**************************************************************************** File name: 1ooa.pdb no. of DNA/RNA chains: 2 [C=29,D=29] no. of nucleotides: 58 no. of atoms: 6442 no. of waters: 294 no. of metals: 0 **************************************************************************** List of 24 base pairs nt1 nt2 bp name Saenger LW DSSR 1 C.C1 C.G29 C-G WC 19-XIX cWW cW-W 2 C.A2 C.U28 A-U WC 20-XX cWW cW-W 3 C.U3 C.A27 U-A WC 20-XX cWW cW-W 4 C.A4 C.U26 A-U WC 20-XX cWW cW-W 5 C.C5 C.G25 C-G WC 19-XIX cWW cW-W 6 C.U6 C.C24 U-C -- -- tWH tW-M 7 C.A9 C.G22 A-G Sheared 11-XI tHS tM-m 8 C.A10 C.U21 A-U WC 20-XX cWW cW-W 9 C.A11 C.U20 A-U WC 20-XX cWW cW-W 10 C.C12 C.G19 C-G WC 19-XIX cWW cW-W 11 C.U13 C.G18 U-G Wobble 28-XXVIII cWW cW-W 12 C.G14 C.A17 G-A Sheared 11-XI .SH .m-M 13 D.C1 D.G29 C-G WC 19-XIX cWW cW-W 14 D.A2 D.U28 A-U WC 20-XX cWW cW-W 15 D.U3 D.A27 U-A WC 20-XX cWW cW-W 16 D.A4 D.U26 A-U WC 20-XX cWW cW-W 17 D.C5 D.G25 C-G WC 19-XIX cWW cW-W 18 D.U6 D.C24 U-C -- -- tWH tW-M 19 D.A9 D.G22 A-G Sheared 11-XI tHS tM-m 20 D.A10 D.U21 A-U WC 20-XX cWW cW-W 21 D.A11 D.U20 A-U WC 20-XX cWW cW-W 22 D.C12 D.G19 C-G WC 19-XIX cWW cW-W 23 D.U13 D.G18 U-G Wobble 28-XXVIII cWW cW-W 24 D.G14 D.G18 G-G -- -- cSW cm-W **************************************************************************** List of 4 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=6 strand-1 5'-CAUACU-3' bp-type |||||. strand-2 3'-GUAUGC-5' helix-form ...A. 1 C.C1 C.G29 C-G WC 19-XIX cWW cW-W 2 C.A2 C.U28 A-U WC 20-XX cWW cW-W 3 C.U3 C.A27 U-A WC 20-XX cWW cW-W 4 C.A4 C.U26 A-U WC 20-XX cWW cW-W 5 C.C5 C.G25 C-G WC 19-XIX cWW cW-W 6 C.U6 C.C24 U-C -- -- tWH tW-M -------------------------------------------------------------------------- helix#2[1] bps=6 strand-1 5'-AAACUG-3' bp-type .||||. strand-2 3'-GUUGGA-5' helix-form ..A.. 1 C.A9 C.G22 A-G Sheared 11-XI tHS tM-m 2 C.A10 C.U21 A-U WC 20-XX cWW cW-W 3 C.A11 C.U20 A-U WC 20-XX cWW cW-W 4 C.C12 C.G19 C-G WC 19-XIX cWW cW-W 5 C.U13 C.G18 U-G Wobble 28-XXVIII cWW cW-W 6 C.G14 C.A17 G-A Sheared 11-XI .SH .m-M -------------------------------------------------------------------------- helix#3[1] bps=6 strand-1 5'-CAUACU-3' bp-type |||||. strand-2 3'-GUAUGC-5' helix-form AAAA. 1 D.C1 D.G29 C-G WC 19-XIX cWW cW-W 2 D.A2 D.U28 A-U WC 20-XX cWW cW-W 3 D.U3 D.A27 U-A WC 20-XX cWW cW-W 4 D.A4 D.U26 A-U WC 20-XX cWW cW-W 5 D.C5 D.G25 C-G WC 19-XIX cWW cW-W 6 D.U6 D.C24 U-C -- -- tWH tW-M -------------------------------------------------------------------------- helix#4[1] bps=5 strand-1 5'-AAACU-3' bp-type .|||| strand-2 3'-GUUGG-5' helix-form ..A. 1 D.A9 D.G22 A-G Sheared 11-XI tHS tM-m 2 D.A10 D.U21 A-U WC 20-XX cWW cW-W 3 D.A11 D.U20 A-U WC 20-XX cWW cW-W 4 D.C12 D.G19 C-G WC 19-XIX cWW cW-W 5 D.U13 D.G18 U-G Wobble 28-XXVIII cWW cW-W **************************************************************************** List of 4 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=5 strand-1 5'-CAUAC-3' bp-type ||||| strand-2 3'-GUAUG-5' helix-form ...A 1 C.C1 C.G29 C-G WC 19-XIX cWW cW-W 2 C.A2 C.U28 A-U WC 20-XX cWW cW-W 3 C.U3 C.A27 U-A WC 20-XX cWW cW-W 4 C.A4 C.U26 A-U WC 20-XX cWW cW-W 5 C.C5 C.G25 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=4 strand-1 5'-AACU-3' bp-type |||| strand-2 3'-UUGG-5' helix-form .A. 1 C.A10 C.U21 A-U WC 20-XX cWW cW-W 2 C.A11 C.U20 A-U WC 20-XX cWW cW-W 3 C.C12 C.G19 C-G WC 19-XIX cWW cW-W 4 C.U13 C.G18 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#3[#3] bps=5 strand-1 5'-CAUAC-3' bp-type ||||| strand-2 3'-GUAUG-5' helix-form AAAA 1 D.C1 D.G29 C-G WC 19-XIX cWW cW-W 2 D.A2 D.U28 A-U WC 20-XX cWW cW-W 3 D.U3 D.A27 U-A WC 20-XX cWW cW-W 4 D.A4 D.U26 A-U WC 20-XX cWW cW-W 5 D.C5 D.G25 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#4] bps=4 strand-1 5'-AACU-3' bp-type |||| strand-2 3'-UUGG-5' helix-form .A. 1 D.A10 D.U21 A-U WC 20-XX cWW cW-W 2 D.A11 D.U20 A-U WC 20-XX cWW cW-W 3 D.C12 D.G19 C-G WC 19-XIX cWW cW-W 4 D.U13 D.G18 U-G Wobble 28-XXVIII cWW cW-W **************************************************************************** List of 12 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 UG C.U13,C.G14 2 nts=2 UG C.U21,C.G22 3 nts=2 CG C.C24,C.G25 4 nts=2 AA D.A9,D.A10 5 nts=2 UG D.U13,D.G14 6 nts=2 CG D.C24,D.G25 7 nts=3 CUU C.C5,C.U6,C.U7 8 nts=3 UAG C.U15,C.A17,C.G18 9 nts=3 CUU D.C5,D.U6,D.U7 10 nts=3 UAG D.U15,D.A17,D.G18 11 nts=4 GGAA C.G8,C.G23,C.A9,C.A10 12 nts=4 GGGU D.G8,D.G23,D.G22,D.U21 **************************************************************************** Nucleotides not involved in stacking interactions nts=4 CACA C.C1,C.A16,D.C1,D.A16 **************************************************************************** List of 5 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@C.G23 C.A9 3.03 2 sugar O4'@C.U15 C.A17 2.99 3 sugar O2'@C.U7 C.C24 3.29 4 sugar O4'@D.G23 D.A9 3.43 5 sugar O2'@D.U7 D.C24 3.14 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 2 hairpin loops 1 hairpin loop: nts=6; [4]; linked by [#2] summary: [1] 4 [C.13 C.18] 4 nts=6 UGUAAG C.U13,C.G14,C.U15,C.A16,C.A17,C.G18 nts=4 GUAA C.G14,C.U15,C.A16,C.A17 2 hairpin loop: nts=6; [4]; linked by [#4] summary: [1] 4 [D.13 D.18] 4 nts=6 UGUAAG D.U13,D.G14,D.U15,D.A16,D.A17,D.G18 nts=4 GUAA D.G14,D.U15,D.A16,D.A17 **************************************************************************** List of 2 internal loops 1 asymmetric internal loop: nts=11; [4,3]; linked by [#1,#2] summary: [2] 4 3 [C.5 C.25 C.10 C.21] 5 4 k-turn:reverse nts=11 CUUGAAUGGCG C.C5,C.U6,C.U7,C.G8,C.A9,C.A10,C.U21,C.G22,C.G23,C.C24,C.G25 nts=4 UUGA C.U6,C.U7,C.G8,C.A9 nts=3 GGC C.G22,C.G23,C.C24 2 asymmetric internal loop: nts=11; [4,3]; linked by [#3,#4] summary: [2] 4 3 [D.5 D.25 D.10 D.21] 5 4 k-turn:reverse nts=11 CUUGAAUGGCG D.C5,D.U6,D.U7,D.G8,D.A9,D.A10,D.U21,D.G22,D.G23,D.C24,D.G25 nts=4 UUGA D.U6,D.U7,D.G8,D.A9 nts=3 GGC D.G22,D.G23,D.C24 **************************************************************************** List of 2 kink turns 1 REVERSE k-turn [A-G]; iloop#1; between stems [#1,#2]; bending-angle=84 C#1[CG C.C5,C.G25] [AG C.A9,C.G22] NC#2[AU C.A10,C.U21] strand1 nts=13; CAUACUUGAAACU C.C1,C.A2,C.U3,C.A4,C.C5,C.U6,C.U7,C.G8,C.A9,C.A10,C.A11,C.C12,C.U13 strand2 nts=12; GGUUGGCGUAUG C.G18,C.G19,C.U20,C.U21,C.G22,C.G23,C.C24,C.G25,C.U26,C.A27,C.U28,C.G29 2 REVERSE k-turn [A-G]; iloop#2; between stems [#3,#4]; bending-angle=90 C#3[CG D.C5,D.G25] [AG D.A9,D.G22] NC#4[AU D.A10,D.U21] strand1 nts=13; CAUACUUGAAACU D.C1,D.A2,D.U3,D.A4,D.C5,D.U6,D.U7,D.G8,D.A9,D.A10,D.A11,D.C12,D.U13 strand2 nts=12; GGUUGGCGUAUG D.G18,D.G19,D.U20,D.U21,D.G22,D.G23,D.C24,D.G25,D.U26,D.A27,D.U28,D.G29 **************************************************************************** List of 2 splayed-apart dinucleotides 1 C.U15 C.A16 angle=127 distance=14.2 ratio=0.90 2 D.U15 D.A16 angle=89 distance=13.3 ratio=0.70 ---------------------------------------------------------------- Summary of 2 splayed-apart units 1 nts=2 UA C.U15,C.A16 2 nts=2 UA D.U15,D.A16 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1ooa nts=58 [whole] CAUACUUGAAACUGUAAGGUUGGCGUAUG&CAUACUUGAAACUGUAAGGUUGGCGUAUG (((((....((((....))))...)))))&(((((....((((....))))...))))) >1ooa-C #1 nts=29 0.05(2.17) [chain] RNA CAUACUUGAAACUGUAAGGUUGGCGUAUG (((((....((((....))))...))))) >1ooa-D #2 nts=29 0.02(2.03) [chain] RNA CAUACUUGAAACUGUAAGGUUGGCGUAUG (((((....((((....))))...))))) **************************************************************************** Summary of structural features of 58 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( C.C1 0.002 k-turn,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end 2 A ( C.A2 0.001 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 3 U ( C.U3 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 A ( C.A4 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 C ( C.C5 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 6 U . C.U6 0.003 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 7 U . C.U7 0.010 k-turn,anti,non-pair-contact,internal-loop,cap-donor 8 G . C.G8 0.009 k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 9 A . C.A9 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 10 A ( C.A10 0.005 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop 11 A ( C.A11 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 12 C ( C.C12 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 13 U ( C.U13 0.002 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop 14 G . C.G14 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 15 U . C.U15 0.008 anti,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 16 A . C.A16 0.004 turn,syn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 17 A . C.A17 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 18 G ) C.G18 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 19 G ) C.G19 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 20 U ) C.U20 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 21 U ) C.U21 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 22 G . C.G22 0.012 k-turn,anti,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 23 G . C.G23 0.017 k-turn,anti,non-pair-contact,internal-loop,cap-donor 24 C . C.C24 0.009 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor 25 G ) C.G25 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 26 U ) C.U26 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 A ) C.A27 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 28 U ) C.U28 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 29 G ) C.G29 0.002 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 30 C ( D.C1 0.002 k-turn,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end 31 A ( D.A2 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 32 U ( D.U3 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 33 A ( D.A4 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 34 C ( D.C5 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 35 U . D.U6 0.002 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop 36 U . D.U7 0.005 k-turn,anti,non-pair-contact,internal-loop,cap-donor 37 G . D.G8 0.006 k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 38 A . D.A9 0.004 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 39 A ( D.A10 0.003 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop 40 A ( D.A11 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 41 C ( D.C12 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 42 U ( D.U13 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 43 G . D.G14 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop 44 U . D.U15 0.004 anti,non-pair-contact,hairpin-loop,splayed-apart 45 A . D.A16 0.003 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart 46 A . D.A17 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 47 G ) D.G18 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 48 G ) D.G19 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 49 U ) D.U20 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 50 U ) D.U21 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 51 G . D.G22 0.010 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 52 G . D.G23 0.015 k-turn,anti,non-pair-contact,internal-loop,cap-donor,phosphate 53 C . D.C24 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 54 G ) D.G25 0.006 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 55 U ) D.U26 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 56 A ) D.A27 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 57 U ) D.U28 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 58 G ) D.G29 0.003 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 17 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-iloops.pdb -- an ensemble of internal loops 6 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 7 dssr-2ndstrs.ct -- secondary structure in connectivity table format 8 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 9 dssr-torsions.txt -- backbone torsion angles and suite names 10 dssr-splays.pdb -- an ensemble of splayed-apart units 11 dssr-Kturns.pdb -- an ensemble of kink-turn motifs 12 dssr-stacks.pdb -- an ensemble of base stacks 13 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 14 dssr-rotmat.txt -- position vector and rotation matrix 15 dssr-viewV.pdb -- vertical view of the principal moment of inertia 16 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 17 dssr-viewT.pdb -- top view of the principal moment of inertia