{ "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///D/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.149, "conf1": "anti", "pucker1": "----", "lambda1": 56.943, "chi2": -134.107, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.613, "C1C1_dist": 9.976, "N1N9_dist": 8.366, "C6C8_dist": 9.422, "CNNC_torsion": -8.141, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.69],N1-N3(imino)[2.41]", "interBase_angle": 8.747, "planarity": 0.113, "simple_Shear": 0.022, "simple_Stretch": -0.507, "simple_Buckle": -5.028, "simple_Propeller": -7.157, "bp_simpleParams": [ 0.022, -0.507, -0.062, -5.028, -7.157, 5.113 ], "bp_params": [ 0.017, -0.507, -0.062, -5.092, -7.112, 5.117 ], "frame": { "rmsd": null, "origin": [ 73.376, 13.277, 56.460 ], "x_axis": [ -0.900, -0.088, -0.427 ], "y_axis": [ -0.207, -0.776, 0.596 ], "z_axis": [ -0.383, 0.625, 0.680 ], "quaternion": [ 0.033, -0.221, 0.333, 0.916 ] } }, { "index": 2, "nt1": "///C/2", "nt2": "///D/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.484, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.501, "chi2": -100.105, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.029, "C1C1_dist": 10.296, "N1N9_dist": 8.588, "C6C8_dist": 9.455, "CNNC_torsion": -7.118, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.46],O4(carbonyl)-N6(amino)[2.36]", "interBase_angle": 3.257, "planarity": 0.061, "simple_Shear": -0.531, "simple_Stretch": -0.486, "simple_Buckle": -1.727, "simple_Propeller": -2.762, "bp_simpleParams": [ -0.531, -0.486, -0.127, -1.727, -2.762, -3.652 ], "bp_params": [ -0.503, -0.516, -0.127, -1.566, -2.856, -3.652 ], "frame": { "rmsd": null, "origin": [ 72.746, 16.003, 58.270 ], "x_axis": [ -0.907, -0.392, -0.153 ], "y_axis": [ 0.155, -0.650, 0.744 ], "z_axis": [ -0.391, 0.651, 0.650 ], "quaternion": [ -0.153, -0.152, 0.390, 0.895 ] } }, { "index": 3, "nt1": "///C/3", "nt2": "///D/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.013, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 60.041, "chi2": -82.767, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.661, "C1C1_dist": 10.505, "N1N9_dist": 8.886, "C6C8_dist": 9.879, "CNNC_torsion": -5.729, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.84]", "interBase_angle": 8.458, "planarity": 0.098, "simple_Shear": 0.708, "simple_Stretch": -0.054, "simple_Buckle": 5.480, "simple_Propeller": -6.443, "bp_simpleParams": [ 0.708, -0.054, 0.082, 5.480, -6.443, 0.987 ], "bp_params": [ 0.702, -0.106, 0.082, 4.984, -6.834, 0.988 ], "frame": { "rmsd": null, "origin": [ 72.718, 17.295, 61.771 ], "x_axis": [ -0.492, -0.720, 0.489 ], "y_axis": [ 0.801, -0.153, 0.579 ], "z_axis": [ -0.342, 0.677, 0.652 ], "quaternion": [ 0.502, -0.049, -0.414, -0.758 ] } }, { "index": 4, "nt1": "///C/4", "nt2": "///D/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.577, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.811, "chi2": -112.486, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.157, "C1C1_dist": 10.479, "N1N9_dist": 8.965, "C6C8_dist": 9.980, "CNNC_torsion": -11.992, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.29],N1-N3(imino)[3.07]", "interBase_angle": 21.263, "planarity": 0.252, "simple_Shear": -0.316, "simple_Stretch": 0.132, "simple_Buckle": 18.182, "simple_Propeller": -11.025, "bp_simpleParams": [ -0.316, 0.132, 0.409, 18.182, -11.025, 2.268 ], "bp_params": [ -0.320, 0.121, 0.409, 18.583, -10.335, 2.247 ], "frame": { "rmsd": null, "origin": [ 71.410, 18.736, 64.210 ], "x_axis": [ -0.150, -0.765, 0.627 ], "y_axis": [ 0.928, 0.110, 0.356 ], "z_axis": [ -0.341, 0.635, 0.693 ], "quaternion": [ 0.643, -0.109, -0.376, -0.658 ] } }, { "index": 5, "nt1": "///C/5", "nt2": "///D/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -177.433, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.034, "chi2": -128.668, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.256, "C1C1_dist": 10.598, "N1N9_dist": 8.742, "C6C8_dist": 9.635, "CNNC_torsion": -21.632, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.65],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 19.458, "planarity": 0.236, "simple_Shear": 0.065, "simple_Stretch": -0.364, "simple_Buckle": 8.275, "simple_Propeller": -17.611, "bp_simpleParams": [ 0.065, -0.364, 0.062, 8.275, -17.611, -1.576 ], "bp_params": [ 0.067, -0.363, 0.062, 8.311, -17.594, -1.590 ], "frame": { "rmsd": null, "origin": [ 69.169, 19.985, 67.027 ], "x_axis": [ 0.374, -0.537, 0.756 ], "y_axis": [ 0.841, 0.540, -0.033 ], "z_axis": [ -0.390, 0.648, 0.654 ], "quaternion": [ 0.801, -0.212, -0.358, -0.430 ] } }, { "index": 6, "nt1": "///C/6", "nt2": "///D/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.525, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.940, "chi2": -101.704, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.379, "C1C1_dist": 10.264, "N1N9_dist": 8.609, "C6C8_dist": 9.615, "CNNC_torsion": -8.858, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.69],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 9.951, "planarity": 0.161, "simple_Shear": 0.434, "simple_Stretch": -0.344, "simple_Buckle": 0.762, "simple_Propeller": -9.922, "bp_simpleParams": [ 0.434, -0.344, -0.405, 0.762, -9.922, 2.648 ], "bp_params": [ 0.421, -0.361, -0.405, 0.371, -9.944, 2.657 ], "frame": { "rmsd": null, "origin": [ 67.519, 21.678, 69.618 ], "x_axis": [ 0.867, -0.122, 0.483 ], "y_axis": [ 0.338, 0.857, -0.389 ], "z_axis": [ -0.366, 0.501, 0.785 ], "quaternion": [ 0.937, -0.238, -0.226, -0.123 ] } }, { "index": 7, "nt1": "///C/7", "nt2": "///D/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.759, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.169, "chi2": -113.228, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.646, "C1C1_dist": 10.058, "N1N9_dist": 8.398, "C6C8_dist": 9.287, "CNNC_torsion": -10.013, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.29],N3-N1(imino)[2.28],N4(amino)-O6(carbonyl)[2.28]", "interBase_angle": 13.626, "planarity": 0.184, "simple_Shear": -0.072, "simple_Stretch": -0.729, "simple_Buckle": -3.050, "simple_Propeller": -13.280, "bp_simpleParams": [ -0.072, -0.729, -0.041, -3.050, -13.280, -0.741 ], "bp_params": [ -0.065, -0.730, -0.041, -2.896, -13.315, -0.746 ], "frame": { "rmsd": null, "origin": [ 66.432, 23.083, 72.300 ], "x_axis": [ 0.936, 0.323, 0.137 ], "y_axis": [ -0.177, 0.771, -0.611 ], "z_axis": [ -0.303, 0.548, 0.779 ], "quaternion": [ 0.934, -0.311, -0.118, 0.134 ] } }, { "index": 8, "nt1": "///C/8", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.586, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.401, "chi2": -112.624, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.330, "C1C1_dist": 10.529, "N1N9_dist": 8.789, "C6C8_dist": 9.658, "CNNC_torsion": -3.948, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.68],O4(carbonyl)-N6(amino)[2.70]", "interBase_angle": 9.819, "planarity": 0.115, "simple_Shear": -0.208, "simple_Stretch": -0.280, "simple_Buckle": -5.944, "simple_Propeller": -7.815, "bp_simpleParams": [ -0.208, -0.280, 0.130, -5.944, -7.815, -3.326 ], "bp_params": [ -0.201, -0.285, 0.130, -5.757, -7.954, -3.330 ], "frame": { "rmsd": null, "origin": [ 65.621, 24.829, 75.235 ], "x_axis": [ 0.700, 0.672, -0.242 ], "y_axis": [ -0.664, 0.486, -0.569 ], "z_axis": [ -0.265, 0.559, 0.786 ], "quaternion": [ 0.862, -0.327, -0.007, 0.387 ] } }, { "index": 9, "nt1": "///C/9", "nt2": "///D/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.072, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.493, "chi2": -87.977, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.451, "C1C1_dist": 10.387, "N1N9_dist": 8.807, "C6C8_dist": 9.828, "CNNC_torsion": 5.186, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.80]", "interBase_angle": 9.581, "planarity": 0.113, "simple_Shear": 0.377, "simple_Stretch": -0.112, "simple_Buckle": -6.302, "simple_Propeller": -7.217, "bp_simpleParams": [ 0.377, -0.112, -0.126, -6.302, -7.217, 1.823 ], "bp_params": [ 0.372, -0.129, -0.126, -6.614, -6.932, 1.823 ], "frame": { "rmsd": null, "origin": [ 64.840, 27.509, 77.185 ], "x_axis": [ 0.146, 0.797, -0.586 ], "y_axis": [ -0.973, 0.008, -0.231 ], "z_axis": [ -0.180, 0.604, 0.777 ], "quaternion": [ 0.695, -0.300, 0.146, 0.637 ] } }, { "index": 10, "nt1": "///C/10", "nt2": "///D/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.279, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.999, "chi2": -97.103, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.310, "C1C1_dist": 10.391, "N1N9_dist": 8.849, "C6C8_dist": 9.906, "CNNC_torsion": -5.518, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.18]", "interBase_angle": 10.606, "planarity": 0.153, "simple_Shear": 0.337, "simple_Stretch": -0.025, "simple_Buckle": 9.339, "simple_Propeller": -5.026, "bp_simpleParams": [ 0.337, -0.025, 0.032, 9.339, -5.026, 4.558 ], "bp_params": [ 0.337, -0.034, 0.032, 9.205, -5.268, 4.548 ], "frame": { "rmsd": null, "origin": [ 64.407, 29.431, 79.521 ], "x_axis": [ -0.237, 0.686, -0.688 ], "y_axis": [ -0.954, -0.299, 0.031 ], "z_axis": [ -0.185, 0.664, 0.725 ], "quaternion": [ 0.545, -0.290, 0.231, 0.752 ] } }, { "index": 11, "nt1": "///C/11", "nt2": "///D/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.228, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.207, "chi2": -128.119, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.402, "C1C1_dist": 10.281, "N1N9_dist": 8.622, "C6C8_dist": 9.603, "CNNC_torsion": -9.220, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.72],N1-N3(imino)[2.59]", "interBase_angle": 11.785, "planarity": 0.150, "simple_Shear": 0.027, "simple_Stretch": -0.359, "simple_Buckle": 0.947, "simple_Propeller": -11.747, "bp_simpleParams": [ 0.027, -0.359, 0.151, 0.947, -11.747, 0.970 ], "bp_params": [ 0.025, -0.359, 0.151, 0.870, -11.753, 0.975 ], "frame": { "rmsd": null, "origin": [ 64.387, 32.354, 81.418 ], "x_axis": [ -0.738, 0.316, -0.596 ], "y_axis": [ -0.640, -0.608, 0.470 ], "z_axis": [ -0.214, 0.728, 0.651 ], "quaternion": [ 0.276, -0.234, 0.346, 0.866 ] } }, { "index": 12, "nt1": "///C/12", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.675, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.321, "chi2": -154.880, "conf2": "anti", "pucker2": "----", "lambda2": 56.594, "C1C1_dist": 10.183, "N1N9_dist": 8.576, "C6C8_dist": 9.535, "CNNC_torsion": -1.474, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.60],O4(carbonyl)-N6(amino)[2.68]", "interBase_angle": 5.796, "planarity": 0.090, "simple_Shear": 0.131, "simple_Stretch": -0.419, "simple_Buckle": -4.232, "simple_Propeller": -3.961, "bp_simpleParams": [ 0.131, -0.419, 0.403, -4.232, -3.961, -0.518 ], "bp_params": [ 0.127, -0.420, 0.403, -4.272, -3.918, -0.518 ], "frame": { "rmsd": null, "origin": [ 63.707, 35.798, 82.845 ], "x_axis": [ -0.966, -0.061, -0.251 ], "y_axis": [ -0.140, -0.693, 0.707 ], "z_axis": [ -0.218, 0.718, 0.661 ], "quaternion": [ 0.022, -0.129, 0.391, 0.911 ] } }, { "index": 13, "nt1": "///C/13", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.017, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.092, "chi2": -98.789, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.223, "C1C1_dist": 10.315, "N1N9_dist": 8.719, "C6C8_dist": 9.739, "CNNC_torsion": -2.839, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.74]", "interBase_angle": 11.771, "planarity": 0.153, "simple_Shear": 0.016, "simple_Stretch": -0.176, "simple_Buckle": -10.179, "simple_Propeller": -5.912, "bp_simpleParams": [ 0.016, -0.176, -0.390, -10.179, -5.912, 3.756 ], "bp_params": [ 0.014, -0.176, -0.390, -10.238, -5.810, 3.746 ], "frame": { "rmsd": null, "origin": [ 63.646, 39.000, 84.479 ], "x_axis": [ -0.879, -0.337, 0.337 ], "y_axis": [ 0.470, -0.497, 0.730 ], "z_axis": [ -0.079, 0.800, 0.595 ], "quaternion": [ -0.234, 0.075, 0.444, 0.862 ] } }, { "index": 14, "nt1": "///C/14", "nt2": "///D/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.227, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.328, "chi2": -162.412, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.903, "C1C1_dist": 10.513, "N1N9_dist": 8.974, "C6C8_dist": 10.024, "CNNC_torsion": -7.100, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.24],N1-N3(imino)[2.98]", "interBase_angle": 9.811, "planarity": 0.125, "simple_Shear": 0.033, "simple_Stretch": 0.069, "simple_Buckle": 1.931, "simple_Propeller": -9.619, "bp_simpleParams": [ 0.033, 0.069, 0.110, 1.931, -9.619, 4.055 ], "bp_params": [ 0.033, 0.069, 0.110, 1.851, -9.635, 4.069 ], "frame": { "rmsd": null, "origin": [ 63.031, 41.564, 86.175 ], "x_axis": [ -0.454, -0.584, 0.673 ], "y_axis": [ 0.889, -0.244, 0.388 ], "z_axis": [ -0.063, 0.774, 0.630 ], "quaternion": [ -0.483, 0.200, 0.381, 0.763 ] } }, { "index": 15, "nt1": "///C/15", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.367, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.276, "chi2": -90.878, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.774, "C1C1_dist": 10.350, "N1N9_dist": 8.809, "C6C8_dist": 9.911, "CNNC_torsion": -7.011, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.28]", "interBase_angle": 12.040, "planarity": 0.154, "simple_Shear": 0.364, "simple_Stretch": -0.027, "simple_Buckle": 4.189, "simple_Propeller": -11.288, "bp_simpleParams": [ 0.364, -0.027, -0.097, 4.189, -11.288, 6.621 ], "bp_params": [ 0.364, -0.038, -0.097, 3.842, -11.410, 6.650 ], "frame": { "rmsd": null, "origin": [ 62.638, 44.674, 87.584 ], "x_axis": [ 0.045, -0.673, 0.739 ], "y_axis": [ 0.994, 0.102, 0.033 ], "z_axis": [ -0.097, 0.733, 0.673 ], "quaternion": [ 0.675, -0.259, -0.310, -0.618 ] } }, { "index": 16, "nt1": "///C/16", "nt2": "///D/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.835, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.416, "chi2": -119.812, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.641, "C1C1_dist": 11.076, "N1N9_dist": 9.085, "C6C8_dist": 9.654, "CNNC_torsion": -16.910, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.55],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[3.56]", "interBase_angle": 15.729, "planarity": 0.220, "simple_Shear": -0.593, "simple_Stretch": -0.255, "simple_Buckle": 6.895, "simple_Propeller": -14.137, "bp_simpleParams": [ -0.593, -0.255, 0.426, 6.895, -14.137, -16.097 ], "bp_params": [ -0.576, -0.291, 0.426, 7.727, -13.700, -16.176 ], "frame": { "rmsd": null, "origin": [ 62.562, 48.474, 88.070 ], "x_axis": [ 0.567, -0.541, 0.621 ], "y_axis": [ 0.820, 0.295, -0.491 ], "z_axis": [ 0.082, 0.787, 0.611 ], "quaternion": [ 0.786, -0.406, -0.171, -0.433 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "ATAACTCTATATAATG", "strand2": "TATTGAGATATATTAC", "bp_type": "||||||||||||||||", "helix_form": "..B.BBBBBBBBB..", "helical_rise": 3.258, "helical_rise_std": 0.478, "helical_radius": 9.729, "helical_radius_std": 1.747, "helical_axis": [ -0.275, 0.692, 0.667 ], "point1": [ 73.244, 11.775, 58.110 ], "point2": [ 59.789, 45.639, 90.723 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///D/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.017, -0.507, -0.062, -5.092, -7.112, 5.117 ], "step_params": [ -0.634, -0.732, 3.188, 2.264, 0.523, 23.616 ], "heli_params": [ -1.946, 2.263, 3.097, 1.273, -5.514, 23.728 ], "bp2_params": [ -0.503, -0.516, -0.127, -1.566, -2.856, -3.652 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 27.078, "simple_hRise": 3.111, "simple_hTwist": 27.176 }, { "index": 2, "nt1": "///C/2", "nt2": "///D/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.503, -0.516, -0.127, -1.566, -2.856, -3.652 ], "step_params": [ -0.109, 2.000, 3.150, -0.892, -3.038, 49.096 ], "heli_params": [ 2.618, 0.068, 3.030, -3.652, 1.072, 49.192 ], "bp2_params": [ 0.702, -0.106, 0.082, 4.984, -6.834, 0.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.150, "simple_Twist": 42.191, "simple_hRise": 3.007, "simple_hTwist": 42.304 }, { "index": 3, "nt1": "///C/3", "nt2": "///D/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.702, -0.106, 0.082, 4.984, -6.834, 0.988 ], "step_params": [ 0.730, -0.037, 3.033, -1.204, 3.138, 21.197 ], "heli_params": [ -1.267, -2.409, 2.950, 8.462, 3.247, 21.459 ], "bp2_params": [ -0.320, 0.121, 0.409, 18.583, -10.335, 2.247 ], "groove_widths": [ 13.293, null, 17.646, null ], "simple_Rise": 3.033, "simple_Twist": 27.334, "simple_hRise": 2.975, "simple_hTwist": 27.536 }, { "index": 4, "nt1": "///C/4", "nt2": "///D/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.320, 0.121, 0.409, 18.583, -10.335, 2.247 ], "step_params": [ 0.897, -1.149, 3.520, 2.734, -2.463, 33.971 ], "heli_params": [ -1.528, -1.052, 3.651, -4.199, -4.663, 34.163 ], "bp2_params": [ 0.067, -0.363, 0.062, 8.311, -17.594, -1.590 ], "groove_widths": [ 11.298, 11.156, 17.904, 17.576 ], "simple_Rise": 3.520, "simple_Twist": 31.030, "simple_hRise": 3.662, "simple_hTwist": 31.242 }, { "index": 5, "nt1": "///C/5", "nt2": "///D/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.067, -0.363, 0.062, 8.311, -17.594, -1.590 ], "step_params": [ -0.055, -0.458, 3.477, 7.137, 8.891, 40.113 ], "heli_params": [ -1.631, 0.869, 3.252, 12.656, -10.159, 41.637 ], "bp2_params": [ 0.421, -0.361, -0.405, 0.371, -9.944, 2.657 ], "groove_widths": [ 10.118, 9.885, 19.959, 19.416 ], "simple_Rise": 3.477, "simple_Twist": 38.028, "simple_hRise": 3.233, "simple_hTwist": 39.639 }, { "index": 6, "nt1": "///C/6", "nt2": "///D/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.421, -0.361, -0.405, 0.371, -9.944, 2.657 ], "step_params": [ 0.014, -0.328, 3.200, -2.788, 3.580, 32.823 ], "heli_params": [ -1.162, -0.482, 3.136, 6.298, 4.905, 33.127 ], "bp2_params": [ -0.065, -0.730, -0.041, -2.896, -13.315, -0.746 ], "groove_widths": [ 11.264, 11.020, 16.664, 16.661 ], "simple_Rise": 3.200, "simple_Twist": 36.166, "simple_hRise": 3.145, "simple_hTwist": 36.440 }, { "index": 7, "nt1": "///C/7", "nt2": "///D/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.065, -0.730, -0.041, -2.896, -13.315, -0.746 ], "step_params": [ 0.046, -0.325, 3.494, 0.818, 2.167, 32.868 ], "heli_params": [ -0.966, 0.068, 3.466, 3.824, -1.443, 32.947 ], "bp2_params": [ -0.201, -0.285, 0.130, -5.757, -7.954, -3.330 ], "groove_widths": [ 13.489, 13.290, 18.411, 18.308 ], "simple_Rise": 3.494, "simple_Twist": 33.605, "simple_hRise": 3.467, "simple_hTwist": 33.683 }, { "index": 8, "nt1": "///C/8", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, -0.285, 0.130, -5.757, -7.954, -3.330 ], "step_params": [ 0.848, 0.508, 3.259, 3.331, 4.419, 38.515 ], "heli_params": [ 0.218, -0.862, 3.353, 6.656, -5.018, 38.896 ], "bp2_params": [ 0.372, -0.129, -0.126, -6.614, -6.932, 1.823 ], "groove_widths": [ 14.642, 14.546, 18.779, 17.375 ], "simple_Rise": 3.259, "simple_Twist": 35.052, "simple_hRise": 3.360, "simple_hTwist": 35.473 }, { "index": 9, "nt1": "///C/9", "nt2": "///D/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.372, -0.129, -0.126, -6.614, -6.932, 1.823 ], "step_params": [ -0.044, -0.123, 3.053, -0.074, 4.585, 23.339 ], "heli_params": [ -1.702, 0.083, 2.974, 11.194, 0.180, 23.779 ], "bp2_params": [ 0.337, -0.034, 0.032, 9.205, -5.268, 4.548 ], "groove_widths": [ 14.193, 13.983, 17.586, 16.805 ], "simple_Rise": 3.053, "simple_Twist": 23.784, "simple_hRise": 2.976, "simple_hTwist": 24.215 }, { "index": 10, "nt1": "///C/10", "nt2": "///D/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.337, -0.034, 0.032, 9.205, -5.268, 4.548 ], "step_params": [ 0.255, -0.933, 3.348, 1.444, 5.672, 36.283 ], "heli_params": [ -2.257, -0.206, 3.179, 9.036, -2.301, 36.736 ], "bp2_params": [ 0.025, -0.359, 0.151, 0.870, -11.753, 0.975 ], "groove_widths": [ 12.303, 11.860, 19.399, 19.380 ], "simple_Rise": 3.348, "simple_Twist": 37.681, "simple_hRise": 3.187, "simple_hTwist": 38.117 }, { "index": 11, "nt1": "///C/11", "nt2": "///D/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.359, 0.151, 0.870, -11.753, 0.975 ], "step_params": [ 0.437, -1.183, 3.573, -0.836, -0.149, 32.490 ], "heli_params": [ -2.085, -0.941, 3.566, -0.266, 1.494, 32.501 ], "bp2_params": [ 0.127, -0.420, 0.403, -4.272, -3.918, -0.518 ], "groove_widths": [ 9.746, 9.477, 19.340, 19.336 ], "simple_Rise": 3.573, "simple_Twist": 32.075, "simple_hRise": 3.566, "simple_hTwist": 32.086 }, { "index": 12, "nt1": "///C/12", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.420, 0.403, -4.272, -3.918, -0.518 ], "step_params": [ -0.588, -0.693, 3.479, 4.444, -8.963, 37.262 ], "heli_params": [ 0.148, 1.486, 3.458, -13.726, -6.805, 38.535 ], "bp2_params": [ 0.014, -0.176, -0.390, -10.238, -5.810, 3.746 ], "groove_widths": [ 8.961, 8.884, 22.054, 22.054 ], "simple_Rise": 3.479, "simple_Twist": 37.285, "simple_hRise": 3.458, "simple_hTwist": 38.558 }, { "index": 13, "nt1": "///C/13", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.176, -0.390, -10.238, -5.810, 3.746 ], "step_params": [ 0.109, -0.450, 3.101, -2.396, 1.121, 34.618 ], "heli_params": [ -0.916, -0.529, 3.071, 1.881, 4.019, 34.716 ], "bp2_params": [ 0.033, 0.069, 0.110, 1.851, -9.635, 4.069 ], "groove_widths": [ 10.933, null, 22.317, null ], "simple_Rise": 3.101, "simple_Twist": 34.998, "simple_hRise": 3.072, "simple_hTwist": 35.095 }, { "index": 14, "nt1": "///C/14", "nt2": "///D/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.033, 0.069, 0.110, 1.851, -9.635, 4.069 ], "step_params": [ -0.919, -0.332, 3.295, 1.225, 3.777, 29.386 ], "heli_params": [ -1.442, 2.052, 3.188, 7.402, -2.401, 29.647 ], "bp2_params": [ 0.364, -0.038, -0.097, 3.842, -11.410, 6.650 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.295, "simple_Twist": 27.483, "simple_hRise": 3.178, "simple_hTwist": 27.763 }, { "index": 15, "nt1": "///C/15", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.364, -0.038, -0.097, 3.842, -11.410, 6.650 ], "step_params": [ -1.990, 0.612, 3.216, -11.272, -1.250, 32.123 ], "heli_params": [ 1.263, 1.452, 3.662, -2.176, 19.622, 34.016 ], "bp2_params": [ -0.576, -0.291, 0.426, 7.727, -13.700, -16.176 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 37.652, "simple_hRise": 3.621, "simple_hTwist": 39.264 }, { "index": 16, "nt1": "///C/16", "nt2": "///D/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "ATAACTCTATATAATG", "strand2": "TATTGAGATATATTAC", "bp_type": "||||||||||||||||", "helix_form": "..B.BBBBBBBBB..", "helical_rise": 3.258, "helical_rise_std": 0.478, "helical_radius": 9.729, "helical_radius_std": 1.747, "helical_axis": [ -0.275, 0.692, 0.667 ], "point1": [ 73.244, 11.775, 58.110 ], "point2": [ 59.789, 45.639, 90.723 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///D/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.017, -0.507, -0.062, -5.092, -7.112, 5.117 ], "step_params": [ -0.634, -0.732, 3.188, 2.264, 0.523, 23.616 ], "heli_params": [ -1.946, 2.263, 3.097, 1.273, -5.514, 23.728 ], "bp2_params": [ -0.503, -0.516, -0.127, -1.566, -2.856, -3.652 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 27.078, "simple_hRise": 3.111, "simple_hTwist": 27.176 }, { "index": 2, "nt1": "///C/2", "nt2": "///D/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.503, -0.516, -0.127, -1.566, -2.856, -3.652 ], "step_params": [ -0.109, 2.000, 3.150, -0.892, -3.038, 49.096 ], "heli_params": [ 2.618, 0.068, 3.030, -3.652, 1.072, 49.192 ], "bp2_params": [ 0.702, -0.106, 0.082, 4.984, -6.834, 0.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.150, "simple_Twist": 42.191, "simple_hRise": 3.007, "simple_hTwist": 42.304 }, { "index": 3, "nt1": "///C/3", "nt2": "///D/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.702, -0.106, 0.082, 4.984, -6.834, 0.988 ], "step_params": [ 0.730, -0.037, 3.033, -1.204, 3.138, 21.197 ], "heli_params": [ -1.267, -2.409, 2.950, 8.462, 3.247, 21.459 ], "bp2_params": [ -0.320, 0.121, 0.409, 18.583, -10.335, 2.247 ], "groove_widths": [ 13.293, null, 17.646, null ], "simple_Rise": 3.033, "simple_Twist": 27.334, "simple_hRise": 2.975, "simple_hTwist": 27.536 }, { "index": 4, "nt1": "///C/4", "nt2": "///D/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.320, 0.121, 0.409, 18.583, -10.335, 2.247 ], "step_params": [ 0.897, -1.149, 3.520, 2.734, -2.463, 33.971 ], "heli_params": [ -1.528, -1.052, 3.651, -4.199, -4.663, 34.163 ], "bp2_params": [ 0.067, -0.363, 0.062, 8.311, -17.594, -1.590 ], "groove_widths": [ 11.298, 11.156, 17.904, 17.576 ], "simple_Rise": 3.520, "simple_Twist": 31.030, "simple_hRise": 3.662, "simple_hTwist": 31.242 }, { "index": 5, "nt1": "///C/5", "nt2": "///D/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.067, -0.363, 0.062, 8.311, -17.594, -1.590 ], "step_params": [ -0.055, -0.458, 3.477, 7.137, 8.891, 40.113 ], "heli_params": [ -1.631, 0.869, 3.252, 12.656, -10.159, 41.637 ], "bp2_params": [ 0.421, -0.361, -0.405, 0.371, -9.944, 2.657 ], "groove_widths": [ 10.118, 9.885, 19.959, 19.416 ], "simple_Rise": 3.477, "simple_Twist": 38.028, "simple_hRise": 3.233, "simple_hTwist": 39.639 }, { "index": 6, "nt1": "///C/6", "nt2": "///D/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.421, -0.361, -0.405, 0.371, -9.944, 2.657 ], "step_params": [ 0.014, -0.328, 3.200, -2.788, 3.580, 32.823 ], "heli_params": [ -1.162, -0.482, 3.136, 6.298, 4.905, 33.127 ], "bp2_params": [ -0.065, -0.730, -0.041, -2.896, -13.315, -0.746 ], "groove_widths": [ 11.264, 11.020, 16.664, 16.661 ], "simple_Rise": 3.200, "simple_Twist": 36.166, "simple_hRise": 3.145, "simple_hTwist": 36.440 }, { "index": 7, "nt1": "///C/7", "nt2": "///D/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.065, -0.730, -0.041, -2.896, -13.315, -0.746 ], "step_params": [ 0.046, -0.325, 3.494, 0.818, 2.167, 32.868 ], "heli_params": [ -0.966, 0.068, 3.466, 3.824, -1.443, 32.947 ], "bp2_params": [ -0.201, -0.285, 0.130, -5.757, -7.954, -3.330 ], "groove_widths": [ 13.489, 13.290, 18.411, 18.308 ], "simple_Rise": 3.494, "simple_Twist": 33.605, "simple_hRise": 3.467, "simple_hTwist": 33.683 }, { "index": 8, "nt1": "///C/8", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, -0.285, 0.130, -5.757, -7.954, -3.330 ], "step_params": [ 0.848, 0.508, 3.259, 3.331, 4.419, 38.515 ], "heli_params": [ 0.218, -0.862, 3.353, 6.656, -5.018, 38.896 ], "bp2_params": [ 0.372, -0.129, -0.126, -6.614, -6.932, 1.823 ], "groove_widths": [ 14.642, 14.546, 18.779, 17.375 ], "simple_Rise": 3.259, "simple_Twist": 35.052, "simple_hRise": 3.360, "simple_hTwist": 35.473 }, { "index": 9, "nt1": "///C/9", "nt2": "///D/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.372, -0.129, -0.126, -6.614, -6.932, 1.823 ], "step_params": [ -0.044, -0.123, 3.053, -0.074, 4.585, 23.339 ], "heli_params": [ -1.702, 0.083, 2.974, 11.194, 0.180, 23.779 ], "bp2_params": [ 0.337, -0.034, 0.032, 9.205, -5.268, 4.548 ], "groove_widths": [ 14.193, 13.983, 17.586, 16.805 ], "simple_Rise": 3.053, "simple_Twist": 23.784, "simple_hRise": 2.976, "simple_hTwist": 24.215 }, { "index": 10, "nt1": "///C/10", "nt2": "///D/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.337, -0.034, 0.032, 9.205, -5.268, 4.548 ], "step_params": [ 0.255, -0.933, 3.348, 1.444, 5.672, 36.283 ], "heli_params": [ -2.257, -0.206, 3.179, 9.036, -2.301, 36.736 ], "bp2_params": [ 0.025, -0.359, 0.151, 0.870, -11.753, 0.975 ], "groove_widths": [ 12.303, 11.860, 19.399, 19.380 ], "simple_Rise": 3.348, "simple_Twist": 37.681, "simple_hRise": 3.187, "simple_hTwist": 38.117 }, { "index": 11, "nt1": "///C/11", "nt2": "///D/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.359, 0.151, 0.870, -11.753, 0.975 ], "step_params": [ 0.437, -1.183, 3.573, -0.836, -0.149, 32.490 ], "heli_params": [ -2.085, -0.941, 3.566, -0.266, 1.494, 32.501 ], "bp2_params": [ 0.127, -0.420, 0.403, -4.272, -3.918, -0.518 ], "groove_widths": [ 9.746, 9.477, 19.340, 19.336 ], "simple_Rise": 3.573, "simple_Twist": 32.075, "simple_hRise": 3.566, "simple_hTwist": 32.086 }, { "index": 12, "nt1": "///C/12", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.420, 0.403, -4.272, -3.918, -0.518 ], "step_params": [ -0.588, -0.693, 3.479, 4.444, -8.963, 37.262 ], "heli_params": [ 0.148, 1.486, 3.458, -13.726, -6.805, 38.535 ], "bp2_params": [ 0.014, -0.176, -0.390, -10.238, -5.810, 3.746 ], "groove_widths": [ 8.961, 8.884, 22.054, 22.054 ], "simple_Rise": 3.479, "simple_Twist": 37.285, "simple_hRise": 3.458, "simple_hTwist": 38.558 }, { "index": 13, "nt1": "///C/13", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.176, -0.390, -10.238, -5.810, 3.746 ], "step_params": [ 0.109, -0.450, 3.101, -2.396, 1.121, 34.618 ], "heli_params": [ -0.916, -0.529, 3.071, 1.881, 4.019, 34.716 ], "bp2_params": [ 0.033, 0.069, 0.110, 1.851, -9.635, 4.069 ], "groove_widths": [ 10.933, null, 22.317, null ], "simple_Rise": 3.101, "simple_Twist": 34.998, "simple_hRise": 3.072, "simple_hTwist": 35.095 }, { "index": 14, "nt1": "///C/14", "nt2": "///D/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.033, 0.069, 0.110, 1.851, -9.635, 4.069 ], "step_params": [ -0.919, -0.332, 3.295, 1.225, 3.777, 29.386 ], "heli_params": [ -1.442, 2.052, 3.188, 7.402, -2.401, 29.647 ], "bp2_params": [ 0.364, -0.038, -0.097, 3.842, -11.410, 6.650 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.295, "simple_Twist": 27.483, "simple_hRise": 3.178, "simple_hTwist": 27.763 }, { "index": 15, "nt1": "///C/15", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.364, -0.038, -0.097, 3.842, -11.410, 6.650 ], "step_params": [ -1.990, 0.612, 3.216, -11.272, -1.250, 32.123 ], "heli_params": [ 1.263, 1.452, 3.662, -2.176, 19.622, 34.016 ], "bp2_params": [ -0.576, -0.291, 0.426, 7.727, -13.700, -16.176 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 37.652, "simple_hRise": 3.621, "simple_hTwist": 39.264 }, { "index": 16, "nt1": "///C/16", "nt2": "///D/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 3, "stacks": [ { "index": 1, "num_nts": 3, "nts_short": "ATA", "nts_long": "///D/16,///D/17,///D/18" }, { "index": 2, "num_nts": 15, "nts_short": "ATAACTCTATATAGC", "nts_long": "///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///D/11,///D/12,///D/13,///D/14,///D/15" }, { "index": 3, "num_nts": 16, "nts_short": "TGCTATATAGAGTTAT", "nts_long": "///C/19,///C/20,///C/21,///C/22,///C/23,///C/24,///C/25,///C/26,///C/27,///C/28,///C/29,///C/30,///C/31,///C/32,///C/33,///C/34" } ], "nonStack": { "num_nts": 1, "nts_short": "G", "nts_long": "///C/16" }, "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 17, "nts_short": "ATGCTATATAGAGTTAT", "nts_long": "///C/18,///C/19,///C/20,///C/21,///C/22,///C/23,///C/24,///C/25,///C/26,///C/27,///C/28,///C/29,///C/30,///C/31,///C/32,///C/33,///C/34" }, { "index": 2, "num_nts": 18, "nts_short": "ATAACTCTATATAGCATA", "nts_long": "///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///D/11,///D/12,///D/13,///D/14,///D/15,///D/16,///D/17,///D/18" } ], "dbn": { "all_chains": { "num_nts": 67, "num_chars": 69, "bseq": "ATAACTCTATATAATG&ATGCTATATAGAGTTAT&ATAACTCTATATAGCATACATTATATAGAGTTAT", "sstr": "((((((((((((((((&.................&..................))))))))))))))))", "form": "..B.BBBB.B.BB..-&-BB.BBBBB.BB..BB-&B...B.BBBB.B.B....B.BB...BBB..BB.-" }, "chain_C": { "num_nts": 33, "num_chars": 34, "bseq": "ATAACTCTATATAATG&ATGCTATATAGAGTTAT", "sstr": "((((((((((((((((&.................", "form": "..B.BBBB.B.BB..-&-BB.BBBBB.BB..BB-" }, "chain_D": { "num_nts": 34, "num_chars": 34, "bseq": "ATAACTCTATATAGCATACATTATATAGAGTTAT", "sstr": "..................))))))))))))))))", "form": "B...B.BBBB.B.B....B.BB...BBB..BB.-" } }, "chains": { "chain_C": { "num_nts": 33, "bseq": "ATAACTCTATATAATG&ATGCTATATAGAGTTAT", "sstr": "((((((((((((((((&.................", "form": "..B.BBBB.B.BB..-&-BB.BBBBB.BB..BB-", "helical_rise": 2.074, "helical_rise_std": 1.908, "helical_axis": [ -0.336, 0.846, -0.415 ], "point1": [ 80.158, 20.335, 78.318 ], "point2": [ 53.529, 87.395, 45.390 ], "num_chars": 97, "suite": "A!!T4bA!!A!!C1bT!!C!!T!!A!!T!!A!!T!!A!!A!!T!!G..A__T!!G!!C!!T!!A!!T!!A!!T4bA!!G!!A!!G!!T!!T!!A!!T" }, "chain_D": { "num_nts": 34, "bseq": "ATAACTCTATATAGCATACATTATATAGAGTTAT", "sstr": "..................))))))))))))))))", "form": "B...B.BBBB.B.B....B.BB...BBB..BB.-", "helical_rise": 2.892, "helical_rise_std": 1.472, "helical_axis": [ 0.035, -0.250, -0.968 ], "point1": [ 64.558, 49.563, 144.834 ], "point2": [ 67.934, 25.678, 52.234 ], "num_chars": 100, "suite": "A1bT!!A!!A!!C!!T!!C!!T!!A!!T!!A!!T!!A!!G!!C!!A!!T!!A!!C!!A!!T!!T!!A1bT!!A!!T!!A!!G!!A!!G!!T!!T4bA!!T" } }, "num_nts": 67, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -118.382, "delta": 156.574, "epsilon": 136.655, "zeta": -68.733, "epsilon_zeta": -154.612, "bb_type": "--", "chi": -92.149, "glyco_bond": "anti", "C5prime_xyz": [ -0.973, 6.933, -2.243 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.161, "Dp": 1.356, "splay_angle": 18.953, "splay_distance": 3.335, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 17.961, "v1": 4.517, "v2": -23.647, "v3": 34.789, "v4": -33.629, "amplitude": 35.590, "phase_angle": 228.362, "puckering": "C4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.005, "origin": [ 73.433, 13.454, 56.283 ], "x_axis": [ -0.930, -0.086, -0.357 ], "y_axis": [ -0.150, -0.800, 0.581 ], "z_axis": [ -0.336, 0.594, 0.731 ], "quaternion": [ 0.017, -0.186, 0.316, 0.930 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -118.121, "beta": -152.483, "gamma": 82.113, "delta": 130.440, "epsilon": -142.576, "zeta": -166.346, "epsilon_zeta": 23.770, "bb_type": "--", "chi": -102.484, "glyco_bond": "anti", "C5prime_xyz": [ -3.053, 8.106, -2.353 ], "P_xyz": [ -0.939, 9.755, -2.879 ], "form": ".", "ssZp": 1.594, "Dp": 1.944, "splay_angle": 22.791, "splay_distance": 3.985, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 175.522, "theta": 176.143, "eta_prime": -164.749, "theta_prime": 178.872, "eta_base": -144.145, "theta_base": -111.362, "v0": -31.399, "v1": 40.349, "v2": -33.748, "v3": 16.161, "v4": 9.503, "amplitude": 39.827, "phase_angle": 147.926, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ 72.959, 16.227, 58.075 ], "x_axis": [ -0.921, -0.354, -0.160 ], "y_axis": [ 0.131, -0.670, 0.730 ], "z_axis": [ -0.366, 0.652, 0.664 ], "quaternion": [ -0.134, -0.146, 0.383, 0.902 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.620, "beta": 147.679, "gamma": 37.617, "delta": 154.677, "epsilon": -165.344, "zeta": -100.487, "epsilon_zeta": -64.857, "bb_type": "BI", "chi": -89.013, "glyco_bond": "--", "C5prime_xyz": [ -1.756, 7.510, -2.384 ], "P_xyz": [ 0.803, 7.604, -2.046 ], "form": "B", "ssZp": 1.201, "Dp": 1.580, "splay_angle": 18.521, "splay_distance": 3.203, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 172.167, "theta": -104.981, "eta_prime": -155.839, "theta_prime": -136.852, "eta_base": -93.524, "theta_base": -109.144, "v0": -5.116, "v1": 27.236, "v2": -37.454, "v3": 35.353, "v4": -19.420, "amplitude": 38.156, "phase_angle": 191.007, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.026, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 72.488, 17.078, 61.939 ], "x_axis": [ -0.506, -0.679, 0.532 ], "y_axis": [ 0.790, -0.117, 0.602 ], "z_axis": [ -0.346, 0.725, 0.596 ], "quaternion": [ -0.493, 0.062, 0.445, 0.745 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.987, "beta": 159.755, "gamma": 49.425, "delta": 127.428, "epsilon": -158.602, "zeta": -90.741, "epsilon_zeta": -67.860, "bb_type": "BI", "chi": -94.577, "glyco_bond": "anti", "C5prime_xyz": [ -4.129, 7.493, -2.116 ], "P_xyz": [ -2.463, 9.125, -3.277 ], "form": ".", "ssZp": 2.616, "Dp": 2.490, "splay_angle": 20.600, "splay_distance": 3.801, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 158.162, "theta": -150.368, "eta_prime": -171.074, "theta_prime": -179.775, "eta_base": -139.378, "theta_base": -134.232, "v0": -44.300, "v1": 46.046, "v2": -29.853, "v3": 5.628, "v4": 23.728, "amplitude": 46.183, "phase_angle": 130.272, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.015, "origin": [ 71.421, 18.995, 64.273 ], "x_axis": [ -0.169, -0.701, 0.693 ], "y_axis": [ 0.865, 0.231, 0.445 ], "z_axis": [ -0.472, 0.675, 0.567 ], "quaternion": [ 0.638, -0.090, -0.456, -0.614 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -97.615, "beta": 86.125, "gamma": 161.849, "delta": 86.266, "epsilon": -139.543, "zeta": -61.517, "epsilon_zeta": -78.025, "bb_type": "BI", "chi": -177.433, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 8.898, 1.088 ], "P_xyz": [ -1.571, 10.549, -0.880 ], "form": "B", "ssZp": 3.401, "Dp": 3.740, "splay_angle": 19.381, "splay_distance": 3.238, "splay_ratio": 0.169, "d22": 4.506, "d64": 3.552, "eta": -147.539, "theta": 174.053, "eta_prime": -166.488, "theta_prime": -160.079, "eta_base": -116.750, "theta_base": -116.191, "v0": -18.333, "v1": -3.689, "v2": 22.915, "v3": -34.028, "v4": 32.346, "amplitude": 34.901, "phase_angle": 48.961, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.014, "origin": [ 69.017, 19.889, 67.078 ], "x_axis": [ 0.294, -0.443, 0.847 ], "y_axis": [ 0.813, 0.582, 0.022 ], "z_axis": [ -0.503, 0.682, 0.531 ], "quaternion": [ 0.776, -0.213, -0.435, -0.405 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.873, "beta": -164.374, "gamma": 32.021, "delta": 152.903, "epsilon": -170.583, "zeta": -119.634, "epsilon_zeta": -50.949, "bb_type": "BI", "chi": -98.525, "glyco_bond": "anti", "C5prime_xyz": [ -1.802, 7.954, -2.231 ], "P_xyz": [ 0.248, 9.531, -1.711 ], "form": "B", "ssZp": 1.487, "Dp": 1.817, "splay_angle": 19.882, "splay_distance": 3.421, "splay_ratio": 0.175, "d22": 4.006, "d64": 3.841, "eta": 158.010, "theta": -142.942, "eta_prime": -160.584, "theta_prime": -154.720, "eta_base": -113.616, "theta_base": -114.989, "v0": -19.586, "v1": 36.957, "v2": -39.872, "v3": 29.480, "v4": -6.392, "amplitude": 40.434, "phase_angle": 170.438, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.115, "filter_rmsd": 0.101, "frame": { "rmsd": 0.013, "origin": [ 67.715, 21.397, 69.631 ], "x_axis": [ 0.840, -0.059, 0.540 ], "y_axis": [ 0.317, 0.860, -0.399 ], "z_axis": [ -0.441, 0.506, 0.741 ], "quaternion": [ 0.928, -0.244, -0.264, -0.101 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.366, "beta": 174.466, "gamma": 19.558, "delta": 142.431, "epsilon": -168.708, "zeta": -125.075, "epsilon_zeta": -43.633, "bb_type": "BI", "chi": -105.759, "glyco_bond": "anti", "C5prime_xyz": [ -2.512, 8.154, -1.969 ], "P_xyz": [ -0.589, 9.878, -1.812 ], "form": "B", "ssZp": 2.145, "Dp": 2.119, "splay_angle": 20.651, "splay_distance": 3.585, "splay_ratio": 0.180, "d22": 4.241, "d64": 3.919, "eta": 170.969, "theta": -145.630, "eta_prime": -167.607, "theta_prime": -153.655, "eta_base": -123.591, "theta_base": -117.142, "v0": -25.367, "v1": 38.059, "v2": -34.978, "v3": 20.519, "v4": 2.928, "amplitude": 38.017, "phase_angle": 156.937, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 66.473, 22.780, 72.503 ], "x_axis": [ 0.896, 0.381, 0.229 ], "y_axis": [ -0.162, 0.760, -0.629 ], "z_axis": [ -0.414, 0.527, 0.743 ], "quaternion": [ 0.922, -0.313, -0.175, 0.147 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -0.058, "beta": 165.013, "gamma": -11.613, "delta": 151.951, "epsilon": -156.417, "zeta": -122.248, "epsilon_zeta": -34.170, "bb_type": "BI", "chi": -89.586, "glyco_bond": "anti", "C5prime_xyz": [ -2.729, 7.745, -2.183 ], "P_xyz": [ -1.194, 9.871, -2.001 ], "form": "B", "ssZp": 2.093, "Dp": 1.973, "splay_angle": 20.106, "splay_distance": 3.398, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 172.240, "theta": -149.194, "eta_prime": -167.304, "theta_prime": -161.311, "eta_base": -126.563, "theta_base": -103.836, "v0": -18.437, "v1": 36.511, "v2": -39.240, "v3": 30.024, "v4": -7.575, "amplitude": 39.643, "phase_angle": 171.825, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 65.628, 24.729, 75.391 ], "x_axis": [ 0.697, 0.696, -0.170 ], "y_axis": [ -0.628, 0.479, -0.613 ], "z_axis": [ -0.345, 0.534, 0.771 ], "quaternion": [ 0.858, -0.334, -0.051, 0.386 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.755, "beta": 149.836, "gamma": 49.463, "delta": 95.448, "epsilon": -176.580, "zeta": -121.768, "epsilon_zeta": -54.812, "bb_type": "BI", "chi": -136.072, "glyco_bond": "anti", "C5prime_xyz": [ -2.551, 8.644, -1.042 ], "P_xyz": [ -0.308, 9.512, -1.978 ], "form": ".", "ssZp": 3.543, "Dp": 3.845, "splay_angle": 19.597, "splay_distance": 3.119, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 153.855, "theta": -172.731, "eta_prime": 167.466, "theta_prime": -170.827, "eta_base": -123.867, "theta_base": -143.683, "v0": -22.387, "v1": 2.117, "v2": 17.377, "v3": -30.875, "v4": 33.649, "amplitude": 33.745, "phase_angle": 59.005, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.019, "origin": [ 64.941, 27.619, 77.042 ], "x_axis": [ 0.118, 0.832, -0.542 ], "y_axis": [ -0.963, -0.038, -0.268 ], "z_axis": [ -0.244, 0.554, 0.796 ], "quaternion": [ 0.685, -0.300, 0.109, 0.655 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -12.981, "beta": 134.374, "gamma": 52.217, "delta": 129.198, "epsilon": -171.875, "zeta": -96.272, "epsilon_zeta": -75.603, "bb_type": "BI", "chi": -124.279, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.605, -1.183 ], "P_xyz": [ 0.126, 8.794, -1.096 ], "form": "B", "ssZp": 2.660, "Dp": 2.459, "splay_angle": 20.457, "splay_distance": 3.551, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 174.680, "theta": -121.977, "eta_prime": -152.816, "theta_prime": -148.175, "eta_base": -122.896, "theta_base": -115.689, "v0": -30.206, "v1": 33.703, "v2": -24.614, "v3": 7.945, "v4": 13.793, "amplitude": 33.460, "phase_angle": 137.360, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 64.380, 29.562, 79.416 ], "x_axis": [ -0.281, 0.706, -0.650 ], "y_axis": [ -0.955, -0.274, 0.116 ], "z_axis": [ -0.096, 0.654, 0.751 ], "quaternion": [ 0.547, -0.246, 0.253, 0.759 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.138, "beta": 172.985, "gamma": 49.998, "delta": 129.683, "epsilon": -168.472, "zeta": -94.046, "epsilon_zeta": -74.426, "bb_type": "BI", "chi": -124.228, "glyco_bond": "anti", "C5prime_xyz": [ -2.719, 8.604, -1.247 ], "P_xyz": [ -0.593, 10.091, -1.031 ], "form": ".", "ssZp": 2.587, "Dp": 2.443, "splay_angle": 21.780, "splay_distance": 3.933, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 166.275, "theta": -138.068, "eta_prime": -169.351, "theta_prime": -149.061, "eta_base": -123.784, "theta_base": -113.969, "v0": -35.585, "v1": 39.154, "v2": -28.225, "v3": 8.368, "v4": 17.146, "amplitude": 39.154, "phase_angle": 136.127, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 64.476, 32.522, 81.376 ], "x_axis": [ -0.761, 0.384, -0.522 ], "y_axis": [ -0.635, -0.606, 0.479 ], "z_axis": [ -0.133, 0.697, 0.705 ], "quaternion": [ 0.290, -0.187, 0.335, 0.876 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -70.484, "beta": 174.857, "gamma": 55.703, "delta": 130.893, "epsilon": -155.062, "zeta": -144.210, "epsilon_zeta": -10.853, "bb_type": "--", "chi": -126.675, "glyco_bond": "anti", "C5prime_xyz": [ -3.179, 8.586, -1.129 ], "P_xyz": [ -1.387, 10.384, -1.066 ], "form": "B", "ssZp": 2.460, "Dp": 2.295, "splay_angle": 19.470, "splay_distance": 3.172, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 173.694, "theta": -178.005, "eta_prime": -162.961, "theta_prime": 177.749, "eta_base": -120.160, "theta_base": -138.077, "v0": -42.067, "v1": 44.628, "v2": -30.181, "v3": 6.554, "v4": 22.411, "amplitude": 44.958, "phase_angle": 132.169, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 63.632, 36.084, 82.814 ], "x_axis": [ -0.972, -0.034, -0.231 ], "y_axis": [ -0.137, -0.720, 0.681 ], "z_axis": [ -0.190, 0.693, 0.695 ], "quaternion": [ 0.028, -0.114, 0.373, 0.920 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.451, "beta": 155.957, "gamma": 52.824, "delta": 133.853, "epsilon": -169.998, "zeta": -94.578, "epsilon_zeta": -75.420, "bb_type": "BI", "chi": -131.017, "glyco_bond": "anti", "C5prime_xyz": [ -1.987, 8.749, -0.833 ], "P_xyz": [ 0.449, 9.443, -0.429 ], "form": "B", "ssZp": 2.151, "Dp": 2.164, "splay_angle": 19.978, "splay_distance": 3.371, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 175.482, "theta": -129.743, "eta_prime": -163.118, "theta_prime": -143.988, "eta_base": -117.064, "theta_base": -108.409, "v0": -26.272, "v1": 34.918, "v2": -30.092, "v3": 15.556, "v4": 6.617, "amplitude": 34.551, "phase_angle": 150.569, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 63.614, 38.885, 84.301 ], "x_axis": [ -0.865, -0.316, 0.390 ], "y_axis": [ 0.502, -0.557, 0.662 ], "z_axis": [ 0.008, 0.768, 0.640 ], "quaternion": [ -0.234, 0.114, 0.409, 0.875 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -56.910, "beta": -173.722, "gamma": 36.989, "delta": 156.723, "epsilon": -79.346, "zeta": -156.956, "epsilon_zeta": 77.610, "bb_type": "BII", "chi": -95.227, "glyco_bond": "anti", "C5prime_xyz": [ -2.609, 7.905, -2.247 ], "P_xyz": [ -0.732, 9.643, -1.913 ], "form": ".", "ssZp": 0.013, "Dp": 0.741, "splay_angle": 18.892, "splay_distance": 3.292, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -165.170, "theta": -118.160, "eta_prime": -135.220, "theta_prime": -151.169, "eta_base": -100.034, "theta_base": -116.934, "v0": -25.739, "v1": 44.454, "v2": -45.695, "v3": 31.880, "v4": -4.064, "amplitude": 47.030, "phase_angle": 166.313, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 63.051, 41.589, 86.234 ], "x_axis": [ -0.427, -0.525, 0.737 ], "y_axis": [ 0.904, -0.213, 0.372 ], "z_axis": [ -0.039, 0.824, 0.565 ], "quaternion": [ -0.481, 0.235, 0.403, 0.742 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 18.843, "beta": -144.482, "gamma": -126.699, "delta": 129.025, "epsilon": -139.877, "zeta": -139.023, "epsilon_zeta": -0.854, "bb_type": "--", "chi": -110.367, "glyco_bond": "anti", "C5prime_xyz": [ -1.919, 8.317, -1.882 ], "P_xyz": [ -1.420, 9.133, -4.217 ], "form": ".", "ssZp": 1.559, "Dp": 2.131, "splay_angle": 24.267, "splay_distance": 4.273, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 158.449, "theta": 140.073, "eta_prime": 164.333, "theta_prime": 154.789, "eta_base": -157.125, "theta_base": -176.435, "v0": -19.998, "v1": 26.651, "v2": -23.181, "v3": 12.164, "v4": 4.831, "amplitude": 26.468, "phase_angle": 151.142, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 62.632, 44.514, 87.685 ], "x_axis": [ 0.091, -0.588, 0.804 ], "y_axis": [ 0.987, 0.162, 0.007 ], "z_axis": [ -0.135, 0.792, 0.595 ], "quaternion": [ 0.680, -0.289, -0.345, -0.579 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/16", "linked_nts": [ "///C/15", null ], "nt_type": "DNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C2'-endo,non-stack,canonical,helix-end,stem-end,phosphate", "alpha": -57.471, "beta": 149.658, "gamma": 43.772, "delta": 117.119, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -124.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.994, 8.623, -1.225 ], "P_xyz": [ 0.529, 9.198, -1.143 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -14.768, "v1": 15.843, "v2": -10.976, "v3": 2.757, "v4": 7.502, "amplitude": 15.888, "phase_angle": 133.693, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 62.297, 48.754, 88.092 ], "x_axis": [ 0.448, -0.489, 0.748 ], "y_axis": [ 0.893, 0.284, -0.349 ], "z_axis": [ -0.041, 0.825, 0.564 ], "quaternion": [ 0.758, -0.387, -0.261, -0.456 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/18", "linked_nts": [ null, "///C/19" ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": null, "v1": null, "v2": null, "v3": null, "v4": null, "amplitude": null, "phase_angle": null, "puckering": "", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": null }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -75.376, "beta": -91.984, "gamma": -89.477, "delta": 164.450, "epsilon": -135.527, "zeta": -114.574, "epsilon_zeta": -20.953, "bb_type": "--", "chi": -115.102, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.204, -1.129 ], "P_xyz": [ -1.510, 10.141, -2.964 ], "form": "B", "ssZp": 1.252, "Dp": 1.245, "splay_angle": 18.895, "splay_distance": 3.228, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": null, "theta": 164.931, "eta_prime": null, "theta_prime": -172.396, "eta_base": null, "theta_base": -142.775, "v0": -5.556, "v1": 30.124, "v2": -42.038, "v3": 39.666, "v4": -21.508, "amplitude": 42.846, "phase_angle": 191.147, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 65.826, 67.323, 77.054 ], "x_axis": [ 0.640, -0.638, -0.428 ], "y_axis": [ -0.743, -0.655, -0.136 ], "z_axis": [ -0.194, 0.405, -0.894 ], "quaternion": [ -0.151, 0.893, -0.387, -0.174 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -92.241, "beta": 160.502, "gamma": 62.555, "delta": 150.500, "epsilon": -160.833, "zeta": -151.431, "epsilon_zeta": -9.403, "bb_type": "--", "chi": -93.302, "glyco_bond": "anti", "C5prime_xyz": [ -2.966, 7.796, -2.262 ], "P_xyz": [ -0.612, 8.650, -2.834 ], "form": "B", "ssZp": 1.869, "Dp": 1.901, "splay_angle": 23.214, "splay_distance": 3.844, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 140.726, "theta": -148.800, "eta_prime": -172.378, "theta_prime": -176.586, "eta_base": -144.086, "theta_base": -122.928, "v0": -26.503, "v1": 42.217, "v2": -41.318, "v3": 27.372, "v4": -0.811, "amplitude": 43.367, "phase_angle": 162.319, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 64.279, 68.900, 74.701 ], "x_axis": [ 0.257, -0.895, -0.365 ], "y_axis": [ -0.964, -0.263, -0.035 ], "z_axis": [ -0.065, 0.361, -0.930 ], "quaternion": [ -0.127, 0.783, -0.594, -0.137 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -33.421, "beta": 139.527, "gamma": 46.411, "delta": 130.382, "epsilon": -171.158, "zeta": -101.303, "epsilon_zeta": -69.855, "bb_type": "BI", "chi": -125.942, "glyco_bond": "anti", "C5prime_xyz": [ -2.320, 8.821, -1.249 ], "P_xyz": [ 0.151, 9.642, -0.958 ], "form": ".", "ssZp": 2.049, "Dp": 2.183, "splay_angle": 15.748, "splay_distance": 2.783, "splay_ratio": 0.143, "d22": 4.472, "d64": 4.266, "eta": 172.100, "theta": -137.692, "eta_prime": -165.630, "theta_prime": -158.100, "eta_base": -109.734, "theta_base": -127.311, "v0": -32.940, "v1": 38.706, "v2": -30.079, "v3": 11.899, "v4": 13.097, "amplitude": 38.274, "phase_angle": 141.801, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ 64.137, 69.714, 70.947 ], "x_axis": [ -0.454, -0.851, -0.264 ], "y_axis": [ -0.875, 0.369, 0.313 ], "z_axis": [ -0.169, 0.372, -0.913 ], "quaternion": [ 0.029, -0.522, 0.827, 0.207 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -83.997, "beta": 173.295, "gamma": 69.204, "delta": 124.632, "epsilon": -171.532, "zeta": -115.960, "epsilon_zeta": -55.573, "bb_type": "BI", "chi": -116.699, "glyco_bond": "anti", "C5prime_xyz": [ -3.046, 8.424, -1.587 ], "P_xyz": [ -0.954, 9.891, -2.030 ], "form": "B", "ssZp": 2.485, "Dp": 2.443, "splay_angle": 23.756, "splay_distance": 3.973, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 167.013, "theta": -158.412, "eta_prime": -170.086, "theta_prime": -168.806, "eta_base": -131.825, "theta_base": -117.580, "v0": -34.275, "v1": 38.354, "v2": -27.622, "v3": 8.703, "v4": 15.840, "amplitude": 37.877, "phase_angle": 136.823, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 64.725, 70.146, 68.261 ], "x_axis": [ -0.840, -0.483, -0.247 ], "y_axis": [ -0.536, 0.808, 0.243 ], "z_axis": [ 0.082, 0.337, -0.938 ], "quaternion": [ 0.087, -0.269, 0.947, 0.153 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -45.060, "beta": 159.619, "gamma": 57.171, "delta": 116.591, "epsilon": 176.953, "zeta": -73.164, "epsilon_zeta": -109.884, "bb_type": "BI", "chi": -131.305, "glyco_bond": "anti", "C5prime_xyz": [ -2.397, 8.735, -1.015 ], "P_xyz": [ -0.080, 9.798, -0.611 ], "form": "B", "ssZp": 2.160, "Dp": 2.311, "splay_angle": 19.115, "splay_distance": 3.285, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": -179.938, "theta": -139.339, "eta_prime": -155.964, "theta_prime": -150.909, "eta_base": -100.256, "theta_base": -116.819, "v0": -27.180, "v1": 29.509, "v2": -20.854, "v3": 5.777, "v4": 13.359, "amplitude": 29.512, "phase_angle": 134.961, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 64.242, 70.903, 64.391 ], "x_axis": [ -0.977, 0.200, -0.074 ], "y_axis": [ 0.152, 0.896, 0.416 ], "z_axis": [ 0.150, 0.396, -0.906 ], "quaternion": [ 0.058, 0.090, 0.972, 0.209 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -75.363, "beta": -155.937, "gamma": 49.952, "delta": 146.493, "epsilon": -168.530, "zeta": -129.868, "epsilon_zeta": -38.662, "bb_type": "--", "chi": -104.352, "glyco_bond": "anti", "C5prime_xyz": [ -2.491, 8.081, -2.091 ], "P_xyz": [ -0.803, 9.869, -1.592 ], "form": "B", "ssZp": 1.533, "Dp": 1.847, "splay_angle": 21.710, "splay_distance": 3.515, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 171.315, "theta": -146.576, "eta_prime": -160.164, "theta_prime": -156.830, "eta_base": -120.466, "theta_base": -97.562, "v0": -31.925, "v1": 45.316, "v2": -40.331, "v3": 23.245, "v4": 5.196, "amplitude": 44.682, "phase_angle": 154.505, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.114, "frame": { "rmsd": 0.017, "origin": [ 64.351, 71.444, 61.153 ], "x_axis": [ -0.726, 0.675, 0.131 ], "y_axis": [ 0.674, 0.661, 0.331 ], "z_axis": [ 0.137, 0.328, -0.935 ], "quaternion": [ 0.002, 0.370, 0.911, 0.181 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 13.324, "beta": -179.821, "gamma": -28.643, "delta": 166.482, "epsilon": 178.635, "zeta": -97.571, "epsilon_zeta": -83.794, "bb_type": "BI", "chi": -89.053, "glyco_bond": "anti", "C5prime_xyz": [ -1.219, 7.223, -2.168 ], "P_xyz": [ 0.611, 9.127, -2.002 ], "form": "B", "ssZp": 1.224, "Dp": 1.562, "splay_angle": 19.070, "splay_distance": 3.328, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 172.987, "theta": -137.323, "eta_prime": -166.586, "theta_prime": -147.689, "eta_base": -105.014, "theta_base": -123.236, "v0": 4.532, "v1": 22.392, "v2": -38.724, "v3": 42.305, "v4": -29.898, "amplitude": 42.560, "phase_angle": 204.512, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 64.718, 73.616, 58.414 ], "x_axis": [ 0.030, 0.898, 0.439 ], "y_axis": [ 0.993, -0.076, 0.088 ], "z_axis": [ 0.112, 0.433, -0.894 ], "quaternion": [ -0.122, 0.707, 0.669, 0.195 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -64.945, "beta": 174.068, "gamma": 42.465, "delta": 131.778, "epsilon": -138.792, "zeta": -170.941, "epsilon_zeta": 32.149, "bb_type": "--", "chi": -98.966, "glyco_bond": "anti", "C5prime_xyz": [ -3.303, 8.061, -2.067 ], "P_xyz": [ -1.418, 9.699, -2.762 ], "form": "B", "ssZp": 2.282, "Dp": 2.148, "splay_angle": 19.068, "splay_distance": 3.283, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 166.133, "theta": 176.237, "eta_prime": -173.360, "theta_prime": 174.245, "eta_base": -145.603, "theta_base": -150.490, "v0": -35.920, "v1": 42.499, "v2": -32.576, "v3": 12.808, "v4": 14.321, "amplitude": 41.662, "phase_angle": 141.436, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.011, "origin": [ 64.653, 75.081, 55.426 ], "x_axis": [ 0.379, 0.794, 0.474 ], "y_axis": [ 0.923, -0.362, -0.132 ], "z_axis": [ 0.067, 0.488, -0.870 ], "quaternion": [ -0.192, 0.808, 0.531, 0.168 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -41.511, "beta": 125.555, "gamma": 47.166, "delta": 126.747, "epsilon": -179.572, "zeta": -90.091, "epsilon_zeta": -89.480, "bb_type": "BI", "chi": -121.354, "glyco_bond": "anti", "C5prime_xyz": [ -2.625, 8.509, -1.486 ], "P_xyz": [ -0.137, 9.047, -1.396 ], "form": ".", "ssZp": 2.281, "Dp": 2.372, "splay_angle": 19.531, "splay_distance": 3.479, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.025, "theta": -123.627, "eta_prime": -171.060, "theta_prime": -150.477, "eta_base": -134.256, "theta_base": -111.555, "v0": -35.197, "v1": 38.108, "v2": -27.129, "v3": 7.461, "v4": 17.414, "amplitude": 38.312, "phase_angle": 135.081, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 64.830, 75.914, 52.256 ], "x_axis": [ 0.758, 0.519, 0.395 ], "y_axis": [ 0.649, -0.658, -0.381 ], "z_axis": [ 0.062, 0.545, -0.836 ], "quaternion": [ -0.257, 0.902, 0.324, 0.127 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -95.176, "beta": 177.596, "gamma": 82.990, "delta": 114.247, "epsilon": -160.391, "zeta": -134.898, "epsilon_zeta": -25.493, "bb_type": "--", "chi": -139.274, "glyco_bond": "anti", "C5prime_xyz": [ -2.823, 8.811, -0.931 ], "P_xyz": [ -0.668, 10.222, -1.055 ], "form": "B", "ssZp": 2.525, "Dp": 2.540, "splay_angle": 20.040, "splay_distance": 3.368, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 169.539, "theta": -161.348, "eta_prime": -171.295, "theta_prime": -163.115, "eta_base": -121.806, "theta_base": -120.042, "v0": -43.024, "v1": 37.222, "v2": -18.240, "v3": -6.155, "v4": 31.051, "amplitude": 42.298, "phase_angle": 115.546, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 65.482, 78.762, 50.369 ], "x_axis": [ 0.975, -0.042, 0.219 ], "y_axis": [ 0.087, -0.834, -0.544 ], "z_axis": [ 0.206, 0.550, -0.810 ], "quaternion": [ -0.288, 0.951, 0.012, 0.112 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 29, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/29", "linked_nts": [ "///C/28", "///C/30" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 0.542, "beta": 139.295, "gamma": 12.526, "delta": 145.489, "epsilon": -169.629, "zeta": -124.580, "epsilon_zeta": -45.049, "bb_type": "BI", "chi": -114.682, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.449, -1.476 ], "P_xyz": [ -0.420, 9.718, -0.487 ], "form": "B", "ssZp": 1.994, "Dp": 2.144, "splay_angle": 21.740, "splay_distance": 3.597, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 165.429, "theta": -142.170, "eta_prime": -164.671, "theta_prime": -155.114, "eta_base": -115.239, "theta_base": -102.388, "v0": -26.119, "v1": 40.635, "v2": -39.061, "v3": 25.080, "v4": 0.417, "amplitude": 41.386, "phase_angle": 160.703, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 66.363, 80.902, 47.921 ], "x_axis": [ 0.841, -0.527, -0.120 ], "y_axis": [ -0.500, -0.675, -0.542 ], "z_axis": [ 0.205, 0.516, -0.831 ], "quaternion": [ -0.289, 0.915, -0.281, 0.023 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 30, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/30", "linked_nts": [ "///C/29", "///C/31" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -45.569, "beta": 162.599, "gamma": 47.953, "delta": 140.571, "epsilon": -163.983, "zeta": -114.408, "epsilon_zeta": -49.574, "bb_type": "BI", "chi": -121.418, "glyco_bond": "anti", "C5prime_xyz": [ -2.268, 8.624, -1.251 ], "P_xyz": [ 0.031, 9.691, -0.545 ], "form": ".", "ssZp": 1.722, "Dp": 1.949, "splay_angle": 19.890, "splay_distance": 3.471, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 172.381, "theta": -138.312, "eta_prime": -160.768, "theta_prime": -154.588, "eta_base": -100.744, "theta_base": -128.163, "v0": -24.022, "v1": 36.634, "v2": -35.059, "v3": 22.024, "v4": 1.097, "amplitude": 37.360, "phase_angle": 159.786, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 67.839, 82.435, 45.021 ], "x_axis": [ 0.271, -0.834, -0.480 ], "y_axis": [ -0.957, -0.180, -0.227 ], "z_axis": [ 0.103, 0.521, -0.847 ], "quaternion": [ -0.247, 0.758, -0.591, -0.124 ] } }, { "index": 30, "index_chain": 30, "chain_name": "C", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/31", "linked_nts": [ "///C/30", "///C/32" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -43.061, "beta": -177.949, "gamma": 25.436, "delta": 136.613, "epsilon": -155.839, "zeta": -130.004, "epsilon_zeta": -25.835, "bb_type": "--", "chi": -105.508, "glyco_bond": "anti", "C5prime_xyz": [ -2.251, 8.199, -2.096 ], "P_xyz": [ -0.524, 10.049, -1.578 ], "form": ".", "ssZp": 1.282, "Dp": 1.782, "splay_angle": 15.876, "splay_distance": 2.831, "splay_ratio": 0.140, "d22": 4.601, "d64": 4.073, "eta": 178.076, "theta": -145.342, "eta_prime": -166.172, "theta_prime": -158.018, "eta_base": -134.681, "theta_base": -135.651, "v0": -24.236, "v1": 34.662, "v2": -31.935, "v3": 18.668, "v4": 3.333, "amplitude": 34.931, "phase_angle": 156.095, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.013, "origin": [ 69.393, 84.706, 42.905 ], "x_axis": [ -0.244, -0.793, -0.558 ], "y_axis": [ -0.961, 0.275, 0.030 ], "z_axis": [ 0.129, 0.544, -0.829 ], "quaternion": [ 0.224, -0.572, 0.766, 0.187 ] } }, { "index": 31, "index_chain": 31, "chain_name": "C", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/32", "linked_nts": [ "///C/31", "///C/33" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 37.172, "beta": -174.651, "gamma": -72.087, "delta": 151.385, "epsilon": -162.912, "zeta": -120.175, "epsilon_zeta": -42.737, "bb_type": "BI", "chi": -96.058, "glyco_bond": "anti", "C5prime_xyz": [ -1.760, 7.762, -2.103 ], "P_xyz": [ -0.787, 9.789, -3.259 ], "form": "B", "ssZp": 1.488, "Dp": 1.757, "splay_angle": 23.227, "splay_distance": 3.960, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 176.416, "theta": -176.948, "eta_prime": -173.874, "theta_prime": -171.913, "eta_base": -149.497, "theta_base": -111.977, "v0": -5.124, "v1": 23.993, "v2": -32.392, "v3": 30.141, "v4": -16.117, "amplitude": 32.867, "phase_angle": 189.756, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.097, "frame": { "rmsd": 0.013, "origin": [ 70.723, 86.312, 40.990 ], "x_axis": [ -0.642, -0.574, -0.508 ], "y_axis": [ -0.711, 0.694, 0.114 ], "z_axis": [ 0.287, 0.434, -0.854 ], "quaternion": [ 0.223, -0.360, 0.893, 0.154 ] } }, { "index": 32, "index_chain": 32, "chain_name": "C", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/33", "linked_nts": [ "///C/32", "///C/34" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -39.123, "beta": 152.890, "gamma": 42.543, "delta": 137.361, "epsilon": -174.396, "zeta": -109.926, "epsilon_zeta": -64.471, "bb_type": "BI", "chi": -107.443, "glyco_bond": "anti", "C5prime_xyz": [ -2.244, 8.282, -1.987 ], "P_xyz": [ 0.152, 9.139, -2.026 ], "form": "B", "ssZp": 1.935, "Dp": 2.088, "splay_angle": 18.934, "splay_distance": 3.179, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 166.658, "theta": -144.630, "eta_prime": -158.408, "theta_prime": -162.540, "eta_base": -99.088, "theta_base": -125.745, "v0": -28.104, "v1": 38.691, "v2": -34.365, "v3": 18.803, "v4": 5.746, "amplitude": 38.546, "phase_angle": 153.065, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.008, "origin": [ 70.202, 88.518, 37.743 ], "x_axis": [ -0.949, 0.051, -0.311 ], "y_axis": [ -0.094, 0.896, 0.433 ], "z_axis": [ 0.301, 0.441, -0.846 ], "quaternion": [ 0.159, -0.011, 0.961, 0.227 ] } }, { "index": 33, "index_chain": 33, "chain_name": "C", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/34", "linked_nts": [ "///C/33", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -78.475, "beta": 168.370, "gamma": 75.180, "delta": 143.647, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -110.700, "glyco_bond": "anti", "C5prime_xyz": [ -2.951, 8.379, -1.594 ], "P_xyz": [ -0.682, 9.492, -2.178 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -33.501, "v1": 45.445, "v2": -39.381, "v3": 21.451, "v4": 7.320, "amplitude": 44.658, "phase_angle": 151.863, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.010, "origin": [ 71.087, 89.562, 34.874 ], "x_axis": [ -0.811, 0.561, -0.166 ], "y_axis": [ 0.449, 0.779, 0.438 ], "z_axis": [ 0.375, 0.281, -0.883 ], "quaternion": [ 0.145, 0.271, 0.932, 0.193 ] } }, { "index": 34, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 52.802, "delta": 94.165, "epsilon": -154.017, "zeta": -92.098, "epsilon_zeta": -61.919, "bb_type": "BI", "chi": -141.907, "glyco_bond": "anti", "C5prime_xyz": [ -2.175, 8.848, -0.681 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 3.135, "Dp": 3.555, "splay_angle": 17.943, "splay_distance": 3.091, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -18.931, "v1": 2.258, "v2": 13.975, "v3": -25.197, "v4": 27.836, "amplitude": 27.873, "phase_angle": 59.909, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 70.764, 31.133, 145.516 ], "x_axis": [ -0.926, -0.361, -0.111 ], "y_axis": [ -0.365, 0.779, 0.510 ], "z_axis": [ -0.098, 0.513, -0.853 ], "quaternion": [ 0.003, -0.192, 0.943, 0.271 ] } }, { "index": 35, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -36.221, "beta": 160.767, "gamma": 40.947, "delta": 128.936, "epsilon": -154.312, "zeta": -139.716, "epsilon_zeta": -14.597, "bb_type": "--", "chi": -114.482, "glyco_bond": "anti", "C5prime_xyz": [ -2.678, 8.352, -1.739 ], "P_xyz": [ -0.546, 9.720, -1.588 ], "form": ".", "ssZp": 1.910, "Dp": 2.100, "splay_angle": 20.987, "splay_distance": 3.588, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 178.182, "theta": -167.747, "eta_prime": -155.365, "theta_prime": -168.902, "eta_base": -132.354, "theta_base": -110.526, "v0": -31.967, "v1": 36.369, "v2": -27.048, "v3": 9.221, "v4": 14.240, "amplitude": 36.051, "phase_angle": 138.614, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.090, "filter_rmsd": 0.104, "frame": { "rmsd": 0.013, "origin": [ 70.787, 32.315, 142.660 ], "x_axis": [ -0.982, -0.070, 0.177 ], "y_axis": [ -0.000, 0.931, 0.366 ], "z_axis": [ -0.190, 0.359, -0.914 ], "quaternion": [ -0.094, -0.018, 0.978, 0.185 ] } }, { "index": 36, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -38.373, "beta": 159.515, "gamma": 33.412, "delta": 164.509, "epsilon": -155.012, "zeta": -104.558, "epsilon_zeta": -50.453, "bb_type": "BI", "chi": -98.354, "glyco_bond": "anti", "C5prime_xyz": [ -1.630, 7.902, -2.046 ], "P_xyz": [ 0.859, 8.295, -1.576 ], "form": ".", "ssZp": 1.336, "Dp": 1.362, "splay_angle": 18.950, "splay_distance": 3.361, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 165.450, "theta": -101.890, "eta_prime": -156.813, "theta_prime": -136.270, "eta_base": -100.850, "theta_base": -103.960, "v0": -8.094, "v1": 29.048, "v2": -39.942, "v3": 37.081, "v4": -16.788, "amplitude": 40.310, "phase_angle": 187.749, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.015, "origin": [ 70.501, 34.778, 140.066 ], "x_axis": [ -0.684, 0.641, 0.349 ], "y_axis": [ 0.708, 0.697, 0.108 ], "z_axis": [ -0.174, 0.321, -0.931 ], "quaternion": [ -0.144, 0.371, 0.910, 0.118 ] } }, { "index": 37, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -65.518, "beta": 164.901, "gamma": 34.614, "delta": 135.459, "epsilon": -143.694, "zeta": -127.372, "epsilon_zeta": -16.322, "bb_type": "--", "chi": -90.562, "glyco_bond": "anti", "C5prime_xyz": [ -3.801, 7.853, -2.036 ], "P_xyz": [ -2.176, 9.664, -2.918 ], "form": ".", "ssZp": 2.659, "Dp": 2.594, "splay_angle": 21.564, "splay_distance": 3.959, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 151.539, "theta": -143.060, "eta_prime": -179.955, "theta_prime": -172.298, "eta_base": -139.800, "theta_base": -117.127, "v0": -39.321, "v1": 45.444, "v2": -34.274, "v3": 13.202, "v4": 15.549, "amplitude": 44.450, "phase_angle": 140.449, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.019, "origin": [ 69.189, 36.219, 137.329 ], "x_axis": [ -0.302, 0.861, 0.409 ], "y_axis": [ 0.913, 0.384, -0.136 ], "z_axis": [ -0.275, 0.332, -0.902 ], "quaternion": [ -0.213, 0.551, 0.804, 0.061 ] } }, { "index": 38, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": 39.426, "beta": -102.391, "gamma": -108.418, "delta": 112.878, "epsilon": -159.839, "zeta": -60.245, "epsilon_zeta": -99.593, "bb_type": "BI", "chi": -156.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.030, 8.477, 0.566 ], "P_xyz": [ -0.857, 10.644, -0.959 ], "form": "B", "ssZp": 3.313, "Dp": 3.450, "splay_angle": 19.604, "splay_distance": 3.286, "splay_ratio": 0.170, "d22": 4.502, "d64": 3.753, "eta": -148.639, "theta": 168.500, "eta_prime": -166.624, "theta_prime": -164.611, "eta_base": -104.810, "theta_base": -126.921, "v0": 5.747, "v1": -7.933, "v2": 7.051, "v3": -3.991, "v4": -1.037, "amplitude": 7.865, "phase_angle": 333.698, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.011, "origin": [ 67.590, 39.336, 135.484 ], "x_axis": [ 0.342, 0.905, 0.252 ], "y_axis": [ 0.888, -0.224, -0.401 ], "z_axis": [ -0.307, 0.361, -0.881 ], "quaternion": [ -0.243, 0.782, 0.573, -0.017 ] } }, { "index": 39, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -86.320, "beta": -171.663, "gamma": 59.404, "delta": 124.836, "epsilon": 179.072, "zeta": -110.556, "epsilon_zeta": -70.372, "bb_type": "BI", "chi": -122.350, "glyco_bond": "anti", "C5prime_xyz": [ -1.958, 8.579, -1.382 ], "P_xyz": [ 0.394, 9.511, -0.981 ], "form": ".", "ssZp": 2.404, "Dp": 2.448, "splay_angle": 19.936, "splay_distance": 3.510, "splay_ratio": 0.176, "d22": 4.267, "d64": 4.087, "eta": 155.400, "theta": -136.895, "eta_prime": -165.619, "theta_prime": -152.587, "eta_base": -123.697, "theta_base": -115.629, "v0": -25.414, "v1": 27.771, "v2": -20.066, "v3": 5.763, "v4": 12.466, "amplitude": 27.952, "phase_angle": 135.880, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ 66.470, 40.906, 132.823 ], "x_axis": [ 0.821, 0.569, 0.056 ], "y_axis": [ 0.494, -0.657, -0.569 ], "z_axis": [ -0.287, 0.494, -0.821 ], "quaternion": [ -0.293, 0.908, 0.293, -0.064 ] } }, { "index": 40, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 62.171, "beta": -178.859, "gamma": -71.936, "delta": 168.026, "epsilon": -168.365, "zeta": -120.034, "epsilon_zeta": -48.331, "bb_type": "BI", "chi": -115.516, "glyco_bond": "anti", "C5prime_xyz": [ -1.188, 8.105, -1.047 ], "P_xyz": [ 0.297, 10.233, -1.083 ], "form": "B", "ssZp": 1.891, "Dp": 1.793, "splay_angle": 20.166, "splay_distance": 3.493, "splay_ratio": 0.178, "d22": 4.365, "d64": 3.892, "eta": -177.861, "theta": -145.031, "eta_prime": -157.440, "theta_prime": -152.136, "eta_base": -113.384, "theta_base": -111.849, "v0": -3.393, "v1": 28.810, "v2": -41.603, "v3": 40.411, "v4": -23.606, "amplitude": 42.868, "phase_angle": 193.954, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 65.659, 43.383, 130.472 ], "x_axis": [ 0.956, 0.088, -0.280 ], "y_axis": [ -0.069, -0.860, -0.506 ], "z_axis": [ -0.285, 0.503, -0.816 ], "quaternion": [ -0.265, 0.953, 0.005, -0.148 ] } }, { "index": 41, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 37.269, "beta": 179.903, "gamma": -58.725, "delta": 161.720, "epsilon": -171.576, "zeta": -108.886, "epsilon_zeta": -62.690, "bb_type": "BI", "chi": -106.511, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 7.820, -1.559 ], "P_xyz": [ 0.134, 9.979, -1.752 ], "form": "B", "ssZp": 1.993, "Dp": 1.902, "splay_angle": 18.185, "splay_distance": 3.054, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 168.006, "theta": -155.243, "eta_prime": -169.162, "theta_prime": -153.258, "eta_base": -123.323, "theta_base": -115.900, "v0": -0.388, "v1": 23.461, "v2": -35.998, "v3": 36.569, "v4": -23.114, "amplitude": 37.834, "phase_angle": 197.923, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 65.172, 45.561, 127.784 ], "x_axis": [ 0.739, -0.451, -0.501 ], "y_axis": [ -0.626, -0.735, -0.261 ], "z_axis": [ -0.250, 0.506, -0.825 ], "quaternion": [ -0.211, 0.908, -0.296, -0.207 ] } }, { "index": 42, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -54.072, "beta": 163.314, "gamma": 49.752, "delta": 136.765, "epsilon": -161.091, "zeta": -125.264, "epsilon_zeta": -35.827, "bb_type": "BI", "chi": -104.452, "glyco_bond": "anti", "C5prime_xyz": [ -3.141, 8.012, -2.010 ], "P_xyz": [ -0.925, 9.377, -2.147 ], "form": "B", "ssZp": 2.156, "Dp": 2.180, "splay_angle": 19.053, "splay_distance": 3.232, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 164.037, "theta": -148.203, "eta_prime": -162.256, "theta_prime": -162.644, "eta_base": -122.576, "theta_base": -119.326, "v0": -32.936, "v1": 40.640, "v2": -32.913, "v3": 15.125, "v4": 10.916, "amplitude": 39.891, "phase_angle": 145.597, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 64.662, 46.867, 125.071 ], "x_axis": [ 0.369, -0.762, -0.533 ], "y_axis": [ -0.920, -0.381, -0.092 ], "z_axis": [ -0.133, 0.524, -0.841 ], "quaternion": [ -0.191, 0.805, -0.522, -0.207 ] } }, { "index": 43, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -53.158, "beta": 153.159, "gamma": 57.631, "delta": 133.063, "epsilon": -128.092, "zeta": -127.077, "epsilon_zeta": -1.014, "bb_type": "--", "chi": -112.767, "glyco_bond": "anti", "C5prime_xyz": [ -3.129, 8.325, -1.719 ], "P_xyz": [ -0.995, 9.602, -2.186 ], "form": "B", "ssZp": 1.554, "Dp": 1.531, "splay_angle": 18.869, "splay_distance": 3.203, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -170.994, "theta": -153.044, "eta_prime": -152.520, "theta_prime": -167.017, "eta_base": -109.940, "theta_base": -119.057, "v0": -33.849, "v1": 41.216, "v2": -34.236, "v3": 16.131, "v4": 10.604, "amplitude": 41.020, "phase_angle": 146.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.018, "origin": [ 64.743, 47.995, 122.043 ], "x_axis": [ -0.235, -0.816, -0.528 ], "y_axis": [ -0.972, 0.200, 0.124 ], "z_axis": [ 0.004, 0.543, -0.840 ], "quaternion": [ 0.176, -0.593, 0.754, 0.221 ] } }, { "index": 44, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -66.591, "beta": 148.805, "gamma": 52.581, "delta": 115.960, "epsilon": -168.159, "zeta": -81.583, "epsilon_zeta": -86.576, "bb_type": "BI", "chi": -126.365, "glyco_bond": "anti", "C5prime_xyz": [ -2.541, 8.572, -1.516 ], "P_xyz": [ -0.262, 9.662, -1.848 ], "form": ".", "ssZp": 2.169, "Dp": 2.157, "splay_angle": 19.224, "splay_distance": 3.570, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.477, "theta": -139.105, "eta_prime": -177.096, "theta_prime": -153.484, "eta_base": -126.034, "theta_base": -117.139, "v0": -28.336, "v1": 25.765, "v2": -13.363, "v3": -2.518, "v4": 18.722, "amplitude": 27.890, "phase_angle": 118.630, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.012, "origin": [ 64.679, 49.516, 119.225 ], "x_axis": [ -0.780, -0.577, -0.242 ], "y_axis": [ -0.622, 0.669, 0.408 ], "z_axis": [ -0.073, 0.469, -0.880 ], "quaternion": [ 0.046, -0.328, 0.912, 0.240 ] } }, { "index": 45, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -54.437, "beta": 172.044, "gamma": 41.151, "delta": 123.023, "epsilon": -157.528, "zeta": -143.033, "epsilon_zeta": -14.496, "bb_type": "--", "chi": -121.699, "glyco_bond": "anti", "C5prime_xyz": [ -3.064, 8.515, -1.623 ], "P_xyz": [ -1.495, 10.511, -1.765 ], "form": "B", "ssZp": 2.222, "Dp": 2.165, "splay_angle": 20.576, "splay_distance": 3.357, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 175.685, "theta": 170.334, "eta_prime": -162.328, "theta_prime": 172.402, "eta_base": -120.950, "theta_base": -136.866, "v0": -41.276, "v1": 42.441, "v2": -27.578, "v3": 4.274, "v4": 23.356, "amplitude": 43.315, "phase_angle": 129.545, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ 64.133, 49.994, 115.729 ], "x_axis": [ -0.987, -0.159, -0.001 ], "y_axis": [ -0.144, 0.894, 0.425 ], "z_axis": [ -0.067, 0.419, -0.905 ], "quaternion": [ -0.017, -0.078, 0.973, 0.217 ] } }, { "index": 46, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -41.943, "beta": 166.759, "gamma": 34.355, "delta": 144.584, "epsilon": 156.704, "zeta": -83.853, "epsilon_zeta": -119.443, "bb_type": "BI", "chi": -119.984, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.398, -1.144 ], "P_xyz": [ 0.925, 9.038, -0.402 ], "form": ".", "ssZp": 1.771, "Dp": 1.883, "splay_angle": 20.430, "splay_distance": 3.498, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 163.334, "theta": -124.704, "eta_prime": -165.069, "theta_prime": -149.310, "eta_base": -112.739, "theta_base": -119.264, "v0": -9.853, "v1": 26.108, "v2": -31.425, "v3": 26.492, "v4": -10.745, "amplitude": 31.428, "phase_angle": 180.756, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 64.586, 51.317, 112.678 ], "x_axis": [ -0.840, 0.512, 0.179 ], "y_axis": [ 0.538, 0.743, 0.399 ], "z_axis": [ 0.071, 0.431, -0.900 ], "quaternion": [ -0.029, 0.281, 0.933, 0.222 ] } }, { "index": 47, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -109.586, "beta": -154.554, "gamma": 87.516, "delta": 129.606, "epsilon": -156.577, "zeta": -64.916, "epsilon_zeta": -91.660, "bb_type": "BI", "chi": -120.660, "glyco_bond": "anti", "C5prime_xyz": [ -2.973, 8.496, -1.465 ], "P_xyz": [ -0.789, 9.845, -1.374 ], "form": "B", "ssZp": 2.336, "Dp": 2.294, "splay_angle": 24.579, "splay_distance": 4.171, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 172.985, "theta": -133.579, "eta_prime": -163.876, "theta_prime": -162.264, "eta_base": -124.436, "theta_base": -113.394, "v0": -38.720, "v1": 41.486, "v2": -28.597, "v3": 7.389, "v4": 19.342, "amplitude": 41.406, "phase_angle": 133.681, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 64.153, 51.699, 109.227 ], "x_axis": [ -0.424, 0.895, 0.140 ], "y_axis": [ 0.890, 0.383, 0.248 ], "z_axis": [ 0.168, 0.230, -0.959 ], "quaternion": [ 0.009, 0.537, 0.832, 0.144 ] } }, { "index": 48, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -114.206, "beta": 55.776, "gamma": 177.860, "delta": 151.180, "epsilon": -151.022, "zeta": -122.654, "epsilon_zeta": -28.367, "bb_type": "--", "chi": -170.375, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 7.928, 1.798 ], "P_xyz": [ -0.707, 9.943, 0.305 ], "form": ".", "ssZp": 1.580, "Dp": 1.849, "splay_angle": 18.110, "splay_distance": 3.011, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": -125.690, "theta": 163.583, "eta_prime": -152.307, "theta_prime": -157.863, "eta_base": -98.515, "theta_base": -124.992, "v0": 0.421, "v1": 20.049, "v2": -31.423, "v3": 32.610, "v4": -21.023, "amplitude": 33.309, "phase_angle": 199.373, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 64.404, 53.347, 105.404 ], "x_axis": [ 0.187, 0.934, 0.305 ], "y_axis": [ 0.908, -0.283, 0.310 ], "z_axis": [ 0.376, 0.219, -0.900 ], "quaternion": [ 0.030, 0.770, 0.598, 0.221 ] } }, { "index": 49, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": ".", "summary": "non-pair-contact,ss-non-loop", "alpha": 61.752, "beta": 119.720, "gamma": -43.537, "delta": 119.641, "epsilon": 42.843, "zeta": 61.963, "epsilon_zeta": -19.120, "bb_type": "--", "chi": -80.839, "glyco_bond": "--", "C5prime_xyz": [ -1.519, 6.528, -2.879 ], "P_xyz": [ 0.492, 8.187, -2.748 ], "form": ".", "ssZp": -1.003, "Dp": 1.676, "splay_angle": 33.973, "splay_distance": 5.544, "splay_ratio": 0.297, "d22": null, "d64": null, "eta": -178.122, "theta": -164.800, "eta_prime": -142.388, "theta_prime": -179.052, "eta_base": -115.980, "theta_base": -122.654, "v0": 22.727, "v1": -17.718, "v2": 6.727, "v3": 6.106, "v4": -18.062, "amplitude": 22.046, "phase_angle": 287.766, "puckering": "O4'-exo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 65.031, 52.547, 102.569 ], "x_axis": [ 0.801, 0.579, 0.157 ], "y_axis": [ 0.598, -0.790, -0.135 ], "z_axis": [ 0.046, 0.202, -0.978 ], "quaternion": [ -0.089, 0.945, 0.311, 0.054 ] } }, { "index": 50, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 144.185, "beta": 115.779, "gamma": 151.691, "delta": 158.119, "epsilon": -164.825, "zeta": -95.419, "epsilon_zeta": -69.406, "bb_type": "BI", "chi": -127.025, "glyco_bond": "anti", "C5prime_xyz": [ -0.850, 7.974, -0.552 ], "P_xyz": [ 0.461, 8.378, -2.736 ], "form": ".", "ssZp": 1.962, "Dp": 2.114, "splay_angle": 20.152, "splay_distance": 3.492, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": -160.697, "theta": 177.801, "eta_prime": -167.313, "theta_prime": -168.549, "eta_base": -118.027, "theta_base": -114.691, "v0": 8.575, "v1": 13.782, "v2": -29.264, "v3": 34.884, "v4": -27.493, "amplitude": 34.662, "phase_angle": 212.406, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.013, "origin": [ 64.824, 50.463, 97.436 ], "x_axis": [ 0.978, -0.020, -0.209 ], "y_axis": [ 0.023, -0.980, 0.200 ], "z_axis": [ -0.209, -0.200, -0.957 ], "quaternion": [ 0.101, 0.989, 0.001, -0.106 ] } }, { "index": 51, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -88.993, "beta": -172.468, "gamma": 70.907, "delta": 141.848, "epsilon": -171.233, "zeta": -117.514, "epsilon_zeta": -53.719, "bb_type": "BI", "chi": -94.580, "glyco_bond": "anti", "C5prime_xyz": [ -1.676, 7.547, -2.593 ], "P_xyz": [ 0.918, 7.643, -2.851 ], "form": ".", "ssZp": 1.244, "Dp": 1.882, "splay_angle": 37.701, "splay_distance": 6.893, "splay_ratio": 0.326, "d22": null, "d64": null, "eta": 159.390, "theta": -112.843, "eta_prime": -160.252, "theta_prime": -141.962, "eta_base": -108.097, "theta_base": -129.853, "v0": -6.660, "v1": 22.015, "v2": -28.293, "v3": 25.119, "v4": -11.811, "amplitude": 28.420, "phase_angle": 185.416, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.054, "frame": { "rmsd": 0.029, "origin": [ 64.015, 48.277, 94.837 ], "x_axis": [ 0.691, -0.720, -0.069 ], "y_axis": [ -0.715, -0.694, 0.083 ], "z_axis": [ -0.108, -0.009, -0.994 ], "quaternion": [ 0.025, 0.919, -0.390, -0.048 ] } }, { "index": 52, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": 56.255, "beta": 152.643, "gamma": -66.353, "delta": 144.578, "epsilon": 174.389, "zeta": -75.225, "epsilon_zeta": -110.386, "bb_type": "BI", "chi": -119.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.668, 8.536, -1.169 ], "P_xyz": [ -0.982, 11.012, -0.633 ], "form": "B", "ssZp": 1.867, "Dp": 1.942, "splay_angle": 20.731, "splay_distance": 3.411, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.784, "theta": -145.245, "eta_prime": -177.448, "theta_prime": -139.771, "eta_base": -157.705, "theta_base": -80.186, "v0": -15.321, "v1": 31.969, "v2": -35.724, "v3": 27.535, "v4": -7.966, "amplitude": 35.929, "phase_angle": 173.880, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 62.827, 48.193, 88.047 ], "x_axis": [ 0.658, -0.592, 0.466 ], "y_axis": [ -0.725, -0.331, 0.605 ], "z_axis": [ -0.204, -0.735, -0.646 ], "quaternion": [ 0.413, 0.812, -0.405, 0.081 ] } }, { "index": 53, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -110.102, "beta": -161.451, "gamma": 75.527, "delta": 137.917, "epsilon": -158.952, "zeta": -82.545, "epsilon_zeta": -76.407, "bb_type": "BI", "chi": -90.878, "glyco_bond": "anti", "C5prime_xyz": [ -3.445, 7.609, -2.383 ], "P_xyz": [ -1.392, 8.905, -3.296 ], "form": ".", "ssZp": 2.218, "Dp": 2.186, "splay_angle": 20.008, "splay_distance": 3.586, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 156.680, "theta": -134.266, "eta_prime": -164.320, "theta_prime": -165.066, "eta_base": -101.634, "theta_base": -124.660, "v0": -33.000, "v1": 41.566, "v2": -33.720, "v3": 15.966, "v4": 10.554, "amplitude": 40.521, "phase_angle": 146.322, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 62.644, 44.834, 87.483 ], "x_axis": [ -0.005, -0.746, 0.666 ], "y_axis": [ -0.998, -0.035, -0.048 ], "z_axis": [ 0.059, -0.665, -0.744 ], "quaternion": [ 0.232, 0.666, -0.655, 0.272 ] } }, { "index": 54, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -110.803, "beta": 87.831, "gamma": 160.749, "delta": 122.336, "epsilon": -136.379, "zeta": -112.204, "epsilon_zeta": -24.174, "bb_type": "--", "chi": -162.412, "glyco_bond": "anti", "C5prime_xyz": [ -2.321, 8.860, 0.570 ], "P_xyz": [ -2.003, 10.118, -1.731 ], "form": "B", "ssZp": 2.648, "Dp": 2.374, "splay_angle": 16.935, "splay_distance": 2.908, "splay_ratio": 0.148, "d22": 4.551, "d64": 3.902, "eta": -134.291, "theta": 155.814, "eta_prime": -156.266, "theta_prime": -171.276, "eta_base": -114.803, "theta_base": -133.141, "v0": -32.764, "v1": 33.608, "v2": -22.466, "v3": 4.057, "v4": 18.102, "amplitude": 34.460, "phase_angle": 130.690, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.014, "origin": [ 63.011, 41.540, 86.116 ], "x_axis": [ -0.479, -0.637, 0.603 ], "y_axis": [ -0.873, 0.279, -0.399 ], "z_axis": [ 0.086, -0.718, -0.690 ], "quaternion": [ -0.165, -0.483, 0.782, -0.357 ] } }, { "index": 55, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -18.889, "beta": 152.299, "gamma": 9.796, "delta": 138.054, "epsilon": -171.471, "zeta": -116.172, "epsilon_zeta": -55.300, "bb_type": "BI", "chi": -98.789, "glyco_bond": "anti", "C5prime_xyz": [ -2.795, 7.903, -2.325 ], "P_xyz": [ -0.872, 9.717, -2.104 ], "form": "B", "ssZp": 2.037, "Dp": 2.190, "splay_angle": 23.360, "splay_distance": 4.021, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 151.721, "theta": -152.625, "eta_prime": -172.101, "theta_prime": -168.144, "eta_base": -131.478, "theta_base": -121.936, "v0": -30.067, "v1": 38.487, "v2": -32.134, "v3": 15.871, "v4": 8.733, "amplitude": 37.826, "phase_angle": 148.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 63.678, 39.115, 84.657 ], "x_axis": [ -0.888, -0.364, 0.282 ], "y_axis": [ -0.430, 0.436, -0.790 ], "z_axis": [ 0.165, -0.823, -0.544 ], "quaternion": [ -0.035, -0.235, 0.847, -0.476 ] } }, { "index": 56, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.376, "beta": 151.797, "gamma": 67.695, "delta": 95.006, "epsilon": -176.603, "zeta": -97.101, "epsilon_zeta": -79.502, "bb_type": "BI", "chi": -154.880, "glyco_bond": "anti", "C5prime_xyz": [ -2.657, 8.892, -0.209 ], "P_xyz": [ -0.376, 10.090, -0.626 ], "form": ".", "ssZp": 3.544, "Dp": 3.460, "splay_angle": 22.319, "splay_distance": 3.651, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 172.303, "theta": -165.191, "eta_prime": -176.404, "theta_prime": -166.125, "eta_base": -120.739, "theta_base": -132.661, "v0": -31.243, "v1": 13.096, "v2": 8.454, "v3": -26.608, "v4": 36.587, "amplitude": 35.948, "phase_angle": 76.398, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 63.783, 35.511, 82.876 ], "x_axis": [ -0.959, -0.089, -0.270 ], "y_axis": [ 0.144, 0.666, -0.732 ], "z_axis": [ 0.245, -0.741, -0.625 ], "quaternion": [ 0.143, 0.015, 0.901, -0.408 ] } }, { "index": 57, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -30.970, "beta": 164.854, "gamma": 45.306, "delta": 145.794, "epsilon": -177.203, "zeta": -94.483, "epsilon_zeta": -82.720, "bb_type": "BI", "chi": -128.119, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.701, -0.862 ], "P_xyz": [ 0.210, 9.552, 0.133 ], "form": ".", "ssZp": 1.881, "Dp": 2.124, "splay_angle": 20.410, "splay_distance": 3.423, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 173.655, "theta": -121.952, "eta_prime": -150.417, "theta_prime": -139.404, "eta_base": -110.203, "theta_base": -105.704, "v0": -24.600, "v1": 38.907, "v2": -38.123, "v3": 24.583, "v4": -0.167, "amplitude": 40.149, "phase_angle": 161.721, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.078, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 64.297, 32.186, 81.461 ], "x_axis": [ -0.707, 0.245, -0.664 ], "y_axis": [ 0.644, 0.612, -0.460 ], "z_axis": [ 0.294, -0.752, -0.590 ], "quaternion": [ 0.281, 0.261, 0.853, -0.355 ] } }, { "index": 58, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.045, "beta": -154.421, "gamma": 25.112, "delta": 150.891, "epsilon": -174.896, "zeta": -92.019, "epsilon_zeta": -82.877, "bb_type": "BI", "chi": -97.103, "glyco_bond": "anti", "C5prime_xyz": [ -1.814, 7.858, -2.192 ], "P_xyz": [ -0.073, 9.695, -1.431 ], "form": ".", "ssZp": 1.387, "Dp": 1.705, "splay_angle": 17.132, "splay_distance": 2.997, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 164.516, "theta": -129.056, "eta_prime": -171.573, "theta_prime": -139.307, "eta_base": -126.963, "theta_base": -115.085, "v0": -12.084, "v1": 31.304, "v2": -38.073, "v3": 31.464, "v4": -12.496, "amplitude": 38.073, "phase_angle": 180.280, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 64.433, 29.300, 79.625 ], "x_axis": [ -0.189, 0.668, -0.719 ], "y_axis": [ 0.944, 0.326, 0.055 ], "z_axis": [ 0.271, -0.669, -0.692 ], "quaternion": [ 0.333, 0.543, 0.743, -0.207 ] } }, { "index": 59, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -78.135, "beta": 179.328, "gamma": 46.160, "delta": 137.935, "epsilon": -132.925, "zeta": 162.405, "epsilon_zeta": 64.670, "bb_type": "BII", "chi": -87.977, "glyco_bond": "anti", "C5prime_xyz": [ -3.821, 7.685, -2.177 ], "P_xyz": [ -2.195, 9.387, -3.223 ], "form": "B", "ssZp": 2.338, "Dp": 2.046, "splay_angle": 20.469, "splay_distance": 3.454, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 161.959, "theta": 168.512, "eta_prime": -173.848, "theta_prime": 165.310, "eta_base": -145.851, "theta_base": -146.749, "v0": -39.969, "v1": 47.211, "v2": -35.710, "v3": 13.924, "v4": 16.062, "amplitude": 46.016, "phase_angle": 140.900, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.015, "origin": [ 64.739, 27.399, 77.328 ], "x_axis": [ 0.171, 0.759, -0.629 ], "y_axis": [ 0.979, -0.057, 0.197 ], "z_axis": [ 0.114, -0.649, -0.752 ], "quaternion": [ 0.301, 0.703, 0.617, -0.183 ] } }, { "index": 60, "index_chain": 27, "chain_name": "D", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -24.268, "beta": 128.439, "gamma": 23.394, "delta": 133.736, "epsilon": -173.175, "zeta": -110.382, "epsilon_zeta": -62.792, "bb_type": "BI", "chi": -112.624, "glyco_bond": "anti", "C5prime_xyz": [ -2.048, 8.390, -1.735 ], "P_xyz": [ 0.432, 8.926, -1.107 ], "form": "B", "ssZp": 2.216, "Dp": 2.267, "splay_angle": 20.205, "splay_distance": 3.445, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 170.919, "theta": -133.249, "eta_prime": -171.820, "theta_prime": -150.652, "eta_base": -125.054, "theta_base": -113.307, "v0": -21.400, "v1": 31.192, "v2": -28.784, "v3": 17.119, "v4": 2.543, "amplitude": 31.322, "phase_angle": 156.773, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.007, "origin": [ 65.614, 24.930, 75.078 ], "x_axis": [ 0.695, 0.647, -0.312 ], "y_axis": [ 0.695, -0.496, 0.520 ], "z_axis": [ 0.182, -0.579, -0.795 ], "quaternion": [ 0.318, 0.864, 0.388, -0.038 ] } }, { "index": 61, "index_chain": 28, "chain_name": "D", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -31.939, "beta": 169.144, "gamma": 28.968, "delta": 134.953, "epsilon": -174.252, "zeta": -107.983, "epsilon_zeta": -66.268, "bb_type": "BI", "chi": -113.228, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.425, -1.725 ], "P_xyz": [ -0.060, 9.835, -1.362 ], "form": "B", "ssZp": 2.247, "Dp": 2.297, "splay_angle": 18.061, "splay_distance": 3.019, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 170.861, "theta": -148.374, "eta_prime": -165.439, "theta_prime": -155.313, "eta_base": -118.830, "theta_base": -116.101, "v0": -23.697, "v1": 33.291, "v2": -30.052, "v3": 17.079, "v4": 4.035, "amplitude": 33.271, "phase_angle": 154.586, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 66.392, 23.386, 72.098 ], "x_axis": [ 0.964, 0.264, 0.041 ], "y_axis": [ 0.189, -0.784, 0.592 ], "z_axis": [ 0.188, -0.563, -0.805 ], "quaternion": [ 0.306, 0.942, 0.120, 0.061 ] } }, { "index": 62, "index_chain": 29, "chain_name": "D", "nt_resnum": 29, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/29", "linked_nts": [ "///D/28", "///D/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.560, "beta": -178.935, "gamma": 31.422, "delta": 143.296, "epsilon": 168.259, "zeta": -102.386, "epsilon_zeta": -89.355, "bb_type": "BI", "chi": -101.704, "glyco_bond": "anti", "C5prime_xyz": [ -2.303, 8.073, -2.030 ], "P_xyz": [ -0.144, 9.519, -1.747 ], "form": ".", "ssZp": 2.251, "Dp": 2.284, "splay_angle": 23.053, "splay_distance": 3.800, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 160.042, "theta": -147.096, "eta_prime": -172.669, "theta_prime": -159.524, "eta_base": -125.580, "theta_base": -113.418, "v0": -19.677, "v1": 33.572, "v2": -34.138, "v3": 23.443, "v4": -2.588, "amplitude": 35.265, "phase_angle": 165.476, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.008, "origin": [ 67.323, 21.960, 69.605 ], "x_axis": [ 0.888, -0.185, 0.422 ], "y_axis": [ -0.359, -0.851, 0.382 ], "z_axis": [ 0.288, -0.491, -0.822 ], "quaternion": [ 0.231, 0.944, -0.144, 0.188 ] } }, { "index": 63, "index_chain": 30, "chain_name": "D", "nt_resnum": 30, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/30", "linked_nts": [ "///D/29", "///D/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.129, "beta": 176.740, "gamma": 76.346, "delta": 138.449, "epsilon": -177.867, "zeta": -96.861, "epsilon_zeta": -81.006, "bb_type": "BI", "chi": -128.668, "glyco_bond": "anti", "C5prime_xyz": [ -2.195, 8.737, -1.035 ], "P_xyz": [ 0.178, 9.658, -0.651 ], "form": ".", "ssZp": 1.821, "Dp": 2.153, "splay_angle": 22.486, "splay_distance": 3.859, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 172.030, "theta": -132.749, "eta_prime": -157.243, "theta_prime": -153.687, "eta_base": -104.938, "theta_base": -119.058, "v0": -31.252, "v1": 40.899, "v2": -34.770, "v3": 17.734, "v4": 8.323, "amplitude": 40.306, "phase_angle": 149.617, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 69.322, 20.081, 66.976 ], "x_axis": [ 0.437, -0.626, 0.646 ], "y_axis": [ -0.859, -0.503, 0.093 ], "z_axis": [ 0.267, -0.596, -0.758 ], "quaternion": [ 0.210, 0.821, -0.452, 0.278 ] } }, { "index": 64, "index_chain": 31, "chain_name": "D", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/31", "linked_nts": [ "///D/30", "///D/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.399, "beta": -158.880, "gamma": 43.471, "delta": 137.057, "epsilon": -170.517, "zeta": -103.567, "epsilon_zeta": -66.949, "bb_type": "BI", "chi": -112.486, "glyco_bond": "anti", "C5prime_xyz": [ -2.038, 8.381, -1.776 ], "P_xyz": [ -0.148, 10.012, -1.082 ], "form": "B", "ssZp": 1.801, "Dp": 2.001, "splay_angle": 18.521, "splay_distance": 3.129, "splay_ratio": 0.161, "d22": 4.577, "d64": 4.186, "eta": 172.714, "theta": -147.016, "eta_prime": -168.385, "theta_prime": -150.583, "eta_base": -125.606, "theta_base": -137.227, "v0": -24.264, "v1": 34.595, "v2": -31.699, "v3": 18.434, "v4": 3.543, "amplitude": 34.769, "phase_angle": 155.740, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.013, "origin": [ 71.400, 18.477, 64.147 ], "x_axis": [ -0.144, -0.819, 0.555 ], "y_axis": [ -0.969, 0.004, -0.246 ], "z_axis": [ 0.199, -0.573, -0.795 ], "quaternion": [ -0.128, -0.642, 0.697, -0.294 ] } }, { "index": 65, "index_chain": 32, "chain_name": "D", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/32", "linked_nts": [ "///D/31", "///D/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -70.784, "beta": -170.123, "gamma": 35.766, "delta": 157.731, "epsilon": -108.498, "zeta": 177.330, "epsilon_zeta": 74.172, "bb_type": "BII", "chi": -82.767, "glyco_bond": "anti", "C5prime_xyz": [ -3.196, 7.572, -2.406 ], "P_xyz": [ -1.308, 9.321, -2.728 ], "form": "B", "ssZp": 1.290, "Dp": 1.132, "splay_angle": 21.771, "splay_distance": 3.610, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 174.335, "theta": -172.383, "eta_prime": -163.812, "theta_prime": -176.274, "eta_base": -149.479, "theta_base": -108.782, "v0": -30.259, "v1": 47.197, "v2": -46.664, "v3": 31.006, "v4": -0.811, "amplitude": 48.964, "phase_angle": 162.371, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.013, "origin": [ 72.947, 17.512, 61.604 ], "x_axis": [ -0.479, -0.757, 0.444 ], "y_axis": [ -0.811, 0.188, -0.554 ], "z_axis": [ 0.335, -0.626, -0.704 ], "quaternion": [ -0.035, -0.509, 0.770, -0.383 ] } }, { "index": 66, "index_chain": 33, "chain_name": "D", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/33", "linked_nts": [ "///D/32", "///D/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.424, "beta": 133.633, "gamma": 57.844, "delta": 144.795, "epsilon": -142.879, "zeta": -84.795, "epsilon_zeta": -58.084, "bb_type": "BI", "chi": -100.105, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.023, -2.188 ], "P_xyz": [ 0.118, 8.140, -2.554 ], "form": ".", "ssZp": 1.682, "Dp": 1.874, "splay_angle": 18.245, "splay_distance": 3.336, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 170.274, "theta": -110.633, "eta_prime": -162.381, "theta_prime": -162.000, "eta_base": -99.525, "theta_base": -121.815, "v0": -28.244, "v1": 42.073, "v2": -39.350, "v3": 23.535, "v4": 2.850, "amplitude": 42.526, "phase_angle": 157.715, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.235, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 72.533, 15.778, 58.465 ], "x_axis": [ -0.892, -0.428, -0.145 ], "y_axis": [ -0.178, 0.628, -0.758 ], "z_axis": [ 0.415, -0.650, -0.636 ], "quaternion": [ 0.158, -0.171, 0.888, -0.396 ] } }, { "index": 67, "index_chain": 34, "chain_name": "D", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/34", "linked_nts": [ "///D/33", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -15.589, "beta": -57.845, "gamma": -96.103, "delta": 157.848, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -134.107, "glyco_bond": "anti", "C5prime_xyz": [ -1.146, 8.310, -0.024 ], "P_xyz": [ -1.577, 10.402, -1.568 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.118, "v1": 26.271, "v2": -38.260, "v3": 37.316, "v4": -21.707, "amplitude": 39.453, "phase_angle": 194.126, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.018, "origin": [ 73.320, 13.101, 56.636 ], "x_axis": [ -0.864, -0.094, -0.495 ], "y_axis": [ 0.264, 0.752, -0.604 ], "z_axis": [ 0.429, -0.652, -0.625 ], "quaternion": [ 0.257, 0.047, 0.900, -0.349 ] } } ], "num_hbonds": 752, "hbonds": [ { "index": 1, "atom1_serNum": 14, "atom2_serNum": 1427, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///C/1/N6", "atom2_id": "///D/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 15, "atom2_serNum": 1425, "donAcc_type": "standard", "distance": 2.406, "atom1_id": "///C/1/N1", "atom2_id": "///D/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 32, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/2/O2", "atom2_id": "///B/244/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 4, "atom1_serNum": 33, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.461, "atom1_id": "///C/2/N3", "atom2_id": "///D/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 35, "atom2_serNum": 1406, "donAcc_type": "standard", "distance": 2.357, "atom1_id": "///C/2/O4", "atom2_id": "///D/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 55, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/3/N6", "atom2_id": "///D/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 56, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/3/N1", "atom2_id": "///D/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 61, "atom2_serNum": 5103, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///C/4/OP1", "atom2_id": "///B/154/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 9, "atom1_serNum": 63, "atom2_serNum": 5118, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/4/O5'", "atom2_id": "///B/156/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 10, "atom1_serNum": 68, "atom2_serNum": 5780, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///C/4/O3'", "atom2_id": "///B/242/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 11, "atom1_serNum": 76, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///C/4/N6", "atom2_id": "///D/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 77, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///C/4/N1", "atom2_id": "///D/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 82, "atom2_serNum": 5144, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///C/5/OP1", "atom2_id": "///B/159/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 14, "atom1_serNum": 82, "atom2_serNum": 5777, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///C/5/OP1", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 15, "atom1_serNum": 83, "atom2_serNum": 5118, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/5/OP2", "atom2_id": "///B/156/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 16, "atom1_serNum": 83, "atom2_serNum": 5145, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/5/OP2", "atom2_id": "///B/159/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 17, "atom1_serNum": 94, "atom2_serNum": 1347, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///C/5/O2", "atom2_id": "///D/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 95, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///C/5/N3", "atom2_id": "///D/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 97, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///C/5/N4", "atom2_id": "///D/30/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 102, "atom2_serNum": 5881, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///C/6/OP2", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 102, "atom2_serNum": 5886, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///C/6/OP2", "atom2_id": "///B/257/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 22, "atom1_serNum": 114, "atom2_serNum": 1324, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///C/6/N3", "atom2_id": "///D/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 116, "atom2_serNum": 1323, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/6/O4", "atom2_id": "///D/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 133, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 2.288, "atom1_id": "///C/7/O2", "atom2_id": "///D/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 134, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.285, "atom1_id": "///C/7/N3", "atom2_id": "///D/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 136, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 2.283, "atom1_id": "///C/7/N4", "atom2_id": "///D/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 136, "atom2_serNum": 5900, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///C/7/N4", "atom2_id": "///B/259/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 28, "atom1_serNum": 153, "atom2_serNum": 1281, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///C/8/N3", "atom2_id": "///D/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 155, "atom2_serNum": 1280, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///C/8/O4", "atom2_id": "///D/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 167, "atom2_serNum": 4249, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/9/O3'", "atom2_id": "///B/50/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 175, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/9/N6", "atom2_id": "///D/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 176, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/9/N1", "atom2_id": "///D/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 182, "atom2_serNum": 4226, "donAcc_type": "acceptable", "distance": 2.449, "atom1_id": "///C/10/OP2", "atom2_id": "///B/47/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 34, "atom1_serNum": 194, "atom2_serNum": 1240, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/10/N3", "atom2_id": "///D/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 196, "atom2_serNum": 1239, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/10/O4", "atom2_id": "///D/25/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 201, "atom2_serNum": 4521, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/11/OP1", "atom2_id": "///B/81/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 37, "atom1_serNum": 201, "atom2_serNum": 4522, "donAcc_type": "standard", "distance": 2.300, "atom1_id": "///C/11/OP1", "atom2_id": "///B/81/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 38, "atom1_serNum": 216, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///C/11/N6", "atom2_id": "///D/24/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 217, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///C/11/N1", "atom2_id": "///D/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 219, "atom2_serNum": 6075, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/11/N3", "atom2_id": "///B/282/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 41, "atom1_serNum": 223, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///C/12/OP2", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 235, "atom2_serNum": 1199, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///C/12/N3", "atom2_id": "///D/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 237, "atom2_serNum": 1198, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///C/12/O4", "atom2_id": "///D/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 242, "atom2_serNum": 4912, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/13/OP1", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 45, "atom1_serNum": 257, "atom2_serNum": 1178, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/13/N6", "atom2_id": "///D/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 257, "atom2_serNum": 4587, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/13/N6", "atom2_id": "///B/90/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 47, "atom1_serNum": 258, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///C/13/N1", "atom2_id": "///D/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 263, "atom2_serNum": 6391, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///C/14/OP1", "atom2_id": "///B/324/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 275, "atom2_serNum": 4555, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///C/14/N7", "atom2_id": "///B/86/NZ", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 50, "atom1_serNum": 278, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/14/N6", "atom2_id": "///D/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 279, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/14/N1", "atom2_id": "///D/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 281, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///C/14/N3", "atom2_id": "///B/201/NZ", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 53, "atom1_serNum": 284, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/15/OP1", "atom2_id": "///B/173/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 284, "atom2_serNum": 5256, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///C/15/OP1", "atom2_id": "///B/173/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 284, "atom2_serNum": 6134, "donAcc_type": "standard", "distance": 3.891, "atom1_id": "///C/15/OP1", "atom2_id": "///B/289/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 285, "atom2_serNum": 6156, "donAcc_type": "standard", "distance": 3.667, "atom1_id": "///C/15/OP2", "atom2_id": "///B/292/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 285, "atom2_serNum": 6313, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///C/15/OP2", "atom2_id": "///B/315/NE1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 58, "atom1_serNum": 289, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///C/15/O4'", "atom2_id": "///B/201/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 59, "atom1_serNum": 297, "atom2_serNum": 1138, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/15/N3", "atom2_id": "///D/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 299, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///C/15/O4", "atom2_id": "///D/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 304, "atom2_serNum": 6319, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///C/16/OP1", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 305, "atom2_serNum": 6326, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/16/OP2", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 306, "atom2_serNum": 6324, "donAcc_type": "acceptable", "distance": 2.271, "atom1_id": "///C/16/O5'", "atom2_id": "///B/316/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 319, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///C/16/O6", "atom2_id": "///D/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 320, "atom2_serNum": 1111, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/16/N1", "atom2_id": "///D/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 322, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///C/16/N2", "atom2_id": "///D/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 551, "atom2_serNum": 559, "donAcc_type": "questionable", "distance": 3.262, "atom1_id": "///C/29/N3", "atom2_id": "///C/30/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 688, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 2.394, "atom1_id": "///D/2/O2", "atom2_id": "///A/244/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 735, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///D/4/N3", "atom2_id": "///A/241/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 738, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///D/5/OP1", "atom2_id": "///A/159/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 71, "atom1_serNum": 738, "atom2_serNum": 3230, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///D/5/OP1", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 72, "atom1_serNum": 739, "atom2_serNum": 2570, "donAcc_type": "questionable", "distance": 3.110, "atom1_id": "///D/5/OP2", "atom2_id": "///A/156/OE1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 73, "atom1_serNum": 739, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///D/5/OP2", "atom2_id": "///A/159/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 74, "atom1_serNum": 743, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///D/5/O4'", "atom2_id": "///A/241/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 75, "atom1_serNum": 758, "atom2_serNum": 3334, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///D/6/OP2", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 76, "atom1_serNum": 758, "atom2_serNum": 3339, "donAcc_type": "acceptable", "distance": 2.439, "atom1_id": "///D/6/OP2", "atom2_id": "///A/257/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 77, "atom1_serNum": 792, "atom2_serNum": 3353, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///D/7/N4", "atom2_id": "///A/259/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 78, "atom1_serNum": 838, "atom2_serNum": 1679, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///D/10/OP2", "atom2_id": "///A/47/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 79, "atom1_serNum": 838, "atom2_serNum": 1703, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///D/10/OP2", "atom2_id": "///A/50/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 80, "atom1_serNum": 857, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///D/11/OP1", "atom2_id": "///A/81/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 81, "atom1_serNum": 858, "atom2_serNum": 1974, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///D/11/OP2", "atom2_id": "///A/81/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 82, "atom1_serNum": 875, "atom2_serNum": 3528, "donAcc_type": "standard", "distance": 2.475, "atom1_id": "///D/11/N3", "atom2_id": "///A/282/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 879, "atom2_serNum": 1988, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/12/OP2", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 84, "atom1_serNum": 879, "atom2_serNum": 2014, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///D/12/OP2", "atom2_id": "///A/87/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 85, "atom1_serNum": 893, "atom2_serNum": 2041, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/12/O4", "atom2_id": "///A/90/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 86, "atom1_serNum": 898, "atom2_serNum": 2365, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///D/13/OP1", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 916, "atom2_serNum": 924, "donAcc_type": "questionable", "distance": 3.269, "atom1_id": "///D/13/N3", "atom2_id": "///D/14/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 919, "atom2_serNum": 3844, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///D/14/OP1", "atom2_id": "///A/324/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 89, "atom1_serNum": 965, "atom2_serNum": 2927, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///D/16/O5'", "atom2_id": "///A/201/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 90, "atom1_serNum": 1017, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///D/17/O3'", "atom2_id": "///B/121/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 91, "atom1_serNum": 1043, "atom2_serNum": 4836, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///D/18/OP1", "atom2_id": "///B/121/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 1085, "atom2_serNum": 4719, "donAcc_type": "standard", "distance": 3.716, "atom1_id": "///D/19/OP1", "atom2_id": "///B/106/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 1143, "atom2_serNum": 4683, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///D/21/OP1", "atom2_id": "///B/101/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 1144, "atom2_serNum": 4680, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/21/OP2", "atom2_id": "///B/101/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 95, "atom1_serNum": 1164, "atom2_serNum": 4142, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/22/OP2", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 1164, "atom2_serNum": 4172, "donAcc_type": "acceptable", "distance": 2.553, "atom1_id": "///D/22/OP2", "atom2_id": "///B/41/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 1178, "atom2_serNum": 4587, "donAcc_type": "questionable", "distance": 2.852, "atom1_id": "///D/22/O4", "atom2_id": "///B/90/OE1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 98, "atom1_serNum": 1184, "atom2_serNum": 4147, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///D/23/OP2", "atom2_id": "///B/38/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 99, "atom1_serNum": 1204, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/24/OP1", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 1219, "atom2_serNum": 4196, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///D/24/O4", "atom2_id": "///B/43/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 101, "atom1_serNum": 1224, "atom2_serNum": 6120, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///D/25/OP1", "atom2_id": "///B/287/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 1224, "atom2_serNum": 6125, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///D/25/OP1", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 103, "atom1_serNum": 1225, "atom2_serNum": 6121, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/25/OP2", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 104, "atom1_serNum": 1245, "atom2_serNum": 6076, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///D/26/OP1", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 105, "atom1_serNum": 1246, "atom2_serNum": 5923, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///D/26/OP2", "atom2_id": "///B/262/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 1376, "atom2_serNum": 5794, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/32/O4'", "atom2_id": "///B/243/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 1383, "atom2_serNum": 5793, "donAcc_type": "standard", "distance": 2.305, "atom1_id": "///D/32/O2", "atom2_id": "///B/243/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 1412, "atom2_serNum": 5811, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///D/34/OP1", "atom2_id": "///B/245/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 1435, "atom2_serNum": 1437, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///A/19/O", "atom2_id": "///A/19/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1435, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1442, "atom2_serNum": 1469, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1448, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1456, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1465, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1472, "atom2_serNum": 1505, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1483, "atom2_serNum": 1513, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1488, "atom2_serNum": 1519, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/25/NZ", "atom2_id": "///A/29/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1488, "atom2_serNum": 4415, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/25/NZ", "atom2_id": "///B/69/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1492, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1496, "atom2_serNum": 2140, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/26/ND2", "atom2_id": "///A/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1500, "atom2_serNum": 1529, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1508, "atom2_serNum": 1540, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1516, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1532, "atom2_serNum": 1568, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///A/31/O", "atom2_id": "///A/34/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1543, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/32/O", "atom2_id": "///B/119/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1549, "atom2_serNum": 4414, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/32/NH1", "atom2_id": "///B/69/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1550, "atom2_serNum": 4415, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/32/NH2", "atom2_id": "///B/69/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1554, "atom2_serNum": 1579, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/33/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1557, "atom2_serNum": 4441, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/33/OD1", "atom2_id": "///B/72/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1557, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/33/OD1", "atom2_id": "///B/119/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1558, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/33/OD2", "atom2_id": "///B/72/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1562, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/34/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1562, "atom2_serNum": 1635, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/34/O", "atom2_id": "///A/42/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1582, "atom2_serNum": 4805, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/36/O", "atom2_id": "///B/118/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1598, "atom2_serNum": 1620, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/38/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1598, "atom2_serNum": 1627, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1600, "atom2_serNum": 1625, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///A/38/OG", "atom2_id": "///A/41/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1604, "atom2_serNum": 1641, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1613, "atom2_serNum": 1650, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1623, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1630, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1644, "atom2_serNum": 1674, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1653, "atom2_serNum": 1680, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1661, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1669, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1677, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1683, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1683, "atom2_serNum": 1914, "donAcc_type": "acceptable", "distance": 3.957, "atom1_id": "///A/48/O", "atom2_id": "///A/74/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1690, "atom2_serNum": 1724, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1696, "atom2_serNum": 1729, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1707, "atom2_serNum": 1734, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1709, "atom2_serNum": 1914, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///A/51/OG", "atom2_id": "///A/74/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1713, "atom2_serNum": 1748, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1718, "atom2_serNum": 1810, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/52/NE1", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1727, "atom2_serNum": 1754, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1732, "atom2_serNum": 1763, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1737, "atom2_serNum": 1771, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1737, "atom2_serNum": 1778, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/55/O", "atom2_id": "///A/59/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1751, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1751, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/56/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1757, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/57/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1774, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///A/59/O", "atom2_id": "///A/61/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1796, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/61/NH1", "atom2_id": "///A/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1796, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/61/NH1", "atom2_id": "///A/73/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1797, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/61/NH2", "atom2_id": "///A/73/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1839, "atom2_serNum": 2114, "donAcc_type": "questionable", "distance": 2.864, "atom1_id": "///A/66/N", "atom2_id": "///A/99/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1847, "atom2_serNum": 1869, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///A/67/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1847, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1856, "atom2_serNum": 1884, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1863, "atom2_serNum": 1895, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1872, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1880, "atom2_serNum": 1915, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1887, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1893, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 3.879, "atom1_id": "///A/72/NH1", "atom2_id": "///A/73/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1898, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1906, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1914, "atom2_serNum": 2048, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///A/74/OH", "atom2_id": "///A/91/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1918, "atom2_serNum": 1951, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1926, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1934, "atom2_serNum": 1965, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1946, "atom2_serNum": 1965, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/78/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1946, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/78/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1954, "atom2_serNum": 1976, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///A/79/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1959, "atom2_serNum": 2306, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/79/NE2", "atom2_id": "///A/123/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1959, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///A/79/NE2", "atom2_id": "///A/124/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1983, "atom2_serNum": 2315, "donAcc_type": "standard", "distance": 3.648, "atom1_id": "///A/83/O", "atom2_id": "///A/124/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1991, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/84/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1991, "atom2_serNum": 2016, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1993, "atom2_serNum": 2348, "donAcc_type": "standard", "distance": 2.298, "atom1_id": "///A/85/N", "atom2_id": "///A/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1996, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 2003, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 2008, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/86/NZ", "atom2_id": "///A/89/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 2008, "atom2_serNum": 2032, "donAcc_type": "questionable", "distance": 2.581, "atom1_id": "///A/86/NZ", "atom2_id": "///A/89/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 2012, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 2019, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 2027, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 2031, "atom2_serNum": 2289, "donAcc_type": "standard", "distance": 2.423, "atom1_id": "///A/89/OE1", "atom2_id": "///A/121/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 2036, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 2040, "atom2_serNum": 2072, "donAcc_type": "standard", "distance": 2.399, "atom1_id": "///A/90/OE1", "atom2_id": "///A/94/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 2045, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/91/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 2045, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 2055, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 2063, "atom2_serNum": 2089, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 2067, "atom2_serNum": 2097, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2076, "atom2_serNum": 2105, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2076, "atom2_serNum": 2111, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///A/95/O", "atom2_id": "///A/99/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2084, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2087, "atom2_serNum": 2180, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/96/OD1", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2088, "atom2_serNum": 2185, "donAcc_type": "acceptable", "distance": 2.301, "atom1_id": "///A/96/ND2", "atom2_id": "///A/108/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2092, "atom2_serNum": 2126, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2100, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2100, "atom2_serNum": 2142, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///A/98/O", "atom2_id": "///A/102/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2105, "atom2_serNum": 2111, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///A/99/N", "atom2_id": "///A/99/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2108, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/99/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2108, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/99/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2125, "atom2_serNum": 2171, "donAcc_type": "questionable", "distance": 2.809, "atom1_id": "///A/100/NH2", "atom2_id": "///A/106/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2135, "atom2_serNum": 4753, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/101/NH1", "atom2_id": "///B/111/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2162, "atom2_serNum": 2193, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/106/N", "atom2_id": "///A/109/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2169, "atom2_serNum": 2192, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/106/NE", "atom2_id": "///A/109/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2176, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/107/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2183, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/108/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2183, "atom2_serNum": 2225, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///A/108/O", "atom2_id": "///A/114/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2197, "atom2_serNum": 2213, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/110/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2197, "atom2_serNum": 2220, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2203, "atom2_serNum": 2226, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2211, "atom2_serNum": 2234, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2216, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2223, "atom2_serNum": 2249, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2229, "atom2_serNum": 2260, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2237, "atom2_serNum": 2271, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2244, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2252, "atom2_serNum": 2290, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2263, "atom2_serNum": 2299, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2274, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2282, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2293, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2311, "atom2_serNum": 2340, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/124/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2339, "atom2_serNum": 2349, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/128/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2373, "atom2_serNum": 3512, "donAcc_type": "standard", "distance": 3.966, "atom1_id": "///A/132/NZ", "atom2_id": "///A/281/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2382, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/133/NE2", "atom2_id": "///A/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2386, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/134/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2391, "atom2_serNum": 3593, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///A/135/O", "atom2_id": "///A/290/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2399, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/136/O", "atom2_id": "///A/286/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2412, "atom2_serNum": 2446, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/138/N", "atom2_id": "///A/141/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2415, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/138/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2415, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2419, "atom2_serNum": 3638, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/138/OE1", "atom2_id": "///A/297/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2419, "atom2_serNum": 3673, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///A/138/OE1", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2420, "atom2_serNum": 3673, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/138/OE2", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2421, "atom2_serNum": 3649, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/139/N", "atom2_id": "///A/298/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2424, "atom2_serNum": 2458, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2431, "atom2_serNum": 6456, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/139/NH2", "atom2_id": "///B/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2431, "atom2_serNum": 6464, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///A/139/NH2", "atom2_id": "///B/339/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2442, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2445, "atom2_serNum": 3464, "donAcc_type": "acceptable", "distance": 3.966, "atom1_id": "///A/141/OD1", "atom2_id": "///A/273/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2450, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/142/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2461, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2464, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/143/OD1", "atom2_id": "///A/146/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2469, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2478, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2478, "atom2_serNum": 2507, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2485, "atom2_serNum": 2507, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/146/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2485, "atom2_serNum": 2515, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2496, "atom2_serNum": 2498, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///A/147/O", "atom2_id": "///A/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2510, "atom2_serNum": 2532, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/149/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2518, "atom2_serNum": 3084, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///A/150/O", "atom2_id": "///A/223/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2537, "atom2_serNum": 2546, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///A/152/OG", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2537, "atom2_serNum": 2579, "donAcc_type": "acceptable", "distance": 3.390, "atom1_id": "///A/152/OG", "atom2_id": "///A/157/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2541, "atom2_serNum": 2557, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/153/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2549, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///A/154/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2549, "atom2_serNum": 2580, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2556, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/154/NH2", "atom2_id": "///A/157/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2560, "atom2_serNum": 2588, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2566, "atom2_serNum": 2599, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2575, "atom2_serNum": 2607, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2583, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2591, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2595, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/159/NE", "atom2_id": "///A/160/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2597, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/159/NH1", "atom2_id": "///A/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2598, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/159/NH2", "atom2_id": "///A/160/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2602, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2610, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2618, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/162/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2618, "atom2_serNum": 2643, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2623, "atom2_serNum": 2651, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2634, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2642, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2646, "atom2_serNum": 2676, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2654, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2667, "atom2_serNum": 3649, "donAcc_type": "acceptable", "distance": 2.405, "atom1_id": "///A/168/OH", "atom2_id": "///A/298/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2674, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/169/OD1", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2679, "atom2_serNum": 2910, "donAcc_type": "standard", "distance": 3.811, "atom1_id": "///A/170/O", "atom2_id": "///A/199/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2679, "atom2_serNum": 2996, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/170/O", "atom2_id": "///A/211/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2686, "atom2_serNum": 2911, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/171/O", "atom2_id": "///A/199/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2686, "atom2_serNum": 3608, "donAcc_type": "standard", "distance": 2.483, "atom1_id": "///A/171/O", "atom2_id": "///A/292/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2699, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/173/N", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2702, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/173/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2702, "atom2_serNum": 2729, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2713, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2718, "atom2_serNum": 2742, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2751, "atom2_serNum": 2900, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/179/NH1", "atom2_id": "///A/198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2761, "atom2_serNum": 2795, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/181/N", "atom2_id": "///A/184/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2764, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/181/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2768, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/181/NE", "atom2_id": "///A/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2771, "atom2_serNum": 3302, "donAcc_type": "standard", "distance": 2.422, "atom1_id": "///A/181/NH2", "atom2_id": "///A/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2772, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/182/N", "atom2_id": "///A/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2775, "atom2_serNum": 2796, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/182/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2779, "atom2_serNum": 3162, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///A/183/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2782, "atom2_serNum": 2796, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/183/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2791, "atom2_serNum": 2879, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/184/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2804, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///A/186/N", "atom2_id": "///A/194/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2809, "atom2_serNum": 2987, "donAcc_type": "acceptable", "distance": 3.817, "atom1_id": "///A/186/OG", "atom2_id": "///A/210/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2817, "atom2_serNum": 2843, "donAcc_type": "standard", "distance": 2.469, "atom1_id": "///A/187/NE", "atom2_id": "///A/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2821, "atom2_serNum": 2847, "donAcc_type": "standard", "distance": 2.360, "atom1_id": "///A/188/N", "atom2_id": "///A/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2824, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/188/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2824, "atom2_serNum": 2840, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/188/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2826, "atom2_serNum": 2828, "donAcc_type": "acceptable", "distance": 2.236, "atom1_id": "///A/188/OG1", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2851, "atom2_serNum": 6477, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/192/NE", "atom2_id": "///B/340/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2855, "atom2_serNum": 3040, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///A/193/N", "atom2_id": "///A/218/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2858, "atom2_serNum": 3002, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/193/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2871, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 2.377, "atom1_id": "///A/195/N", "atom2_id": "///A/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2874, "atom2_serNum": 2889, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/195/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2874, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/195/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2885, "atom2_serNum": 2892, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///A/196/ND1", "atom2_id": "///A/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2915, "atom2_serNum": 2933, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///A/200/O", "atom2_id": "///A/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2933, "atom2_serNum": 4866, "donAcc_type": "acceptable", "distance": 3.938, "atom1_id": "///A/202/OG1", "atom2_id": "///B/125/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2933, "atom2_serNum": 4886, "donAcc_type": "acceptable", "distance": 3.918, "atom1_id": "///A/202/OG1", "atom2_id": "///B/128/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2935, "atom2_serNum": 4890, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///A/203/N", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2938, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/203/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2938, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/203/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2953, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 3.997, "atom1_id": "///A/205/O", "atom2_id": "///B/326/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2961, "atom2_serNum": 2971, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///A/206/OG1", "atom2_id": "///A/208/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2996, "atom2_serNum": 3748, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/211/NZ", "atom2_id": "///A/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3013, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3015, "atom2_serNum": 3024, "donAcc_type": "acceptable", "distance": 3.194, "atom1_id": "///A/214/OG", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3015, "atom2_serNum": 3028, "donAcc_type": "acceptable", "distance": 3.307, "atom1_id": "///A/214/OG", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3016, "atom2_serNum": 6477, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/215/N", "atom2_id": "///B/340/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3027, "atom2_serNum": 3042, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/216/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3027, "atom2_serNum": 3051, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3031, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3038, "atom2_serNum": 3066, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/218/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3045, "atom2_serNum": 3075, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3054, "atom2_serNum": 3086, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/220/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3062, "atom2_serNum": 3100, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/221/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3069, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/222/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3078, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///A/223/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3078, "atom2_serNum": 3114, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/223/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3089, "atom2_serNum": 3121, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3089, "atom2_serNum": 3126, "donAcc_type": "acceptable", "distance": 2.414, "atom1_id": "///A/224/O", "atom2_id": "///A/228/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3094, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 2.369, "atom1_id": "///A/224/NE1", "atom2_id": "///A/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3103, "atom2_serNum": 3127, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3130, "atom2_serNum": 3143, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/229/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3134, "atom2_serNum": 3151, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/230/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3134, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 2.502, "atom1_id": "///A/230/O", "atom2_id": "///A/236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3154, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///A/233/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3154, "atom2_serNum": 3174, "donAcc_type": "standard", "distance": 2.502, "atom1_id": "///A/233/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3169, "atom2_serNum": 3302, "donAcc_type": "questionable", "distance": 3.325, "atom1_id": "///A/235/O", "atom2_id": "///A/252/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3182, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/237/N", "atom2_id": "///A/251/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3222, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/241/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3237, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/243/N", "atom2_id": "///A/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3240, "atom2_serNum": 3265, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/243/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3298, "atom2_serNum": 3304, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///A/251/OG", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3298, "atom2_serNum": 3311, "donAcc_type": "acceptable", "distance": 2.577, "atom1_id": "///A/251/OG", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3298, "atom2_serNum": 3314, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/251/OG", "atom2_id": "///A/254/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3337, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///A/257/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3337, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/257/O", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3339, "atom2_serNum": 3354, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///A/257/OG", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3343, "atom2_serNum": 3367, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/258/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3351, "atom2_serNum": 3377, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/259/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3357, "atom2_serNum": 3377, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///A/260/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3357, "atom2_serNum": 3381, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3362, "atom2_serNum": 3389, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/261/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3370, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/262/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3380, "atom2_serNum": 3404, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3384, "atom2_serNum": 3409, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3384, "atom2_serNum": 3414, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///A/264/O", "atom2_id": "///A/268/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3392, "atom2_serNum": 3416, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3403, "atom2_serNum": 3426, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3407, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3412, "atom2_serNum": 3445, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3419, "atom2_serNum": 3453, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3429, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 2.358, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3486, "atom2_serNum": 3499, "donAcc_type": "standard", "distance": 2.291, "atom1_id": "///A/277/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3568, "atom2_serNum": 3593, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///A/287/N", "atom2_id": "///A/290/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3571, "atom2_serNum": 3588, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/287/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3581, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3591, "atom2_serNum": 3617, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3597, "atom2_serNum": 3621, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3602, "atom2_serNum": 3626, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3608, "atom2_serNum": 3753, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/292/NH1", "atom2_id": "///A/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3620, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3624, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3629, "atom2_serNum": 3658, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3634, "atom2_serNum": 3658, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/297/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3634, "atom2_serNum": 3663, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3640, "atom2_serNum": 3836, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/297/NH1", "atom2_id": "///A/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3640, "atom2_serNum": 3870, "donAcc_type": "standard", "distance": 2.400, "atom1_id": "///A/297/NH1", "atom2_id": "///A/327/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3641, "atom2_serNum": 3870, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/297/NH2", "atom2_id": "///A/327/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3645, "atom2_serNum": 3674, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3648, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 3.816, "atom1_id": "///A/298/OD1", "atom2_id": "///A/301/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3653, "atom2_serNum": 3683, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/299/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3661, "atom2_serNum": 3679, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/300/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3693, "atom2_serNum": 3720, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3695, "atom2_serNum": 3711, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///A/305/OG", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3699, "atom2_serNum": 3728, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3707, "atom2_serNum": 3736, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3714, "atom2_serNum": 3745, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/308/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3719, "atom2_serNum": 6416, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/308/OE2", "atom2_id": "///B/332/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3719, "atom2_serNum": 6451, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/308/OE2", "atom2_id": "///B/337/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3723, "atom2_serNum": 3750, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/309/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3731, "atom2_serNum": 3754, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/310/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3731, "atom2_serNum": 3758, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/310/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3739, "atom2_serNum": 3754, "donAcc_type": "standard", "distance": 2.549, "atom1_id": "///A/311/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3782, "atom2_serNum": 3786, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/317/O", "atom2_id": "///A/317/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3782, "atom2_serNum": 3794, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/317/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3790, "atom2_serNum": 3810, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/318/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3790, "atom2_serNum": 3817, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/318/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3805, "atom2_serNum": 3825, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/320/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3805, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/320/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3813, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/321/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3813, "atom2_serNum": 3845, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3820, "atom2_serNum": 3853, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3848, "atom2_serNum": 3872, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/325/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3864, "atom2_serNum": 3870, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///A/327/N", "atom2_id": "///A/327/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3883, "atom2_serNum": 3903, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/329/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3883, "atom2_serNum": 3908, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///A/329/O", "atom2_id": "///A/332/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3893, "atom2_serNum": 3902, "donAcc_type": "acceptable", "distance": 2.477, "atom1_id": "///A/330/OG", "atom2_id": "///A/331/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3913, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/333/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3913, "atom2_serNum": 3934, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3917, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3922, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3930, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3937, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/337/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3937, "atom2_serNum": 3970, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3948, "atom2_serNum": 3970, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/338/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3982, "atom2_serNum": 4000, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/19/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3982, "atom2_serNum": 4009, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3984, "atom2_serNum": 4008, "donAcc_type": "acceptable", "distance": 3.210, "atom1_id": "///B/19/OG1", "atom2_id": "///B/22/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3989, "atom2_serNum": 4016, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3995, "atom2_serNum": 4027, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3998, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/21/OD1", "atom2_id": "///B/24/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4003, "atom2_serNum": 4027, "donAcc_type": "standard", "distance": 2.458, "atom1_id": "///B/22/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4003, "atom2_serNum": 4036, "donAcc_type": "standard", "distance": 2.524, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4012, "atom2_serNum": 4044, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4019, "atom2_serNum": 4052, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4030, "atom2_serNum": 4060, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4035, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///B/25/NZ", "atom2_id": "///B/29/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4039, "atom2_serNum": 4068, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4043, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/26/ND2", "atom2_id": "///B/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4047, "atom2_serNum": 4076, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4055, "atom2_serNum": 4087, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4063, "atom2_serNum": 4098, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4071, "atom2_serNum": 4106, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4079, "atom2_serNum": 4115, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///B/31/O", "atom2_id": "///B/34/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4101, "atom2_serNum": 4126, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/33/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4109, "atom2_serNum": 4131, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/34/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4109, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///B/34/O", "atom2_id": "///B/42/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4145, "atom2_serNum": 4167, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/38/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4145, "atom2_serNum": 4174, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4147, "atom2_serNum": 4157, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/38/OG", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4151, "atom2_serNum": 4188, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4160, "atom2_serNum": 4197, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4170, "atom2_serNum": 4205, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4177, "atom2_serNum": 4213, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4191, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/43/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4200, "atom2_serNum": 4227, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/44/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4208, "atom2_serNum": 4234, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4216, "atom2_serNum": 4240, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/46/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4224, "atom2_serNum": 4251, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/47/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4230, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/48/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4237, "atom2_serNum": 4271, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/49/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4243, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/50/O", "atom2_id": "///B/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4254, "atom2_serNum": 4281, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///B/51/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4256, "atom2_serNum": 4461, "donAcc_type": "acceptable", "distance": 2.573, "atom1_id": "///B/51/OG", "atom2_id": "///B/74/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4260, "atom2_serNum": 4281, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/52/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4260, "atom2_serNum": 4295, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/52/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4265, "atom2_serNum": 4357, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/52/NE1", "atom2_id": "///B/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4274, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/53/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4279, "atom2_serNum": 4310, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4284, "atom2_serNum": 4318, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4284, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/55/O", "atom2_id": "///B/59/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4298, "atom2_serNum": 4318, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/56/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4298, "atom2_serNum": 4326, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4298, "atom2_serNum": 4334, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/56/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4341, "atom2_serNum": 4422, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/61/NE", "atom2_id": "///B/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4344, "atom2_serNum": 4422, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/61/NH2", "atom2_id": "///B/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4386, "atom2_serNum": 4661, "donAcc_type": "questionable", "distance": 2.719, "atom1_id": "///B/66/N", "atom2_id": "///B/99/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4394, "atom2_serNum": 4416, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/67/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4394, "atom2_serNum": 4424, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4403, "atom2_serNum": 4431, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4410, "atom2_serNum": 4442, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4419, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4427, "atom2_serNum": 4462, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4434, "atom2_serNum": 4470, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4445, "atom2_serNum": 4478, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4453, "atom2_serNum": 4478, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/74/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4453, "atom2_serNum": 4490, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4461, "atom2_serNum": 4595, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///B/74/OH", "atom2_id": "///B/91/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4465, "atom2_serNum": 4498, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4473, "atom2_serNum": 4507, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4481, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4493, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/78/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4493, "atom2_serNum": 4523, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4493, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/78/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4501, "atom2_serNum": 4523, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/79/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4506, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 3.959, "atom1_id": "///B/79/NE2", "atom2_id": "///B/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4506, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/79/NE2", "atom2_id": "///B/123/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4506, "atom2_serNum": 4861, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///B/79/NE2", "atom2_id": "///B/124/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4530, "atom2_serNum": 4862, "donAcc_type": "standard", "distance": 3.845, "atom1_id": "///B/83/O", "atom2_id": "///B/124/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4538, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/84/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4538, "atom2_serNum": 4563, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4540, "atom2_serNum": 4895, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/85/N", "atom2_id": "///B/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4543, "atom2_serNum": 4571, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4550, "atom2_serNum": 4580, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4559, "atom2_serNum": 4580, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///B/87/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4559, "atom2_serNum": 4589, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4566, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4574, "atom2_serNum": 4607, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/89/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4583, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4588, "atom2_serNum": 4619, "donAcc_type": "questionable", "distance": 3.219, "atom1_id": "///B/90/NE2", "atom2_id": "///B/94/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4592, "atom2_serNum": 4620, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4602, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4610, "atom2_serNum": 4636, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4614, "atom2_serNum": 4644, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4623, "atom2_serNum": 4652, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4623, "atom2_serNum": 4658, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///B/95/O", "atom2_id": "///B/99/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4631, "atom2_serNum": 4662, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4634, "atom2_serNum": 4727, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///B/96/OD1", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4635, "atom2_serNum": 4718, "donAcc_type": "questionable", "distance": 3.090, "atom1_id": "///B/96/ND2", "atom2_id": "///B/106/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4635, "atom2_serNum": 4732, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///B/96/ND2", "atom2_id": "///B/108/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4639, "atom2_serNum": 4673, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4647, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/98/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4647, "atom2_serNum": 4689, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///B/98/O", "atom2_id": "///B/102/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4655, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/99/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4655, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/99/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4655, "atom2_serNum": 4694, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/99/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4665, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///B/100/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4709, "atom2_serNum": 4740, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/106/N", "atom2_id": "///B/109/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4712, "atom2_serNum": 4733, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///B/106/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4723, "atom2_serNum": 4741, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/107/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4723, "atom2_serNum": 4746, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///B/107/O", "atom2_id": "///B/110/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4730, "atom2_serNum": 4772, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///B/108/O", "atom2_id": "///B/114/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4744, "atom2_serNum": 4746, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///B/110/O", "atom2_id": "///B/110/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4744, "atom2_serNum": 4760, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/110/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4744, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/110/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4750, "atom2_serNum": 4773, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/111/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4758, "atom2_serNum": 4781, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/112/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4763, "atom2_serNum": 4788, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/113/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4770, "atom2_serNum": 4796, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/114/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4776, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/115/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4784, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/116/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4791, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/117/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4791, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/117/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4799, "atom2_serNum": 4837, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/118/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4810, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/119/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4814, "atom2_serNum": 4854, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/119/NE", "atom2_id": "///B/123/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4821, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/120/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4829, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/121/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4829, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/121/O", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4858, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/124/O", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4928, "atom2_serNum": 6188, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///B/133/OE1", "atom2_id": "///B/297/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4928, "atom2_serNum": 6383, "donAcc_type": "questionable", "distance": 3.363, "atom1_id": "///B/133/OE1", "atom2_id": "///B/324/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4929, "atom2_serNum": 6379, "donAcc_type": "questionable", "distance": 3.242, "atom1_id": "///B/133/NE2", "atom2_id": "///B/323/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4938, "atom2_serNum": 6140, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///B/135/O", "atom2_id": "///B/290/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4946, "atom2_serNum": 6109, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/136/O", "atom2_id": "///B/286/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4959, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/138/N", "atom2_id": "///B/141/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4962, "atom2_serNum": 4986, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/138/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4962, "atom2_serNum": 4994, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/138/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4966, "atom2_serNum": 6220, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/138/OE1", "atom2_id": "///B/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4968, "atom2_serNum": 6196, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///B/139/N", "atom2_id": "///B/298/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4971, "atom2_serNum": 5005, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/139/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4982, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/140/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4989, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4992, "atom2_serNum": 6011, "donAcc_type": "acceptable", "distance": 3.799, "atom1_id": "///B/141/OD1", "atom2_id": "///B/273/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4997, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/142/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5008, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5016, "atom2_serNum": 5045, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///B/144/O", "atom2_id": "///B/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5016, "atom2_serNum": 5046, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/144/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5025, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5032, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/146/O", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5043, "atom2_serNum": 5078, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///B/147/O", "atom2_id": "///B/151/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5057, "atom2_serNum": 5079, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/149/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5065, "atom2_serNum": 5631, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///B/150/O", "atom2_id": "///B/223/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5082, "atom2_serNum": 5631, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/152/O", "atom2_id": "///B/223/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5082, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/152/O", "atom2_id": "///B/223/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5084, "atom2_serNum": 5093, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///B/152/OG", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5084, "atom2_serNum": 5126, "donAcc_type": "acceptable", "distance": 2.520, "atom1_id": "///B/152/OG", "atom2_id": "///B/157/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5091, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/153/OD1", "atom2_id": "///B/223/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5096, "atom2_serNum": 5127, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/154/O", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5102, "atom2_serNum": 5125, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/154/NH1", "atom2_id": "///B/157/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5107, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/155/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5113, "atom2_serNum": 5146, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/156/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5122, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/157/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5130, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/158/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5138, "atom2_serNum": 5167, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/159/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5142, "atom2_serNum": 5152, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/159/NE", "atom2_id": "///B/160/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5144, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/159/NH1", "atom2_id": "///B/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5145, "atom2_serNum": 5152, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/159/NH2", "atom2_id": "///B/160/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5149, "atom2_serNum": 5178, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/160/O", "atom2_id": "///B/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5157, "atom2_serNum": 5186, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/161/O", "atom2_id": "///B/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5165, "atom2_serNum": 5190, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/162/O", "atom2_id": "///B/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5170, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/163/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5181, "atom2_serNum": 5203, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/164/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5189, "atom2_serNum": 5215, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/165/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5193, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/166/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5193, "atom2_serNum": 5228, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///B/166/O", "atom2_id": "///B/170/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5201, "atom2_serNum": 5230, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/167/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5214, "atom2_serNum": 6196, "donAcc_type": "acceptable", "distance": 2.282, "atom1_id": "///B/168/OH", "atom2_id": "///B/298/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5221, "atom2_serNum": 5557, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/169/OD1", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5222, "atom2_serNum": 5547, "donAcc_type": "standard", "distance": 3.848, "atom1_id": "///B/169/ND2", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5226, "atom2_serNum": 5543, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/170/O", "atom2_id": "///B/211/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5228, "atom2_serNum": 5238, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///B/170/OG1", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5233, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/171/O", "atom2_id": "///B/292/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5249, "atom2_serNum": 5267, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/173/O", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5249, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5255, "atom2_serNum": 5275, "donAcc_type": "standard", "distance": 2.327, "atom1_id": "///B/173/NH1", "atom2_id": "///B/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5255, "atom2_serNum": 5464, "donAcc_type": "acceptable", "distance": 3.924, "atom1_id": "///B/173/NH1", "atom2_id": "///B/200/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5260, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/174/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5260, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5279, "atom2_serNum": 5300, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/177/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5292, "atom2_serNum": 5308, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///B/179/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5303, "atom2_serNum": 5741, "donAcc_type": "standard", "distance": 2.433, "atom1_id": "///B/180/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5308, "atom2_serNum": 5342, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/181/N", "atom2_id": "///B/184/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5311, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/181/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5317, "atom2_serNum": 5716, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///B/181/NH1", "atom2_id": "///B/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5317, "atom2_serNum": 5849, "donAcc_type": "standard", "distance": 2.298, "atom1_id": "///B/181/NH1", "atom2_id": "///B/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5319, "atom2_serNum": 5724, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///B/182/N", "atom2_id": "///B/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5322, "atom2_serNum": 5343, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/182/O", "atom2_id": "///B/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5326, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.429, "atom1_id": "///B/183/N", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5334, "atom2_serNum": 5719, "donAcc_type": "standard", "distance": 2.309, "atom1_id": "///B/183/NZ", "atom2_id": "///B/235/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5338, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/184/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5351, "atom2_serNum": 5413, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/186/N", "atom2_id": "///B/194/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5354, "atom2_serNum": 5410, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/186/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5356, "atom2_serNum": 5534, "donAcc_type": "acceptable", "distance": 3.625, "atom1_id": "///B/186/OG", "atom2_id": "///B/210/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5366, "atom2_serNum": 5621, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/187/NH1", "atom2_id": "///B/222/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5367, "atom2_serNum": 5621, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///B/187/NH2", "atom2_id": "///B/222/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5368, "atom2_serNum": 5394, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/188/N", "atom2_id": "///B/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5371, "atom2_serNum": 5387, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/188/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5373, "atom2_serNum": 5383, "donAcc_type": "acceptable", "distance": 3.136, "atom1_id": "///B/188/OG1", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5373, "atom2_serNum": 5391, "donAcc_type": "acceptable", "distance": 3.245, "atom1_id": "///B/188/OG1", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5402, "atom2_serNum": 5587, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///B/193/N", "atom2_id": "///B/218/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5405, "atom2_serNum": 5549, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/193/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5418, "atom2_serNum": 5538, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///B/195/N", "atom2_id": "///B/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5421, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///B/195/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5432, "atom2_serNum": 5533, "donAcc_type": "acceptable", "distance": 3.043, "atom1_id": "///B/196/ND1", "atom2_id": "///B/210/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5436, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.425, "atom1_id": "///B/197/N", "atom2_id": "///B/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5439, "atom2_serNum": 5519, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///B/197/O", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5459, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///B/200/N", "atom2_id": "///B/203/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5462, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/200/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5464, "atom2_serNum": 5475, "donAcc_type": "acceptable", "distance": 3.043, "atom1_id": "///B/200/OG1", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5464, "atom2_serNum": 5482, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///B/200/OG1", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5502, "atom2_serNum": 5510, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///B/205/OG", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5502, "atom2_serNum": 5515, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///B/205/OG", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5543, "atom2_serNum": 6295, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/211/NZ", "atom2_id": "///B/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5560, "atom2_serNum": 5582, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/214/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5560, "atom2_serNum": 5587, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///B/214/O", "atom2_id": "///B/218/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5562, "atom2_serNum": 5575, "donAcc_type": "acceptable", "distance": 2.968, "atom1_id": "///B/214/OG", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5566, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/215/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5574, "atom2_serNum": 5598, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/216/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5578, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5585, "atom2_serNum": 5613, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5592, "atom2_serNum": 5622, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5601, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///B/220/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5609, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/221/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5609, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/221/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5616, "atom2_serNum": 5655, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/222/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5625, "atom2_serNum": 5661, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/223/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5636, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/224/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5636, "atom2_serNum": 5673, "donAcc_type": "acceptable", "distance": 2.392, "atom1_id": "///B/224/O", "atom2_id": "///B/228/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5641, "atom2_serNum": 5744, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/224/NE1", "atom2_id": "///B/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5650, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/225/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5650, "atom2_serNum": 5673, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///B/225/O", "atom2_id": "///B/228/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5650, "atom2_serNum": 5674, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/225/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5677, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/229/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5681, "atom2_serNum": 5728, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/230/O", "atom2_id": "///B/236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5701, "atom2_serNum": 5721, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///B/233/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5704, "atom2_serNum": 5713, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///B/233/OD1", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5729, "atom2_serNum": 5843, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/237/N", "atom2_id": "///B/251/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5740, "atom2_serNum": 5872, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///B/237/OH", "atom2_id": "///B/255/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5769, "atom2_serNum": 5828, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/241/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5784, "atom2_serNum": 5819, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/243/N", "atom2_id": "///B/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5787, "atom2_serNum": 5812, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///B/243/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5810, "atom2_serNum": 5816, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/245/OD1", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5845, "atom2_serNum": 5851, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///B/251/OG", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5845, "atom2_serNum": 5858, "donAcc_type": "acceptable", "distance": 2.453, "atom1_id": "///B/251/OG", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5845, "atom2_serNum": 5861, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///B/251/OG", "atom2_id": "///B/254/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5884, "atom2_serNum": 5901, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/257/O", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5884, "atom2_serNum": 5906, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/257/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5886, "atom2_serNum": 5900, "donAcc_type": "acceptable", "distance": 3.141, "atom1_id": "///B/257/OG", "atom2_id": "///B/259/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5890, "atom2_serNum": 5914, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/258/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5898, "atom2_serNum": 5924, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5904, "atom2_serNum": 5924, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/260/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5904, "atom2_serNum": 5928, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5909, "atom2_serNum": 5936, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///B/261/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5917, "atom2_serNum": 5947, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/262/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5927, "atom2_serNum": 5951, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///B/263/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5931, "atom2_serNum": 5956, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/264/O", "atom2_id": "///B/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5931, "atom2_serNum": 5961, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///B/264/O", "atom2_id": "///B/268/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5939, "atom2_serNum": 5963, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/265/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5950, "atom2_serNum": 5973, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///B/266/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5954, "atom2_serNum": 5973, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/267/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5954, "atom2_serNum": 5984, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/267/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5959, "atom2_serNum": 5992, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///B/268/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5966, "atom2_serNum": 6000, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/269/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5976, "atom2_serNum": 6012, "donAcc_type": "standard", "distance": 2.479, "atom1_id": "///B/270/O", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6036, "atom2_serNum": 6038, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///B/277/OD1", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6036, "atom2_serNum": 6044, "donAcc_type": "questionable", "distance": 2.285, "atom1_id": "///B/277/OD1", "atom2_id": "///B/278/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6044, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/278/OD1", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6051, "atom2_serNum": 6064, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///B/279/OG", "atom2_id": "///B/281/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6115, "atom2_serNum": 6140, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///B/287/N", "atom2_id": "///B/290/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6118, "atom2_serNum": 6125, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///B/287/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6118, "atom2_serNum": 6135, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///B/287/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6118, "atom2_serNum": 6140, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///B/287/O", "atom2_id": "///B/290/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6128, "atom2_serNum": 6157, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/289/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6138, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/290/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6144, "atom2_serNum": 6168, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/291/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6149, "atom2_serNum": 6173, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/292/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6156, "atom2_serNum": 6300, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/292/NH2", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6160, "atom2_serNum": 6178, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/293/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6167, "atom2_serNum": 6189, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/294/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6171, "atom2_serNum": 6197, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/295/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6176, "atom2_serNum": 6205, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/296/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6181, "atom2_serNum": 6210, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6185, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///B/297/NE", "atom2_id": "///B/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6188, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/297/NH2", "atom2_id": "///B/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6192, "atom2_serNum": 6221, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6195, "atom2_serNum": 6220, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/298/OD1", "atom2_id": "///B/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6200, "atom2_serNum": 6230, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///B/299/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6208, "atom2_serNum": 6226, "donAcc_type": "standard", "distance": 2.469, "atom1_id": "///B/300/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6237, "atom2_serNum": 6265, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///B/305/N", "atom2_id": "///B/308/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6240, "atom2_serNum": 6242, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///B/305/O", "atom2_id": "///B/305/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6240, "atom2_serNum": 6258, "donAcc_type": "standard", "distance": 2.306, "atom1_id": "///B/305/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6240, "atom2_serNum": 6267, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/305/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6242, "atom2_serNum": 6258, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///B/305/OG", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6246, "atom2_serNum": 6275, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/306/O", "atom2_id": "///B/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6254, "atom2_serNum": 6283, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/307/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6261, "atom2_serNum": 6292, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/308/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6270, "atom2_serNum": 6297, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///B/309/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6278, "atom2_serNum": 6305, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///B/310/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6300, "atom2_serNum": 6305, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///B/313/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6344, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///B/319/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6352, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/320/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6352, "atom2_serNum": 6380, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/320/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6375, "atom2_serNum": 6407, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/323/O", "atom2_id": "///B/326/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6414, "atom2_serNum": 6451, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/332/O", "atom2_id": "///B/337/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6416, "atom2_serNum": 6418, "donAcc_type": "acceptable", "distance": 2.514, "atom1_id": "///B/332/OG1", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6416, "atom2_serNum": 6422, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///B/332/OG1", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6421, "atom2_serNum": 6442, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6425, "atom2_serNum": 6453, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6430, "atom2_serNum": 6461, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6438, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/336/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6456, "atom2_serNum": 6478, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///B/338/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1pvp", "num_aaChains": 2, "aaChains": "A=323,B=318", "num_naChains": 2, "naChains": "C=33,D=34", "num_atoms": 6657, "num_waters": 256, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }