.539, "phase_angle": 32.198, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 23.139, -28.684, 3.614 ], "x_axis": [ -0.846, -0.427, 0.319 ], "y_axis": [ 0.524, -0.778, 0.347 ], "z_axis": [ 0.100, 0.461, 0.882 ], "quaternion": [ -0.254, 0.112, 0.216, 0.936 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": 125.077, "beta": -120.928, "gamma": -165.862, "delta": 76.329, "epsilon": -152.618, "zeta": -79.378, "epsilon_zeta": -73.240, "bb_type": "BI", "chi": -167.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.992, 8.881, 0.762 ], "P_xyz": [ -1.419, 10.220, -1.404 ], "form": "A", "ssZp": 4.527, "Dp": 4.598, "splay_angle": 22.278, "splay_distance": 3.511, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 176.871, "theta": 176.915, "eta_prime": -167.144, "theta_prime": -178.669, "eta_base": -127.255, "theta_base": -135.511, "v0": -6.794, "v1": -22.068, "v2": 40.966, "v3": -45.547, "v4": 33.156, "amplitude": 45.858, "phase_angle": 26.706, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.040, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 21.569, -27.807, 6.699 ], "x_axis": [ -0.605, -0.642, 0.470 ], "y_axis": [ 0.796, -0.499, 0.343 ], "z_axis": [ 0.015, 0.582, 0.813 ], "quaternion": [ -0.421, 0.142, 0.270, 0.854 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.523, "beta": 158.489, "gamma": 54.239, "delta": 80.906, "epsilon": -153.229, "zeta": -74.199, "epsilon_zeta": -79.029, "bb_type": "BI", "chi": -158.107, "glyco_bond": "anti", "C5prime_xyz": [ -1.354, 8.836, 0.313 ], "P_xyz": [ 1.250, 9.155, 0.055 ], "form": "A", "ssZp": 4.313, "Dp": 4.615, "splay_angle": 20.184, "splay_distance": 3.207, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 172.702, "theta": -147.533, "eta_prime": -171.353, "theta_prime": -149.316, "eta_base": -116.060, "theta_base": -128.365, "v0": 1.191, "v1": -25.957, "v2": 39.406, "v3": -39.720, "v4": 24.310, "amplitude": 41.188, "phase_angle": 16.915, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.698, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 19.899, -26.731, 9.594 ], "x_axis": [ 0.023, -0.734, 0.679 ], "y_axis": [ 0.990, 0.111, 0.085 ], "z_axis": [ -0.138, 0.671, 0.729 ], "quaternion": [ 0.682, -0.214, -0.299, -0.631 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.986, "beta": 172.090, "gamma": 57.960, "delta": 84.373, "epsilon": -152.605, "zeta": -65.680, "epsilon_zeta": -86.925, "bb_type": "BI", "chi": -157.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.406, 8.759, 0.281 ], "P_xyz": [ 1.191, 9.174, 0.194 ], "form": "A", "ssZp": 4.291, "Dp": 4.558, "splay_angle": 20.470, "splay_distance": 3.459, "splay_ratio": 0.183, "d22": 4.188, "d64": 4.287, "eta": 165.700, "theta": -137.787, "eta_prime": 179.227, "theta_prime": -140.348, "eta_base": -144.597, "theta_base": -123.120, "v0": 1.079, "v1": -24.212, "v2": 36.905, "v3": -37.288, "v4": 22.786, "amplitude": 38.597, "phase_angle": 17.026, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 18.399, -25.328, 12.057 ], "x_axis": [ 0.534, -0.672, 0.512 ], "y_axis": [ 0.825, 0.547, -0.143 ], "z_axis": [ -0.184, 0.499, 0.847 ], "quaternion": [ 0.856, -0.188, -0.203, -0.438 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "U", "nt_code": "U", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate", "alpha": -75.456, "beta": -179.094, "gamma": 56.146, "delta": 83.321, "epsilon": -129.307, "zeta": -73.070, "epsilon_zeta": -56.236, "bb_type": "BI", "chi": -150.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.839, 8.898, -0.101 ], "P_xyz": [ 0.602, 9.849, -0.158 ], "form": ".", "ssZp": 3.910, "Dp": 4.511, "splay_angle": 31.757, "splay_distance": 5.349, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 170.485, "theta": -122.526, "eta_prime": -177.702, "theta_prime": -111.038, "eta_base": -148.262, "theta_base": -67.811, "v0": -6.790, "v1": -17.820, "v2": 34.088, "v3": -38.998, "v4": 28.880, "amplitude": 38.771, "phase_angle": 28.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.866, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 17.135, -25.443, 15.276 ], "x_axis": [ 0.886, -0.423, 0.191 ], "y_axis": [ 0.458, 0.864, -0.210 ], "z_axis": [ -0.076, 0.273, 0.959 ], "quaternion": [ 0.963, -0.125, -0.070, -0.229 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate", "alpha": -36.065, "beta": 145.855, "gamma": 66.026, "delta": 97.592, "epsilon": -160.875, "zeta": -113.922, "epsilon_zeta": -46.953, "bb_type": "BI", "chi": -140.027, "glyco_bond": "anti", "C5prime_xyz": [ -2.754, 8.786, -1.040 ], "P_xyz": [ -0.347, 9.812, -1.239 ], "form": ".", "ssZp": 2.311, "Dp": 2.745, "splay_angle": 24.935, "splay_distance": 4.204, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": -174.979, "theta": -179.655, "eta_prime": -136.796, "theta_prime": -179.613, "eta_base": -84.530, "theta_base": -160.491, "v0": -18.830, "v1": 0.969, "v2": 15.818, "v3": -27.491, "v4": 28.986, "amplitude": 29.401, "phase_angle": 57.452, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1a", "suiteness": 0.082, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 21.818, -25.164, 17.846 ], "x_axis": [ 0.872, 0.249, -0.422 ], "y_axis": [ -0.280, 0.960, -0.012 ], "z_axis": [ 0.402, 0.128, 0.907 ], "quaternion": [ 0.967, -0.036, 0.213, 0.137 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,non-pair-contact,internal-loop,cap-donor", "alpha": -74.417, "beta": 175.402, "gamma": 55.758, "delta": 107.392, "epsilon": 13.882, "zeta": 120.965, "epsilon_zeta": -107.083, "bb_type": "--", "chi": -122.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.431, -1.554 ], "P_xyz": [ 1.035, 8.785, -1.289 ], "form": ".", "ssZp": 0.037, "Dp": 1.406, "splay_angle": 84.823, "splay_distance": 13.052, "splay_ratio": 0.676, "d22": null, "d64": null, "eta": -150.976, "theta": -162.729, "eta_prime": -149.247, "theta_prime": -159.603, "eta_base": -137.947, "theta_base": -121.972, "v0": 0.439, "v1": -11.867, "v2": 17.872, "v3": -18.440, "v4": 11.309, "amplitude": 18.749, "phase_angle": 17.594, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 20.908, -25.935, 21.876 ], "x_axis": [ 0.672, 0.663, -0.330 ], "y_axis": [ -0.630, 0.746, 0.217 ], "z_axis": [ 0.390, 0.062, 0.919 ], "quaternion": [ 0.913, 0.043, 0.197, 0.354 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor", "alpha": -129.374, "beta": 168.741, "gamma": 56.578, "delta": 84.263, "epsilon": -147.986, "zeta": -51.532, "epsilon_zeta": -96.455, "bb_type": "BI", "chi": -174.783, "glyco_bond": "anti", "C5prime_xyz": [ -1.285, 8.554, 1.473 ], "P_xyz": [ 1.330, 8.894, 1.652 ], "form": ".", "ssZp": 4.823, "Dp": 4.669, "splay_angle": 34.547, "splay_distance": 5.367, "splay_ratio": 0.301, "d22": null, "d64": null, "eta": -172.326, "theta": -121.154, "eta_prime": -164.516, "theta_prime": -118.332, "eta_base": -130.866, "theta_base": -79.173, "v0": 3.356, "v1": -25.881, "v2": 37.312, "v3": -36.296, "v4": 20.801, "amplitude": 38.394, "phase_angle": 13.638, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 15.313, -25.396, 33.656 ], "x_axis": [ 0.287, 0.958, 0.006 ], "y_axis": [ -0.255, 0.082, -0.963 ], "z_axis": [ -0.923, 0.275, 0.268 ], "quaternion": [ 0.640, -0.484, -0.363, 0.474 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate", "alpha": -72.725, "beta": 176.185, "gamma": 61.812, "delta": 80.578, "epsilon": -148.537, "zeta": -77.090, "epsilon_zeta": -71.447, "bb_type": "BI", "chi": -173.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.626, 8.674, 1.201 ], "P_xyz": [ 0.908, 9.200, 1.598 ], "form": "A", "ssZp": 4.592, "Dp": 4.630, "splay_angle": 22.297, "splay_distance": 3.488, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 168.303, "theta": -149.230, "eta_prime": -163.480, "theta_prime": -147.262, "eta_base": -96.931, "theta_base": -120.459, "v0": -0.602, "v1": -24.255, "v2": 38.636, "v3": -39.887, "v4": 25.594, "amplitude": 40.956, "phase_angle": 19.380, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.657, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 12.983, -20.682, 34.730 ], "x_axis": [ -0.055, 0.647, -0.761 ], "y_axis": [ -0.329, -0.731, -0.598 ], "z_axis": [ -0.943, 0.217, 0.253 ], "quaternion": [ 0.342, -0.597, -0.133, 0.714 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.397, "beta": 177.016, "gamma": 51.538, "delta": 83.729, "epsilon": -145.003, "zeta": -68.809, "epsilon_zeta": -76.194, "bb_type": "BI", "chi": -156.899, "glyco_bond": "anti", "C5prime_xyz": [ -1.321, 8.708, 0.356 ], "P_xyz": [ 1.266, 9.079, 0.526 ], "form": ".", "ssZp": 4.353, "Dp": 4.661, "splay_angle": 27.507, "splay_distance": 4.340, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 171.660, "theta": -135.951, "eta_prime": -178.016, "theta_prime": -132.600, "eta_base": -140.502, "theta_base": -94.982, "v0": 3.163, "v1": -26.098, "v2": 37.654, "v3": -36.965, "v4": 21.349, "amplitude": 38.819, "phase_angle": 14.074, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.956, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 10.590, -18.437, 35.913 ], "x_axis": [ -0.227, 0.113, -0.967 ], "y_axis": [ -0.345, -0.938, -0.028 ], "z_axis": [ -0.911, 0.327, 0.252 ], "quaternion": [ 0.147, -0.604, 0.096, 0.777 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.286, "beta": 160.259, "gamma": 62.811, "delta": 84.435, "epsilon": -152.951, "zeta": -69.187, "epsilon_zeta": -83.764, "bb_type": "BI", "chi": -164.947, "glyco_bond": "anti", "C5prime_xyz": [ -1.524, 8.675, 0.792 ], "P_xyz": [ 1.034, 9.111, 0.426 ], "form": "A", "ssZp": 4.549, "Dp": 4.595, "splay_angle": 22.850, "splay_distance": 3.609, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 167.164, "theta": -139.875, "eta_prime": -168.751, "theta_prime": -143.404, "eta_base": -110.897, "theta_base": -114.532, "v0": 0.847, "v1": -24.366, "v2": 37.224, "v3": -37.802, "v4": 23.321, "amplitude": 39.010, "phase_angle": 17.404, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 6.831, -16.984, 34.301 ], "x_axis": [ -0.352, -0.547, -0.759 ], "y_axis": [ -0.160, -0.764, 0.625 ], "z_axis": [ -0.922, 0.342, 0.182 ], "quaternion": [ -0.128, -0.554, 0.319, 0.758 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -80.892, "beta": 179.882, "gamma": 59.985, "delta": 82.309, "epsilon": -160.419, "zeta": -67.902, "epsilon_zeta": -92.516, "bb_type": "BI", "chi": -158.170, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.743, 0.385 ], "P_xyz": [ 1.235, 9.196, 0.231 ], "form": "A", "ssZp": 4.457, "Dp": 4.612, "splay_angle": 18.799, "splay_distance": 3.120, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 161.050, "theta": -147.853, "eta_prime": 177.006, "theta_prime": -149.081, "eta_base": -134.364, "theta_base": -135.844, "v0": 3.518, "v1": -27.753, "v2": 40.080, "v3": -38.951, "v4": 22.375, "amplitude": 41.253, "phase_angle": 13.693, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.735, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 3.651, -15.859, 33.018 ], "x_axis": [ -0.303, -0.927, -0.223 ], "y_axis": [ -0.047, -0.220, 0.974 ], "z_axis": [ -0.952, 0.305, 0.023 ], "quaternion": [ -0.354, -0.473, 0.515, 0.622 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///C/29", "linked_nts": [ "///C/28", null ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -71.024, "beta": -177.684, "gamma": 55.252, "delta": 77.241, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.551, 8.874, -0.274 ], "P_xyz": [ 0.987, 9.547, -0.352 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.419, "v1": -22.906, "v2": 37.153, "v3": -38.997, "v4": 25.448, "amplitude": 39.688, "phase_angle": 20.590, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 1.249, -15.168, 31.152 ], "x_axis": [ -0.189, -0.954, 0.232 ], "y_axis": [ -0.161, 0.263, 0.951 ], "z_axis": [ -0.969, 0.142, -0.204 ], "quaternion": [ -0.467, -0.433, 0.643, 0.425 ] } }, { "index": 30, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "C", "nt_code": "C", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 178.412, "delta": 85.736, "epsilon": -164.471, "zeta": -62.529, "epsilon_zeta": -101.942, "bb_type": "BI", "chi": -176.743, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.464, 1.510 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.445, "Dp": 4.471, "splay_angle": 23.413, "splay_distance": 3.691, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.591, "v1": -26.154, "v2": 36.578, "v3": -35.004, "v4": 19.179, "amplitude": 37.363, "phase_angle": 11.761, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 22.898, 0.143, 45.065 ], "x_axis": [ -0.333, 0.912, 0.239 ], "y_axis": [ 0.868, 0.395, -0.300 ], "z_axis": [ -0.368, 0.108, -0.923 ], "quaternion": [ -0.187, 0.547, 0.814, -0.059 ] } }, { "index": 31, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -78.211, "beta": -159.689, "gamma": 47.839, "delta": 82.756, "epsilon": -156.611, "zeta": -88.967, "epsilon_zeta": -67.644, "bb_type": "BI", "chi": -160.482, "glyco_bond": "anti", "C5prime_xyz": [ -1.272, 8.692, 0.578 ], "P_xyz": [ 1.122, 9.081, 1.590 ], "form": "A", "ssZp": 4.415, "Dp": 4.561, "splay_angle": 19.291, "splay_distance": 3.142, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.219, "theta": -132.003, "eta_prime": -179.832, "theta_prime": -135.990, "eta_base": -151.526, "theta_base": -102.663, "v0": 2.746, "v1": -24.814, "v2": 36.191, "v3": -35.698, "v4": 20.854, "amplitude": 37.397, "phase_angle": 14.590, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.544, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 19.865, -0.571, 43.086 ], "x_axis": [ 0.199, 0.975, 0.096 ], "y_axis": [ 0.910, -0.147, -0.387 ], "z_axis": [ -0.363, 0.165, -0.917 ], "quaternion": [ -0.183, 0.752, 0.627, -0.089 ] } }, { "index": 32, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 148.267, "beta": -147.084, "gamma": 170.164, "delta": 84.699, "epsilon": -129.797, "zeta": -76.950, "epsilon_zeta": -52.847, "bb_type": "BI", "chi": -167.392, "glyco_bond": "anti", "C5prime_xyz": [ -0.963, 8.389, 1.040 ], "P_xyz": [ 0.750, 9.459, -0.632 ], "form": "A", "ssZp": 4.617, "Dp": 4.805, "splay_angle": 23.544, "splay_distance": 3.702, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 157.928, "theta": -149.686, "eta_prime": 176.375, "theta_prime": -149.412, "eta_base": -132.048, "theta_base": -120.537, "v0": 11.264, "v1": -31.679, "v2": 39.129, "v3": -33.705, "v4": 14.212, "amplitude": 39.162, "phase_angle": 2.365, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.586, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 18.250, 1.386, 41.233 ], "x_axis": [ 0.626, 0.758, -0.182 ], "y_axis": [ 0.544, -0.592, -0.595 ], "z_axis": [ -0.559, 0.273, -0.783 ], "quaternion": [ -0.251, 0.866, 0.376, -0.214 ] } }, { "index": 33, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.654, "beta": 167.451, "gamma": 51.720, "delta": 81.689, "epsilon": -143.098, "zeta": -77.426, "epsilon_zeta": -65.672, "bb_type": "BI", "chi": -158.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.503, 8.723, 0.428 ], "P_xyz": [ 1.076, 9.168, 0.425 ], "form": "A", "ssZp": 4.357, "Dp": 4.668, "splay_angle": 21.650, "splay_distance": 3.511, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.253, "theta": -142.980, "eta_prime": -177.679, "theta_prime": -142.676, "eta_base": -133.346, "theta_base": -114.839, "v0": 1.273, "v1": -25.398, "v2": 38.509, "v3": -38.844, "v4": 23.682, "amplitude": 40.232, "phase_angle": 16.832, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.773, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ 17.170, 4.220, 39.110 ], "x_axis": [ 0.928, 0.179, -0.326 ], "y_axis": [ -0.005, -0.869, -0.494 ], "z_axis": [ -0.372, 0.460, -0.806 ], "quaternion": [ -0.251, 0.949, 0.046, -0.184 ] } }, { "index": 34, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -61.172, "beta": 162.750, "gamma": 56.755, "delta": 78.216, "epsilon": -168.766, "zeta": -57.057, "epsilon_zeta": -111.709, "bb_type": "BI", "chi": -154.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.916, 0.187 ], "P_xyz": [ 1.026, 9.446, -0.357 ], "form": ".", "ssZp": 4.369, "Dp": 4.526, "splay_angle": 24.865, "splay_distance": 4.576, "splay_ratio": 0.235, "d22": 4.032, "d64": 5.234, "eta": 162.207, "theta": -116.879, "eta_prime": -179.744, "theta_prime": -126.097, "eta_base": -133.813, "theta_base": -101.915, "v0": -1.972, "v1": -24.287, "v2": 40.025, "v3": -41.871, "v4": 27.684, "amplitude": 42.868, "phase_angle": 20.982, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 17.418, 6.798, 36.741 ], "x_axis": [ 0.797, -0.335, -0.503 ], "y_axis": [ -0.556, -0.733, -0.392 ], "z_axis": [ -0.237, 0.592, -0.770 ], "quaternion": [ -0.271, 0.908, -0.245, -0.204 ] } }, { "index": 35, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 152.599, "beta": -161.938, "gamma": -172.212, "delta": 84.030, "epsilon": -127.240, "zeta": -92.841, "epsilon_zeta": -34.399, "bb_type": "--", "chi": -174.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.618, 8.579, 1.366 ], "P_xyz": [ -0.495, 10.660, 0.158 ], "form": "A", "ssZp": 4.633, "Dp": 4.649, "splay_angle": 23.760, "splay_distance": 3.717, "splay_ratio": 0.206, "d22": 4.063, "d64": 3.976, "eta": -177.832, "theta": -176.302, "eta_prime": -159.464, "theta_prime": -163.192, "eta_base": -111.161, "theta_base": -118.638, "v0": 0.106, "v1": -23.136, "v2": 36.139, "v3": -36.950, "v4": 23.251, "amplitude": 38.082, "phase_angle": 18.381, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.798, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 20.332, 8.393, 33.594 ], "x_axis": [ 0.393, -0.637, -0.664 ], "y_axis": [ -0.912, -0.365, -0.189 ], "z_axis": [ -0.122, 0.679, -0.724 ], "quaternion": [ -0.276, 0.788, -0.492, -0.249 ] } }, { "index": 36, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,non-pair-contact,internal-loop,cap-donor", "alpha": -48.963, "beta": 141.188, "gamma": 64.938, "delta": 80.755, "epsilon": 55.269, "zeta": 63.001, "epsilon_zeta": -7.732, "bb_type": "--", "chi": -167.421, "glyco_bond": "anti", "C5prime_xyz": [ -1.984, 8.770, 0.760 ], "P_xyz": [ 0.622, 9.066, 0.684 ], "form": ".", "ssZp": 1.933, "Dp": 2.142, "splay_angle": 43.745, "splay_distance": 7.137, "splay_ratio": 0.373, "d22": null, "d64": null, "eta": -155.247, "theta": -140.349, "eta_prime": -135.313, "theta_prime": -143.274, "eta_base": -88.629, "theta_base": -103.585, "v0": -5.464, "v1": -16.010, "v2": 30.118, "v3": -34.128, "v4": 24.791, "amplitude": 33.973, "phase_angle": 27.558, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1a", "suiteness": 0.275, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 21.150, 9.731, 30.223 ], "x_axis": [ -0.263, -0.759, -0.596 ], "y_axis": [ -0.963, 0.170, 0.209 ], "z_axis": [ -0.057, 0.629, -0.775 ], "quaternion": [ 0.181, -0.579, 0.743, 0.282 ] } }, { "index": 37, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate", "alpha": 85.566, "beta": -147.432, "gamma": -173.094, "delta": 82.322, "epsilon": -141.632, "zeta": -71.790, "epsilon_zeta": -69.842, "bb_type": "BI", "chi": -117.326, "glyco_bond": "anti", "C5prime_xyz": [ -1.446, 8.148, -1.962 ], "P_xyz": [ -1.535, 8.077, -4.591 ], "form": ".", "ssZp": 2.086, "Dp": 4.749, "splay_angle": 62.505, "splay_distance": 10.552, "splay_ratio": 0.521, "d22": null, "d64": null, "eta": -174.704, "theta": 168.728, "eta_prime": -148.365, "theta_prime": 157.359, "eta_base": -95.652, "theta_base": 146.056, "v0": 9.259, "v1": -32.269, "v2": 42.101, "v3": -37.586, "v4": 17.965, "amplitude": 42.347, "phase_angle": 6.177, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 20.410, 15.412, 25.967 ], "x_axis": [ -0.234, 0.844, -0.482 ], "y_axis": [ -0.140, 0.461, 0.876 ], "z_axis": [ 0.962, 0.272, 0.010 ], "quaternion": [ 0.556, 0.271, 0.649, 0.442 ] } }, { "index": 38, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate", "alpha": -130.322, "beta": 100.649, "gamma": 163.668, "delta": 85.517, "epsilon": -141.361, "zeta": -57.804, "epsilon_zeta": -83.557, "bb_type": "BI", "chi": -163.448, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.631, 0.733 ], "P_xyz": [ -1.467, 10.498, -1.100 ], "form": ".", "ssZp": 4.360, "Dp": 4.605, "splay_angle": 27.155, "splay_distance": 4.270, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": -165.874, "theta": 178.051, "eta_prime": 174.891, "theta_prime": -163.140, "eta_base": 160.670, "theta_base": -100.184, "v0": 5.246, "v1": -26.967, "v2": 37.090, "v3": -35.221, "v4": 18.960, "amplitude": 37.770, "phase_angle": 10.894, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.536, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 30.059, 15.447, 30.236 ], "x_axis": [ -0.096, 0.384, -0.919 ], "y_axis": [ -0.786, 0.537, 0.307 ], "z_axis": [ 0.610, 0.752, 0.250 ], "quaternion": [ 0.650, -0.171, 0.588, 0.450 ] } }, { "index": 39, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -67.977, "beta": 169.259, "gamma": 51.769, "delta": 78.699, "epsilon": 154.772, "zeta": 58.139, "epsilon_zeta": 96.633, "bb_type": "--", "chi": -155.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.698, 0.255 ], "P_xyz": [ 1.336, 9.027, 0.200 ], "form": ".", "ssZp": 4.071, "Dp": 4.146, "splay_angle": 18.302, "splay_distance": 3.682, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 156.784, "theta": -97.183, "eta_prime": -169.752, "theta_prime": -126.749, "eta_base": -89.647, "theta_base": -124.279, "v0": 5.868, "v1": -28.085, "v2": 38.137, "v3": -35.949, "v4": 19.108, "amplitude": 38.749, "phase_angle": 10.193, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 30.518, 19.179, 28.211 ], "x_axis": [ -0.743, 0.601, -0.294 ], "y_axis": [ -0.262, 0.144, 0.954 ], "z_axis": [ 0.616, 0.786, 0.050 ], "quaternion": [ 0.336, 0.125, 0.678, 0.642 ] } }, { "index": 40, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.371, "beta": -72.955, "gamma": -93.593, "delta": 95.207, "epsilon": -176.618, "zeta": -50.126, "epsilon_zeta": -126.491, "bb_type": "BI", "chi": -147.357, "glyco_bond": "anti", "C5prime_xyz": [ -0.790, 8.362, -0.206 ], "P_xyz": [ -1.774, 10.663, -0.999 ], "form": "A", "ssZp": 3.970, "Dp": 4.337, "splay_angle": 20.376, "splay_distance": 3.270, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 176.168, "theta": 146.010, "eta_prime": -179.551, "theta_prime": 170.805, "eta_base": -156.317, "theta_base": -152.289, "v0": 16.093, "v1": -31.828, "v2": 34.270, "v3": -26.148, "v4": 6.545, "amplitude": 34.626, "phase_angle": 351.784, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 31.839, 21.356, 25.551 ], "x_axis": [ -0.754, 0.657, -0.011 ], "y_axis": [ 0.128, 0.164, 0.978 ], "z_axis": [ 0.645, 0.736, -0.207 ], "quaternion": [ 0.225, 0.269, 0.729, 0.588 ] } }, { "index": 41, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -90.151, "beta": -172.404, "gamma": 58.847, "delta": 83.985, "epsilon": -157.140, "zeta": -71.852, "epsilon_zeta": -85.288, "bb_type": "BI", "chi": -151.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.804, 0.002 ], "P_xyz": [ 1.305, 9.223, 0.055 ], "form": ".", "ssZp": 4.195, "Dp": 4.556, "splay_angle": 18.021, "splay_distance": 2.838, "splay_ratio": 0.157, "d22": 4.139, "d64": 3.468, "eta": 162.864, "theta": -148.281, "eta_prime": -179.302, "theta_prime": -147.471, "eta_base": -137.880, "theta_base": -111.548, "v0": 1.863, "v1": -24.733, "v2": 36.860, "v3": -36.819, "v4": 22.092, "amplitude": 38.326, "phase_angle": 15.900, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.145, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 33.269, 23.889, 24.058 ], "x_axis": [ -0.593, 0.619, 0.514 ], "y_axis": [ 0.564, -0.137, 0.815 ], "z_axis": [ 0.575, 0.773, -0.268 ], "quaternion": [ 0.023, 0.450, 0.656, 0.605 ] } }, { "index": 42, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -69.793, "beta": 172.298, "gamma": 54.724, "delta": 84.807, "epsilon": -173.955, "zeta": -81.543, "epsilon_zeta": -92.412, "bb_type": "BI", "chi": -147.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.126, 8.649, -0.231 ], "P_xyz": [ 1.475, 8.755, -0.546 ], "form": ".", "ssZp": 4.075, "Dp": 4.453, "splay_angle": 36.830, "splay_distance": 5.601, "splay_ratio": 0.317, "d22": null, "d64": null, "eta": 162.521, "theta": -120.893, "eta_prime": -179.371, "theta_prime": -118.176, "eta_base": -127.507, "theta_base": -73.236, "v0": 6.867, "v1": -28.679, "v2": 38.400, "v3": -35.465, "v4": 18.106, "amplitude": 38.845, "phase_angle": 8.672, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.905, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 33.985, 26.618, 23.745 ], "x_axis": [ -0.201, 0.368, 0.908 ], "y_axis": [ 0.919, -0.249, 0.305 ], "z_axis": [ 0.339, 0.896, -0.288 ], "quaternion": [ -0.256, 0.578, 0.557, 0.539 ] } }, { "index": 43, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop", "alpha": 160.023, "beta": -113.290, "gamma": 167.324, "delta": 89.574, "epsilon": -128.431, "zeta": -83.192, "epsilon_zeta": -45.239, "bb_type": "--", "chi": -134.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.426, 8.677, -0.989 ], "P_xyz": [ -0.196, 8.029, -3.217 ], "form": ".", "ssZp": 2.959, "Dp": 4.439, "splay_angle": 31.084, "splay_distance": 5.541, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": -170.801, "theta": -111.648, "eta_prime": -139.391, "theta_prime": -149.670, "eta_base": -78.994, "theta_base": 172.678, "v0": 1.719, "v1": -22.041, "v2": 32.595, "v3": -32.753, "v4": 19.741, "amplitude": 33.906, "phase_angle": 15.983, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.106, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 36.250, 30.479, 27.111 ], "x_axis": [ 0.619, 0.507, 0.600 ], "y_axis": [ 0.707, -0.026, -0.707 ], "z_axis": [ -0.343, 0.862, -0.374 ], "quaternion": [ 0.552, -0.710, -0.427, -0.091 ] } }, { "index": 44, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 112.940, "beta": -177.062, "gamma": 169.794, "delta": 90.759, "epsilon": 9.773, "zeta": 64.388, "epsilon_zeta": -54.615, "bb_type": "--", "chi": -165.680, "glyco_bond": "anti", "C5prime_xyz": [ -1.760, 8.729, 0.849 ], "P_xyz": [ -0.297, 10.517, -0.382 ], "form": ".", "ssZp": 1.972, "Dp": 2.259, "splay_angle": 88.754, "splay_distance": 13.323, "splay_ratio": 0.700, "d22": null, "d64": null, "eta": 150.936, "theta": 129.526, "eta_prime": 153.318, "theta_prime": 103.544, "eta_base": 132.894, "theta_base": 59.364, "v0": -5.465, "v1": -14.229, "v2": 27.136, "v3": -31.294, "v4": 23.219, "amplitude": 30.941, "phase_angle": 28.714, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "1c", "suiteness": 0.011, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 32.451, 33.650, 24.618 ], "x_axis": [ 0.223, -0.799, 0.559 ], "y_axis": [ 0.774, -0.203, -0.599 ], "z_axis": [ 0.592, 0.567, 0.573 ], "quaternion": [ 0.631, -0.462, 0.013, -0.623 ] } }, { "index": 45, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 74.798, "beta": 166.981, "gamma": 80.402, "delta": 86.031, "epsilon": -170.736, "zeta": -65.632, "epsilon_zeta": -105.105, "bb_type": "BI", "chi": -141.681, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.652, -0.637 ], "P_xyz": [ 0.823, 8.765, -2.108 ], "form": ".", "ssZp": 3.993, "Dp": 4.517, "splay_angle": 53.400, "splay_distance": 7.992, "splay_ratio": 0.450, "d22": null, "d64": null, "eta": 35.750, "theta": -110.174, "eta_prime": 38.894, "theta_prime": -113.150, "eta_base": 41.697, "theta_base": -79.448, "v0": 4.957, "v1": -27.664, "v2": 38.161, "v3": -36.348, "v4": 19.933, "amplitude": 38.928, "phase_angle": 11.389, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 35.326, 31.540, 11.782 ], "x_axis": [ 0.503, -0.712, 0.491 ], "y_axis": [ 0.161, 0.634, 0.756 ], "z_axis": [ -0.850, -0.301, 0.433 ], "quaternion": [ 0.802, 0.330, -0.418, -0.272 ] } }, { "index": 46, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 168.643, "beta": -129.998, "gamma": 167.701, "delta": 88.760, "epsilon": -162.228, "zeta": -65.484, "epsilon_zeta": -96.743, "bb_type": "BI", "chi": -134.264, "glyco_bond": "anti", "C5prime_xyz": [ -1.001, 8.429, -0.990 ], "P_xyz": [ 0.102, 7.992, -3.344 ], "form": ".", "ssZp": 3.486, "Dp": 4.523, "splay_angle": 19.554, "splay_distance": 3.731, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": -178.196, "theta": -117.781, "eta_prime": -135.852, "theta_prime": -137.645, "eta_base": -78.617, "theta_base": -131.920, "v0": 10.695, "v1": -29.993, "v2": 36.629, "v3": -31.547, "v4": 13.314, "amplitude": 36.654, "phase_angle": 2.120, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.349, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 35.514, 29.085, 19.385 ], "x_axis": [ -0.045, 0.127, 0.991 ], "y_axis": [ -0.722, 0.681, -0.120 ], "z_axis": [ -0.690, -0.721, 0.061 ], "quaternion": [ 0.651, 0.231, -0.645, 0.326 ] } }, { "index": 47, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": 124.217, "beta": -142.941, "gamma": -154.855, "delta": 81.681, "epsilon": -162.210, "zeta": -68.323, "epsilon_zeta": -93.887, "bb_type": "BI", "chi": -167.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.823, 0.815 ], "P_xyz": [ -1.389, 10.759, -0.897 ], "form": "A", "ssZp": 4.427, "Dp": 4.448, "splay_angle": 21.815, "splay_distance": 3.492, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": -175.256, "theta": 168.059, "eta_prime": -156.829, "theta_prime": -179.882, "eta_base": -124.673, "theta_base": -137.741, "v0": -5.065, "v1": -20.999, "v2": 37.610, "v3": -41.500, "v4": 29.330, "amplitude": 41.625, "phase_angle": 25.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.038, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 34.622, 26.477, 21.899 ], "x_axis": [ -0.232, 0.320, 0.919 ], "y_axis": [ -0.783, 0.499, -0.372 ], "z_axis": [ -0.577, -0.806, 0.135 ], "quaternion": [ 0.592, 0.183, -0.632, 0.466 ] } }, { "index": 48, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.527, "beta": 172.688, "gamma": 55.640, "delta": 83.843, "epsilon": -160.447, "zeta": -64.862, "epsilon_zeta": -95.586, "bb_type": "BI", "chi": -156.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.837, 0.261 ], "P_xyz": [ 1.185, 9.316, 0.338 ], "form": "A", "ssZp": 4.249, "Dp": 4.466, "splay_angle": 20.779, "splay_distance": 3.343, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 173.686, "theta": -143.598, "eta_prime": -169.318, "theta_prime": -144.781, "eta_base": -117.954, "theta_base": -115.776, "v0": 1.430, "v1": -23.930, "v2": 35.952, "v3": -36.205, "v4": 21.959, "amplitude": 37.498, "phase_angle": 16.514, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 33.547, 23.875, 23.967 ], "x_axis": [ -0.740, 0.426, 0.520 ], "y_axis": [ -0.527, 0.114, -0.842 ], "z_axis": [ -0.418, -0.898, 0.140 ], "quaternion": [ 0.358, 0.039, -0.655, 0.664 ] } }, { "index": 49, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.439, "beta": -178.307, "gamma": 50.768, "delta": 83.604, "epsilon": -148.633, "zeta": -77.602, "epsilon_zeta": -71.031, "bb_type": "BI", "chi": -153.654, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.766, 0.152 ], "P_xyz": [ 1.163, 9.296, 0.424 ], "form": "A", "ssZp": 4.219, "Dp": 4.574, "splay_angle": 22.760, "splay_distance": 3.864, "splay_ratio": 0.201, "d22": 4.173, "d64": 4.601, "eta": 166.695, "theta": -147.575, "eta_prime": -179.723, "theta_prime": -148.091, "eta_base": -136.728, "theta_base": -142.003, "v0": 0.733, "v1": -23.248, "v2": 35.621, "v3": -36.309, "v4": 22.485, "amplitude": 37.374, "phase_angle": 17.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.843, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 31.964, 21.491, 25.695 ], "x_axis": [ -0.836, 0.543, -0.078 ], "y_axis": [ -0.064, -0.237, -0.970 ], "z_axis": [ -0.545, -0.805, 0.232 ], "quaternion": [ 0.200, -0.205, -0.585, 0.759 ] } }, { "index": 50, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "U", "nt_code": "U", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -61.290, "beta": 166.595, "gamma": 51.383, "delta": 79.042, "epsilon": -133.743, "zeta": -74.376, "epsilon_zeta": -59.367, "bb_type": "BI", "chi": -161.944, "glyco_bond": "anti", "C5prime_xyz": [ -2.114, 8.909, 0.481 ], "P_xyz": [ 0.265, 9.958, 0.736 ], "form": ".", "ssZp": 4.272, "Dp": 4.483, "splay_angle": 35.220, "splay_distance": 5.712, "splay_ratio": 0.303, "d22": null, "d64": null, "eta": 168.311, "theta": -129.551, "eta_prime": 177.504, "theta_prime": -118.934, "eta_base": -166.657, "theta_base": -66.926, "v0": -9.621, "v1": -16.779, "v2": 35.180, "v3": -41.662, "v4": 32.334, "amplitude": 41.343, "phase_angle": 31.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.937, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 30.412, 19.133, 28.334 ], "x_axis": [ -0.588, 0.687, -0.427 ], "y_axis": [ 0.174, -0.408, -0.896 ], "z_axis": [ -0.790, -0.601, 0.121 ], "quaternion": [ 0.176, -0.418, -0.515, 0.727 ] } }, { "index": 51, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -36.641, "beta": 147.169, "gamma": 61.218, "delta": 86.773, "epsilon": 169.478, "zeta": -115.368, "epsilon_zeta": -75.154, "bb_type": "BI", "chi": -143.892, "glyco_bond": "anti", "C5prime_xyz": [ -2.072, 8.905, -0.728 ], "P_xyz": [ 0.467, 9.445, -1.060 ], "form": ".", "ssZp": 3.039, "Dp": 3.505, "splay_angle": 27.245, "splay_distance": 4.401, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 176.587, "theta": -172.416, "eta_prime": -143.552, "theta_prime": -178.497, "eta_base": -77.244, "theta_base": -160.549, "v0": -9.429, "v1": -12.790, "v2": 28.612, "v3": -35.080, "v4": 28.052, "amplitude": 34.580, "phase_angle": 34.168, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.276, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 25.874, 19.463, 24.880 ], "x_axis": [ -0.135, 0.047, -0.990 ], "y_axis": [ 0.374, -0.923, -0.094 ], "z_axis": [ -0.918, -0.382, 0.107 ], "quaternion": [ -0.111, -0.648, -0.162, 0.736 ] } }, { "index": 52, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,non-pair-contact,internal-loop,cap-donor,phosphate", "alpha": -174.885, "beta": -138.220, "gamma": 144.123, "delta": 85.739, "epsilon": 69.022, "zeta": 89.487, "epsilon_zeta": -20.465, "bb_type": "--", "chi": -155.323, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.664, 0.283 ], "P_xyz": [ 1.242, 8.522, -0.641 ], "form": ".", "ssZp": 1.549, "Dp": 2.260, "splay_angle": 84.271, "splay_distance": 12.761, "splay_ratio": 0.672, "d22": null, "d64": null, "eta": -147.662, "theta": -157.160, "eta_prime": -155.106, "theta_prime": -150.309, "eta_base": -140.286, "theta_base": -122.875, "v0": 8.916, "v1": -24.871, "v2": 30.374, "v3": -26.468, "v4": 11.166, "amplitude": 30.400, "phase_angle": 2.356, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 22.713, 18.454, 27.770 ], "x_axis": [ -0.023, -0.347, -0.938 ], "y_axis": [ 0.395, -0.865, 0.310 ], "z_axis": [ -0.919, -0.363, 0.156 ], "quaternion": [ -0.259, -0.649, -0.018, 0.715 ] } }, { "index": 53, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate", "alpha": -139.849, "beta": -173.226, "gamma": 66.679, "delta": 81.881, "epsilon": -150.803, "zeta": -67.354, "epsilon_zeta": -83.449, "bb_type": "BI", "chi": -166.966, "glyco_bond": "anti", "C5prime_xyz": [ -1.229, 8.658, 0.966 ], "P_xyz": [ 1.381, 8.919, 1.076 ], "form": ".", "ssZp": 4.651, "Dp": 4.676, "splay_angle": 37.676, "splay_distance": 6.212, "splay_ratio": 0.332, "d22": null, "d64": null, "eta": -171.361, "theta": -101.338, "eta_prime": -152.669, "theta_prime": -101.142, "eta_base": -127.882, "theta_base": -71.276, "v0": 4.127, "v1": -28.079, "v2": 40.243, "v3": -38.764, "v4": 21.863, "amplitude": 41.289, "phase_angle": 12.924, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 15.656, 12.683, 36.700 ], "x_axis": [ 0.077, -0.867, -0.493 ], "y_axis": [ 0.971, 0.178, -0.161 ], "z_axis": [ 0.227, -0.466, 0.855 ], "quaternion": [ 0.726, 0.105, 0.248, -0.632 ] } }, { "index": 54, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate", "alpha": 146.761, "beta": -133.962, "gamma": -174.643, "delta": 85.682, "epsilon": -129.770, "zeta": -89.502, "epsilon_zeta": -40.268, "bb_type": "--", "chi": 171.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.945, 8.304, 1.962 ], "P_xyz": [ -0.292, 10.070, 0.933 ], "form": "A", "ssZp": 4.395, "Dp": 4.553, "splay_angle": 23.981, "splay_distance": 3.673, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -177.859, "theta": -170.652, "eta_prime": -146.104, "theta_prime": -165.034, "eta_base": -83.062, "theta_base": -131.893, "v0": 0.426, "v1": -23.259, "v2": 35.925, "v3": -36.766, "v4": 22.931, "amplitude": 37.783, "phase_angle": 18.041, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.532, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 17.325, 6.703, 36.913 ], "x_axis": [ 0.805, -0.466, -0.366 ], "y_axis": [ 0.577, 0.757, 0.306 ], "z_axis": [ 0.135, -0.457, 0.879 ], "quaternion": [ 0.928, 0.206, 0.135, -0.281 ] } }, { "index": 55, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.268, "beta": 167.837, "gamma": 54.399, "delta": 87.452, "epsilon": -156.909, "zeta": -64.265, "epsilon_zeta": -92.644, "bb_type": "BI", "chi": -165.590, "glyco_bond": "anti", "C5prime_xyz": [ -1.354, 8.610, 0.871 ], "P_xyz": [ 1.256, 8.758, 1.179 ], "form": "A", "ssZp": 4.418, "Dp": 4.494, "splay_angle": 21.772, "splay_distance": 3.537, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 162.782, "theta": -135.581, "eta_prime": 177.514, "theta_prime": -138.454, "eta_base": -138.852, "theta_base": -115.717, "v0": 4.525, "v1": -25.418, "v2": 35.364, "v3": -33.797, "v4": 18.510, "amplitude": 36.103, "phase_angle": 11.611, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.607, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 17.092, 3.964, 39.349 ], "x_axis": [ 0.986, 0.132, -0.099 ], "y_axis": [ -0.073, 0.887, 0.456 ], "z_axis": [ 0.148, -0.443, 0.884 ], "quaternion": [ 0.969, 0.232, 0.064, 0.053 ] } }, { "index": 56, "index_chain": 27, "chain_name": "D", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.822, "beta": 178.390, "gamma": 53.667, "delta": 80.956, "epsilon": -155.006, "zeta": -74.547, "epsilon_zeta": -80.458, "bb_type": "BI", "chi": -156.990, "glyco_bond": "anti", "C5prime_xyz": [ -1.618, 8.802, 0.277 ], "P_xyz": [ 0.909, 9.482, 0.442 ], "form": "A", "ssZp": 4.308, "Dp": 4.571, "splay_angle": 19.034, "splay_distance": 3.019, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 165.852, "theta": -152.262, "eta_prime": -177.796, "theta_prime": -153.186, "eta_base": -135.910, "theta_base": -130.920, "v0": -0.748, "v1": -24.098, "v2": 38.378, "v3": -39.770, "v4": 25.555, "amplitude": 40.730, "phase_angle": 19.563, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 18.493, 1.359, 41.288 ], "x_axis": [ 0.794, 0.575, 0.198 ], "y_axis": [ -0.583, 0.628, 0.515 ], "z_axis": [ 0.172, -0.525, 0.834 ], "quaternion": [ 0.902, 0.288, -0.007, 0.321 ] } }, { "index": 57, "index_chain": 28, "chain_name": "D", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -79.187, "beta": 178.441, "gamma": 53.902, "delta": 79.683, "epsilon": -149.257, "zeta": -61.019, "epsilon_zeta": -88.238, "bb_type": "BI", "chi": -154.151, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 8.725, 0.175 ], "P_xyz": [ 1.396, 9.122, -0.089 ], "form": "A", "ssZp": 4.366, "Dp": 4.735, "splay_angle": 22.176, "splay_distance": 3.749, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 157.605, "theta": -136.285, "eta_prime": 166.554, "theta_prime": -135.357, "eta_base": -157.845, "theta_base": -112.897, "v0": 5.088, "v1": -29.284, "v2": 41.074, "v3": -39.016, "v4": 21.461, "amplitude": 41.941, "phase_angle": 11.668, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.803, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 19.990, -0.558, 43.077 ], "x_axis": [ 0.335, 0.893, 0.301 ], "y_axis": [ -0.847, 0.145, 0.511 ], "z_axis": [ 0.413, -0.426, 0.805 ], "quaternion": [ 0.756, 0.310, 0.037, 0.576 ] } }, { "index": 58, "index_chain": 29, "chain_name": "D", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///D/29", "linked_nts": [ "///D/28", null ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -68.581, "beta": -171.895, "gamma": 48.658, "delta": 73.434, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -146.673, "glyco_bond": "anti", "C5prime_xyz": [ -1.635, 8.914, -0.317 ], "P_xyz": [ 0.818, 9.841, -0.161 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.874, "v1": -21.150, "v2": 36.707, "v3": -39.996, "v4": 27.620, "amplitude": 40.186, "phase_angle": 24.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.747, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 23.094, 0.017, 45.098 ], "x_axis": [ -0.325, 0.924, 0.200 ], "y_axis": [ -0.793, -0.382, 0.475 ], "z_axis": [ 0.516, -0.004, 0.857 ], "quaternion": [ 0.536, 0.224, 0.147, 0.800 ] } } ], "num_hbonds": 628, "hbonds": [ { "index": 1, "atom1_serNum": 12, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/1/O2", "atom2_id": "///C/29/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 615, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///C/1/O2", "atom2_id": "///C/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 13, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///C/1/N3", "atom2_id": "///C/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 35, "atom2_serNum": 590, "donAcc_type": "questionable", "distance": 2.998, "atom1_id": "///C/2/N6", "atom2_id": "///C/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 36, "atom2_serNum": 589, "donAcc_type": "questionable", "distance": 2.552, "atom1_id": "///C/2/N1", "atom2_id": "///C/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 36, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///C/2/N1", "atom2_id": "///C/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 57, "atom2_serNum": 571, "donAcc_type": "questionable", "distance": 2.564, "atom1_id": "///C/3/O4", "atom2_id": "///C/27/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 77, "atom2_serNum": 550, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///C/4/N6", "atom2_id": "///C/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 78, "atom2_serNum": 548, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/4/N1", "atom2_id": "///C/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 96, "atom2_serNum": 530, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/5/O2", "atom2_id": "///C/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 97, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/5/N3", "atom2_id": "///C/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 99, "atom2_serNum": 527, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/5/N4", "atom2_id": "///C/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 116, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/6/O2", "atom2_id": "///C/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 132, "atom2_serNum": 145, "donAcc_type": "acceptable", "distance": 1.992, "atom1_id": "///C/7/O2'", "atom2_id": "///C/8/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 132, "atom2_serNum": 148, "donAcc_type": "acceptable", "distance": 2.218, "atom1_id": "///C/7/O2'", "atom2_id": "///C/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 143, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/8/OP1", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 17, "atom1_serNum": 152, "atom2_serNum": 477, "donAcc_type": "acceptable", "distance": 2.273, "atom1_id": "///C/8/O2'", "atom2_id": "///C/23/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 152, "atom2_serNum": 496, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///C/8/O2'", "atom2_id": "///C/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 166, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/9/OP1", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 20, "atom1_serNum": 167, "atom2_serNum": 1410, "donAcc_type": "acceptable", "distance": 2.443, "atom1_id": "///C/9/OP2", "atom2_id": "///A/57/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 168, "atom2_serNum": 487, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///C/9/O5'", "atom2_id": "///C/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 179, "atom2_serNum": 464, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///C/9/N7", "atom2_id": "///C/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 182, "atom2_serNum": 465, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/9/N6", "atom2_id": "///C/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 197, "atom2_serNum": 210, "donAcc_type": "acceptable", "distance": 2.441, "atom1_id": "///C/10/O2'", "atom2_id": "///C/11/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 204, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///C/10/N6", "atom2_id": "///C/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 205, "atom2_serNum": 439, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/10/N1", "atom2_id": "///C/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 226, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///C/11/N6", "atom2_id": "///C/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 226, "atom2_serNum": 421, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/11/N6", "atom2_id": "///C/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 226, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///C/11/N6", "atom2_id": "///A/60/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 30, "atom1_serNum": 227, "atom2_serNum": 419, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///C/11/N1", "atom2_id": "///C/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 245, "atom2_serNum": 401, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/12/O2", "atom2_id": "///C/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 246, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/12/N3", "atom2_id": "///C/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 248, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/12/N4", "atom2_id": "///C/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 248, "atom2_serNum": 1427, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/12/N4", "atom2_id": "///A/60/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 35, "atom1_serNum": 265, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///C/13/O2", "atom2_id": "///C/18/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 266, "atom2_serNum": 375, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/13/N3", "atom2_id": "///C/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 281, "atom2_serNum": 296, "donAcc_type": "acceptable", "distance": 2.990, "atom1_id": "///C/14/O2'", "atom2_id": "///C/15/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 281, "atom2_serNum": 297, "donAcc_type": "acceptable", "distance": 2.465, "atom1_id": "///C/14/O2'", "atom2_id": "///C/15/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 289, "atom2_serNum": 1440, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///C/14/N1", "atom2_id": "///A/62/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 40, "atom1_serNum": 291, "atom2_serNum": 1440, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/14/N2", "atom2_id": "///A/62/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 41, "atom1_serNum": 291, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/14/N2", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 292, "atom2_serNum": 353, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///C/14/N3", "atom2_id": "///C/17/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 304, "atom2_serNum": 315, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///C/15/O2'", "atom2_id": "///C/16/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 304, "atom2_serNum": 317, "donAcc_type": "acceptable", "distance": 2.460, "atom1_id": "///C/15/O2'", "atom2_id": "///C/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 304, "atom2_serNum": 339, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///C/15/O2'", "atom2_id": "///C/17/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 304, "atom2_serNum": 342, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///C/15/O2'", "atom2_id": "///C/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 337, "atom2_serNum": 1547, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///C/17/OP1", "atom2_id": "///A/77/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 372, "atom2_serNum": 1456, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///C/18/N7", "atom2_id": "///A/64/ND1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 375, "atom2_serNum": 1456, "donAcc_type": "acceptable", "distance": 3.123, "atom1_id": "///C/18/O6", "atom2_id": "///A/64/ND1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 50, "atom1_serNum": 395, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/19/N7", "atom2_id": "///A/56/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 51, "atom1_serNum": 398, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/19/O6", "atom2_id": "///A/56/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 52, "atom1_serNum": 421, "atom2_serNum": 1376, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///C/20/O4", "atom2_id": "///A/54/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 53, "atom1_serNum": 426, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/21/OP2", "atom2_id": "///A/249/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 441, "atom2_serNum": 1375, "donAcc_type": "standard", "distance": 3.914, "atom1_id": "///C/21/O4", "atom2_id": "///A/54/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 445, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///C/22/OP1", "atom2_id": "///B/305/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 446, "atom2_serNum": 5774, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///C/22/OP2", "atom2_id": "///B/305/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 454, "atom2_serNum": 470, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///C/22/O2'", "atom2_id": "///C/23/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 461, "atom2_serNum": 2810, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/22/O6", "atom2_id": "///A/241/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 59, "atom1_serNum": 477, "atom2_serNum": 493, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///C/23/O2'", "atom2_id": "///C/24/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 487, "atom2_serNum": 1410, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///C/23/N2", "atom2_id": "///A/57/OH", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 61, "atom1_serNum": 498, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///C/24/O3'", "atom2_id": "///A/145/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 504, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/24/O2", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 511, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///C/25/OP1", "atom2_id": "///A/145/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 630, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/1/O2", "atom2_id": "///D/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 631, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/1/N3", "atom2_id": "///D/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 633, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/1/N4", "atom2_id": "///D/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 653, "atom2_serNum": 1210, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/2/N6", "atom2_id": "///D/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 654, "atom2_serNum": 1208, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/2/N1", "atom2_id": "///D/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 673, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///D/3/N3", "atom2_id": "///D/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 675, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///D/3/O4", "atom2_id": "///D/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 695, "atom2_serNum": 1168, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///D/4/N6", "atom2_id": "///D/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 696, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///D/4/N1", "atom2_id": "///D/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 714, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/5/O2", "atom2_id": "///D/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 715, "atom2_serNum": 1146, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/5/N3", "atom2_id": "///D/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 717, "atom2_serNum": 1145, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///D/5/N4", "atom2_id": "///D/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 734, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///D/6/O2", "atom2_id": "///D/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 750, "atom2_serNum": 763, "donAcc_type": "acceptable", "distance": 2.099, "atom1_id": "///D/7/O2'", "atom2_id": "///D/8/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 750, "atom2_serNum": 766, "donAcc_type": "acceptable", "distance": 2.261, "atom1_id": "///D/7/O2'", "atom2_id": "///D/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 761, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///D/8/OP1", "atom2_id": "///B/144/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 80, "atom1_serNum": 770, "atom2_serNum": 1095, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///D/8/O2'", "atom2_id": "///D/23/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 770, "atom2_serNum": 1114, "donAcc_type": "acceptable", "distance": 2.677, "atom1_id": "///D/8/O2'", "atom2_id": "///D/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 784, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///D/9/OP1", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 785, "atom2_serNum": 3868, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///D/9/OP2", "atom2_id": "///B/57/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 84, "atom1_serNum": 786, "atom2_serNum": 1105, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///D/9/O5'", "atom2_id": "///D/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 789, "atom2_serNum": 1095, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///D/9/O4'", "atom2_id": "///D/23/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 797, "atom2_serNum": 1082, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///D/9/N7", "atom2_id": "///D/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 800, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///D/9/N6", "atom2_id": "///D/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 815, "atom2_serNum": 828, "donAcc_type": "acceptable", "distance": 2.378, "atom1_id": "///D/10/O2'", "atom2_id": "///D/11/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 822, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///D/10/N6", "atom2_id": "///D/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 823, "atom2_serNum": 1057, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///D/10/N1", "atom2_id": "///D/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 837, "atom2_serNum": 855, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///D/11/O2'", "atom2_id": "///D/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 844, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/11/N6", "atom2_id": "///D/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 844, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///D/11/N6", "atom2_id": "///B/60/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 845, "atom2_serNum": 1037, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///D/11/N1", "atom2_id": "///D/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 859, "atom2_serNum": 875, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///D/12/O2'", "atom2_id": "///D/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 863, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///D/12/O2", "atom2_id": "///D/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 864, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/12/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 866, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///D/12/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 866, "atom2_serNum": 3885, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/12/N4", "atom2_id": "///B/60/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 883, "atom2_serNum": 994, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///D/13/O2", "atom2_id": "///D/18/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 884, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///D/13/N3", "atom2_id": "///D/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 899, "atom2_serNum": 971, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///D/14/O2'", "atom2_id": "///D/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 899, "atom2_serNum": 972, "donAcc_type": "acceptable", "distance": 2.512, "atom1_id": "///D/14/O2'", "atom2_id": "///D/17/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 909, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/14/N2", "atom2_id": "///D/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 922, "atom2_serNum": 935, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///D/15/O2'", "atom2_id": "///D/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 926, "atom2_serNum": 956, "donAcc_type": "questionable", "distance": 2.957, "atom1_id": "///D/15/O2", "atom2_id": "///D/17/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 927, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 2.485, "atom1_id": "///D/15/N3", "atom2_id": "///B/63/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 929, "atom2_serNum": 3898, "donAcc_type": "questionable", "distance": 2.605, "atom1_id": "///D/15/O4", "atom2_id": "///B/62/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 962, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///D/17/O3'", "atom2_id": "///B/77/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 990, "atom2_serNum": 3914, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///D/18/N7", "atom2_id": "///B/64/ND1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 111, "atom1_serNum": 993, "atom2_serNum": 3914, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///D/18/O6", "atom2_id": "///B/64/ND1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 1013, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/19/N7", "atom2_id": "///B/56/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 113, "atom1_serNum": 1016, "atom2_serNum": 3855, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///D/19/O6", "atom2_id": "///B/56/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 1032, "atom2_serNum": 1048, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///D/20/O2'", "atom2_id": "///D/21/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1039, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///D/20/O4", "atom2_id": "///B/54/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 116, "atom1_serNum": 1039, "atom2_serNum": 3834, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/20/O4", "atom2_id": "///B/54/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 1039, "atom2_serNum": 3855, "donAcc_type": "standard", "distance": 3.698, "atom1_id": "///D/20/O4", "atom2_id": "///B/56/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 118, "atom1_serNum": 1059, "atom2_serNum": 3834, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///D/21/O4", "atom2_id": "///B/54/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 119, "atom1_serNum": 1072, "atom2_serNum": 1087, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///D/22/O2'", "atom2_id": "///D/23/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1072, "atom2_serNum": 1088, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///D/22/O2'", "atom2_id": "///D/23/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 1072, "atom2_serNum": 1091, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///D/22/O2'", "atom2_id": "///D/23/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1079, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///D/22/O6", "atom2_id": "///B/241/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 123, "atom1_serNum": 1095, "atom2_serNum": 1109, "donAcc_type": "acceptable", "distance": 2.491, "atom1_id": "///D/23/O2'", "atom2_id": "///D/24/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1095, "atom2_serNum": 1111, "donAcc_type": "acceptable", "distance": 2.583, "atom1_id": "///D/23/O2'", "atom2_id": "///D/24/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 1105, "atom2_serNum": 3868, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///D/23/N2", "atom2_id": "///B/57/OH", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 126, "atom1_serNum": 1122, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///D/24/O2", "atom2_id": "///B/144/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 127, "atom1_serNum": 1129, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///D/25/OP1", "atom2_id": "///B/145/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 128, "atom1_serNum": 1244, "atom2_serNum": 1619, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/39/O", "atom2_id": "///A/86/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1252, "atom2_serNum": 1609, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/41/N", "atom2_id": "///A/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1255, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/41/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1263, "atom2_serNum": 1279, "donAcc_type": "acceptable", "distance": 3.853, "atom1_id": "///A/41/OH", "atom2_id": "///A/43/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1272, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/43/N", "atom2_id": "///A/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1275, "atom2_serNum": 1289, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///A/43/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1275, "atom2_serNum": 1589, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/43/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1289, "atom2_serNum": 1576, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/45/N", "atom2_id": "///A/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1297, "atom2_serNum": 1576, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/46/N", "atom2_id": "///A/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1300, "atom2_serNum": 1573, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/46/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1304, "atom2_serNum": 1492, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/46/OE1", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1304, "atom2_serNum": 1553, "donAcc_type": "acceptable", "distance": 2.505, "atom1_id": "///A/46/OE1", "atom2_id": "///A/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1309, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///A/47/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1313, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/47/OE1", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1322, "atom2_serNum": 1479, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/49/N", "atom2_id": "///A/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1330, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/49/NZ", "atom2_id": "///A/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1334, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/50/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1338, "atom2_serNum": 2766, "donAcc_type": "questionable", "distance": 3.124, "atom1_id": "///A/50/OE1", "atom2_id": "///A/236/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1358, "atom2_serNum": 2796, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/53/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1375, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/54/NH1", "atom2_id": "///A/60/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1377, "atom2_serNum": 2794, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/55/N", "atom2_id": "///A/239/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1388, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/56/N", "atom2_id": "///A/139/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1391, "atom2_serNum": 2013, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/56/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1397, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/56/NH1", "atom2_id": "///A/60/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1399, "atom2_serNum": 1432, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/57/N", "atom2_id": "///A/60/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1402, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/57/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1414, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/58/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1427, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/60/O", "atom2_id": "///A/64/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1467, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///A/66/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1468, "atom2_serNum": 1988, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/67/N", "atom2_id": "///A/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1483, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/69/N", "atom2_id": "///A/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1486, "atom2_serNum": 1498, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/69/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1503, "atom2_serNum": 1548, "donAcc_type": "acceptable", "distance": 3.210, "atom1_id": "///A/72/OG", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1504, "atom2_serNum": 1533, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/73/N", "atom2_id": "///A/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1569, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/80/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1582, "atom2_serNum": 1953, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/82/N", "atom2_id": "///A/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1585, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/82/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1598, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/84/N", "atom2_id": "///A/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1631, "atom2_serNum": 1646, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///A/87/OH", "atom2_id": "///A/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1650, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/91/N", "atom2_id": "///A/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1653, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/91/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1655, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/92/N", "atom2_id": "///A/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1658, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/92/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1663, "atom2_serNum": 2200, "donAcc_type": "acceptable", "distance": 2.730, "atom1_id": "///A/92/NZ", "atom2_id": "///A/163/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1664, "atom2_serNum": 1891, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/93/N", "atom2_id": "///A/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1667, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/93/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1671, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/94/N", "atom2_id": "///A/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1674, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/94/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1679, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/95/N", "atom2_id": "///A/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1682, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/95/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1686, "atom2_serNum": 2586, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/96/N", "atom2_id": "///A/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1689, "atom2_serNum": 2583, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/96/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1694, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/96/NE2", "atom2_id": "///A/164/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1698, "atom2_serNum": 1772, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/97/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1703, "atom2_serNum": 2567, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/98/N", "atom2_id": "///A/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1706, "atom2_serNum": 2564, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/98/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1710, "atom2_serNum": 1757, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/99/N", "atom2_id": "///A/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1715, "atom2_serNum": 1741, "donAcc_type": "acceptable", "distance": 3.762, "atom1_id": "///A/99/OG1", "atom2_id": "///A/103/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1715, "atom2_serNum": 1754, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///A/99/OG1", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1723, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///A/100/OD1", "atom2_id": "///A/211/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1737, "atom2_serNum": 1744, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/102/NZ", "atom2_id": "///A/103/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1749, "atom2_serNum": 2223, "donAcc_type": "questionable", "distance": 3.264, "atom1_id": "///A/104/O", "atom2_id": "///A/167/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1764, "atom2_serNum": 2231, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/106/N", "atom2_id": "///A/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1797, "atom2_serNum": 2008, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/110/N", "atom2_id": "///A/140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1800, "atom2_serNum": 2005, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/110/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1802, "atom2_serNum": 2130, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///A/110/OG", "atom2_id": "///A/154/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1803, "atom2_serNum": 1867, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/111/N", "atom2_id": "///A/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1811, "atom2_serNum": 1996, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/112/N", "atom2_id": "///A/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1814, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/112/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1821, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/113/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1821, "atom2_serNum": 1841, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/113/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1822, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/114/N", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1834, "atom2_serNum": 1881, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/115/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1847, "atom2_serNum": 1871, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/117/N", "atom2_id": "///A/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1850, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/117/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1933, "atom2_serNum": 1935, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/129/OD1", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1933, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/129/OD1", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2000, "atom2_serNum": 2013, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/139/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2008, "atom2_serNum": 2023, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/140/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2019, "atom2_serNum": 2026, "donAcc_type": "acceptable", "distance": 2.598, "atom1_id": "///A/141/ND1", "atom2_id": "///A/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2033, "atom2_serNum": 2055, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/143/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2033, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2035, "atom2_serNum": 2055, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///A/143/OG1", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2040, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/144/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2058, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2058, "atom2_serNum": 2096, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///A/146/O", "atom2_id": "///A/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2067, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2074, "atom2_serNum": 2106, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/148/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2085, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2094, "atom2_serNum": 2120, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2101, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2109, "atom2_serNum": 2139, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2109, "atom2_serNum": 2144, "donAcc_type": "acceptable", "distance": 2.744, "atom1_id": "///A/152/O", "atom2_id": "///A/156/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2118, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2123, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2134, "atom2_serNum": 2160, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2142, "atom2_serNum": 2160, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/156/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2142, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2149, "atom2_serNum": 2174, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2158, "atom2_serNum": 2185, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2158, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/158/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2188, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/162/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2188, "atom2_serNum": 2309, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///A/162/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2204, "atom2_serNum": 2228, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2207, "atom2_serNum": 2607, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///A/164/OD1", "atom2_id": "///A/215/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2208, "atom2_serNum": 2709, "donAcc_type": "questionable", "distance": 2.789, "atom1_id": "///A/164/ND2", "atom2_id": "///A/228/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2212, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2212, "atom2_serNum": 2243, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/165/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2239, "atom2_serNum": 2494, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/169/O", "atom2_id": "///A/201/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2246, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/170/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2252, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/170/NE2", "atom2_id": "///A/172/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2256, "atom2_serNum": 2275, "donAcc_type": "standard", "distance": 3.803, "atom1_id": "///A/171/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2270, "atom2_serNum": 2292, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/173/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2278, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 2.467, "atom1_id": "///A/174/O", "atom2_id": "///A/177/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2291, "atom2_serNum": 2405, "donAcc_type": "acceptable", "distance": 2.502, "atom1_id": "///A/175/OH", "atom2_id": "///A/190/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2303, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///A/177/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2330, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///A/181/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2371, "atom2_serNum": 2404, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/187/N", "atom2_id": "///A/190/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2374, "atom2_serNum": 2406, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2376, "atom2_serNum": 2397, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "///A/187/OG1", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2381, "atom2_serNum": 2415, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2389, "atom2_serNum": 2395, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/189/O", "atom2_id": "///A/189/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2389, "atom2_serNum": 2424, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2400, "atom2_serNum": 2432, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2409, "atom2_serNum": 2440, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2418, "atom2_serNum": 2451, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2422, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/192/OE1", "atom2_id": "///A/195/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2422, "atom2_serNum": 2450, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/192/OE1", "atom2_id": "///A/195/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2427, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2435, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2443, "atom2_serNum": 2470, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2454, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2463, "atom2_serNum": 2486, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2468, "atom2_serNum": 2495, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2468, "atom2_serNum": 2500, "donAcc_type": "acceptable", "distance": 2.294, "atom1_id": "///A/198/O", "atom2_id": "///A/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2473, "atom2_serNum": 2500, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///A/199/O", "atom2_id": "///A/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2485, "atom2_serNum": 2510, "donAcc_type": "questionable", "distance": 2.789, "atom1_id": "///A/200/NE2", "atom2_id": "///A/203/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2531, "atom2_serNum": 2553, "donAcc_type": "questionable", "distance": 3.212, "atom1_id": "///A/206/O", "atom2_id": "///A/209/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2534, "atom2_serNum": 2536, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/206/OD1", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2534, "atom2_serNum": 2544, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/206/OD1", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2547, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/208/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2557, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/210/N", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2560, "atom2_serNum": 2768, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/210/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2571, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/211/NE", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2574, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/211/NH2", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2575, "atom2_serNum": 2754, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/212/N", "atom2_id": "///A/234/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2578, "atom2_serNum": 2749, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/212/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2591, "atom2_serNum": 2738, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/214/N", "atom2_id": "///A/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2594, "atom2_serNum": 2735, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/214/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2612, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/216/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2625, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/218/N", "atom2_id": "///A/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2628, "atom2_serNum": 2689, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/218/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2636, "atom2_serNum": 2696, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/219/O", "atom2_id": "///A/227/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2640, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/220/N", "atom2_id": "///A/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2646, "atom2_serNum": 2687, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///A/220/OD1", "atom2_id": "///A/226/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2647, "atom2_serNum": 2659, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///A/220/OD2", "atom2_id": "///A/222/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2647, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/220/OD2", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2647, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/220/OD2", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2659, "atom2_serNum": 2665, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///A/222/OG1", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2659, "atom2_serNum": 2670, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///A/222/OG1", "atom2_id": "///A/224/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2668, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/224/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2685, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/226/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2714, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/229/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2754, "atom2_serNum": 2758, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///A/234/OG", "atom2_id": "///A/235/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2814, "atom2_serNum": 2831, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/242/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2829, "atom2_serNum": 2848, "donAcc_type": "questionable", "distance": 3.347, "atom1_id": "///A/244/OD1", "atom2_id": "///A/247/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2841, "atom2_serNum": 3593, "donAcc_type": "acceptable", "distance": 3.825, "atom1_id": "///A/246/OG", "atom2_id": "///A/339/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2841, "atom2_serNum": 3611, "donAcc_type": "acceptable", "distance": 3.945, "atom1_id": "///A/246/OG", "atom2_id": "///A/341/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2861, "atom2_serNum": 3024, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/249/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2875, "atom2_serNum": 3013, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/251/N", "atom2_id": "///A/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2882, "atom2_serNum": 3013, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/252/N", "atom2_id": "///A/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2885, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/252/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2891, "atom2_serNum": 5745, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/252/NH1", "atom2_id": "///B/302/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2901, "atom2_serNum": 2993, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/254/N", "atom2_id": "///A/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2904, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/254/O", "atom2_id": "///A/255/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2907, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/254/OD1", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2907, "atom2_serNum": 2990, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/254/OD1", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2908, "atom2_serNum": 5366, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///A/254/OD2", "atom2_id": "///B/254/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2923, "atom2_serNum": 3646, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/256/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2932, "atom2_serNum": 3649, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/258/N", "atom2_id": "///A/346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2935, "atom2_serNum": 3666, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/258/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2936, "atom2_serNum": 2971, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/259/N", "atom2_id": "///A/264/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2939, "atom2_serNum": 2956, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/259/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2942, "atom2_serNum": 3669, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/260/N", "atom2_id": "///A/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2945, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/260/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2952, "atom2_serNum": 3399, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/261/O", "atom2_id": "///A/315/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2960, "atom2_serNum": 3380, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/263/N", "atom2_id": "///A/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2964, "atom2_serNum": 3382, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///A/264/N", "atom2_id": "///A/313/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2967, "atom2_serNum": 3377, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/264/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2982, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///A/266/N", "atom2_id": "///A/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2985, "atom2_serNum": 3357, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/266/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 3001, "atom2_serNum": 5349, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///A/267/OH", "atom2_id": "///B/252/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 3002, "atom2_serNum": 3345, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/268/N", "atom2_id": "///A/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 3005, "atom2_serNum": 3342, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/268/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 3021, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/270/O", "atom2_id": "///B/304/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 3030, "atom2_serNum": 5771, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/271/OD1", "atom2_id": "///B/305/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 3030, "atom2_serNum": 5774, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/271/OD1", "atom2_id": "///B/305/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 3041, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/273/N", "atom2_id": "///A/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 3044, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/273/O", "atom2_id": "///A/306/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3051, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/274/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3080, "atom2_serNum": 3559, "donAcc_type": "standard", "distance": 2.502, "atom1_id": "///A/277/OD1", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3090, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/279/N", "atom2_id": "///A/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3093, "atom2_serNum": 3528, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/279/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3097, "atom2_serNum": 3537, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/279/OE1", "atom2_id": "///A/332/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3102, "atom2_serNum": 3238, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/280/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3107, "atom2_serNum": 3514, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/281/N", "atom2_id": "///A/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3110, "atom2_serNum": 3511, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/281/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3114, "atom2_serNum": 3221, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/281/NE", "atom2_id": "///A/293/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3116, "atom2_serNum": 3518, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///A/281/NH1", "atom2_id": "///A/330/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3117, "atom2_serNum": 3221, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/281/NH2", "atom2_id": "///A/293/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3118, "atom2_serNum": 3226, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/282/N", "atom2_id": "///A/294/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3121, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/282/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3129, "atom2_serNum": 3496, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/283/N", "atom2_id": "///A/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3132, "atom2_serNum": 3493, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/283/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3141, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/284/N", "atom2_id": "///A/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3144, "atom2_serNum": 3159, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/284/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3144, "atom2_serNum": 3200, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/284/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3148, "atom2_serNum": 3411, "donAcc_type": "acceptable", "distance": 2.424, "atom1_id": "///A/284/OE1", "atom2_id": "///A/316/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3148, "atom2_serNum": 3420, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/284/OE1", "atom2_id": "///A/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3149, "atom2_serNum": 3411, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///A/284/OE2", "atom2_id": "///A/316/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3159, "atom2_serNum": 3192, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/286/N", "atom2_id": "///A/290/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3166, "atom2_serNum": 3420, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/286/OE1", "atom2_id": "///A/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3221, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///A/293/OE1", "atom2_id": "///A/332/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3242, "atom2_serNum": 3371, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/297/N", "atom2_id": "///A/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3245, "atom2_serNum": 3368, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/297/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3261, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/299/N", "atom2_id": "///A/302/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3264, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/299/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3266, "atom2_serNum": 3279, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///A/299/OG", "atom2_id": "///A/301/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3266, "atom2_serNum": 3287, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///A/299/OG", "atom2_id": "///A/302/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3270, "atom2_serNum": 3289, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/300/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3284, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/302/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3284, "atom2_serNum": 3350, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/302/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3288, "atom2_serNum": 5350, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///A/302/OD2", "atom2_id": "///B/252/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3296, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/304/N", "atom2_id": "///A/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3299, "atom2_serNum": 3326, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/304/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3305, "atom2_serNum": 5479, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/304/NE2", "atom2_id": "///B/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3305, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/304/NE2", "atom2_id": "///B/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3316, "atom2_serNum": 5488, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/305/NH2", "atom2_id": "///B/271/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3329, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/307/O", "atom2_id": "///B/304/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3387, "atom2_serNum": 3665, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///A/314/O", "atom2_id": "///A/347/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3424, "atom2_serNum": 3444, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///A/318/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3427, "atom2_serNum": 3436, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///A/318/OD1", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3475, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/325/N", "atom2_id": "///A/347/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3478, "atom2_serNum": 3654, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/325/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3486, "atom2_serNum": 3638, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/327/N", "atom2_id": "///A/345/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3489, "atom2_serNum": 3635, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/327/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3504, "atom2_serNum": 3622, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/329/N", "atom2_id": "///A/343/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3507, "atom2_serNum": 3619, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/329/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3519, "atom2_serNum": 3600, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/330/NE2", "atom2_id": "///A/340/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3520, "atom2_serNum": 3602, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///A/331/N", "atom2_id": "///A/340/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3523, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/331/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3539, "atom2_serNum": 3584, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/333/N", "atom2_id": "///A/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3542, "atom2_serNum": 3573, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3548, "atom2_serNum": 3571, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/333/NH1", "atom2_id": "///A/336/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3548, "atom2_serNum": 3572, "donAcc_type": "standard", "distance": 2.422, "atom1_id": "///A/333/NH1", "atom2_id": "///A/336/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3571, "atom2_serNum": 3581, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/336/OD1", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3589, "atom2_serNum": 3590, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/338/OE2", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3602, "atom2_serNum": 3606, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///A/340/OG", "atom2_id": "///A/341/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3710, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/41/N", "atom2_id": "///B/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3713, "atom2_serNum": 4064, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/41/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3730, "atom2_serNum": 4050, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/43/N", "atom2_id": "///B/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3733, "atom2_serNum": 3747, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/43/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3733, "atom2_serNum": 4047, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/43/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3747, "atom2_serNum": 4034, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///B/45/N", "atom2_id": "///B/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3755, "atom2_serNum": 4034, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/46/N", "atom2_id": "///B/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3758, "atom2_serNum": 4031, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/46/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3762, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/46/OE1", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3762, "atom2_serNum": 3950, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/46/OE1", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3762, "atom2_serNum": 4011, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///B/46/OE1", "atom2_id": "///B/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3763, "atom2_serNum": 4011, "donAcc_type": "acceptable", "distance": 2.401, "atom1_id": "///B/46/OE2", "atom2_id": "///B/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3767, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/47/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3771, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/47/OE1", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3780, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/49/N", "atom2_id": "///B/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3792, "atom2_serNum": 5234, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/50/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3797, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/50/NE2", "atom2_id": "///B/235/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3816, "atom2_serNum": 5254, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/53/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3834, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/54/NH2", "atom2_id": "///B/60/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3835, "atom2_serNum": 5252, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/55/N", "atom2_id": "///B/239/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3846, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/56/N", "atom2_id": "///B/139/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3849, "atom2_serNum": 4471, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/56/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3855, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/56/NH1", "atom2_id": "///B/60/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3857, "atom2_serNum": 3890, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/57/N", "atom2_id": "///B/60/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3860, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/57/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3872, "atom2_serNum": 3891, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///B/58/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3885, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/60/O", "atom2_id": "///B/64/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3926, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///B/67/N", "atom2_id": "///B/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3941, "atom2_serNum": 4009, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/69/N", "atom2_id": "///B/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3944, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/69/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3961, "atom2_serNum": 4006, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///B/72/OG", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3962, "atom2_serNum": 3991, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/73/N", "atom2_id": "///B/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 4027, "atom2_serNum": 4419, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/80/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 4040, "atom2_serNum": 4411, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/82/N", "atom2_id": "///B/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 4043, "atom2_serNum": 4408, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/82/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 4056, "atom2_serNum": 4396, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/84/N", "atom2_id": "///B/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 4089, "atom2_serNum": 4104, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///B/87/OH", "atom2_id": "///B/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 4108, "atom2_serNum": 4363, "donAcc_type": "standard", "distance": 3.678, "atom1_id": "///B/91/N", "atom2_id": "///B/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 4111, "atom2_serNum": 4358, "donAcc_type": "acceptable", "distance": 3.356, "atom1_id": "///B/91/O", "atom2_id": "///B/124/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 4111, "atom2_serNum": 4360, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/91/O", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 4113, "atom2_serNum": 5075, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/92/N", "atom2_id": "///B/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 4116, "atom2_serNum": 5072, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///B/92/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 4122, "atom2_serNum": 4349, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/93/N", "atom2_id": "///B/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4125, "atom2_serNum": 4346, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/93/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4129, "atom2_serNum": 5063, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/94/N", "atom2_id": "///B/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 4132, "atom2_serNum": 5060, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/94/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4137, "atom2_serNum": 4336, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/95/N", "atom2_id": "///B/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4140, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/95/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4144, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/96/N", "atom2_id": "///B/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4147, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/96/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4156, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/97/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4161, "atom2_serNum": 5025, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/98/N", "atom2_id": "///B/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4164, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/98/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4168, "atom2_serNum": 4215, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/99/N", "atom2_id": "///B/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4173, "atom2_serNum": 4199, "donAcc_type": "acceptable", "distance": 3.636, "atom1_id": "///B/99/OG1", "atom2_id": "///B/103/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4173, "atom2_serNum": 4212, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///B/99/OG1", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4207, "atom2_serNum": 4681, "donAcc_type": "questionable", "distance": 2.843, "atom1_id": "///B/104/O", "atom2_id": "///B/167/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4222, "atom2_serNum": 4689, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///B/106/N", "atom2_id": "///B/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4255, "atom2_serNum": 4466, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///B/110/N", "atom2_id": "///B/140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4258, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/110/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4260, "atom2_serNum": 4588, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///B/110/OG", "atom2_id": "///B/154/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4261, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/111/N", "atom2_id": "///B/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4269, "atom2_serNum": 4454, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/112/N", "atom2_id": "///B/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4272, "atom2_serNum": 4451, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/112/O", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4279, "atom2_serNum": 4299, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/113/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4280, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/114/N", "atom2_id": "///B/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4292, "atom2_serNum": 4339, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///B/115/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4305, "atom2_serNum": 4329, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/117/N", "atom2_id": "///B/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4308, "atom2_serNum": 4326, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/117/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4356, "atom2_serNum": 4365, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/124/O", "atom2_id": "///B/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4365, "atom2_serNum": 4388, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/126/N", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4379, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/128/O", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4391, "atom2_serNum": 4401, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/129/OD1", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4458, "atom2_serNum": 4471, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/139/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4466, "atom2_serNum": 4481, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///B/140/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4477, "atom2_serNum": 4484, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///B/141/ND1", "atom2_id": "///B/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4491, "atom2_serNum": 4513, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/143/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4491, "atom2_serNum": 4522, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4516, "atom2_serNum": 4549, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/146/O", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4516, "atom2_serNum": 4554, "donAcc_type": "acceptable", "distance": 2.640, "atom1_id": "///B/146/O", "atom2_id": "///B/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4525, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/147/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4532, "atom2_serNum": 4564, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/148/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4543, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/149/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4552, "atom2_serNum": 4578, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4559, "atom2_serNum": 4589, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4567, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4576, "atom2_serNum": 4604, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/153/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4581, "atom2_serNum": 4604, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///B/154/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4581, "atom2_serNum": 4613, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/154/O", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4592, "atom2_serNum": 4618, "donAcc_type": "standard", "distance": 3.834, "atom1_id": "///B/155/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4600, "atom2_serNum": 4624, "donAcc_type": "standard", "distance": 3.566, "atom1_id": "///B/156/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4607, "atom2_serNum": 4641, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/157/O", "atom2_id": "///B/161/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4616, "atom2_serNum": 4632, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///B/158/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4616, "atom2_serNum": 4643, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/158/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4616, "atom2_serNum": 4647, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///B/158/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4621, "atom2_serNum": 4643, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/159/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4646, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/162/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4662, "atom2_serNum": 4686, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/164/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4665, "atom2_serNum": 5168, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///B/164/OD1", "atom2_id": "///B/228/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4670, "atom2_serNum": 4701, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/165/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4697, "atom2_serNum": 4952, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/169/O", "atom2_id": "///B/201/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4707, "atom2_serNum": 4711, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///B/170/ND1", "atom2_id": "///B/171/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4707, "atom2_serNum": 4717, "donAcc_type": "acceptable", "distance": 3.501, "atom1_id": "///B/170/ND1", "atom2_id": "///B/172/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4714, "atom2_serNum": 4725, "donAcc_type": "standard", "distance": 2.446, "atom1_id": "///B/171/O", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4714, "atom2_serNum": 4733, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/171/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4749, "atom2_serNum": 4863, "donAcc_type": "acceptable", "distance": 2.561, "atom1_id": "///B/175/OH", "atom2_id": "///B/190/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4788, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/181/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4810, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///B/184/NH1", "atom2_id": "///B/190/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4829, "atom2_serNum": 4862, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///B/187/N", "atom2_id": "///B/190/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4832, "atom2_serNum": 4864, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/187/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4834, "atom2_serNum": 4855, "donAcc_type": "acceptable", "distance": 3.261, "atom1_id": "///B/187/OG1", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4839, "atom2_serNum": 4873, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/188/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4847, "atom2_serNum": 4882, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/189/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4858, "atom2_serNum": 4890, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/190/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4867, "atom2_serNum": 4898, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/191/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4876, "atom2_serNum": 4909, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/192/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4881, "atom2_serNum": 4908, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/192/OE2", "atom2_id": "///B/195/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4881, "atom2_serNum": 4917, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/192/OE2", "atom2_id": "///B/196/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4885, "atom2_serNum": 4918, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/193/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4893, "atom2_serNum": 4923, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/194/O", "atom2_id": "///B/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4901, "atom2_serNum": 4928, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/195/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4912, "atom2_serNum": 4935, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/196/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4921, "atom2_serNum": 4944, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/197/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4926, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/198/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4926, "atom2_serNum": 4958, "donAcc_type": "acceptable", "distance": 2.573, "atom1_id": "///B/198/O", "atom2_id": "///B/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4931, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/199/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4931, "atom2_serNum": 4960, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///B/199/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4943, "atom2_serNum": 4976, "donAcc_type": "standard", "distance": 3.645, "atom1_id": "///B/200/NE2", "atom2_id": "///B/204/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4989, "atom2_serNum": 5011, "donAcc_type": "questionable", "distance": 3.235, "atom1_id": "///B/206/O", "atom2_id": "///B/209/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4992, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///B/206/OD1", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 5005, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/208/O", "atom2_id": "///B/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 5015, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/210/N", "atom2_id": "///B/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 5018, "atom2_serNum": 5226, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/210/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 5029, "atom2_serNum": 5210, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/211/NE", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 5032, "atom2_serNum": 5210, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/211/NH2", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 5033, "atom2_serNum": 5212, "donAcc_type": "acceptable", "distance": 3.337, "atom1_id": "///B/212/N", "atom2_id": "///B/234/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 5036, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/212/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 5049, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/214/N", "atom2_id": "///B/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 5052, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/214/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 5070, "atom2_serNum": 5169, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/216/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 5083, "atom2_serNum": 5150, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///B/218/N", "atom2_id": "///B/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 5086, "atom2_serNum": 5147, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/218/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 5094, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/219/O", "atom2_id": "///B/227/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 5094, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/219/O", "atom2_id": "///B/227/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 5098, "atom2_serNum": 5104, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/220/N", "atom2_id": "///B/220/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 5098, "atom2_serNum": 5126, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/220/N", "atom2_id": "///B/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 5104, "atom2_serNum": 5117, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///B/220/OD1", "atom2_id": "///B/222/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 5104, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/220/OD1", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 5104, "atom2_serNum": 5123, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/220/OD1", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 5104, "atom2_serNum": 5126, "donAcc_type": "questionable", "distance": 2.620, "atom1_id": "///B/220/OD1", "atom2_id": "///B/224/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 5117, "atom2_serNum": 5128, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///B/222/OG1", "atom2_id": "///B/224/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 5126, "atom2_serNum": 5140, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///B/224/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 5143, "atom2_serNum": 5158, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/226/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 5172, "atom2_serNum": 5186, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/229/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 5212, "atom2_serNum": 5216, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///B/234/OG", "atom2_id": "///B/235/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 5252, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/239/OD1", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 5287, "atom2_serNum": 5299, "donAcc_type": "acceptable", "distance": 3.206, "atom1_id": "///B/244/OD1", "atom2_id": "///B/246/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 5288, "atom2_serNum": 5297, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/244/ND2", "atom2_id": "///B/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 5289, "atom2_serNum": 6069, "donAcc_type": "standard", "distance": 2.508, "atom1_id": "///B/245/N", "atom2_id": "///B/341/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 5299, "atom2_serNum": 5311, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///B/246/OG", "atom2_id": "///B/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 5299, "atom2_serNum": 6061, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///B/246/OG", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 5307, "atom2_serNum": 6047, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///B/247/ND2", "atom2_id": "///B/338/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 5319, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/249/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 5328, "atom2_serNum": 6085, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/250/O", "atom2_id": "///B/343/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 5333, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/251/N", "atom2_id": "///B/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 5340, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/252/N", "atom2_id": "///B/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 5343, "atom2_serNum": 5468, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/252/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 5359, "atom2_serNum": 5365, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/254/N", "atom2_id": "///B/254/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5359, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/254/N", "atom2_id": "///B/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5365, "atom2_serNum": 5367, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/254/OD1", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5365, "atom2_serNum": 5448, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/254/OD1", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5377, "atom2_serNum": 5434, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/255/NH2", "atom2_id": "///B/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5381, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/256/O", "atom2_id": "///B/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 5390, "atom2_serNum": 6107, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/258/N", "atom2_id": "///B/346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5393, "atom2_serNum": 6124, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/258/O", "atom2_id": "///B/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 5394, "atom2_serNum": 5429, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///B/259/N", "atom2_id": "///B/264/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 5397, "atom2_serNum": 5414, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/259/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 5400, "atom2_serNum": 6127, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/260/N", "atom2_id": "///B/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5403, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/260/O", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5418, "atom2_serNum": 5838, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/263/N", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5422, "atom2_serNum": 5840, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///B/264/N", "atom2_id": "///B/313/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5425, "atom2_serNum": 5835, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/264/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5440, "atom2_serNum": 5818, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/266/N", "atom2_id": "///B/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5443, "atom2_serNum": 5815, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/266/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5460, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/268/N", "atom2_id": "///B/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5463, "atom2_serNum": 5800, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///B/268/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5476, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/270/N", "atom2_id": "///B/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5479, "atom2_serNum": 5787, "donAcc_type": "questionable", "distance": 3.140, "atom1_id": "///B/270/O", "atom2_id": "///B/307/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5499, "atom2_serNum": 5778, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/273/N", "atom2_id": "///B/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5502, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///B/273/O", "atom2_id": "///B/306/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5509, "atom2_serNum": 5532, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///B/274/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5539, "atom2_serNum": 6017, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/277/OD2", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5548, "atom2_serNum": 5989, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/279/N", "atom2_id": "///B/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5551, "atom2_serNum": 5986, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/279/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5556, "atom2_serNum": 5993, "donAcc_type": "questionable", "distance": 2.699, "atom1_id": "///B/279/NE2", "atom2_id": "///B/332/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5560, "atom2_serNum": 5696, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/280/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5565, "atom2_serNum": 5972, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/281/N", "atom2_id": "///B/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5568, "atom2_serNum": 5969, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/281/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5572, "atom2_serNum": 5680, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///B/281/NE", "atom2_id": "///B/293/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5574, "atom2_serNum": 5976, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/281/NH1", "atom2_id": "///B/330/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5575, "atom2_serNum": 5680, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/281/NH2", "atom2_id": "///B/293/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5576, "atom2_serNum": 5684, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///B/282/N", "atom2_id": "///B/294/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5579, "atom2_serNum": 5681, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///B/282/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5587, "atom2_serNum": 5954, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/283/N", "atom2_id": "///B/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5590, "atom2_serNum": 5951, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/283/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5599, "atom2_serNum": 5661, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/284/N", "atom2_id": "///B/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5602, "atom2_serNum": 5617, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/284/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5602, "atom2_serNum": 5658, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/284/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5606, "atom2_serNum": 5869, "donAcc_type": "acceptable", "distance": 3.170, "atom1_id": "///B/284/OE1", "atom2_id": "///B/316/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5607, "atom2_serNum": 5869, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///B/284/OE2", "atom2_id": "///B/316/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5607, "atom2_serNum": 5878, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/284/OE2", "atom2_id": "///B/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5617, "atom2_serNum": 5650, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/286/N", "atom2_id": "///B/290/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5625, "atom2_serNum": 5878, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///B/286/OE2", "atom2_id": "///B/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5635, "atom2_serNum": 5641, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///B/288/N", "atom2_id": "///B/288/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5638, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///B/288/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5700, "atom2_serNum": 5829, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/297/N", "atom2_id": "///B/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5703, "atom2_serNum": 5826, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/297/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5719, "atom2_serNum": 5746, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/299/N", "atom2_id": "///B/302/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5722, "atom2_serNum": 5739, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/299/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5728, "atom2_serNum": 5747, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/300/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5742, "atom2_serNum": 5754, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///B/302/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5742, "atom2_serNum": 5808, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/302/O", "atom2_id": "///B/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5754, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/304/N", "atom2_id": "///B/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5757, "atom2_serNum": 5784, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/304/O", "atom2_id": "///B/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5845, "atom2_serNum": 6123, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///B/314/O", "atom2_id": "///B/347/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5882, "atom2_serNum": 5902, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///B/318/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5886, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/318/OD2", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5913, "atom2_serNum": 5915, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///B/322/O", "atom2_id": "///B/322/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5933, "atom2_serNum": 6115, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/325/N", "atom2_id": "///B/347/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5936, "atom2_serNum": 6112, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/325/O", "atom2_id": "///B/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5944, "atom2_serNum": 6096, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/327/N", "atom2_id": "///B/345/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5947, "atom2_serNum": 6093, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///B/327/O", "atom2_id": "///B/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5962, "atom2_serNum": 6080, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/329/N", "atom2_id": "///B/343/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5965, "atom2_serNum": 6077, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/329/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5977, "atom2_serNum": 6058, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///B/330/NE2", "atom2_id": "///B/340/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5978, "atom2_serNum": 6060, "donAcc_type": "acceptable", "distance": 3.432, "atom1_id": "///B/331/N", "atom2_id": "///B/340/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5981, "atom2_serNum": 6055, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/331/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5997, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/333/N", "atom2_id": "///B/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 6000, "atom2_serNum": 6031, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 6006, "atom2_serNum": 6029, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/333/NH1", "atom2_id": "///B/336/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 6006, "atom2_serNum": 6030, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/333/NH1", "atom2_id": "///B/336/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 6023, "atom2_serNum": 6029, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///B/336/N", "atom2_id": "///B/336/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 6060, "atom2_serNum": 6064, "donAcc_type": "acceptable", "distance": 2.907, "atom1_id": "///B/340/OG", "atom2_id": "///B/341/O", "atom_pair": "O:O", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1ooa", "num_aaChains": 2, "aaChains": "A=313,B=313", "num_naChains": 2, "naChains": "C=29,D=29", "num_atoms": 6442, "num_waters": 294, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-Kturns.pdb", "desc": "an ensemble of kink-turn motifs" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }