{ "num_pairs": 40, "pairs": [ { "index": 1, "nt1": "///X/1", "nt2": "///Z/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.187, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.466, "chi2": -92.751, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.731, "C1C1_dist": 10.132, "N1N9_dist": 8.605, "C6C8_dist": 9.658, "CNNC_torsion": -6.798, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.65],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 6.837, "planarity": 0.107, "simple_Shear": -0.004, "simple_Stretch": -0.275, "simple_Buckle": 4.436, "simple_Propeller": -5.203, "bp_simpleParams": [ -0.004, -0.275, 0.056, 4.436, -5.203, 4.321 ], "bp_params": [ -0.002, -0.275, 0.056, 4.469, -5.175, 4.322 ], "frame": { "rmsd": null, "origin": [ 29.424, 56.812, 159.337 ], "x_axis": [ 0.780, -0.145, -0.609 ], "y_axis": [ -0.486, 0.473, -0.735 ], "z_axis": [ 0.395, 0.869, 0.298 ], "quaternion": [ 0.799, -0.502, 0.314, 0.107 ] } }, { "index": 2, "nt1": "///X/2", "nt2": "///Z/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.470, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.887, "chi2": -124.746, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 70.216, "C1C1_dist": 9.396, "N1N9_dist": 8.173, "C6C8_dist": 9.511, "CNNC_torsion": -12.733, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.56],O4(carbonyl)-N6(amino)[3.27]", "interBase_angle": 5.960, "planarity": 0.160, "simple_Shear": -0.593, "simple_Stretch": -0.313, "simple_Buckle": 0.994, "simple_Propeller": -5.877, "bp_simpleParams": [ -0.593, -0.313, 0.608, 0.994, -5.877, 16.517 ], "bp_params": [ -0.571, -0.352, 0.608, 1.383, -5.798, 16.536 ], "frame": { "rmsd": null, "origin": [ 31.748, 59.154, 160.466 ], "x_axis": [ 0.326, -0.049, -0.944 ], "y_axis": [ -0.844, 0.435, -0.314 ], "z_axis": [ 0.426, 0.899, 0.100 ], "quaternion": [ 0.682, -0.445, 0.502, 0.291 ] } }, { "index": 3, "nt1": "///X/3", "nt2": "///Y/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.603, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.193, "chi2": -128.682, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.782, "C1C1_dist": 10.351, "N1N9_dist": 8.922, "C6C8_dist": 10.053, "CNNC_torsion": 2.748, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.21],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.60]", "interBase_angle": 3.234, "planarity": 0.069, "simple_Shear": -0.186, "simple_Stretch": 0.044, "simple_Buckle": -3.234, "simple_Propeller": 0.041, "bp_simpleParams": [ -0.186, 0.044, -0.104, -3.234, 0.041, 7.745 ], "bp_params": [ -0.186, 0.042, -0.104, -3.234, -0.003, 7.742 ], "frame": { "rmsd": null, "origin": [ 33.830, 61.905, 160.104 ], "x_axis": [ -0.259, 0.148, -0.954 ], "y_axis": [ -0.814, 0.498, 0.299 ], "z_axis": [ 0.520, 0.854, -0.009 ], "quaternion": [ 0.555, -0.251, 0.664, 0.434 ] } }, { "index": 4, "nt1": "///X/4", "nt2": "///Y/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -64.716, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.473, "chi2": -110.711, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.887, "C1C1_dist": 10.636, "N1N9_dist": 8.935, "C6C8_dist": 9.830, "CNNC_torsion": 7.945, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.88]", "interBase_angle": 1.457, "planarity": 0.056, "simple_Shear": -0.006, "simple_Stretch": -0.113, "simple_Buckle": 0.142, "simple_Propeller": -1.450, "bp_simpleParams": [ -0.006, -0.113, 0.202, 0.142, -1.450, -2.655 ], "bp_params": [ -0.007, -0.113, 0.202, 0.138, -1.451, -2.654 ], "frame": { "rmsd": null, "origin": [ 35.432, 64.503, 159.814 ], "x_axis": [ -0.637, 0.243, -0.731 ], "y_axis": [ -0.631, 0.380, 0.676 ], "z_axis": [ 0.442, 0.892, -0.089 ], "quaternion": [ 0.404, -0.134, 0.726, 0.540 ] } }, { "index": 5, "nt1": "///X/5", "nt2": "///Y/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -141.808, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.573, "chi2": -102.259, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.422, "C1C1_dist": 10.822, "N1N9_dist": 9.037, "C6C8_dist": 9.923, "CNNC_torsion": -1.766, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 1.167, "planarity": 0.023, "simple_Shear": -0.178, "simple_Stretch": -0.104, "simple_Buckle": 1.108, "simple_Propeller": 0.369, "bp_simpleParams": [ -0.178, -0.104, 0.073, 1.108, 0.369, -1.531 ], "bp_params": [ -0.176, -0.107, 0.073, 1.102, 0.384, -1.531 ], "frame": { "rmsd": null, "origin": [ 37.707, 67.084, 159.280 ], "x_axis": [ -0.900, 0.407, -0.154 ], "y_axis": [ -0.091, 0.170, 0.981 ], "z_axis": [ 0.426, 0.898, -0.116 ], "quaternion": [ 0.196, 0.107, 0.739, 0.635 ] } }, { "index": 6, "nt1": "///X/6", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.144, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.455, "chi2": -108.873, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.363, "C1C1_dist": 10.584, "N1N9_dist": 8.900, "C6C8_dist": 9.831, "CNNC_torsion": 8.673, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 6.614, "planarity": 0.098, "simple_Shear": -0.024, "simple_Stretch": -0.200, "simple_Buckle": -4.891, "simple_Propeller": -4.452, "bp_simpleParams": [ -0.024, -0.200, -0.321, -4.891, -4.452, -0.379 ], "bp_params": [ -0.025, -0.200, -0.321, -4.903, -4.439, -0.379 ], "frame": { "rmsd": null, "origin": [ 38.447, 70.468, 157.834 ], "x_axis": [ -0.836, 0.377, 0.399 ], "y_axis": [ 0.433, 0.006, 0.901 ], "z_axis": [ 0.338, 0.926, -0.169 ], "quaternion": [ -0.022, 0.286, 0.709, 0.644 ] } }, { "index": 7, "nt1": "///X/7", "nt2": "///Y/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.508, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.403, "chi2": -99.198, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.011, "C1C1_dist": 10.664, "N1N9_dist": 9.050, "C6C8_dist": 10.037, "CNNC_torsion": -8.038, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.19],N1-N3(imino)[3.05]", "interBase_angle": 9.446, "planarity": 0.132, "simple_Shear": -0.064, "simple_Stretch": 0.084, "simple_Buckle": -3.219, "simple_Propeller": -8.881, "bp_simpleParams": [ -0.064, 0.084, 0.148, -3.219, -8.881, 1.207 ], "bp_params": [ -0.064, 0.084, 0.148, -3.213, -8.883, 1.210 ], "frame": { "rmsd": null, "origin": [ 38.341, 73.652, 156.749 ], "x_axis": [ -0.494, 0.270, 0.826 ], "y_axis": [ 0.810, -0.203, 0.551 ], "z_axis": [ 0.316, 0.941, -0.118 ], "quaternion": [ -0.215, 0.455, 0.594, 0.628 ] } }, { "index": 8, "nt1": "///X/8", "nt2": "///Y/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.566, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.398, "chi2": -89.999, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.592, "C1C1_dist": 10.867, "N1N9_dist": 9.143, "C6C8_dist": 10.046, "CNNC_torsion": -3.311, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[3.09]", "interBase_angle": 4.828, "planarity": 0.077, "simple_Shear": 0.045, "simple_Stretch": 0.104, "simple_Buckle": -2.762, "simple_Propeller": -3.960, "bp_simpleParams": [ 0.045, 0.104, -0.094, -2.762, -3.960, -1.746 ], "bp_params": [ 0.046, 0.103, -0.094, -2.796, -3.936, -1.747 ], "frame": { "rmsd": null, "origin": [ 39.412, 76.609, 155.823 ], "x_axis": [ 0.138, 0.135, 0.981 ], "y_axis": [ 0.925, -0.373, -0.079 ], "z_axis": [ 0.355, 0.918, -0.176 ], "quaternion": [ -0.384, 0.649, 0.408, 0.514 ] } }, { "index": 9, "nt1": "///X/9", "nt2": "///Y/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.569, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.822, "chi2": -93.862, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.198, "C1C1_dist": 10.740, "N1N9_dist": 8.997, "C6C8_dist": 9.873, "CNNC_torsion": -18.996, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 13.642, "planarity": 0.185, "simple_Shear": -0.387, "simple_Stretch": -0.072, "simple_Buckle": -4.051, "simple_Propeller": -13.027, "bp_simpleParams": [ -0.387, -0.072, 0.146, -4.051, -13.027, -3.293 ], "bp_params": [ -0.384, -0.089, 0.146, -3.488, -13.189, -3.314 ], "frame": { "rmsd": null, "origin": [ 39.919, 79.821, 154.862 ], "x_axis": [ 0.645, -0.053, 0.762 ], "y_axis": [ 0.668, -0.445, -0.597 ], "z_axis": [ 0.371, 0.894, -0.252 ], "quaternion": [ -0.487, 0.765, 0.201, 0.370 ] } }, { "index": 10, "nt1": "///X/10", "nt2": "///Y/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.728, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.309, "chi2": -97.456, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.463, "C1C1_dist": 10.405, "N1N9_dist": 8.763, "C6C8_dist": 9.765, "CNNC_torsion": -10.900, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 10.921, "planarity": 0.155, "simple_Shear": -0.016, "simple_Stretch": -0.177, "simple_Buckle": -1.487, "simple_Propeller": -10.819, "bp_simpleParams": [ -0.016, -0.177, -0.214, -1.487, -10.819, 2.978 ], "bp_params": [ -0.015, -0.177, -0.214, -1.416, -10.829, 2.991 ], "frame": { "rmsd": null, "origin": [ 41.051, 82.809, 154.227 ], "x_axis": [ 0.964, -0.208, 0.165 ], "y_axis": [ 0.098, -0.300, -0.949 ], "z_axis": [ 0.247, 0.931, -0.269 ], "quaternion": [ 0.591, -0.796, 0.035, -0.130 ] } }, { "index": 11, "nt1": "///X/11", "nt2": "///Y/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.363, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.225, "chi2": -145.280, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.485, "C1C1_dist": 10.684, "N1N9_dist": 8.962, "C6C8_dist": 9.853, "CNNC_torsion": -4.521, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 5.504, "planarity": 0.102, "simple_Shear": -0.393, "simple_Stretch": -0.097, "simple_Buckle": -2.168, "simple_Propeller": -5.059, "bp_simpleParams": [ -0.393, -0.097, -0.289, -2.168, -5.059, -2.581 ], "bp_params": [ -0.388, -0.115, -0.289, -1.941, -5.151, -2.583 ], "frame": { "rmsd": null, "origin": [ 42.035, 85.875, 153.507 ], "x_axis": [ 0.836, -0.299, -0.460 ], "y_axis": [ -0.516, -0.142, -0.845 ], "z_axis": [ 0.187, 0.944, -0.273 ], "quaternion": [ 0.596, -0.750, 0.272, 0.091 ] } }, { "index": 12, "nt1": "///X/12", "nt2": "///Y/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.039, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.373, "chi2": -106.105, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.479, "C1C1_dist": 10.427, "N1N9_dist": 8.868, "C6C8_dist": 9.960, "CNNC_torsion": 1.979, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.51],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[3.13]", "interBase_angle": 5.573, "planarity": 0.096, "simple_Shear": 0.140, "simple_Stretch": -0.051, "simple_Buckle": 0.518, "simple_Propeller": -5.549, "bp_simpleParams": [ 0.140, -0.051, -0.225, 0.518, -5.549, 7.343 ], "bp_params": [ 0.139, -0.052, -0.225, 0.466, -5.553, 7.352 ], "frame": { "rmsd": null, "origin": [ 43.116, 88.918, 152.947 ], "x_axis": [ 0.422, -0.330, -0.845 ], "y_axis": [ -0.890, 0.030, -0.456 ], "z_axis": [ 0.176, 0.943, -0.281 ], "quaternion": [ 0.541, -0.647, 0.472, 0.258 ] } }, { "index": 13, "nt1": "///X/13", "nt2": "///Y/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.258, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.400, "chi2": -133.478, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.947, "C1C1_dist": 10.729, "N1N9_dist": 8.930, "C6C8_dist": 9.790, "CNNC_torsion": -7.767, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 3.044, "planarity": 0.071, "simple_Shear": 0.506, "simple_Stretch": -0.221, "simple_Buckle": 2.202, "simple_Propeller": -2.102, "bp_simpleParams": [ 0.506, -0.221, -0.003, 2.202, -2.102, -2.380 ], "bp_params": [ 0.495, -0.244, -0.003, 2.102, -2.202, -2.380 ], "frame": { "rmsd": null, "origin": [ 44.114, 92.169, 152.735 ], "x_axis": [ -0.140, -0.318, -0.938 ], "y_axis": [ -0.971, 0.227, 0.068 ], "z_axis": [ 0.192, 0.920, -0.341 ], "quaternion": [ 0.432, -0.493, 0.654, 0.378 ] } }, { "index": 14, "nt1": "///X/14", "nt2": "///Y/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.704, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.120, "chi2": -112.708, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.218, "C1C1_dist": 10.059, "N1N9_dist": 8.504, "C6C8_dist": 9.568, "CNNC_torsion": 2.298, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.58]", "interBase_angle": 9.457, "planarity": 0.122, "simple_Shear": 0.287, "simple_Stretch": -0.338, "simple_Buckle": 6.418, "simple_Propeller": -6.946, "bp_simpleParams": [ 0.287, -0.338, -0.072, 6.418, -6.946, 5.273 ], "bp_params": [ 0.276, -0.348, -0.072, 6.188, -7.152, 5.276 ], "frame": { "rmsd": null, "origin": [ 43.904, 95.096, 151.199 ], "x_axis": [ -0.737, -0.157, -0.657 ], "y_axis": [ -0.650, 0.432, 0.625 ], "z_axis": [ 0.186, 0.888, -0.420 ], "quaternion": [ 0.262, -0.251, 0.805, 0.470 ] } }, { "index": 15, "nt1": "///V/1", "nt2": "///W/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.033, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.260, "chi2": -87.771, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.639, "C1C1_dist": 10.253, "N1N9_dist": 8.761, "C6C8_dist": 9.796, "CNNC_torsion": 5.908, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 4.671, "planarity": 0.072, "simple_Shear": -0.031, "simple_Stretch": -0.134, "simple_Buckle": 3.532, "simple_Propeller": -3.056, "bp_simpleParams": [ -0.031, -0.134, -0.124, 3.532, -3.056, 3.318 ], "bp_params": [ -0.030, -0.134, -0.124, 3.557, -3.028, 3.318 ], "frame": { "rmsd": null, "origin": [ 28.469, 15.920, 141.100 ], "x_axis": [ 0.152, -0.209, 0.966 ], "y_axis": [ 0.856, 0.516, -0.023 ], "z_axis": [ -0.493, 0.831, 0.258 ], "quaternion": [ 0.694, -0.308, -0.526, -0.384 ] } }, { "index": 16, "nt1": "///V/2", "nt2": "///W/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.756, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.112, "chi2": -118.101, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 71.417, "C1C1_dist": 9.155, "N1N9_dist": 8.052, "C6C8_dist": 9.472, "CNNC_torsion": -17.430, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.52],O4(carbonyl)-N6(amino)[3.33]", "interBase_angle": 7.102, "planarity": 0.159, "simple_Shear": -0.402, "simple_Stretch": -0.306, "simple_Buckle": -0.315, "simple_Propeller": -7.095, "bp_simpleParams": [ -0.402, -0.306, 0.579, -0.315, -7.095, 20.240 ], "bp_params": [ -0.387, -0.325, 0.579, 0.026, -7.102, 20.278 ], "frame": { "rmsd": null, "origin": [ 26.429, 18.355, 142.690 ], "x_axis": [ 0.603, 0.010, 0.798 ], "y_axis": [ 0.705, 0.460, -0.539 ], "z_axis": [ -0.372, 0.888, 0.270 ], "quaternion": [ 0.764, -0.467, -0.383, -0.228 ] } }, { "index": 17, "nt1": "///V/3", "nt2": "///Z/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.021, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.460, "chi2": -79.572, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.235, "C1C1_dist": 10.548, "N1N9_dist": 8.980, "C6C8_dist": 10.010, "CNNC_torsion": 8.399, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 2.241, "planarity": 0.110, "simple_Shear": -0.232, "simple_Stretch": -0.008, "simple_Buckle": -1.926, "simple_Propeller": 1.147, "bp_simpleParams": [ -0.232, -0.008, -0.134, -1.926, 1.147, 3.805 ], "bp_params": [ -0.232, -0.012, -0.134, -1.947, 1.110, 3.804 ], "frame": { "rmsd": null, "origin": [ 25.234, 20.911, 144.098 ], "x_axis": [ 0.971, 0.144, 0.193 ], "y_axis": [ 0.095, 0.508, -0.856 ], "z_axis": [ -0.221, 0.850, 0.479 ], "quaternion": [ 0.860, -0.496, -0.120, 0.014 ] } }, { "index": 18, "nt1": "///V/4", "nt2": "///Z/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.568, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.878, "chi2": -94.099, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.955, "C1C1_dist": 10.597, "N1N9_dist": 8.754, "C6C8_dist": 9.565, "CNNC_torsion": 8.341, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.52],N1-N3(imino)[2.62]", "interBase_angle": 1.710, "planarity": 0.038, "simple_Shear": 0.196, "simple_Stretch": -0.369, "simple_Buckle": -1.710, "simple_Propeller": -0.047, "bp_simpleParams": [ 0.196, -0.369, -0.122, -1.710, -0.047, -5.897 ], "bp_params": [ 0.187, -0.374, -0.122, -1.710, -0.007, -5.896 ], "frame": { "rmsd": null, "origin": [ 24.344, 23.498, 145.895 ], "x_axis": [ 0.942, 0.237, -0.239 ], "y_axis": [ -0.319, 0.402, -0.858 ], "z_axis": [ -0.107, 0.885, 0.454 ], "quaternion": [ 0.836, -0.521, 0.039, 0.166 ] } }, { "index": 19, "nt1": "///V/5", "nt2": "///Z/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.803, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.243, "chi2": -113.981, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.247, "C1C1_dist": 10.641, "N1N9_dist": 8.911, "C6C8_dist": 9.856, "CNNC_torsion": -2.189, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 3.273, "planarity": 0.045, "simple_Shear": -0.277, "simple_Stretch": -0.153, "simple_Buckle": -0.989, "simple_Propeller": -3.120, "bp_simpleParams": [ -0.277, -0.153, -0.106, -0.989, -3.120, 1.653 ], "bp_params": [ -0.274, -0.159, -0.106, -0.919, -3.142, 1.654 ], "frame": { "rmsd": null, "origin": [ 23.899, 26.471, 147.530 ], "x_axis": [ 0.582, 0.385, -0.717 ], "y_axis": [ -0.810, 0.198, -0.551 ], "z_axis": [ -0.070, 0.902, 0.427 ], "quaternion": [ 0.743, -0.489, 0.218, 0.402 ] } }, { "index": 20, "nt1": "///V/6", "nt2": "///Z/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.643, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.258, "chi2": -118.240, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.326, "C1C1_dist": 10.712, "N1N9_dist": 9.002, "C6C8_dist": 9.917, "CNNC_torsion": 1.320, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 3.203, "planarity": 0.040, "simple_Shear": -0.189, "simple_Stretch": -0.100, "simple_Buckle": -0.379, "simple_Propeller": -3.180, "bp_simpleParams": [ -0.189, -0.100, -0.062, -0.379, -3.180, -0.687 ], "bp_params": [ -0.187, -0.103, -0.062, -0.336, -3.185, -0.687 ], "frame": { "rmsd": null, "origin": [ 24.810, 29.525, 148.853 ], "x_axis": [ 0.095, 0.381, -0.920 ], "y_axis": [ -0.994, -0.016, -0.109 ], "z_axis": [ -0.056, 0.924, 0.377 ], "quaternion": [ 0.603, -0.428, 0.358, 0.570 ] } }, { "index": 21, "nt1": "///V/7", "nt2": "///Z/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -149.385, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.943, "chi2": -139.957, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.146, "C1C1_dist": 10.482, "N1N9_dist": 8.831, "C6C8_dist": 9.828, "CNNC_torsion": -9.393, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.82]", "interBase_angle": 7.442, "planarity": 0.102, "simple_Shear": -0.030, "simple_Stretch": -0.124, "simple_Buckle": 0.345, "simple_Propeller": -7.434, "bp_simpleParams": [ -0.030, -0.124, 0.137, 0.345, -7.434, 2.291 ], "bp_params": [ -0.030, -0.123, 0.137, 0.333, -7.434, 2.296 ], "frame": { "rmsd": null, "origin": [ 25.354, 32.814, 149.422 ], "x_axis": [ -0.420, 0.333, -0.844 ], "y_axis": [ -0.906, -0.206, 0.369 ], "z_axis": [ -0.051, 0.920, 0.389 ], "quaternion": [ 0.437, -0.315, 0.454, 0.710 ] } }, { "index": 22, "nt1": "///V/8", "nt2": "///Z/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.727, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.368, "chi2": -98.103, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.170, "C1C1_dist": 10.645, "N1N9_dist": 8.941, "C6C8_dist": 9.932, "CNNC_torsion": 0.207, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.90]", "interBase_angle": 4.739, "planarity": 0.083, "simple_Shear": 0.204, "simple_Stretch": -0.015, "simple_Buckle": -0.073, "simple_Propeller": -4.738, "bp_simpleParams": [ 0.204, -0.015, -0.154, -0.073, -4.738, 2.452 ], "bp_params": [ 0.203, -0.020, -0.154, -0.193, -4.735, 2.454 ], "frame": { "rmsd": null, "origin": [ 26.022, 35.760, 150.801 ], "x_axis": [ -0.921, 0.146, -0.362 ], "y_axis": [ -0.390, -0.347, 0.853 ], "z_axis": [ -0.001, 0.926, 0.376 ], "quaternion": [ 0.165, -0.111, 0.547, 0.813 ] } }, { "index": 23, "nt1": "///V/9", "nt2": "///Z/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.719, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.108, "chi2": -100.636, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.189, "C1C1_dist": 10.363, "N1N9_dist": 8.773, "C6C8_dist": 9.814, "CNNC_torsion": -13.333, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 6.783, "planarity": 0.104, "simple_Shear": -0.237, "simple_Stretch": -0.122, "simple_Buckle": -1.734, "simple_Propeller": -6.558, "bp_simpleParams": [ -0.237, -0.122, -0.132, -1.734, -6.558, 4.019 ], "bp_params": [ -0.233, -0.129, -0.132, -1.546, -6.605, 4.025 ], "frame": { "rmsd": null, "origin": [ 26.295, 39.003, 151.852 ], "x_axis": [ -0.980, 0.009, 0.198 ], "y_axis": [ 0.175, -0.436, 0.883 ], "z_axis": [ 0.094, 0.900, 0.426 ], "quaternion": [ -0.049, 0.087, 0.529, 0.843 ] } }, { "index": 24, "nt1": "///V/10", "nt2": "///Z/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.720, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.018, "chi2": -130.445, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.751, "C1C1_dist": 10.572, "N1N9_dist": 8.793, "C6C8_dist": 9.673, "CNNC_torsion": -8.237, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.71],O4(carbonyl)-N6(amino)[2.68]", "interBase_angle": 5.426, "planarity": 0.086, "simple_Shear": 0.025, "simple_Stretch": -0.286, "simple_Buckle": 1.125, "simple_Propeller": -5.309, "bp_simpleParams": [ 0.025, -0.286, -0.169, 1.125, -5.309, -2.404 ], "bp_params": [ 0.025, -0.286, -0.169, 1.134, -5.307, -2.407 ], "frame": { "rmsd": null, "origin": [ 26.544, 42.146, 152.888 ], "x_axis": [ -0.649, -0.155, 0.745 ], "y_axis": [ 0.740, -0.355, 0.571 ], "z_axis": [ 0.176, 0.922, 0.345 ], "quaternion": [ -0.292, 0.300, 0.487, 0.766 ] } }, { "index": 25, "nt1": "///V/11", "nt2": "///Z/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.798, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.500, "chi2": -151.778, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.536, "C1C1_dist": 10.809, "N1N9_dist": 9.080, "C6C8_dist": 9.969, "CNNC_torsion": -8.843, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.01],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 5.144, "planarity": 0.078, "simple_Shear": -0.098, "simple_Stretch": 0.028, "simple_Buckle": 0.706, "simple_Propeller": -5.095, "bp_simpleParams": [ -0.098, 0.028, -0.000, 0.706, -5.095, -2.688 ], "bp_params": [ -0.098, 0.027, -0.000, 0.778, -5.085, -2.691 ], "frame": { "rmsd": null, "origin": [ 26.876, 44.937, 154.549 ], "x_axis": [ 0.025, -0.274, 0.961 ], "y_axis": [ 0.979, -0.190, -0.079 ], "z_axis": [ 0.204, 0.943, 0.263 ], "quaternion": [ 0.524, -0.488, -0.361, -0.597 ] } }, { "index": 26, "nt1": "///V/12", "nt2": "///Z/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.886, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.096, "chi2": -90.668, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.313, "C1C1_dist": 10.684, "N1N9_dist": 8.971, "C6C8_dist": 9.878, "CNNC_torsion": 2.764, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 7.035, "planarity": 0.103, "simple_Shear": 0.253, "simple_Stretch": -0.147, "simple_Buckle": 2.370, "simple_Propeller": -6.624, "bp_simpleParams": [ 0.253, -0.147, -0.297, 2.370, -6.624, -0.955 ], "bp_params": [ 0.250, -0.152, -0.297, 2.236, -6.670, -0.957 ], "frame": { "rmsd": null, "origin": [ 26.297, 48.136, 155.441 ], "x_axis": [ 0.484, -0.380, 0.788 ], "y_axis": [ 0.856, 0.016, -0.517 ], "z_axis": [ 0.184, 0.925, 0.333 ], "quaternion": [ 0.677, -0.533, -0.223, -0.456 ] } }, { "index": 27, "nt1": "///V/13", "nt2": "///Z/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.652, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.165, "chi2": -103.491, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.976, "C1C1_dist": 10.627, "N1N9_dist": 8.882, "C6C8_dist": 9.781, "CNNC_torsion": -0.439, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 1.924, "planarity": 0.038, "simple_Shear": 0.119, "simple_Stretch": -0.230, "simple_Buckle": -0.621, "simple_Propeller": -1.821, "bp_simpleParams": [ 0.119, -0.230, 0.039, -0.621, -1.821, -1.019 ], "bp_params": [ 0.117, -0.231, 0.039, -0.636, -1.816, -1.019 ], "frame": { "rmsd": null, "origin": [ 26.420, 51.390, 156.707 ], "x_axis": [ 0.858, -0.382, 0.343 ], "y_axis": [ 0.440, 0.204, -0.874 ], "z_axis": [ 0.264, 0.902, 0.343 ], "quaternion": [ 0.775, -0.573, -0.026, -0.265 ] } }, { "index": 28, "nt1": "///V/14", "nt2": "///Z/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.355, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.519, "chi2": -133.790, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.427, "C1C1_dist": 10.603, "N1N9_dist": 8.931, "C6C8_dist": 9.896, "CNNC_torsion": 8.754, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.89]", "interBase_angle": 3.403, "planarity": 0.055, "simple_Shear": 0.277, "simple_Stretch": -0.047, "simple_Buckle": 3.193, "simple_Propeller": -1.175, "bp_simpleParams": [ 0.277, -0.047, -0.016, 3.193, -1.175, 0.522 ], "bp_params": [ 0.276, -0.055, -0.016, 3.154, -1.276, 0.522 ], "frame": { "rmsd": null, "origin": [ 28.010, 54.273, 157.688 ], "x_axis": [ 0.919, -0.295, -0.260 ], "y_axis": [ -0.130, 0.397, -0.909 ], "z_axis": [ 0.372, 0.869, 0.327 ], "quaternion": [ 0.813, -0.547, 0.194, -0.051 ] } }, { "index": 29, "nt1": "///T/3", "nt2": "///W/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -75.009, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.241, "chi2": -96.769, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.813, "C1C1_dist": 10.796, "N1N9_dist": 9.282, "C6C8_dist": 10.340, "CNNC_torsion": 4.194, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.58],N1(imino)-N3[3.40],N2(amino)-O2(carbonyl)[3.08]", "interBase_angle": 1.926, "planarity": 0.059, "simple_Shear": -0.684, "simple_Stretch": 0.351, "simple_Buckle": -1.545, "simple_Propeller": -1.149, "bp_simpleParams": [ -0.684, 0.351, 0.108, -1.545, -1.149, 5.326 ], "bp_params": [ -0.705, 0.306, 0.108, -1.469, -1.245, 5.326 ], "frame": { "rmsd": null, "origin": [ 43.859, -20.093, 144.677 ], "x_axis": [ -0.784, 0.123, 0.608 ], "y_axis": [ 0.585, 0.472, 0.660 ], "z_axis": [ -0.206, 0.873, -0.442 ], "quaternion": [ -0.248, 0.216, 0.821, 0.467 ] } }, { "index": 30, "nt1": "///T/4", "nt2": "///W/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.659, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.957, "chi2": -89.675, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.092, "C1C1_dist": 10.534, "N1N9_dist": 8.785, "C6C8_dist": 9.710, "CNNC_torsion": 7.560, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.75]", "interBase_angle": 3.413, "planarity": 0.050, "simple_Shear": 0.126, "simple_Stretch": -0.218, "simple_Buckle": -1.562, "simple_Propeller": -3.035, "bp_simpleParams": [ 0.126, -0.218, -0.031, -1.562, -3.035, -0.943 ], "bp_params": [ 0.122, -0.220, -0.031, -1.614, -3.008, -0.943 ], "frame": { "rmsd": null, "origin": [ 42.790, -17.350, 143.513 ], "x_axis": [ -0.333, 0.236, 0.913 ], "y_axis": [ 0.893, 0.390, 0.225 ], "z_axis": [ -0.303, 0.890, -0.340 ], "quaternion": [ -0.424, 0.393, 0.718, 0.388 ] } }, { "index": 31, "nt1": "///T/5", "nt2": "///W/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.682, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.788, "chi2": -111.239, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.649, "C1C1_dist": 10.532, "N1N9_dist": 8.885, "C6C8_dist": 9.896, "CNNC_torsion": 0.167, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 0.383, "planarity": 0.022, "simple_Shear": -0.501, "simple_Stretch": -0.098, "simple_Buckle": 0.268, "simple_Propeller": -0.273, "bp_simpleParams": [ -0.501, -0.098, -0.092, 0.268, -0.273, 3.870 ], "bp_params": [ -0.496, -0.121, -0.092, 0.281, -0.261, 3.870 ], "frame": { "rmsd": null, "origin": [ 41.403, -14.433, 142.227 ], "x_axis": [ 0.207, 0.289, 0.935 ], "y_axis": [ 0.921, 0.265, -0.286 ], "z_axis": [ -0.330, 0.920, -0.212 ], "quaternion": [ 0.561, -0.537, -0.563, -0.282 ] } }, { "index": 32, "nt1": "///T/6", "nt2": "///W/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.173, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.491, "chi2": -103.901, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 64.180, "C1C1_dist": 10.357, "N1N9_dist": 8.887, "C6C8_dist": 10.068, "CNNC_torsion": 4.124, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.58],N1(imino)-O2(carbonyl)[3.24],N1(imino)-N3[3.11],N2(amino)-O2(carbonyl)[2.56]", "interBase_angle": 3.440, "planarity": 0.062, "simple_Shear": -0.961, "simple_Stretch": 0.144, "simple_Buckle": -3.214, "simple_Propeller": -1.226, "bp_simpleParams": [ -0.961, 0.144, -0.235, -3.214, -1.226, 12.080 ], "bp_params": [ -0.970, 0.056, -0.235, -3.089, -1.513, 12.077 ], "frame": { "rmsd": null, "origin": [ 40.430, -11.104, 142.512 ], "x_axis": [ 0.666, 0.286, 0.689 ], "y_axis": [ 0.692, 0.107, -0.714 ], "z_axis": [ -0.278, 0.952, -0.127 ], "quaternion": [ 0.641, -0.649, -0.377, -0.158 ] } }, { "index": 33, "nt1": "///T/7", "nt2": "///W/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -142.104, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.041, "chi2": -131.117, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.172, "C1C1_dist": 10.587, "N1N9_dist": 8.905, "C6C8_dist": 9.841, "CNNC_torsion": -2.812, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.89]", "interBase_angle": 8.176, "planarity": 0.107, "simple_Shear": 0.522, "simple_Stretch": -0.079, "simple_Buckle": -1.967, "simple_Propeller": -7.936, "bp_simpleParams": [ 0.522, -0.079, -0.255, -1.967, -7.936, -0.365 ], "bp_params": [ 0.516, -0.109, -0.255, -2.417, -7.811, -0.366 ], "frame": { "rmsd": null, "origin": [ 39.083, -7.954, 142.388 ], "x_axis": [ 0.956, 0.281, 0.088 ], "y_axis": [ 0.121, -0.104, -0.987 ], "z_axis": [ -0.268, 0.954, -0.133 ], "quaternion": [ 0.655, -0.740, -0.136, 0.061 ] } }, { "index": 34, "nt1": "///T/8", "nt2": "///W/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.301, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.893, "chi2": -90.322, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.029, "C1C1_dist": 10.850, "N1N9_dist": 9.101, "C6C8_dist": 9.941, "CNNC_torsion": -3.590, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.97]", "interBase_angle": 5.741, "planarity": 0.091, "simple_Shear": 0.385, "simple_Stretch": -0.003, "simple_Buckle": 0.633, "simple_Propeller": -5.706, "bp_simpleParams": [ 0.385, -0.003, -0.253, 0.633, -5.706, -4.813 ], "bp_params": [ 0.384, -0.019, -0.253, 0.390, -5.728, -4.818 ], "frame": { "rmsd": null, "origin": [ 37.412, -5.195, 142.387 ], "x_axis": [ 0.789, 0.233, -0.569 ], "y_axis": [ -0.494, -0.310, -0.812 ], "z_axis": [ -0.366, 0.922, -0.130 ], "quaternion": [ 0.581, -0.746, 0.088, 0.313 ] } }, { "index": 35, "nt1": "///T/9", "nt2": "///W/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.903, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.225, "chi2": -108.582, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.416, "C1C1_dist": 10.182, "N1N9_dist": 8.671, "C6C8_dist": 9.834, "CNNC_torsion": -18.013, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[3.30]", "interBase_angle": 7.019, "planarity": 0.112, "simple_Shear": -0.718, "simple_Stretch": -0.044, "simple_Buckle": -2.424, "simple_Propeller": -6.587, "bp_simpleParams": [ -0.718, -0.044, 0.218, -2.424, -6.587, 9.852 ], "bp_params": [ -0.712, -0.100, 0.218, -1.899, -6.757, 9.868 ], "frame": { "rmsd": null, "origin": [ 36.488, -1.947, 141.957 ], "x_axis": [ 0.403, 0.128, -0.906 ], "y_axis": [ -0.791, -0.448, -0.416 ], "z_axis": [ -0.459, 0.885, -0.079 ], "quaternion": [ -0.468, 0.695, -0.239, -0.491 ] } }, { "index": 36, "nt1": "///T/10", "nt2": "///W/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.951, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.465, "chi2": -129.858, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.135, "C1C1_dist": 10.684, "N1N9_dist": 8.996, "C6C8_dist": 9.907, "CNNC_torsion": -3.556, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.04],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 4.704, "planarity": 0.084, "simple_Shear": 0.495, "simple_Stretch": -0.019, "simple_Buckle": 2.239, "simple_Propeller": -4.136, "bp_simpleParams": [ 0.495, -0.019, 0.035, 2.239, -4.136, -1.584 ], "bp_params": [ 0.494, -0.042, 0.035, 2.049, -4.234, -1.585 ], "frame": { "rmsd": null, "origin": [ 35.414, 1.067, 142.240 ], "x_axis": [ -0.310, -0.108, -0.944 ], "y_axis": [ -0.852, -0.409, 0.327 ], "z_axis": [ -0.422, 0.906, 0.035 ], "quaternion": [ 0.281, -0.516, 0.465, 0.662 ] } }, { "index": 37, "nt1": "///T/11", "nt2": "///W/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.486, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.419, "chi2": -150.653, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.102, "C1C1_dist": 10.814, "N1N9_dist": 9.000, "C6C8_dist": 9.839, "CNNC_torsion": -5.783, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 5.021, "planarity": 0.078, "simple_Shear": -0.590, "simple_Stretch": -0.082, "simple_Buckle": 2.225, "simple_Propeller": -4.501, "bp_simpleParams": [ -0.590, -0.082, -0.154, 2.225, -4.501, -4.055 ], "bp_params": [ -0.584, -0.119, -0.154, 2.508, -4.350, -4.057 ], "frame": { "rmsd": null, "origin": [ 34.143, 4.101, 141.469 ], "x_axis": [ -0.764, -0.240, -0.599 ], "y_axis": [ -0.547, -0.252, 0.799 ], "z_axis": [ -0.342, 0.938, 0.061 ], "quaternion": [ 0.106, -0.326, 0.602, 0.721 ] } }, { "index": 38, "nt1": "///T/12", "nt2": "///W/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.737, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.363, "chi2": -112.937, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.394, "C1C1_dist": 10.426, "N1N9_dist": 8.770, "C6C8_dist": 9.742, "CNNC_torsion": 12.036, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.58],N3-N1(imino)[2.71],N4(amino)-O6(carbonyl)[2.70]", "interBase_angle": 2.262, "planarity": 0.073, "simple_Shear": -0.170, "simple_Stretch": -0.282, "simple_Buckle": 1.878, "simple_Propeller": -1.262, "bp_simpleParams": [ -0.170, -0.282, -0.235, 1.878, -1.262, 1.152 ], "bp_params": [ -0.164, -0.286, -0.235, 1.905, -1.221, 1.152 ], "frame": { "rmsd": null, "origin": [ 33.255, 7.276, 140.758 ], "x_axis": [ -0.909, -0.400, -0.116 ], "y_axis": [ -0.079, -0.106, 0.991 ], "z_axis": [ -0.409, 0.910, 0.065 ], "quaternion": [ -0.111, -0.182, 0.659, 0.721 ] } }, { "index": 39, "nt1": "///T/13", "nt2": "///W/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.908, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.846, "chi2": -104.340, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.920, "C1C1_dist": 10.535, "N1N9_dist": 8.743, "C6C8_dist": 9.584, "CNNC_torsion": -1.026, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 2.979, "planarity": 0.043, "simple_Shear": 0.863, "simple_Stretch": -0.406, "simple_Buckle": -1.672, "simple_Propeller": -2.466, "bp_simpleParams": [ 0.863, -0.406, 0.109, -1.672, -2.466, -3.477 ], "bp_params": [ 0.827, -0.476, 0.109, -1.870, -2.319, -3.477 ], "frame": { "rmsd": null, "origin": [ 32.273, 10.678, 140.226 ], "x_axis": [ -0.744, -0.413, 0.525 ], "y_axis": [ 0.503, 0.170, 0.847 ], "z_axis": [ -0.440, 0.895, 0.081 ], "quaternion": [ -0.356, 0.033, 0.677, 0.643 ] } }, { "index": 40, "nt1": "///T/14", "nt2": "///W/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.786, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.066, "chi2": -110.094, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.368, "C1C1_dist": 11.160, "N1N9_dist": 9.300, "C6C8_dist": 9.997, "CNNC_torsion": 14.859, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[3.18]", "interBase_angle": 5.935, "planarity": 0.106, "simple_Shear": 0.105, "simple_Stretch": 0.106, "simple_Buckle": -5.712, "simple_Propeller": -1.610, "bp_simpleParams": [ 0.105, 0.106, -0.426, -5.712, -1.610, -11.236 ], "bp_params": [ 0.106, 0.105, -0.426, -5.735, -1.526, -11.223 ], "frame": { "rmsd": null, "origin": [ 30.815, 13.848, 140.562 ], "x_axis": [ -0.253, -0.357, 0.899 ], "y_axis": [ 0.801, 0.444, 0.402 ], "z_axis": [ -0.543, 0.822, 0.174 ], "quaternion": [ 0.584, -0.180, -0.617, -0.496 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 5, "strand1": "TGGAAATTCCTCAATGGAAATTCCTCAATGGAAATTCCTC", "strand2": "ACCTTTAAGGAGTTACCTTTAAGGAGTTACCTTTAAGGAG", "bp_type": "||||||||||||||||||||||||||||||||||||||||", "helix_form": "BBBBBBB..BBx.xBB.BBBBB.BBx.xBB.BBBBBBBB", "helical_rise": 2.985, "helical_rise_std": 0.943, "helical_radius": 11.538, "helical_radius_std": 6.021, "helical_axis": [ -0.003, -0.999, -0.049 ], "point1": [ 33.518, 95.752, 152.995 ], "point2": [ 33.132, -20.761, 147.332 ], "num_pairs": 40, "pairs": [ { "index": 1, "nt1": "///Y/3", "nt2": "///X/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, -0.348, -0.072, -6.188, -7.152, 5.276 ], "step_params": [ -0.642, 0.596, 3.194, -2.061, 4.491, 39.451 ], "heli_params": [ 0.359, 0.706, 3.268, 6.622, 3.038, 39.747 ], "bp2_params": [ -0.495, -0.244, -0.003, -2.102, -2.202, -2.380 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.194, "simple_Twist": 40.529, "simple_hRise": 3.266, "simple_hTwist": 40.816 }, { "index": 2, "nt1": "///Y/4", "nt2": "///X/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.495, -0.244, -0.003, -2.102, -2.202, -2.380 ], "step_params": [ 0.759, -0.521, 3.281, -0.360, 3.747, 32.879 ], "heli_params": [ -1.544, -1.394, 3.196, 6.594, 0.633, 33.088 ], "bp2_params": [ -0.139, -0.052, -0.225, -0.466, -5.553, 7.352 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.281, "simple_Twist": 31.167, "simple_hRise": 3.190, "simple_hTwist": 31.388 }, { "index": 3, "nt1": "///Y/5", "nt2": "///X/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.139, -0.052, -0.225, -0.466, -5.553, 7.352 ], "step_params": [ -0.098, -0.588, 3.223, 0.801, -0.107, 32.875 ], "heli_params": [ -1.021, 0.307, 3.222, -0.190, -1.416, 32.884 ], "bp2_params": [ 0.388, -0.115, -0.289, 1.941, -5.151, -2.583 ], "groove_widths": [ 11.109, null, 19.462, null ], "simple_Rise": 3.223, "simple_Twist": 29.950, "simple_hRise": 3.221, "simple_hTwist": 29.960 }, { "index": 4, "nt1": "///Y/6", "nt2": "///X/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.388, -0.115, -0.289, 1.941, -5.151, -2.583 ], "step_params": [ -0.234, -0.218, 3.283, 0.810, -3.410, 37.484 ], "heli_params": [ 0.108, 0.468, 3.284, -5.293, -1.257, 37.641 ], "bp2_params": [ 0.015, -0.177, -0.214, 1.416, -10.829, 2.991 ], "groove_widths": [ 9.187, 9.187, 20.277, 20.133 ], "simple_Rise": 3.283, "simple_Twist": 39.482, "simple_hRise": 3.285, "simple_hTwist": 39.631 }, { "index": 5, "nt1": "///Y/7", "nt2": "///X/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.177, -0.214, 1.416, -10.829, 2.991 ], "step_params": [ -0.211, -0.130, 3.249, -2.915, -6.865, 40.054 ], "heli_params": [ 0.572, -0.019, 3.234, -9.918, 4.212, 40.714 ], "bp2_params": [ 0.384, -0.089, 0.146, 3.488, -13.189, -3.314 ], "groove_widths": [ 9.026, 9.023, 17.978, 17.896 ], "simple_Rise": 3.249, "simple_Twist": 38.094, "simple_hRise": 3.230, "simple_hTwist": 38.790 }, { "index": 6, "nt1": "///Y/8", "nt2": "///X/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.384, -0.089, 0.146, 3.488, -13.189, -3.314 ], "step_params": [ 0.505, -0.580, 3.302, 2.852, -3.619, 33.769 ], "heli_params": [ -0.400, -0.397, 3.374, -6.193, -4.882, 34.073 ], "bp2_params": [ -0.046, 0.103, -0.094, 2.796, -3.936, -1.747 ], "groove_widths": [ 9.073, 9.069, 17.911, 17.876 ], "simple_Rise": 3.302, "simple_Twist": 36.155, "simple_hRise": 3.371, "simple_hTwist": 36.438 }, { "index": 7, "nt1": "///Y/9", "nt2": "///X/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, 0.103, -0.094, 2.796, -3.936, -1.747 ], "step_params": [ 0.438, -0.110, 3.247, 1.621, -3.889, 38.659 ], "heli_params": [ 0.306, -0.462, 3.258, -5.853, -2.439, 38.880 ], "bp2_params": [ 0.064, 0.084, 0.148, 3.213, -8.883, 1.210 ], "groove_widths": [ 9.368, 9.355, 20.324, 20.082 ], "simple_Rise": 3.247, "simple_Twist": 38.235, "simple_hRise": 3.258, "simple_hTwist": 38.458 }, { "index": 8, "nt1": "///Y/10", "nt2": "///X/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.064, 0.084, 0.148, 3.213, -8.883, 1.210 ], "step_params": [ -0.465, -1.237, 3.095, 1.284, 2.981, 32.211 ], "heli_params": [ -2.707, 1.044, 2.952, 5.357, -2.308, 32.370 ], "bp2_params": [ 0.025, -0.200, -0.321, 4.903, -4.439, -0.379 ], "groove_widths": [ 11.090, 11.054, 19.308, 19.287 ], "simple_Rise": 3.095, "simple_Twist": 32.043, "simple_hRise": 2.951, "simple_hTwist": 32.203 }, { "index": 9, "nt1": "///Y/11", "nt2": "///X/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.200, -0.321, 4.903, -4.439, -0.379 ], "step_params": [ -0.496, -1.019, 3.578, -3.719, 4.829, 32.068 ], "heli_params": [ -2.720, 0.185, 3.427, 8.643, 6.657, 32.627 ], "bp2_params": [ 0.176, -0.107, 0.073, -1.102, 0.384, -1.531 ], "groove_widths": [ 12.474, null, 20.122, 20.118 ], "simple_Rise": 3.578, "simple_Twist": 31.399, "simple_hRise": 3.422, "simple_hTwist": 31.970 }, { "index": 10, "nt1": "///Y/12", "nt2": "///X/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.107, 0.073, -1.102, 0.384, -1.531 ], "step_params": [ 0.722, -0.603, 3.352, -0.884, 1.609, 38.194 ], "heli_params": [ -1.126, -1.216, 3.308, 2.457, 1.350, 38.236 ], "bp2_params": [ 0.007, -0.113, 0.202, -0.138, -1.451, -2.654 ], "groove_widths": [ null, null, 21.728, 21.296 ], "simple_Rise": 3.352, "simple_Twist": 38.874, "simple_hRise": 3.309, "simple_hTwist": 38.915 }, { "index": 11, "nt1": "///Y/13", "nt2": "///X/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.113, 0.202, -0.138, -1.451, -2.654 ], "step_params": [ -0.047, -0.199, 3.059, 1.950, 6.461, 25.149 ], "heli_params": [ -2.088, 0.601, 2.906, 14.507, -4.379, 26.025 ], "bp2_params": [ 0.186, 0.042, -0.104, 3.234, -0.003, 7.742 ], "groove_widths": [ null, null, 19.748, null ], "simple_Rise": 3.059, "simple_Twist": 24.078, "simple_hRise": 2.895, "simple_hTwist": 24.992 }, { "index": 12, "nt1": "///Y/14", "nt2": "///X/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, 0.042, -0.104, 3.234, -0.003, 7.742 ], "step_params": [ -0.523, -0.522, 3.390, -5.868, 6.297, 35.532 ], "heli_params": [ -1.734, -0.006, 3.295, 10.136, 9.446, 36.527 ], "bp2_params": [ 0.571, -0.352, 0.608, -1.383, -5.798, 16.536 ], "groove_widths": [ 12.560, null, null, null ], "simple_Rise": 3.390, "simple_Twist": 33.692, "simple_hRise": 3.284, "simple_hTwist": 34.743 }, { "index": 13, "nt1": "///Z/1", "nt2": "///X/2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, -0.352, 0.608, -1.383, -5.798, 16.536 ], "step_params": [ -0.233, -1.200, 3.266, 5.783, 10.104, 31.745 ], "heli_params": [ -3.605, 1.282, 2.687, 17.743, -10.155, 33.761 ], "bp2_params": [ 0.002, -0.275, 0.056, -4.469, -5.175, 4.322 ], "groove_widths": [ 12.759, 11.440, 19.109, null ], "simple_Rise": 3.266, "simple_Twist": 34.889, "simple_hRise": 2.752, "simple_hTwist": 36.723 }, { "index": 14, "nt1": "///Z/2", "nt2": "///X/1", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.002, -0.275, 0.056, -4.469, -5.175, 4.322 ], "step_params": [ 0.070, -0.710, 3.264, 0.954, 1.861, 23.252 ], "heli_params": [ -2.384, 0.150, 3.198, 4.604, -2.361, 23.345 ], "bp2_params": [ -0.276, -0.055, -0.016, -3.154, -1.276, 0.522 ], "groove_widths": [ 13.166, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 24.409, "simple_hRise": 3.202, "simple_hTwist": 24.497 }, { "index": 15, "nt1": "///Z/3", "nt2": "///V/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, -0.055, -0.016, -3.154, -1.276, 0.522 ], "step_params": [ -0.514, 0.190, 3.392, 1.294, 6.408, 35.102 ], "heli_params": [ -0.654, 1.034, 3.353, 10.512, -2.123, 35.687 ], "bp2_params": [ -0.117, -0.231, 0.039, 0.636, -1.816, -1.019 ], "groove_widths": [ null, null, 21.740, null ], "simple_Rise": 3.392, "simple_Twist": 34.775, "simple_hRise": 3.352, "simple_hTwist": 35.366 }, { "index": 16, "nt1": "///Z/4", "nt2": "///V/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.231, 0.039, 0.636, -1.816, -1.019 ], "step_params": [ 0.439, -0.501, 3.429, 2.496, 4.058, 33.608 ], "heli_params": [ -1.537, -0.333, 3.371, 6.975, -4.290, 33.935 ], "bp2_params": [ -0.250, -0.152, -0.297, -2.236, -6.670, -0.957 ], "groove_widths": [ null, null, 20.108, 20.100 ], "simple_Rise": 3.429, "simple_Twist": 34.136, "simple_hRise": 3.372, "simple_hTwist": 34.457 }, { "index": 17, "nt1": "///Z/5", "nt2": "///V/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.250, -0.152, -0.297, -2.236, -6.670, -0.957 ], "step_params": [ 0.442, -1.137, 3.143, -2.201, 3.673, 28.843 ], "heli_params": [ -3.007, -1.327, 2.938, 7.322, 4.388, 29.153 ], "bp2_params": [ 0.098, 0.027, -0.000, -0.778, -5.085, -2.691 ], "groove_widths": [ 10.946, null, 19.137, 19.134 ], "simple_Rise": 3.143, "simple_Twist": 27.007, "simple_hRise": 2.921, "simple_hTwist": 27.338 }, { "index": 18, "nt1": "///Z/6", "nt2": "///V/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.098, 0.027, -0.000, -0.778, -5.085, -2.691 ], "step_params": [ -0.765, -0.016, 3.174, -0.095, -5.134, 41.753 ], "heli_params": [ 0.494, 1.057, 3.155, -7.170, 0.133, 42.054 ], "bp2_params": [ -0.025, -0.286, -0.169, -1.134, -5.307, -2.407 ], "groove_widths": [ 9.244, 9.235, 19.674, 19.555 ], "simple_Rise": 3.174, "simple_Twist": 42.030, "simple_hRise": 3.156, "simple_hTwist": 42.328 }, { "index": 19, "nt1": "///Z/7", "nt2": "///V/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.286, -0.169, -1.134, -5.307, -2.407 ], "step_params": [ -0.041, -0.335, 3.302, -1.810, -6.407, 38.009 ], "heli_params": [ 0.299, -0.166, 3.312, -9.746, 2.753, 38.567 ], "bp2_params": [ 0.233, -0.129, -0.132, 1.546, -6.605, 4.025 ], "groove_widths": [ 9.193, 9.178, 18.185, 18.150 ], "simple_Rise": 3.302, "simple_Twist": 36.952, "simple_hRise": 3.310, "simple_hTwist": 37.526 }, { "index": 20, "nt1": "///Z/8", "nt2": "///V/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.233, -0.129, -0.132, 1.546, -6.605, 4.025 ], "step_params": [ 0.074, -0.352, 3.400, 2.564, -5.773, 33.224 ], "heli_params": [ 0.375, 0.307, 3.408, -9.984, -4.434, 33.803 ], "bp2_params": [ -0.203, -0.020, -0.154, 0.193, -4.735, 2.454 ], "groove_widths": [ 9.281, 9.264, 18.498, 18.354 ], "simple_Rise": 3.400, "simple_Twist": 35.496, "simple_hRise": 3.411, "simple_hTwist": 36.036 }, { "index": 21, "nt1": "///Z/9", "nt2": "///V/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.203, -0.020, -0.154, 0.193, -4.735, 2.454 ], "step_params": [ 0.642, -0.418, 3.231, -2.581, -1.524, 42.190 ], "heli_params": [ -0.426, -1.150, 3.201, -2.115, 3.581, 42.291 ], "bp2_params": [ 0.030, -0.123, 0.137, -0.333, -7.434, 2.296 ], "groove_widths": [ 9.300, 9.287, 20.635, 20.468 ], "simple_Rise": 3.231, "simple_Twist": 40.633, "simple_hRise": 3.199, "simple_hTwist": 40.738 }, { "index": 22, "nt1": "///Z/10", "nt2": "///V/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.030, -0.123, 0.137, -0.333, -7.434, 2.296 ], "step_params": [ -0.605, -0.832, 3.222, -0.195, -0.739, 30.297 ], "heli_params": [ -1.443, 1.118, 3.245, -1.414, 0.373, 30.306 ], "bp2_params": [ 0.187, -0.103, -0.062, 0.336, -3.185, -0.687 ], "groove_widths": [ 10.991, 10.937, 19.204, 19.185 ], "simple_Rise": 3.222, "simple_Twist": 29.746, "simple_hRise": 3.245, "simple_hTwist": 29.756 }, { "index": 23, "nt1": "///Z/11", "nt2": "///V/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.187, -0.103, -0.062, 0.336, -3.185, -0.687 ], "step_params": [ -0.412, -1.042, 3.264, 0.368, 3.196, 30.409 ], "heli_params": [ -2.597, 0.854, 3.136, 6.072, -0.699, 30.575 ], "bp2_params": [ 0.274, -0.159, -0.106, 0.919, -3.142, 1.654 ], "groove_widths": [ 12.487, null, 20.196, 20.195 ], "simple_Rise": 3.264, "simple_Twist": 30.090, "simple_hRise": 3.134, "simple_hTwist": 30.257 }, { "index": 24, "nt1": "///Z/12", "nt2": "///V/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.274, -0.159, -0.106, 0.919, -3.142, 1.654 ], "step_params": [ 0.205, -0.037, 3.415, 0.176, 2.807, 35.756 ], "heli_params": [ -0.479, -0.306, 3.403, 4.564, -0.286, 35.863 ], "bp2_params": [ -0.187, -0.374, -0.122, 1.710, -0.007, -5.896 ], "groove_widths": [ null, null, 21.330, 19.790 ], "simple_Rise": 3.415, "simple_Twist": 38.100, "simple_hRise": 3.405, "simple_hTwist": 38.200 }, { "index": 25, "nt1": "///Z/13", "nt2": "///V/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.374, -0.122, 1.710, -0.007, -5.896 ], "step_params": [ 0.401, -0.314, 3.234, 1.464, 6.805, 24.697 ], "heli_params": [ -2.592, -0.499, 3.057, 15.520, -3.338, 25.645 ], "bp2_params": [ 0.232, -0.012, -0.134, 1.947, 1.110, 3.804 ], "groove_widths": [ null, null, 17.696, null ], "simple_Rise": 3.234, "simple_Twist": 22.237, "simple_hRise": 3.024, "simple_hTwist": 23.288 }, { "index": 26, "nt1": "///Z/14", "nt2": "///V/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.232, -0.012, -0.134, 1.947, 1.110, 3.804 ], "step_params": [ 0.113, -0.374, 3.128, -6.408, 13.547, 40.128 ], "heli_params": [ -1.791, -0.759, 2.816, 18.962, 8.969, 42.727 ], "bp2_params": [ 0.387, -0.325, 0.579, -0.026, -7.102, 20.278 ], "groove_widths": [ 12.708, null, null, null ], "simple_Rise": 3.128, "simple_Twist": 39.293, "simple_hRise": 2.806, "simple_hTwist": 41.948 }, { "index": 27, "nt1": "///W/1", "nt2": "///V/2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.387, -0.325, 0.579, -0.026, -7.102, 20.278 ], "step_params": [ -0.460, -0.910, 3.403, 7.097, 3.048, 30.593 ], "heli_params": [ -2.249, 2.184, 3.118, 5.665, -13.188, 31.530 ], "bp2_params": [ 0.030, -0.134, -0.124, -3.557, -3.028, 3.318 ], "groove_widths": [ 12.512, 11.160, 18.636, null ], "simple_Rise": 3.403, "simple_Twist": 33.133, "simple_hRise": 3.147, "simple_hTwist": 33.997 }, { "index": 28, "nt1": "///W/2", "nt2": "///V/1", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.030, -0.134, -0.124, -3.557, -3.028, 3.318 ], "step_params": [ -0.056, -0.894, 3.046, 3.584, 4.307, 24.872 ], "heli_params": [ -3.145, 1.057, 2.818, 9.842, -8.189, 25.485 ], "bp2_params": [ -0.106, 0.105, -0.426, 5.735, -1.526, -11.223 ], "groove_widths": [ 13.423, null, null, null ], "simple_Rise": 3.046, "simple_Twist": 25.311, "simple_hRise": 2.823, "simple_hTwist": 25.914 }, { "index": 29, "nt1": "///W/3", "nt2": "///T/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, 0.105, -0.426, 5.735, -1.526, -11.223 ], "step_params": [ 0.287, 0.161, 3.490, -1.908, 8.768, 35.082 ], "heli_params": [ -1.064, -0.751, 3.411, 14.259, 3.102, 36.176 ], "bp2_params": [ -0.827, -0.476, 0.109, 1.870, -2.319, -3.477 ], "groove_widths": [ null, null, 21.424, null ], "simple_Rise": 3.490, "simple_Twist": 39.079, "simple_hRise": 3.429, "simple_hTwist": 40.057 }, { "index": 30, "nt1": "///W/4", "nt2": "///T/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.827, -0.476, 0.109, 1.870, -2.319, -3.477 ], "step_params": [ 0.716, -0.645, 3.449, 0.485, 2.119, 38.562 ], "heli_params": [ -1.249, -1.020, 3.418, 3.206, -0.733, 38.621 ], "bp2_params": [ 0.164, -0.286, -0.235, -1.905, -1.221, 1.152 ], "groove_widths": [ null, null, 20.250, 20.245 ], "simple_Rise": 3.449, "simple_Twist": 32.854, "simple_hRise": 3.411, "simple_hTwist": 32.924 }, { "index": 31, "nt1": "///W/5", "nt2": "///T/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.286, -0.235, -1.905, -1.221, 1.152 ], "step_params": [ 0.007, -0.989, 3.224, 1.732, 3.771, 30.458 ], "heli_params": [ -2.581, 0.315, 3.078, 7.135, -3.278, 30.732 ], "bp2_params": [ 0.584, -0.119, -0.154, -2.508, -4.350, -4.057 ], "groove_widths": [ 10.635, null, 19.198, 19.164 ], "simple_Rise": 3.224, "simple_Twist": 28.160, "simple_hRise": 3.063, "simple_hTwist": 28.458 }, { "index": 32, "nt1": "///W/6", "nt2": "///T/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.584, -0.119, -0.154, -2.508, -4.350, -4.057 ], "step_params": [ -0.757, -0.536, 3.249, -3.063, -4.119, 33.816 ], "heli_params": [ -0.253, 0.798, 3.342, -7.030, 5.228, 34.192 ], "bp2_params": [ -0.494, -0.042, 0.035, -2.049, -4.234, -1.585 ], "groove_widths": [ 9.255, 9.243, 20.158, 20.001 ], "simple_Rise": 3.249, "simple_Twist": 39.730, "simple_hRise": 3.332, "simple_hTwist": 40.047 }, { "index": 33, "nt1": "///W/7", "nt2": "///T/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.494, -0.042, 0.035, -2.049, -4.234, -1.585 ], "step_params": [ 0.336, -0.384, 3.172, -2.788, -6.406, 43.782 ], "heli_params": [ 0.072, -0.699, 3.168, -8.525, 3.711, 44.309 ], "bp2_params": [ 0.712, -0.100, 0.218, 1.899, -6.757, 9.868 ], "groove_widths": [ 9.149, 9.147, 17.670, 17.644 ], "simple_Rise": 3.172, "simple_Twist": 37.017, "simple_hRise": 3.159, "simple_hTwist": 37.648 }, { "index": 34, "nt1": "///W/8", "nt2": "///T/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.712, -0.100, 0.218, 1.899, -6.757, 9.868 ], "step_params": [ -0.386, -0.341, 3.364, 2.576, -5.905, 29.728 ], "heli_params": [ 0.573, 1.269, 3.324, -11.343, -4.948, 30.403 ], "bp2_params": [ -0.384, -0.019, -0.253, -0.390, -5.728, -4.818 ], "groove_widths": [ 8.950, 8.945, 18.576, 18.525 ], "simple_Rise": 3.364, "simple_Twist": 35.968, "simple_hRise": 3.342, "simple_hTwist": 36.522 }, { "index": 35, "nt1": "///W/9", "nt2": "///T/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.384, -0.019, -0.253, -0.390, -5.728, -4.818 ], "step_params": [ 0.783, -0.219, 3.122, 1.309, -5.750, 39.333 ], "heli_params": [ 0.322, -1.005, 3.145, -8.484, -1.931, 39.755 ], "bp2_params": [ -0.516, -0.109, -0.255, 2.417, -7.811, -0.366 ], "groove_widths": [ 9.094, 9.089, 20.312, 20.199 ], "simple_Rise": 3.122, "simple_Twist": 40.321, "simple_hRise": 3.146, "simple_hTwist": 40.732 }, { "index": 36, "nt1": "///W/10", "nt2": "///T/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.516, -0.109, -0.255, 2.417, -7.811, -0.366 ], "step_params": [ 0.257, -0.468, 3.386, 0.570, 0.339, 38.972 ], "heli_params": [ -0.744, -0.314, 3.385, 0.508, -0.854, 38.978 ], "bp2_params": [ 0.970, 0.056, -0.235, 3.089, -1.513, 12.077 ], "groove_widths": [ 11.043, 10.992, 18.994, 18.972 ], "simple_Rise": 3.386, "simple_Twist": 30.375, "simple_hRise": 3.385, "simple_hTwist": 30.382 }, { "index": 37, "nt1": "///W/11", "nt2": "///T/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.970, 0.056, -0.235, 3.089, -1.513, 12.077 ], "step_params": [ -0.795, -0.367, 3.369, 0.347, 6.002, 29.620 ], "heli_params": [ -1.944, 1.597, 3.224, 11.590, -0.670, 30.210 ], "bp2_params": [ 0.496, -0.121, -0.092, -0.281, -0.261, 3.870 ], "groove_widths": [ 12.832, null, 20.629, null ], "simple_Rise": 3.369, "simple_Twist": 32.373, "simple_hRise": 3.242, "simple_hTwist": 32.911 }, { "index": 38, "nt1": "///W/12", "nt2": "///T/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.496, -0.121, -0.092, -0.281, -0.261, 3.870 ], "step_params": [ 0.358, -0.336, 3.441, -1.086, 7.628, 30.553 ], "heli_params": [ -2.099, -0.870, 3.250, 14.194, 2.021, 31.487 ], "bp2_params": [ -0.122, -0.220, -0.031, 1.614, -3.008, -0.943 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.441, "simple_Twist": 34.140, "simple_hRise": 3.280, "simple_hTwist": 34.973 }, { "index": 39, "nt1": "///W/13", "nt2": "///T/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.122, -0.220, -0.031, 1.614, -3.008, -0.943 ], "step_params": [ -0.202, -0.190, 3.154, -1.184, 8.057, 31.327 ], "heli_params": [ -1.707, 0.162, 3.018, 14.613, 2.147, 32.342 ], "bp2_params": [ 0.705, 0.306, 0.108, 1.469, -1.245, 5.326 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 26.469, "simple_hRise": 2.973, "simple_hTwist": 27.672 }, { "index": 40, "nt1": "///W/14", "nt2": "///T/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "TT", "strand2": "AA", "bp_type": "||", "helix_form": ".", "helical_rise": 3.040, "helical_rise_std": 0.053, "helical_radius": 10.922, "helical_radius_std": 0.698, "helical_axis": [ 0.232, 0.955, 0.183 ], "point1": [ 31.420, 57.151, 157.574 ], "point2": [ 32.127, 60.060, 158.131 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///X/1", "nt2": "///Z/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.002, -0.275, 0.056, 4.469, -5.175, 4.322 ], "step_params": [ 0.233, -1.200, 3.266, -5.783, 10.104, 31.745 ], "heli_params": [ -3.605, -1.282, 2.687, 17.743, 10.155, 33.761 ], "bp2_params": [ -0.571, -0.352, 0.608, 1.383, -5.798, 16.536 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.266, "simple_Twist": 34.889, "simple_hRise": 2.752, "simple_hTwist": 36.723 }, { "index": 2, "nt1": "///X/2", "nt2": "///Z/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GAGGAATTTCCA", "strand2": "CTCCTTAAAGGT", "bp_type": "||||||||||||", "helix_form": "BB..BBBBBBB", "helical_rise": 3.391, "helical_rise_std": 0.410, "helical_radius": 9.707, "helical_radius_std": 0.607, "helical_axis": [ 0.295, 0.926, -0.236 ], "point1": [ 34.314, 60.638, 160.368 ], "point2": [ 45.431, 95.508, 151.462 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///X/3", "nt2": "///Y/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.186, 0.042, -0.104, -3.234, -0.003, 7.742 ], "step_params": [ 0.047, -0.199, 3.059, -1.950, 6.461, 25.149 ], "heli_params": [ -2.088, -0.601, 2.906, 14.507, 4.379, 26.025 ], "bp2_params": [ -0.007, -0.113, 0.202, 0.138, -1.451, -2.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.059, "simple_Twist": 24.078, "simple_hRise": 2.895, "simple_hTwist": 24.992 }, { "index": 2, "nt1": "///X/4", "nt2": "///Y/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.113, 0.202, 0.138, -1.451, -2.654 ], "step_params": [ -0.722, -0.603, 3.352, 0.884, 1.609, 38.194 ], "heli_params": [ -1.126, 1.216, 3.308, 2.457, -1.350, 38.236 ], "bp2_params": [ -0.176, -0.107, 0.073, 1.102, 0.384, -1.531 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.352, "simple_Twist": 38.874, "simple_hRise": 3.309, "simple_hTwist": 38.915 }, { "index": 3, "nt1": "///X/5", "nt2": "///Y/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, -0.107, 0.073, 1.102, 0.384, -1.531 ], "step_params": [ 0.496, -1.019, 3.578, 3.719, 4.829, 32.068 ], "heli_params": [ -2.720, -0.185, 3.427, 8.643, -6.657, 32.627 ], "bp2_params": [ -0.025, -0.200, -0.321, -4.903, -4.439, -0.379 ], "groove_widths": [ 12.474, null, 20.122, null ], "simple_Rise": 3.578, "simple_Twist": 31.399, "simple_hRise": 3.422, "simple_hTwist": 31.970 }, { "index": 4, "nt1": "///X/6", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.200, -0.321, -4.903, -4.439, -0.379 ], "step_params": [ 0.465, -1.237, 3.095, -1.284, 2.981, 32.211 ], "heli_params": [ -2.707, -1.044, 2.952, 5.357, 2.308, 32.370 ], "bp2_params": [ -0.064, 0.084, 0.148, -3.213, -8.883, 1.210 ], "groove_widths": [ 11.090, 11.054, 19.308, 19.287 ], "simple_Rise": 3.095, "simple_Twist": 32.043, "simple_hRise": 2.951, "simple_hTwist": 32.203 }, { "index": 5, "nt1": "///X/7", "nt2": "///Y/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, 0.084, 0.148, -3.213, -8.883, 1.210 ], "step_params": [ -0.438, -0.110, 3.247, -1.621, -3.889, 38.659 ], "heli_params": [ 0.306, 0.462, 3.258, -5.853, 2.439, 38.880 ], "bp2_params": [ 0.046, 0.103, -0.094, -2.796, -3.936, -1.747 ], "groove_widths": [ 9.368, 9.355, 20.324, 20.082 ], "simple_Rise": 3.247, "simple_Twist": 38.235, "simple_hRise": 3.258, "simple_hTwist": 38.458 }, { "index": 6, "nt1": "///X/8", "nt2": "///Y/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, 0.103, -0.094, -2.796, -3.936, -1.747 ], "step_params": [ -0.505, -0.580, 3.302, -2.852, -3.619, 33.769 ], "heli_params": [ -0.400, 0.397, 3.374, -6.193, 4.882, 34.073 ], "bp2_params": [ -0.384, -0.089, 0.146, -3.488, -13.189, -3.314 ], "groove_widths": [ 9.073, 9.069, 17.911, 17.876 ], "simple_Rise": 3.302, "simple_Twist": 36.155, "simple_hRise": 3.371, "simple_hTwist": 36.438 }, { "index": 7, "nt1": "///X/9", "nt2": "///Y/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.384, -0.089, 0.146, -3.488, -13.189, -3.314 ], "step_params": [ 0.211, -0.130, 3.249, 2.915, -6.865, 40.054 ], "heli_params": [ 0.572, 0.019, 3.234, -9.918, -4.212, 40.714 ], "bp2_params": [ -0.015, -0.177, -0.214, -1.416, -10.829, 2.991 ], "groove_widths": [ 9.026, 9.023, 17.978, 17.896 ], "simple_Rise": 3.249, "simple_Twist": 38.094, "simple_hRise": 3.230, "simple_hTwist": 38.790 }, { "index": 8, "nt1": "///X/10", "nt2": "///Y/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.015, -0.177, -0.214, -1.416, -10.829, 2.991 ], "step_params": [ 0.234, -0.218, 3.283, -0.810, -3.410, 37.484 ], "heli_params": [ 0.108, -0.468, 3.284, -5.293, 1.257, 37.641 ], "bp2_params": [ -0.388, -0.115, -0.289, -1.941, -5.151, -2.583 ], "groove_widths": [ 9.187, 9.187, 20.277, 20.133 ], "simple_Rise": 3.283, "simple_Twist": 39.482, "simple_hRise": 3.285, "simple_hTwist": 39.631 }, { "index": 9, "nt1": "///X/11", "nt2": "///Y/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.388, -0.115, -0.289, -1.941, -5.151, -2.583 ], "step_params": [ 0.098, -0.588, 3.223, -0.801, -0.107, 32.875 ], "heli_params": [ -1.021, -0.307, 3.222, -0.190, 1.416, 32.884 ], "bp2_params": [ 0.139, -0.052, -0.225, 0.466, -5.553, 7.352 ], "groove_widths": [ 11.109, null, 19.462, null ], "simple_Rise": 3.223, "simple_Twist": 29.950, "simple_hRise": 3.221, "simple_hTwist": 29.960 }, { "index": 10, "nt1": "///X/12", "nt2": "///Y/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.139, -0.052, -0.225, 0.466, -5.553, 7.352 ], "step_params": [ -0.759, -0.521, 3.281, 0.360, 3.747, 32.879 ], "heli_params": [ -1.544, 1.394, 3.196, 6.594, -0.633, 33.088 ], "bp2_params": [ 0.495, -0.244, -0.003, 2.102, -2.202, -2.380 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.281, "simple_Twist": 31.167, "simple_hRise": 3.190, "simple_hTwist": 31.388 }, { "index": 11, "nt1": "///X/13", "nt2": "///Y/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.495, -0.244, -0.003, 2.102, -2.202, -2.380 ], "step_params": [ 0.642, 0.596, 3.194, 2.061, 4.491, 39.451 ], "heli_params": [ 0.359, -0.706, 3.268, 6.622, -3.038, 39.747 ], "bp2_params": [ 0.276, -0.348, -0.072, 6.188, -7.152, 5.276 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.194, "simple_Twist": 40.529, "simple_hRise": 3.266, "simple_hTwist": 40.816 }, { "index": 12, "nt1": "///X/14", "nt2": "///Y/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "TT", "strand2": "AA", "bp_type": "||", "helix_form": ".", "helical_rise": 3.392, "helical_rise_std": 0.143, "helical_radius": 9.789, "helical_radius_std": 2.209, "helical_axis": [ -0.504, 0.857, 0.111 ], "point1": [ 29.464, 17.075, 142.309 ], "point2": [ 27.746, 19.997, 142.686 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///V/1", "nt2": "///W/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.030, -0.134, -0.124, 3.557, -3.028, 3.318 ], "step_params": [ 0.460, -0.910, 3.403, -7.097, 3.048, 30.593 ], "heli_params": [ -2.249, -2.184, 3.118, 5.665, 13.188, 31.530 ], "bp2_params": [ -0.387, -0.325, 0.579, 0.026, -7.102, 20.278 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.403, "simple_Twist": 33.133, "simple_hRise": 3.147, "simple_hTwist": 33.997 }, { "index": 2, "nt1": "///V/2", "nt2": "///W/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "GAGGAATTTCCA", "strand2": "CTCCTTAAAGGT", "bp_type": "||||||||||||", "helix_form": "BB.BBBBB.BB", "helical_rise": 3.421, "helical_rise_std": 0.425, "helical_radius": 9.619, "helical_radius_std": 0.521, "helical_axis": [ 0.059, 0.926, 0.373 ], "point1": [ 24.562, 19.793, 144.181 ], "point2": [ 26.797, 55.081, 158.383 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///V/3", "nt2": "///Z/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.232, -0.012, -0.134, -1.947, 1.110, 3.804 ], "step_params": [ -0.401, -0.314, 3.234, -1.464, 6.805, 24.697 ], "heli_params": [ -2.592, 0.499, 3.057, 15.520, 3.338, 25.645 ], "bp2_params": [ 0.187, -0.374, -0.122, -1.710, -0.007, -5.896 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.234, "simple_Twist": 22.237, "simple_hRise": 3.024, "simple_hTwist": 23.288 }, { "index": 2, "nt1": "///V/4", "nt2": "///Z/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.187, -0.374, -0.122, -1.710, -0.007, -5.896 ], "step_params": [ -0.205, -0.037, 3.415, -0.176, 2.807, 35.756 ], "heli_params": [ -0.479, 0.306, 3.403, 4.564, 0.286, 35.863 ], "bp2_params": [ -0.274, -0.159, -0.106, -0.919, -3.142, 1.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.415, "simple_Twist": 38.100, "simple_hRise": 3.405, "simple_hTwist": 38.200 }, { "index": 3, "nt1": "///V/5", "nt2": "///Z/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.274, -0.159, -0.106, -0.919, -3.142, 1.654 ], "step_params": [ 0.412, -1.042, 3.264, -0.368, 3.196, 30.409 ], "heli_params": [ -2.597, -0.854, 3.136, 6.072, 0.699, 30.575 ], "bp2_params": [ -0.187, -0.103, -0.062, -0.336, -3.185, -0.687 ], "groove_widths": [ 12.487, null, 20.196, null ], "simple_Rise": 3.264, "simple_Twist": 30.090, "simple_hRise": 3.134, "simple_hTwist": 30.257 }, { "index": 4, "nt1": "///V/6", "nt2": "///Z/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.103, -0.062, -0.336, -3.185, -0.687 ], "step_params": [ 0.605, -0.832, 3.222, 0.195, -0.739, 30.297 ], "heli_params": [ -1.443, -1.118, 3.245, -1.414, -0.373, 30.306 ], "bp2_params": [ -0.030, -0.123, 0.137, 0.333, -7.434, 2.296 ], "groove_widths": [ 10.991, 10.937, 19.204, 19.185 ], "simple_Rise": 3.222, "simple_Twist": 29.746, "simple_hRise": 3.245, "simple_hTwist": 29.756 }, { "index": 5, "nt1": "///V/7", "nt2": "///Z/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.030, -0.123, 0.137, 0.333, -7.434, 2.296 ], "step_params": [ -0.642, -0.418, 3.231, 2.581, -1.524, 42.190 ], "heli_params": [ -0.426, 1.150, 3.201, -2.115, -3.581, 42.291 ], "bp2_params": [ 0.203, -0.020, -0.154, -0.193, -4.735, 2.454 ], "groove_widths": [ 9.300, 9.287, 20.635, 20.468 ], "simple_Rise": 3.231, "simple_Twist": 40.633, "simple_hRise": 3.199, "simple_hTwist": 40.738 }, { "index": 6, "nt1": "///V/8", "nt2": "///Z/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.020, -0.154, -0.193, -4.735, 2.454 ], "step_params": [ -0.074, -0.352, 3.400, -2.564, -5.773, 33.224 ], "heli_params": [ 0.375, -0.307, 3.408, -9.984, 4.434, 33.803 ], "bp2_params": [ -0.233, -0.129, -0.132, -1.546, -6.605, 4.025 ], "groove_widths": [ 9.281, 9.264, 18.498, 18.354 ], "simple_Rise": 3.400, "simple_Twist": 35.496, "simple_hRise": 3.411, "simple_hTwist": 36.036 }, { "index": 7, "nt1": "///V/9", "nt2": "///Z/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.233, -0.129, -0.132, -1.546, -6.605, 4.025 ], "step_params": [ 0.041, -0.335, 3.302, 1.810, -6.407, 38.009 ], "heli_params": [ 0.299, 0.166, 3.312, -9.746, -2.753, 38.567 ], "bp2_params": [ 0.025, -0.286, -0.169, 1.134, -5.307, -2.407 ], "groove_widths": [ 9.193, 9.178, 18.185, 18.150 ], "simple_Rise": 3.302, "simple_Twist": 36.952, "simple_hRise": 3.310, "simple_hTwist": 37.526 }, { "index": 8, "nt1": "///V/10", "nt2": "///Z/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.286, -0.169, 1.134, -5.307, -2.407 ], "step_params": [ 0.765, -0.016, 3.174, 0.095, -5.134, 41.753 ], "heli_params": [ 0.494, -1.057, 3.155, -7.170, -0.133, 42.054 ], "bp2_params": [ -0.098, 0.027, -0.000, 0.778, -5.085, -2.691 ], "groove_widths": [ 9.244, 9.235, 19.674, 19.555 ], "simple_Rise": 3.174, "simple_Twist": 42.030, "simple_hRise": 3.156, "simple_hTwist": 42.328 }, { "index": 9, "nt1": "///V/11", "nt2": "///Z/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.098, 0.027, -0.000, 0.778, -5.085, -2.691 ], "step_params": [ -0.442, -1.137, 3.143, 2.201, 3.673, 28.843 ], "heli_params": [ -3.007, 1.327, 2.938, 7.322, -4.388, 29.153 ], "bp2_params": [ 0.250, -0.152, -0.297, 2.236, -6.670, -0.957 ], "groove_widths": [ 10.946, null, 19.137, null ], "simple_Rise": 3.143, "simple_Twist": 27.007, "simple_hRise": 2.921, "simple_hTwist": 27.338 }, { "index": 10, "nt1": "///V/12", "nt2": "///Z/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.250, -0.152, -0.297, 2.236, -6.670, -0.957 ], "step_params": [ -0.439, -0.501, 3.429, -2.496, 4.058, 33.608 ], "heli_params": [ -1.537, 0.333, 3.371, 6.975, 4.290, 33.935 ], "bp2_params": [ 0.117, -0.231, 0.039, -0.636, -1.816, -1.019 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.429, "simple_Twist": 34.136, "simple_hRise": 3.372, "simple_hTwist": 34.457 }, { "index": 11, "nt1": "///V/13", "nt2": "///Z/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.231, 0.039, -0.636, -1.816, -1.019 ], "step_params": [ 0.514, 0.190, 3.392, -1.294, 6.408, 35.102 ], "heli_params": [ -0.654, -1.034, 3.353, 10.512, 2.123, 35.687 ], "bp2_params": [ 0.276, -0.055, -0.016, 3.154, -1.276, 0.522 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.392, "simple_Twist": 34.775, "simple_hRise": 3.352, "simple_hTwist": 35.366 }, { "index": 12, "nt1": "///V/14", "nt2": "///Z/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 1, "strand1": "GAGGAATTTCCA", "strand2": "CTCCTTAAAGGT", "bp_type": "||||||||||||", "helix_form": "BB.BBBBB.BB", "helical_rise": 3.419, "helical_rise_std": 0.418, "helical_radius": 9.647, "helical_radius_std": 0.498, "helical_axis": [ -0.379, 0.922, -0.082 ], "point1": [ 44.533, -21.168, 143.455 ], "point2": [ 30.131, 13.866, 140.326 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///T/3", "nt2": "///W/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.705, 0.306, 0.108, -1.469, -1.245, 5.326 ], "step_params": [ 0.202, -0.190, 3.154, 1.184, 8.057, 31.327 ], "heli_params": [ -1.707, -0.162, 3.018, 14.613, -2.147, 32.342 ], "bp2_params": [ 0.122, -0.220, -0.031, -1.614, -3.008, -0.943 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 26.469, "simple_hRise": 2.973, "simple_hTwist": 27.672 }, { "index": 2, "nt1": "///T/4", "nt2": "///W/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.122, -0.220, -0.031, -1.614, -3.008, -0.943 ], "step_params": [ -0.358, -0.336, 3.441, 1.086, 7.628, 30.553 ], "heli_params": [ -2.099, 0.870, 3.250, 14.194, -2.021, 31.487 ], "bp2_params": [ -0.496, -0.121, -0.092, 0.281, -0.261, 3.870 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.441, "simple_Twist": 34.140, "simple_hRise": 3.280, "simple_hTwist": 34.973 }, { "index": 3, "nt1": "///T/5", "nt2": "///W/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.496, -0.121, -0.092, 0.281, -0.261, 3.870 ], "step_params": [ 0.795, -0.367, 3.369, -0.347, 6.002, 29.620 ], "heli_params": [ -1.944, -1.597, 3.224, 11.590, 0.670, 30.210 ], "bp2_params": [ -0.970, 0.056, -0.235, -3.089, -1.513, 12.077 ], "groove_widths": [ 12.832, null, 20.629, null ], "simple_Rise": 3.369, "simple_Twist": 32.373, "simple_hRise": 3.242, "simple_hTwist": 32.911 }, { "index": 4, "nt1": "///T/6", "nt2": "///W/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.970, 0.056, -0.235, -3.089, -1.513, 12.077 ], "step_params": [ -0.257, -0.468, 3.386, -0.570, 0.339, 38.972 ], "heli_params": [ -0.744, 0.314, 3.385, 0.508, 0.854, 38.978 ], "bp2_params": [ 0.516, -0.109, -0.255, -2.417, -7.811, -0.366 ], "groove_widths": [ 11.043, 10.992, 18.994, 18.972 ], "simple_Rise": 3.386, "simple_Twist": 30.375, "simple_hRise": 3.385, "simple_hTwist": 30.382 }, { "index": 5, "nt1": "///T/7", "nt2": "///W/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.516, -0.109, -0.255, -2.417, -7.811, -0.366 ], "step_params": [ -0.783, -0.219, 3.122, -1.309, -5.750, 39.333 ], "heli_params": [ 0.322, 1.005, 3.145, -8.484, 1.931, 39.755 ], "bp2_params": [ 0.384, -0.019, -0.253, 0.390, -5.728, -4.818 ], "groove_widths": [ 9.094, 9.089, 20.312, 20.199 ], "simple_Rise": 3.122, "simple_Twist": 40.321, "simple_hRise": 3.146, "simple_hTwist": 40.732 }, { "index": 6, "nt1": "///T/8", "nt2": "///W/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.384, -0.019, -0.253, 0.390, -5.728, -4.818 ], "step_params": [ 0.386, -0.341, 3.364, -2.576, -5.905, 29.728 ], "heli_params": [ 0.573, -1.269, 3.324, -11.343, 4.948, 30.403 ], "bp2_params": [ -0.712, -0.100, 0.218, -1.899, -6.757, 9.868 ], "groove_widths": [ 8.950, 8.945, 18.576, 18.525 ], "simple_Rise": 3.364, "simple_Twist": 35.968, "simple_hRise": 3.342, "simple_hTwist": 36.522 }, { "index": 7, "nt1": "///T/9", "nt2": "///W/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.712, -0.100, 0.218, -1.899, -6.757, 9.868 ], "step_params": [ -0.336, -0.384, 3.172, 2.788, -6.406, 43.782 ], "heli_params": [ 0.072, 0.699, 3.168, -8.525, -3.711, 44.309 ], "bp2_params": [ 0.494, -0.042, 0.035, 2.049, -4.234, -1.585 ], "groove_widths": [ 9.149, 9.147, 17.670, 17.644 ], "simple_Rise": 3.172, "simple_Twist": 37.017, "simple_hRise": 3.159, "simple_hTwist": 37.648 }, { "index": 8, "nt1": "///T/10", "nt2": "///W/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.494, -0.042, 0.035, 2.049, -4.234, -1.585 ], "step_params": [ 0.757, -0.536, 3.249, 3.063, -4.119, 33.816 ], "heli_params": [ -0.253, -0.798, 3.342, -7.030, -5.228, 34.192 ], "bp2_params": [ -0.584, -0.119, -0.154, 2.508, -4.350, -4.057 ], "groove_widths": [ 9.255, 9.243, 20.158, 20.001 ], "simple_Rise": 3.249, "simple_Twist": 39.730, "simple_hRise": 3.332, "simple_hTwist": 40.047 }, { "index": 9, "nt1": "///T/11", "nt2": "///W/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.584, -0.119, -0.154, 2.508, -4.350, -4.057 ], "step_params": [ -0.007, -0.989, 3.224, -1.732, 3.771, 30.458 ], "heli_params": [ -2.581, -0.315, 3.078, 7.135, 3.278, 30.732 ], "bp2_params": [ -0.164, -0.286, -0.235, 1.905, -1.221, 1.152 ], "groove_widths": [ 10.635, null, 19.198, null ], "simple_Rise": 3.224, "simple_Twist": 28.160, "simple_hRise": 3.063, "simple_hTwist": 28.458 }, { "index": 10, "nt1": "///T/12", "nt2": "///W/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.164, -0.286, -0.235, 1.905, -1.221, 1.152 ], "step_params": [ -0.716, -0.645, 3.449, -0.485, 2.119, 38.562 ], "heli_params": [ -1.249, 1.020, 3.418, 3.206, 0.733, 38.621 ], "bp2_params": [ 0.827, -0.476, 0.109, -1.870, -2.319, -3.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.449, "simple_Twist": 32.854, "simple_hRise": 3.411, "simple_hTwist": 32.924 }, { "index": 11, "nt1": "///T/13", "nt2": "///W/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.827, -0.476, 0.109, -1.870, -2.319, -3.477 ], "step_params": [ -0.287, 0.161, 3.490, 1.908, 8.768, 35.082 ], "heli_params": [ -1.064, 0.751, 3.411, 14.259, -3.102, 36.176 ], "bp2_params": [ 0.106, 0.105, -0.426, -5.735, -1.526, -11.223 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.490, "simple_Twist": 39.079, "simple_hRise": 3.429, "simple_hTwist": 40.057 }, { "index": 12, "nt1": "///T/14", "nt2": "///W/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 5, "stem_indices": [ 2, 1, 4, 3, 5 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TA", "nts_long": "///X/1,///V/14" }, { "index": 2, "num_nts": 2, "nts_short": "TG", "nts_long": "///X/2,///X/3" }, { "index": 3, "num_nts": 2, "nts_short": "CA", "nts_long": "///Y/14,///Z/1" }, { "index": 4, "num_nts": 2, "nts_short": "TA", "nts_long": "///V/1,///T/14" }, { "index": 5, "num_nts": 2, "nts_short": "TG", "nts_long": "///V/2,///V/3" }, { "index": 6, "num_nts": 2, "nts_short": "CA", "nts_long": "///Z/14,///W/1" }, { "index": 7, "num_nts": 2, "nts_short": "AT", "nts_long": "///W/2,///W/3" }, { "index": 8, "num_nts": 3, "nts_short": "ATR", "nts_long": "///Z/2,///Z/3,///H/430" }, { "index": 9, "num_nts": 3, "nts_short": "TTG", "nts_long": "///T/1,///T/2,///T/3" }, { "index": 10, "num_nts": 4, "nts_short": "AATR", "nts_long": "///Y/1,///Y/2,///Y/3,///L/430" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///Y/1,///Y/2" }, { "index": 2, "num_nts": 2, "nts_short": "TT", "nts_long": "///T/1,///T/2" } ], "pseudoknot_order": 2, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 4, "nts_short": "TTAA", "nts_long": "///X/1,///X/2,///Z/1,///Z/2" }, { "index": 2, "symbols": "{}", "num_nts": 4, "nts_short": "TTAA", "nts_long": "///V/1,///V/2,///W/1,///W/2" } ], "dbn": { "all_chains": { "num_nts": 84, "num_chars": 89, "bseq": "TTGAGGAATTTCCA&AATGGAAATTCCTC&TTGAGGAATTTCCA&AATGGAAATTCCTC&TTGAGGAATTTCCA&AATGGAAATTCCTC", "sstr": "[[((((((((((((&..))))))))))))&{{((((((((((((&]]))))))))))))&..((((((((((((&}}))))))))))))", "form": "..BB..BBBBBBB-&..B.BBBBB..BB-&...B..BBBB.BB-&..BB.BBBB..BB-&B..BB.BBBB.BB-&..B..BBBBBBBB-" }, "chain_X": { "num_nts": 14, "num_chars": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "[[((((((((((((", "form": "..BB..BBBBBBB-" }, "chain_Y": { "num_nts": 14, "num_chars": 14, "bseq": "AATGGAAATTCCTC", "sstr": "..))))))))))))", "form": "..B.BBBBB..BB-" }, "chain_V": { "num_nts": 14, "num_chars": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "{{((((((((((((", "form": "...B..BBBB.BB-" }, "chain_Z": { "num_nts": 14, "num_chars": 14, "bseq": "AATGGAAATTCCTC", "sstr": "]]))))))))))))", "form": "..BB.BBBB..BB-" }, "chain_T": { "num_nts": 14, "num_chars": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "..((((((((((((", "form": "B..BB.BBBB.BB-" }, "chain_W": { "num_nts": 14, "num_chars": 14, "bseq": "AATGGAAATTCCTC", "sstr": "}}))))))))))))", "form": "..B..BBBBBBBB-" } }, "chains": { "chain_X": { "num_nts": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "[[((((((((((((", "form": "..BB..BBBBBBB-", "helical_rise": 3.181, "helical_rise_std": 0.652, "helical_axis": [ 0.325, 0.938, -0.123 ], "point1": [ 32.261, 57.396, 158.774 ], "point2": [ 45.768, 96.349, 153.658 ], "num_chars": 40, "suite": "T!!T!!G!!A!!G!!G!!A!!A!!T!!T!!T!!C!!C!!A" }, "chain_Y": { "num_nts": 14, "bseq": "AATGGAAATTCCTC", "sstr": "..))))))))))))", "form": "..B.BBBBB..BB-", "helical_rise": 3.357, "helical_rise_std": 0.449, "helical_axis": [ -0.247, -0.936, 0.253 ], "point1": [ 45.664, 100.813, 148.956 ], "point2": [ 34.756, 59.438, 160.142 ], "num_chars": 40, "suite": "A!!A!!T!!G!!G!!A!!A!!A!!T!!T!!C!!C!!T!!C" }, "chain_V": { "num_nts": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "{{((((((((((((", "form": "...B..BBBB.BB-", "helical_rise": 3.159, "helical_rise_std": 0.773, "helical_axis": [ -0.078, 0.942, 0.325 ], "point1": [ 27.311, 17.073, 143.755 ], "point2": [ 24.105, 55.955, 157.184 ], "num_chars": 40, "suite": "T!!T!!G!!A!!G!!G!!A!!A!!T!!T!!T!!C!!C!!A" }, "chain_Z": { "num_nts": 14, "bseq": "AATGGAAATTCCTC", "sstr": "]]))))))))))))", "form": "..BB.BBBB..BB-", "helical_rise": 3.359, "helical_rise_std": 0.488, "helical_axis": [ -0.127, -0.930, -0.346 ], "point1": [ 29.395, 59.841, 159.748 ], "point2": [ 23.765, 18.647, 144.410 ], "num_chars": 40, "suite": "A!!A!!T!!G!!G!!A!!A!!A!!T!!T!!C!!C!!T!!C" }, "chain_T": { "num_nts": 14, "bseq": "TTGAGGAATTTCCA", "sstr": "..((((((((((((", "form": "B..BB.BBBB.BB-", "helical_rise": 3.149, "helical_rise_std": 0.838, "helical_axis": [ -0.268, 0.945, -0.187 ], "point1": [ 43.044, -23.771, 146.516 ], "point2": [ 32.010, 15.092, 138.818 ], "num_chars": 40, "suite": "T!!T!!G!!A!!G!!G!!A!!A!!T!!T!!T!!C!!C!!A" }, "chain_W": { "num_nts": 14, "bseq": "AATGGAAATTCCTC", "sstr": "}}))))))))))))", "form": "..B..BBBBBBBB-", "helical_rise": 3.374, "helical_rise_std": 0.465, "helical_axis": [ 0.373, -0.927, 0.040 ], "point1": [ 27.892, 18.940, 141.255 ], "point2": [ 44.489, -22.268, 143.025 ], "num_chars": 40, "suite": "A!!A!!T!!G!!G!!A!!A!!A!!T!!T!!C!!C!!T!!C" } }, "num_nts": 84, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "X", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/1", "linked_nts": [ null, "///X/2" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -157.506, "delta": 152.180, "epsilon": -153.240, "zeta": -103.155, "epsilon_zeta": -50.085, "bb_type": "BI", "chi": -145.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.494, 0.428 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.981, "Dp": 1.951, "splay_angle": 21.038, "splay_distance": 3.811, "splay_ratio": 0.190, "d22": 4.359, "d64": 3.946, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -12.479, "v1": 30.090, "v2": -35.441, "v3": 28.785, "v4": -10.362, "amplitude": 35.458, "phase_angle": 178.203, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ 29.501, 56.772, 159.447 ], "x_axis": [ 0.779, -0.087, -0.621 ], "y_axis": [ -0.500, 0.510, -0.699 ], "z_axis": [ 0.378, 0.856, 0.354 ], "quaternion": [ 0.813, -0.478, 0.307, 0.127 ] } }, { "index": 2, "index_chain": 2, "chain_name": "X", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/2", "linked_nts": [ "///X/1", "///X/3" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 45.486, "beta": 168.319, "gamma": -75.502, "delta": 159.512, "epsilon": -172.295, "zeta": -102.119, "epsilon_zeta": -70.176, "bb_type": "BI", "chi": -113.470, "glyco_bond": "anti", "C5prime_xyz": [ -1.358, 8.078, -1.421 ], "P_xyz": [ -0.244, 10.440, -1.560 ], "form": ".", "ssZp": 1.462, "Dp": 1.698, "splay_angle": 17.183, "splay_distance": 3.182, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 153.589, "theta": -142.836, "eta_prime": -171.747, "theta_prime": -144.881, "eta_base": -126.725, "theta_base": -102.741, "v0": -6.757, "v1": 27.266, "v2": -35.749, "v3": 32.798, "v4": -16.593, "amplitude": 36.096, "phase_angle": 187.951, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.016, "origin": [ 31.933, 59.364, 160.821 ], "x_axis": [ 0.224, 0.060, -0.973 ], "y_axis": [ -0.880, 0.442, -0.175 ], "z_axis": [ 0.420, 0.895, 0.152 ], "quaternion": [ 0.674, -0.397, 0.516, 0.349 ] } }, { "index": 3, "index_chain": 3, "chain_name": "X", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/3", "linked_nts": [ "///X/2", "///X/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": 21.581, "beta": 179.680, "gamma": -50.543, "delta": 157.196, "epsilon": -174.288, "zeta": -145.116, "epsilon_zeta": -29.173, "bb_type": "--", "chi": -91.603, "glyco_bond": "anti", "C5prime_xyz": [ -2.252, 7.662, -2.364 ], "P_xyz": [ -1.433, 10.055, -2.971 ], "form": "B", "ssZp": 1.430, "Dp": 1.774, "splay_angle": 18.987, "splay_distance": 3.234, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 161.861, "theta": -157.510, "eta_prime": -166.601, "theta_prime": -155.281, "eta_base": -121.985, "theta_base": -129.107, "v0": -10.068, "v1": 28.473, "v2": -35.508, "v3": 30.218, "v4": -12.877, "amplitude": 35.539, "phase_angle": 182.386, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 33.810, 61.857, 160.199 ], "x_axis": [ -0.315, 0.180, -0.932 ], "y_axis": [ -0.809, 0.463, 0.363 ], "z_axis": [ 0.496, 0.868, -0.000 ], "quaternion": [ 0.536, -0.236, 0.667, 0.462 ] } }, { "index": 4, "index_chain": 4, "chain_name": "X", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/4", "linked_nts": [ "///X/3", "///X/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 35.350, "beta": 121.144, "gamma": -22.306, "delta": 164.342, "epsilon": -135.316, "zeta": 142.040, "epsilon_zeta": 82.644, "bb_type": "--", "chi": -64.716, "glyco_bond": "anti", "C5prime_xyz": [ -4.029, 7.025, -2.142 ], "P_xyz": [ -2.777, 9.287, -2.189 ], "form": "B", "ssZp": 2.556, "Dp": 1.900, "splay_angle": 21.379, "splay_distance": 3.434, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 160.428, "theta": 174.790, "eta_prime": -172.224, "theta_prime": 161.843, "eta_base": -145.079, "theta_base": -156.041, "v0": -19.605, "v1": 38.945, "v2": -41.671, "v3": 32.497, "v4": -8.396, "amplitude": 42.064, "phase_angle": 172.161, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ 35.514, 64.571, 159.769 ], "x_axis": [ -0.617, 0.245, -0.748 ], "y_axis": [ -0.645, 0.387, 0.659 ], "z_axis": [ 0.451, 0.889, -0.081 ], "quaternion": [ 0.415, -0.138, 0.722, 0.536 ] } }, { "index": 5, "index_chain": 5, "chain_name": "X", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/5", "linked_nts": [ "///X/4", "///X/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 103.418, "beta": -140.752, "gamma": -169.339, "delta": 143.919, "epsilon": -162.489, "zeta": -98.827, "epsilon_zeta": -63.662, "bb_type": "BI", "chi": -141.808, "glyco_bond": "anti", "C5prime_xyz": [ -1.350, 8.558, 0.135 ], "P_xyz": [ 0.873, 9.209, -1.081 ], "form": ".", "ssZp": 2.133, "Dp": 2.302, "splay_angle": 19.270, "splay_distance": 3.603, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 179.232, "theta": -118.740, "eta_prime": -171.090, "theta_prime": -140.614, "eta_base": -130.852, "theta_base": -107.498, "v0": -14.000, "v1": 29.800, "v2": -34.167, "v3": 26.118, "v4": -7.804, "amplitude": 34.317, "phase_angle": 174.633, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 37.807, 67.072, 159.237 ], "x_axis": [ -0.900, 0.402, -0.167 ], "y_axis": [ -0.099, 0.184, 0.978 ], "z_axis": [ 0.423, 0.897, -0.126 ], "quaternion": [ 0.199, 0.102, 0.743, 0.631 ] } }, { "index": 6, "index_chain": 6, "chain_name": "X", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/6", "linked_nts": [ "///X/5", "///X/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 44.637, "beta": 163.551, "gamma": -63.786, "delta": 153.721, "epsilon": -164.732, "zeta": -113.966, "epsilon_zeta": -50.766, "bb_type": "BI", "chi": -105.144, "glyco_bond": "anti", "C5prime_xyz": [ -2.098, 8.161, -1.536 ], "P_xyz": [ -1.169, 10.595, -1.575 ], "form": ".", "ssZp": 2.418, "Dp": 2.065, "splay_angle": 19.035, "splay_distance": 3.544, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 155.915, "theta": -154.733, "eta_prime": -171.091, "theta_prime": -166.255, "eta_base": -126.084, "theta_base": -124.249, "v0": -13.831, "v1": 31.154, "v2": -35.448, "v3": 28.066, "v4": -9.190, "amplitude": 35.536, "phase_angle": 175.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 38.360, 70.314, 157.765 ], "x_axis": [ -0.823, 0.413, 0.390 ], "y_axis": [ 0.415, -0.032, 0.909 ], "z_axis": [ 0.388, 0.910, -0.145 ], "quaternion": [ -0.001, 0.298, 0.696, 0.654 ] } }, { "index": 7, "index_chain": 7, "chain_name": "X", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/7", "linked_nts": [ "///X/6", "///X/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 39.380, "beta": -138.332, "gamma": -79.616, "delta": 151.158, "epsilon": -175.573, "zeta": -95.125, "epsilon_zeta": -80.448, "bb_type": "BI", "chi": -130.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.247, 8.306, -0.411 ], "P_xyz": [ -0.478, 10.685, -1.065 ], "form": "B", "ssZp": 2.144, "Dp": 2.090, "splay_angle": 19.295, "splay_distance": 3.154, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -167.203, "theta": 178.872, "eta_prime": -160.970, "theta_prime": -168.500, "eta_base": -114.949, "theta_base": -123.698, "v0": -8.046, "v1": 25.805, "v2": -32.642, "v3": 28.462, "v4": -13.081, "amplitude": 32.737, "phase_angle": 184.379, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 38.414, 73.705, 156.737 ], "x_axis": [ -0.459, 0.340, 0.821 ], "y_axis": [ 0.805, -0.232, 0.546 ], "z_axis": [ 0.376, 0.911, -0.167 ], "quaternion": [ -0.188, 0.485, 0.590, 0.617 ] } }, { "index": 8, "index_chain": 8, "chain_name": "X", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/8", "linked_nts": [ "///X/7", "///X/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.090, "beta": -168.929, "gamma": 38.805, "delta": 150.975, "epsilon": 172.889, "zeta": -142.964, "epsilon_zeta": -44.147, "bb_type": "--", "chi": -104.566, "glyco_bond": "anti", "C5prime_xyz": [ -1.783, 8.071, -1.817 ], "P_xyz": [ 0.352, 9.309, -0.979 ], "form": "B", "ssZp": 1.505, "Dp": 1.713, "splay_angle": 21.340, "splay_distance": 3.566, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 162.134, "theta": -141.668, "eta_prime": -161.241, "theta_prime": -161.523, "eta_base": -114.976, "theta_base": -124.930, "v0": -8.342, "v1": 28.239, "v2": -36.246, "v3": 32.143, "v4": -15.089, "amplitude": 36.411, "phase_angle": 185.454, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ 39.447, 76.550, 155.850 ], "x_axis": [ 0.137, 0.172, 0.975 ], "y_axis": [ 0.918, -0.392, -0.059 ], "z_axis": [ 0.373, 0.903, -0.212 ], "quaternion": [ -0.365, 0.660, 0.413, 0.511 ] } }, { "index": 9, "index_chain": 9, "chain_name": "X", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/9", "linked_nts": [ "///X/8", "///X/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 145.233, "beta": -142.839, "gamma": -171.684, "delta": 140.396, "epsilon": -147.041, "zeta": -102.160, "epsilon_zeta": -44.881, "bb_type": "BI", "chi": -134.569, "glyco_bond": "anti", "C5prime_xyz": [ -2.225, 8.664, -0.349 ], "P_xyz": [ -0.117, 9.695, -1.393 ], "form": "B", "ssZp": 1.388, "Dp": 1.947, "splay_angle": 17.211, "splay_distance": 3.097, "splay_ratio": 0.154, "d22": 4.539, "d64": 3.841, "eta": -170.329, "theta": -140.478, "eta_prime": -156.807, "theta_prime": -157.338, "eta_base": -118.011, "theta_base": -104.795, "v0": -19.865, "v1": 34.304, "v2": -35.349, "v3": 24.509, "v4": -3.067, "amplitude": 36.390, "phase_angle": 166.264, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.023, "origin": [ 39.792, 79.916, 154.724 ], "x_axis": [ 0.666, 0.063, 0.744 ], "y_axis": [ 0.677, -0.470, -0.566 ], "z_axis": [ 0.314, 0.880, -0.355 ], "quaternion": [ -0.458, 0.789, 0.234, 0.335 ] } }, { "index": 10, "index_chain": 10, "chain_name": "X", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/10", "linked_nts": [ "///X/9", "///X/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 21.283, "beta": -156.503, "gamma": -62.000, "delta": 145.696, "epsilon": 164.852, "zeta": -72.952, "epsilon_zeta": -122.196, "bb_type": "BI", "chi": -107.728, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 7.925, -1.701 ], "P_xyz": [ -0.430, 10.127, -2.475 ], "form": "B", "ssZp": 1.727, "Dp": 1.963, "splay_angle": 19.050, "splay_distance": 3.253, "splay_ratio": 0.167, "d22": 4.156, "d64": 3.719, "eta": 167.953, "theta": -163.868, "eta_prime": -168.247, "theta_prime": -170.050, "eta_base": -110.668, "theta_base": -124.157, "v0": -7.785, "v1": 24.078, "v2": -30.123, "v3": 26.275, "v4": -11.805, "amplitude": 30.191, "phase_angle": 183.837, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.015, "origin": [ 41.009, 82.738, 154.339 ], "x_axis": [ 0.985, -0.128, 0.114 ], "y_axis": [ 0.070, -0.308, -0.949 ], "z_axis": [ 0.156, 0.943, -0.295 ], "quaternion": [ 0.588, -0.804, 0.018, -0.084 ] } }, { "index": 11, "index_chain": 11, "chain_name": "X", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/11", "linked_nts": [ "///X/10", "///X/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -164.023, "beta": 145.603, "gamma": 162.836, "delta": 148.803, "epsilon": -150.461, "zeta": -96.466, "epsilon_zeta": -53.995, "bb_type": "BI", "chi": -134.363, "glyco_bond": "anti", "C5prime_xyz": [ -1.722, 8.531, -0.242 ], "P_xyz": [ -0.060, 9.814, -1.673 ], "form": "B", "ssZp": 1.478, "Dp": 1.718, "splay_angle": 18.318, "splay_distance": 3.330, "splay_ratio": 0.164, "d22": 4.242, "d64": 3.992, "eta": -162.915, "theta": -154.769, "eta_prime": -154.282, "theta_prime": -156.219, "eta_base": -109.362, "theta_base": -110.753, "v0": -13.036, "v1": 30.047, "v2": -34.792, "v3": 27.918, "v4": -9.560, "amplitude": 34.839, "phase_angle": 177.004, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.013, "origin": [ 41.875, 85.804, 153.684 ], "x_axis": [ 0.855, -0.253, -0.453 ], "y_axis": [ -0.500, -0.164, -0.851 ], "z_axis": [ 0.141, 0.954, -0.266 ], "quaternion": [ 0.597, -0.756, 0.249, 0.103 ] } }, { "index": 12, "index_chain": 12, "chain_name": "X", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/12", "linked_nts": [ "///X/11", "///X/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 11.093, "beta": -166.277, "gamma": -56.209, "delta": 148.720, "epsilon": -165.198, "zeta": -115.281, "epsilon_zeta": -49.917, "bb_type": "BI", "chi": -105.039, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 8.026, -1.584 ], "P_xyz": [ -0.540, 10.341, -2.022 ], "form": "B", "ssZp": 1.997, "Dp": 1.961, "splay_angle": 19.560, "splay_distance": 3.466, "splay_ratio": 0.171, "d22": 4.463, "d64": 4.092, "eta": 159.473, "theta": -162.243, "eta_prime": -174.445, "theta_prime": -165.373, "eta_base": -123.753, "theta_base": -135.826, "v0": -8.429, "v1": 25.498, "v2": -31.998, "v3": 27.797, "v4": -12.373, "amplitude": 32.063, "phase_angle": 183.627, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.013, "origin": [ 43.148, 88.788, 152.932 ], "x_axis": [ 0.372, -0.282, -0.885 ], "y_axis": [ -0.915, 0.052, -0.401 ], "z_axis": [ 0.159, 0.958, -0.238 ], "quaternion": [ 0.544, -0.624, 0.479, 0.291 ] } }, { "index": 13, "index_chain": 13, "chain_name": "X", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/13", "linked_nts": [ "///X/12", "///X/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 32.421, "beta": -168.953, "gamma": -59.866, "delta": 156.794, "epsilon": 175.857, "zeta": -85.811, "epsilon_zeta": -98.332, "bb_type": "BI", "chi": -108.258, "glyco_bond": "anti", "C5prime_xyz": [ -1.233, 7.979, -1.560 ], "P_xyz": [ 0.119, 10.119, -2.058 ], "form": "B", "ssZp": 1.849, "Dp": 1.730, "splay_angle": 19.993, "splay_distance": 3.274, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 175.829, "theta": -153.395, "eta_prime": -166.606, "theta_prime": -161.690, "eta_base": -135.344, "theta_base": -105.350, "v0": -3.730, "v1": 23.652, "v2": -33.561, "v3": 31.720, "v4": -17.891, "amplitude": 34.329, "phase_angle": 192.145, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.013, "origin": [ 44.198, 92.061, 152.495 ], "x_axis": [ -0.116, -0.305, -0.945 ], "y_axis": [ -0.970, 0.238, 0.042 ], "z_axis": [ 0.212, 0.922, -0.324 ], "quaternion": [ 0.447, -0.492, 0.648, 0.372 ] } }, { "index": 14, "index_chain": 14, "chain_name": "X", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/14", "linked_nts": [ "///X/13", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -170.495, "beta": 143.878, "gamma": 154.629, "delta": 150.565, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -128.704, "glyco_bond": "anti", "C5prime_xyz": [ -1.110, 8.202, -0.456 ], "P_xyz": [ 0.690, 8.751, -2.237 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.536, "v1": 22.145, "v2": -31.735, "v3": 31.156, "v4": -18.265, "amplitude": 32.738, "phase_angle": 194.214, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 43.908, 94.967, 151.015 ], "x_axis": [ -0.752, -0.080, -0.655 ], "y_axis": [ -0.603, 0.484, 0.634 ], "z_axis": [ 0.266, 0.871, -0.412 ], "quaternion": [ 0.283, -0.210, 0.814, 0.463 ] } }, { "index": 15, "index_chain": 1, "chain_name": "Y", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/1", "linked_nts": [ null, "///Y/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -164.101, "delta": 145.969, "epsilon": -163.927, "zeta": -82.906, "epsilon_zeta": -81.021, "bb_type": "BI", "chi": -126.376, "glyco_bond": "anti", "C5prime_xyz": [ -1.006, 8.151, -0.803 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.151, "Dp": 2.378, "splay_angle": 20.224, "splay_distance": 3.521, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.017, "v1": 21.959, "v2": -30.697, "v3": 28.669, "v4": -15.659, "amplitude": 31.271, "phase_angle": 190.993, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.016, "origin": [ 43.720, 99.858, 146.823 ], "x_axis": [ -0.964, -0.243, -0.106 ], "y_axis": [ 0.190, -0.354, -0.916 ], "z_axis": [ 0.185, -0.903, 0.388 ], "quaternion": [ -0.132, 0.024, -0.553, 0.823 ] } }, { "index": 16, "index_chain": 2, "chain_name": "Y", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/2", "linked_nts": [ "///Y/1", "///Y/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -46.465, "beta": -163.904, "gamma": 14.547, "delta": 152.801, "epsilon": -158.862, "zeta": -83.511, "epsilon_zeta": -75.350, "bb_type": "BI", "chi": -86.571, "glyco_bond": "anti", "C5prime_xyz": [ -2.751, 7.559, -2.404 ], "P_xyz": [ -1.410, 9.784, -2.277 ], "form": ".", "ssZp": 1.594, "Dp": 1.716, "splay_angle": 17.110, "splay_distance": 3.393, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 161.869, "theta": -129.115, "eta_prime": -166.366, "theta_prime": -156.584, "eta_base": -155.899, "theta_base": -136.947, "v0": -13.764, "v1": 32.655, "v2": -37.797, "v3": 30.941, "v4": -11.058, "amplitude": 37.825, "phase_angle": 177.824, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.019, "origin": [ 44.983, 97.496, 149.108 ], "x_axis": [ -0.900, -0.175, -0.400 ], "y_axis": [ 0.437, -0.366, -0.822 ], "z_axis": [ -0.002, -0.914, 0.406 ], "quaternion": [ -0.187, -0.123, -0.531, 0.817 ] } }, { "index": 17, "index_chain": 3, "chain_name": "Y", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/3", "linked_nts": [ "///Y/2", "///Y/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -6.749, "beta": -97.068, "gamma": -83.144, "delta": 152.027, "epsilon": -134.283, "zeta": -173.324, "epsilon_zeta": 39.041, "bb_type": "--", "chi": -112.708, "glyco_bond": "anti", "C5prime_xyz": [ -2.046, 8.392, -1.021 ], "P_xyz": [ -3.005, 10.342, -2.511 ], "form": "B", "ssZp": 2.267, "Dp": 1.760, "splay_angle": 19.893, "splay_distance": 3.352, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": -170.572, "theta": 146.275, "eta_prime": -177.810, "theta_prime": 165.043, "eta_base": -156.150, "theta_base": -149.546, "v0": -14.992, "v1": 32.077, "v2": -35.971, "v3": 28.025, "v4": -8.270, "amplitude": 36.141, "phase_angle": 174.442, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.018, "origin": [ 43.899, 95.224, 151.384 ], "x_axis": [ -0.715, -0.230, -0.660 ], "y_axis": [ 0.691, -0.374, -0.619 ], "z_axis": [ -0.104, -0.899, 0.426 ], "quaternion": [ -0.290, -0.241, -0.478, 0.793 ] } }, { "index": 18, "index_chain": 4, "chain_name": "Y", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/4", "linked_nts": [ "///Y/3", "///Y/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 104.397, "beta": -128.637, "gamma": -170.966, "delta": 141.598, "epsilon": -155.866, "zeta": -95.633, "epsilon_zeta": -60.233, "bb_type": "BI", "chi": -133.478, "glyco_bond": "anti", "C5prime_xyz": [ -1.688, 8.641, -0.385 ], "P_xyz": [ 0.568, 9.073, -1.497 ], "form": ".", "ssZp": 1.370, "Dp": 2.056, "splay_angle": 18.019, "splay_distance": 3.366, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 170.598, "theta": -120.964, "eta_prime": -163.008, "theta_prime": -145.416, "eta_base": -121.101, "theta_base": -97.337, "v0": -18.739, "v1": 33.420, "v2": -35.483, "v3": 24.953, "v4": -4.107, "amplitude": 36.268, "phase_angle": 168.057, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 44.031, 92.277, 152.976 ], "x_axis": [ -0.164, -0.331, -0.929 ], "y_axis": [ 0.972, -0.218, -0.094 ], "z_axis": [ -0.171, -0.918, 0.357 ], "quaternion": [ -0.494, -0.417, -0.384, 0.659 ] } }, { "index": 19, "index_chain": 5, "chain_name": "Y", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/5", "linked_nts": [ "///Y/4", "///Y/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 30.829, "beta": -176.251, "gamma": -65.604, "delta": 150.853, "epsilon": -171.483, "zeta": -58.519, "epsilon_zeta": -112.964, "bb_type": "BI", "chi": -106.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.813, 8.144, -1.634 ], "P_xyz": [ -0.873, 10.513, -2.146 ], "form": "B", "ssZp": 2.095, "Dp": 2.041, "splay_angle": 18.516, "splay_distance": 3.249, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 157.145, "theta": -151.662, "eta_prime": -172.508, "theta_prime": -165.609, "eta_base": -115.869, "theta_base": -128.028, "v0": -11.886, "v1": 28.703, "v2": -34.063, "v3": 27.511, "v4": -9.980, "amplitude": 34.078, "phase_angle": 178.307, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 43.083, 89.048, 152.962 ], "x_axis": [ 0.469, -0.377, -0.799 ], "y_axis": [ 0.862, -0.002, 0.507 ], "z_axis": [ -0.193, -0.926, 0.324 ], "quaternion": [ 0.669, 0.536, 0.227, -0.463 ] } }, { "index": 20, "index_chain": 6, "chain_name": "Y", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/6", "linked_nts": [ "///Y/5", "///Y/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -131.357, "beta": 78.952, "gamma": 172.581, "delta": 143.154, "epsilon": -161.548, "zeta": -88.240, "epsilon_zeta": -73.308, "bb_type": "BI", "chi": -145.280, "glyco_bond": "anti", "C5prime_xyz": [ -1.562, 8.502, 0.402 ], "P_xyz": [ -1.032, 10.041, -1.662 ], "form": "B", "ssZp": 2.083, "Dp": 2.181, "splay_angle": 20.435, "splay_distance": 3.349, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -147.268, "theta": 156.121, "eta_prime": -158.907, "theta_prime": -173.453, "eta_base": -120.235, "theta_base": -127.404, "v0": -11.003, "v1": 27.866, "v2": -33.750, "v3": 27.680, "v4": -10.531, "amplitude": 33.751, "phase_angle": 179.637, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 42.194, 85.945, 153.330 ], "x_axis": [ 0.815, -0.344, -0.467 ], "y_axis": [ 0.531, 0.118, 0.839 ], "z_axis": [ -0.234, -0.931, 0.279 ], "quaternion": [ 0.744, 0.595, 0.078, -0.294 ] } }, { "index": 21, "index_chain": 7, "chain_name": "Y", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/7", "linked_nts": [ "///Y/6", "///Y/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.525, "beta": -163.813, "gamma": 34.220, "delta": 148.271, "epsilon": 168.316, "zeta": -101.886, "epsilon_zeta": -89.798, "bb_type": "BI", "chi": -97.456, "glyco_bond": "anti", "C5prime_xyz": [ -1.834, 7.857, -2.083 ], "P_xyz": [ 0.226, 9.295, -1.445 ], "form": "B", "ssZp": 1.583, "Dp": 1.737, "splay_angle": 21.127, "splay_distance": 3.441, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 159.374, "theta": -146.698, "eta_prime": -161.902, "theta_prime": -159.602, "eta_base": -115.219, "theta_base": -113.331, "v0": -8.538, "v1": 27.946, "v2": -35.246, "v3": 31.389, "v4": -14.543, "amplitude": 35.380, "phase_angle": 184.977, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.018, "origin": [ 41.094, 82.881, 154.116 ], "x_axis": [ 0.933, -0.288, 0.214 ], "y_axis": [ -0.126, 0.296, 0.947 ], "z_axis": [ -0.336, -0.911, 0.240 ], "quaternion": [ 0.786, 0.591, -0.175, -0.051 ] } }, { "index": 22, "index_chain": 8, "chain_name": "Y", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/8", "linked_nts": [ "///Y/7", "///Y/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -47.709, "beta": -170.714, "gamma": 42.823, "delta": 151.416, "epsilon": 176.648, "zeta": -107.507, "epsilon_zeta": -75.845, "bb_type": "BI", "chi": -93.862, "glyco_bond": "anti", "C5prime_xyz": [ -2.330, 7.857, -2.193 ], "P_xyz": [ -0.197, 9.249, -1.814 ], "form": "B", "ssZp": 1.746, "Dp": 1.861, "splay_angle": 19.145, "splay_distance": 3.229, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 171.584, "theta": -139.373, "eta_prime": -160.537, "theta_prime": -155.129, "eta_base": -111.205, "theta_base": -114.112, "v0": -13.898, "v1": 31.817, "v2": -36.860, "v3": 29.800, "v4": -10.082, "amplitude": 36.909, "phase_angle": 177.056, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 40.045, 79.725, 155.000 ], "x_axis": [ 0.619, -0.168, 0.767 ], "y_axis": [ -0.662, 0.413, 0.625 ], "z_axis": [ -0.422, -0.895, 0.144 ], "quaternion": [ 0.738, 0.515, -0.403, 0.167 ] } }, { "index": 23, "index_chain": 9, "chain_name": "Y", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/9", "linked_nts": [ "///Y/8", "///Y/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -56.569, "beta": -173.064, "gamma": 43.210, "delta": 142.369, "epsilon": 166.588, "zeta": -110.936, "epsilon_zeta": -82.477, "bb_type": "BI", "chi": -89.999, "glyco_bond": "anti", "C5prime_xyz": [ -2.804, 7.930, -2.214 ], "P_xyz": [ -0.786, 9.542, -2.278 ], "form": "B", "ssZp": 2.096, "Dp": 2.016, "splay_angle": 21.281, "splay_distance": 3.403, "splay_ratio": 0.185, "d22": 4.524, "d64": 3.939, "eta": 165.434, "theta": -158.218, "eta_prime": -166.237, "theta_prime": -173.130, "eta_base": -121.008, "theta_base": -120.680, "v0": -14.565, "v1": 32.083, "v2": -36.731, "v3": 29.181, "v4": -9.336, "amplitude": 36.826, "phase_angle": 175.886, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.015, "origin": [ 39.378, 76.668, 155.796 ], "x_axis": [ 0.140, 0.098, 0.985 ], "y_axis": [ -0.931, 0.352, 0.098 ], "z_axis": [ -0.337, -0.931, 0.141 ], "quaternion": [ 0.639, 0.403, -0.517, 0.403 ] } }, { "index": 24, "index_chain": 10, "chain_name": "Y", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/10", "linked_nts": [ "///Y/9", "///Y/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.603, "beta": -176.983, "gamma": 57.758, "delta": 150.112, "epsilon": -164.354, "zeta": -131.167, "epsilon_zeta": -33.186, "bb_type": "--", "chi": -99.198, "glyco_bond": "anti", "C5prime_xyz": [ -2.496, 8.031, -1.873 ], "P_xyz": [ -0.190, 9.134, -1.566 ], "form": ".", "ssZp": 1.791, "Dp": 1.807, "splay_angle": 17.154, "splay_distance": 3.200, "splay_ratio": 0.159, "d22": 4.382, "d64": 4.223, "eta": -178.197, "theta": -126.107, "eta_prime": -155.945, "theta_prime": -156.966, "eta_base": -104.343, "theta_base": -130.153, "v0": -14.978, "v1": 32.144, "v2": -36.010, "v3": 28.481, "v4": -8.754, "amplitude": 36.153, "phase_angle": 174.902, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.009, "origin": [ 38.268, 73.600, 156.761 ], "x_axis": [ -0.525, 0.198, 0.828 ], "y_axis": [ -0.812, 0.174, -0.557 ], "z_axis": [ -0.254, -0.965, 0.070 ], "quaternion": [ -0.424, -0.241, 0.638, -0.596 ] } }, { "index": 25, "index_chain": 11, "chain_name": "Y", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/11", "linked_nts": [ "///Y/10", "///Y/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 46.496, "beta": -176.085, "gamma": -80.209, "delta": 154.711, "epsilon": 176.386, "zeta": -91.908, "epsilon_zeta": -91.706, "bb_type": "BI", "chi": -108.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.599, 8.156, -1.392 ], "P_xyz": [ -0.607, 10.394, -2.155 ], "form": ".", "ssZp": 2.221, "Dp": 1.883, "splay_angle": 23.129, "splay_distance": 3.912, "splay_ratio": 0.202, "d22": 4.349, "d64": 4.150, "eta": 169.208, "theta": -170.385, "eta_prime": -179.729, "theta_prime": -167.251, "eta_base": -145.594, "theta_base": -131.618, "v0": -8.075, "v1": 26.879, "v2": -34.285, "v3": 30.211, "v4": -14.128, "amplitude": 34.420, "phase_angle": 185.083, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.013, "origin": [ 38.534, 70.622, 157.902 ], "x_axis": [ -0.846, 0.342, 0.409 ], "y_axis": [ -0.450, -0.045, -0.892 ], "z_axis": [ -0.286, -0.939, 0.191 ], "quaternion": [ 0.274, 0.043, -0.634, 0.722 ] } }, { "index": 26, "index_chain": 12, "chain_name": "Y", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/12", "linked_nts": [ "///Y/11", "///Y/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.235, "beta": -152.712, "gamma": 24.123, "delta": 148.419, "epsilon": -177.007, "zeta": -116.646, "epsilon_zeta": -60.361, "bb_type": "BI", "chi": -102.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.779, 8.130, -1.835 ], "P_xyz": [ -0.064, 9.887, -0.997 ], "form": "B", "ssZp": 1.805, "Dp": 1.787, "splay_angle": 19.945, "splay_distance": 3.531, "splay_ratio": 0.177, "d22": 4.098, "d64": 3.805, "eta": 172.455, "theta": -137.948, "eta_prime": -166.425, "theta_prime": -151.824, "eta_base": -128.851, "theta_base": -105.605, "v0": -9.080, "v1": 28.472, "v2": -35.865, "v3": 31.485, "v4": -14.249, "amplitude": 35.963, "phase_angle": 184.240, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ 37.607, 67.097, 159.323 ], "x_axis": [ -0.900, 0.412, -0.141 ], "y_axis": [ 0.083, -0.156, -0.984 ], "z_axis": [ -0.428, -0.898, 0.106 ], "quaternion": [ 0.112, -0.194, -0.640, 0.735 ] } }, { "index": 27, "index_chain": 13, "chain_name": "Y", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/13", "linked_nts": [ "///Y/12", "///Y/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 41.114, "beta": -176.805, "gamma": -58.741, "delta": 152.778, "epsilon": -163.612, "zeta": -120.741, "epsilon_zeta": -42.872, "bb_type": "BI", "chi": -110.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.030, -1.416 ], "P_xyz": [ 0.042, 10.225, -1.592 ], "form": "B", "ssZp": 1.946, "Dp": 1.940, "splay_angle": 16.706, "splay_distance": 2.904, "splay_ratio": 0.145, "d22": 3.959, "d64": 3.470, "eta": -179.047, "theta": -146.252, "eta_prime": -165.069, "theta_prime": -154.213, "eta_base": -113.824, "theta_base": -117.504, "v0": -3.877, "v1": 22.999, "v2": -32.275, "v3": 30.364, "v4": -16.893, "amplitude": 32.947, "phase_angle": 191.595, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ 35.349, 64.436, 159.859 ], "x_axis": [ -0.657, 0.241, -0.714 ], "y_axis": [ 0.616, -0.374, -0.693 ], "z_axis": [ -0.434, -0.896, 0.097 ], "quaternion": [ -0.129, -0.393, -0.545, 0.729 ] } }, { "index": 28, "index_chain": 14, "chain_name": "Y", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/14", "linked_nts": [ "///Y/13", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 111.977, "beta": -154.339, "gamma": -159.939, "delta": 160.671, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -128.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.814, 8.598, -0.232 ], "P_xyz": [ -0.247, 9.837, -1.969 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.010, "v1": 31.551, "v2": -36.985, "v3": 30.417, "v4": -11.019, "amplitude": 36.999, "phase_angle": 178.427, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.016, "origin": [ 33.850, 61.953, 160.008 ], "x_axis": [ -0.205, 0.113, -0.972 ], "y_axis": [ 0.815, -0.531, -0.233 ], "z_axis": [ -0.542, -0.840, 0.017 ], "quaternion": [ -0.265, -0.572, -0.405, 0.662 ] } }, { "index": 29, "index_chain": 1, "chain_name": "V", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/1", "linked_nts": [ null, "///V/2" ], "nt_type": "DNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -84.574, "delta": 147.940, "epsilon": 159.434, "zeta": -96.573, "epsilon_zeta": -103.993, "bb_type": "BI", "chi": -109.033, "glyco_bond": "anti", "C5prime_xyz": [ -1.607, 8.147, -1.376 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.503, "Dp": 2.062, "splay_angle": 23.504, "splay_distance": 3.933, "splay_ratio": 0.206, "d22": 4.268, "d64": 3.977, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -7.840, "v1": 26.285, "v2": -33.369, "v3": 29.278, "v4": -13.719, "amplitude": 33.493, "phase_angle": 184.937, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.015, "origin": [ 28.440, 15.836, 141.072 ], "x_axis": [ 0.163, -0.172, 0.972 ], "y_axis": [ 0.836, 0.547, -0.044 ], "z_axis": [ -0.524, 0.820, 0.233 ], "quaternion": [ 0.697, -0.310, -0.536, -0.362 ] } }, { "index": 30, "index_chain": 2, "chain_name": "V", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/2", "linked_nts": [ "///V/1", "///V/3" ], "nt_type": "DNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 168.501, "beta": 172.487, "gamma": -176.528, "delta": 146.819, "epsilon": -141.520, "zeta": -85.118, "epsilon_zeta": -56.402, "bb_type": "BI", "chi": -148.756, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.346, 0.502 ], "P_xyz": [ 0.688, 9.822, -0.232 ], "form": ".", "ssZp": 1.771, "Dp": 2.084, "splay_angle": 15.659, "splay_distance": 2.830, "splay_ratio": 0.140, "d22": null, "d64": null, "eta": -163.129, "theta": -125.828, "eta_prime": -155.775, "theta_prime": -128.065, "eta_base": -106.742, "theta_base": -99.029, "v0": -6.588, "v1": 24.367, "v2": -32.415, "v3": 28.780, "v4": -14.086, "amplitude": 32.645, "phase_angle": 186.808, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.019, "origin": [ 26.090, 18.536, 142.701 ], "x_axis": [ 0.694, 0.145, 0.705 ], "y_axis": [ 0.592, 0.441, -0.674 ], "z_axis": [ -0.409, 0.886, 0.220 ], "quaternion": [ 0.767, -0.508, -0.363, -0.146 ] } }, { "index": 31, "index_chain": 3, "chain_name": "V", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/3", "linked_nts": [ "///V/2", "///V/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": 27.407, "beta": -177.980, "gamma": -70.056, "delta": 162.948, "epsilon": -157.819, "zeta": -49.615, "epsilon_zeta": -108.204, "bb_type": "BI", "chi": -95.021, "glyco_bond": "anti", "C5prime_xyz": [ -1.751, 7.662, -2.343 ], "P_xyz": [ -0.758, 9.849, -3.400 ], "form": ".", "ssZp": 0.758, "Dp": 1.388, "splay_angle": 18.207, "splay_distance": 3.283, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 153.428, "theta": -133.548, "eta_prime": -165.794, "theta_prime": -158.062, "eta_base": -131.227, "theta_base": -131.487, "v0": -7.809, "v1": 28.667, "v2": -37.362, "v3": 33.176, "v4": -16.390, "amplitude": 37.603, "phase_angle": 186.494, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 25.135, 20.834, 144.049 ], "x_axis": [ 0.975, 0.152, 0.160 ], "y_axis": [ 0.066, 0.488, -0.870 ], "z_axis": [ -0.210, 0.859, 0.466 ], "quaternion": [ 0.856, -0.505, -0.108, 0.025 ] } }, { "index": 32, "index_chain": 4, "chain_name": "V", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/4", "linked_nts": [ "///V/3", "///V/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.344, "beta": -65.471, "gamma": -106.049, "delta": 150.280, "epsilon": -174.242, "zeta": -109.926, "epsilon_zeta": -64.316, "bb_type": "BI", "chi": -123.568, "glyco_bond": "anti", "C5prime_xyz": [ -1.551, 8.383, -0.694 ], "P_xyz": [ -2.449, 9.841, -2.675 ], "form": "B", "ssZp": 2.610, "Dp": 2.193, "splay_angle": 21.530, "splay_distance": 3.443, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -177.684, "theta": 127.846, "eta_prime": 176.405, "theta_prime": 161.822, "eta_base": -155.235, "theta_base": -149.234, "v0": -12.001, "v1": 28.794, "v2": -33.774, "v3": 27.361, "v4": -9.778, "amplitude": 33.795, "phase_angle": 177.986, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.012, "origin": [ 24.498, 23.391, 146.006 ], "x_axis": [ 0.957, 0.217, -0.194 ], "y_axis": [ -0.269, 0.400, -0.876 ], "z_axis": [ -0.112, 0.890, 0.441 ], "quaternion": [ 0.836, -0.528, 0.025, 0.145 ] } }, { "index": 33, "index_chain": 5, "chain_name": "V", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/5", "linked_nts": [ "///V/4", "///V/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.899, "beta": -172.341, "gamma": 50.109, "delta": 149.736, "epsilon": 178.949, "zeta": -104.850, "epsilon_zeta": -76.201, "bb_type": "BI", "chi": -106.803, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.165, -1.711 ], "P_xyz": [ 0.925, 8.852, -0.957 ], "form": ".", "ssZp": 1.605, "Dp": 1.796, "splay_angle": 18.434, "splay_distance": 3.498, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 170.168, "theta": -112.031, "eta_prime": -160.256, "theta_prime": -138.379, "eta_base": -116.248, "theta_base": -105.853, "v0": -8.531, "v1": 28.089, "v2": -35.762, "v3": 31.435, "v4": -14.598, "amplitude": 35.893, "phase_angle": 184.888, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ 23.887, 26.354, 147.649 ], "x_axis": [ 0.568, 0.412, -0.713 ], "y_axis": [ -0.818, 0.185, -0.545 ], "z_axis": [ -0.092, 0.892, 0.442 ], "quaternion": [ 0.741, -0.485, 0.209, 0.415 ] } }, { "index": 34, "index_chain": 6, "chain_name": "V", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/6", "linked_nts": [ "///V/5", "///V/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 35.097, "beta": 174.222, "gamma": -55.122, "delta": 153.816, "epsilon": 175.890, "zeta": -61.135, "epsilon_zeta": -122.975, "bb_type": "BI", "chi": -100.643, "glyco_bond": "anti", "C5prime_xyz": [ -2.023, 8.109, -1.798 ], "P_xyz": [ -1.148, 10.589, -1.978 ], "form": ".", "ssZp": 2.189, "Dp": 1.988, "splay_angle": 19.932, "splay_distance": 3.505, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 163.985, "theta": -151.646, "eta_prime": -171.457, "theta_prime": -166.520, "eta_base": -128.708, "theta_base": -122.034, "v0": -12.375, "v1": 30.611, "v2": -36.468, "v3": 29.958, "v4": -11.106, "amplitude": 36.474, "phase_angle": 179.019, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 24.854, 29.461, 148.933 ], "x_axis": [ 0.099, 0.407, -0.908 ], "y_axis": [ -0.993, -0.016, -0.116 ], "z_axis": [ -0.062, 0.913, 0.402 ], "quaternion": [ 0.609, -0.422, 0.347, 0.574 ] } }, { "index": 35, "index_chain": 7, "chain_name": "V", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/7", "linked_nts": [ "///V/6", "///V/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -139.129, "beta": 87.349, "gamma": 170.223, "delta": 148.650, "epsilon": -168.244, "zeta": -87.297, "epsilon_zeta": -80.948, "bb_type": "BI", "chi": -149.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.586, 8.382, 0.627 ], "P_xyz": [ -0.993, 10.119, -1.238 ], "form": "B", "ssZp": 2.315, "Dp": 2.336, "splay_angle": 19.816, "splay_distance": 3.146, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -146.145, "theta": 160.224, "eta_prime": -157.908, "theta_prime": -170.103, "eta_base": -110.676, "theta_base": -127.844, "v0": -11.506, "v1": 28.389, "v2": -33.583, "v3": 27.493, "v4": -10.132, "amplitude": 33.591, "phase_angle": 178.742, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ 25.413, 32.885, 149.439 ], "x_axis": [ -0.440, 0.388, -0.810 ], "y_axis": [ -0.898, -0.211, 0.387 ], "z_axis": [ -0.021, 0.897, 0.442 ], "quaternion": [ 0.444, -0.287, 0.444, 0.723 ] } }, { "index": 36, "index_chain": 8, "chain_name": "V", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/8", "linked_nts": [ "///V/7", "///V/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.267, "beta": -149.772, "gamma": 42.324, "delta": 146.351, "epsilon": 147.890, "zeta": -80.664, "epsilon_zeta": -131.446, "bb_type": "BI", "chi": -96.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.641, 7.746, -2.247 ], "P_xyz": [ 0.464, 9.039, -1.439 ], "form": "B", "ssZp": 1.369, "Dp": 1.605, "splay_angle": 21.088, "splay_distance": 3.449, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 154.670, "theta": -143.779, "eta_prime": -164.841, "theta_prime": -162.736, "eta_base": -121.015, "theta_base": -120.534, "v0": -5.652, "v1": 25.053, "v2": -33.902, "v3": 31.078, "v4": -16.210, "amplitude": 34.327, "phase_angle": 189.031, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.046, "frame": { "rmsd": 0.015, "origin": [ 25.933, 35.707, 150.727 ], "x_axis": [ -0.928, 0.177, -0.327 ], "y_axis": [ -0.370, -0.352, 0.860 ], "z_axis": [ 0.037, 0.919, 0.392 ], "quaternion": [ 0.167, -0.089, 0.544, 0.817 ] } }, { "index": 37, "index_chain": 9, "chain_name": "V", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/9", "linked_nts": [ "///V/8", "///V/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.323, "beta": -146.761, "gamma": 41.207, "delta": 148.344, "epsilon": -179.844, "zeta": -121.772, "epsilon_zeta": -58.072, "bb_type": "BI", "chi": -96.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.864, 7.840, -2.280 ], "P_xyz": [ -0.024, 9.450, -1.443 ], "form": "B", "ssZp": 1.189, "Dp": 1.645, "splay_angle": 18.589, "splay_distance": 3.315, "splay_ratio": 0.166, "d22": 4.406, "d64": 4.140, "eta": -176.078, "theta": -135.645, "eta_prime": -156.874, "theta_prime": -155.208, "eta_base": -113.200, "theta_base": -112.856, "v0": -8.965, "v1": 27.878, "v2": -35.150, "v3": 30.663, "v4": -13.896, "amplitude": 35.239, "phase_angle": 184.080, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.016, "origin": [ 26.392, 38.971, 151.744 ], "x_axis": [ -0.966, 0.045, 0.254 ], "y_axis": [ 0.207, -0.450, 0.869 ], "z_axis": [ 0.153, 0.892, 0.425 ], "quaternion": [ -0.048, 0.121, 0.522, 0.843 ] } }, { "index": 38, "index_chain": 10, "chain_name": "V", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/10", "linked_nts": [ "///V/9", "///V/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 45.885, "beta": 177.100, "gamma": -58.591, "delta": 158.701, "epsilon": 176.513, "zeta": -111.350, "epsilon_zeta": -72.137, "bb_type": "BI", "chi": -98.720, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 7.810, -1.987 ], "P_xyz": [ -0.614, 10.042, -2.534 ], "form": "B", "ssZp": 1.743, "Dp": 1.759, "splay_angle": 20.436, "splay_distance": 3.343, "splay_ratio": 0.177, "d22": 4.227, "d64": 3.604, "eta": 178.179, "theta": -171.286, "eta_prime": -163.820, "theta_prime": -172.717, "eta_base": -118.555, "theta_base": -113.780, "v0": -7.275, "v1": 27.017, "v2": -35.084, "v3": 31.569, "v4": -15.422, "amplitude": 35.326, "phase_angle": 186.708, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.007, "origin": [ 26.415, 42.117, 152.786 ], "x_axis": [ -0.656, -0.105, 0.748 ], "y_axis": [ 0.729, -0.348, 0.590 ], "z_axis": [ 0.198, 0.932, 0.305 ], "quaternion": [ -0.274, 0.311, 0.501, 0.760 ] } }, { "index": 39, "index_chain": 11, "chain_name": "V", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/11", "linked_nts": [ "///V/10", "///V/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.211, "beta": 174.345, "gamma": 48.319, "delta": 147.068, "epsilon": -161.076, "zeta": -114.753, "epsilon_zeta": -46.323, "bb_type": "BI", "chi": -101.798, "glyco_bond": "anti", "C5prime_xyz": [ -2.246, 8.218, -1.859 ], "P_xyz": [ 0.052, 9.334, -1.538 ], "form": ".", "ssZp": 1.612, "Dp": 1.699, "splay_angle": 17.065, "splay_distance": 3.235, "splay_ratio": 0.158, "d22": 4.264, "d64": 4.240, "eta": 176.595, "theta": -125.900, "eta_prime": -154.687, "theta_prime": -154.743, "eta_base": -97.077, "theta_base": -124.662, "v0": -13.128, "v1": 31.464, "v2": -36.812, "v3": 30.287, "v4": -10.891, "amplitude": 36.829, "phase_angle": 178.274, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ 26.888, 44.947, 154.501 ], "x_axis": [ 0.011, -0.227, 0.974 ], "y_axis": [ 0.981, -0.189, -0.055 ], "z_axis": [ 0.196, 0.955, 0.221 ], "quaternion": [ 0.511, -0.495, -0.381, -0.591 ] } }, { "index": 40, "index_chain": 12, "chain_name": "V", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/12", "linked_nts": [ "///V/11", "///V/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 23.481, "beta": -158.413, "gamma": -65.705, "delta": 151.148, "epsilon": -164.883, "zeta": -125.815, "epsilon_zeta": -39.068, "bb_type": "BI", "chi": -106.886, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.141, -1.550 ], "P_xyz": [ -0.986, 10.496, -2.328 ], "form": "B", "ssZp": 1.805, "Dp": 1.767, "splay_angle": 20.976, "splay_distance": 3.656, "splay_ratio": 0.183, "d22": 4.499, "d64": 3.963, "eta": 176.334, "theta": -170.265, "eta_prime": -174.362, "theta_prime": -169.651, "eta_base": -139.066, "theta_base": -131.959, "v0": -9.844, "v1": 27.672, "v2": -33.988, "v3": 29.117, "v4": -12.255, "amplitude": 34.011, "phase_angle": 182.111, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 26.265, 47.950, 155.530 ], "x_axis": [ 0.486, -0.326, 0.811 ], "y_axis": [ 0.863, 0.031, -0.505 ], "z_axis": [ 0.139, 0.945, 0.296 ], "quaternion": [ 0.673, -0.538, -0.249, -0.441 ] } }, { "index": 41, "index_chain": 13, "chain_name": "V", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/13", "linked_nts": [ "///V/12", "///V/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 39.008, "beta": 175.514, "gamma": -60.727, "delta": 157.113, "epsilon": 172.891, "zeta": -87.589, "epsilon_zeta": -99.520, "bb_type": "BI", "chi": -110.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.152, 7.979, -1.524 ], "P_xyz": [ 0.430, 10.028, -1.669 ], "form": "B", "ssZp": 2.021, "Dp": 1.977, "splay_angle": 21.087, "splay_distance": 3.432, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 166.517, "theta": -152.211, "eta_prime": -173.589, "theta_prime": -150.049, "eta_base": -132.279, "theta_base": -104.856, "v0": -3.655, "v1": 23.332, "v2": -32.973, "v3": 31.308, "v4": -17.510, "amplitude": 33.728, "phase_angle": 192.140, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 26.424, 51.362, 156.835 ], "x_axis": [ 0.859, -0.369, 0.356 ], "y_axis": [ 0.446, 0.196, -0.873 ], "z_axis": [ 0.252, 0.909, 0.333 ], "quaternion": [ 0.773, -0.577, -0.034, -0.264 ] } }, { "index": 42, "index_chain": 14, "chain_name": "V", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/14", "linked_nts": [ "///V/13", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -80.309, "beta": -164.102, "gamma": 55.648, "delta": 159.812, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -94.355, "glyco_bond": "anti", "C5prime_xyz": [ -2.489, 7.905, -1.962 ], "P_xyz": [ -0.142, 9.083, -1.800 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.520, "v1": 30.150, "v2": -37.250, "v3": 32.020, "v4": -13.614, "amplitude": 37.284, "phase_angle": 182.479, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.015, "origin": [ 28.137, 54.215, 157.675 ], "x_axis": [ 0.923, -0.284, -0.261 ], "y_axis": [ -0.124, 0.422, -0.898 ], "z_axis": [ 0.365, 0.861, 0.355 ], "quaternion": [ 0.822, -0.535, 0.190, -0.049 ] } }, { "index": 43, "index_chain": 1, "chain_name": "Z", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/1", "linked_nts": [ null, "///Z/2" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 66.871, "delta": 151.222, "epsilon": -163.056, "zeta": -107.534, "epsilon_zeta": -55.522, "bb_type": "BI", "chi": -124.746, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.300, -0.788 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.703, "Dp": 1.863, "splay_angle": 17.096, "splay_distance": 3.172, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.939, "v1": 25.989, "v2": -34.105, "v3": 30.833, "v4": -15.073, "amplitude": 34.365, "phase_angle": 187.048, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.023, "origin": [ 31.563, 58.943, 160.111 ], "x_axis": [ 0.424, -0.155, -0.893 ], "y_axis": [ 0.796, -0.406, 0.448 ], "z_axis": [ -0.432, -0.900, -0.049 ], "quaternion": [ 0.492, 0.685, 0.234, -0.483 ] } }, { "index": 44, "index_chain": 2, "chain_name": "Z", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/2", "linked_nts": [ "///Z/1", "///Z/3" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": 36.165, "beta": 170.092, "gamma": -60.838, "delta": 152.901, "epsilon": -174.305, "zeta": -40.803, "epsilon_zeta": -133.502, "bb_type": "BI", "chi": -92.751, "glyco_bond": "anti", "C5prime_xyz": [ -2.156, 7.657, -2.333 ], "P_xyz": [ -1.475, 10.083, -2.906 ], "form": ".", "ssZp": 1.347, "Dp": 1.720, "splay_angle": 18.387, "splay_distance": 3.290, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 158.483, "theta": -136.695, "eta_prime": -172.925, "theta_prime": -161.389, "eta_base": -147.696, "theta_base": -135.270, "v0": -12.967, "v1": 30.309, "v2": -35.651, "v3": 28.640, "v4": -10.168, "amplitude": 35.680, "phase_angle": 177.668, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 29.347, 56.853, 159.227 ], "x_axis": [ 0.780, -0.201, -0.593 ], "y_axis": [ 0.472, -0.432, 0.768 ], "z_axis": [ -0.410, -0.879, -0.242 ], "quaternion": [ 0.526, 0.783, 0.087, -0.320 ] } }, { "index": 45, "index_chain": 3, "chain_name": "Z", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/3", "linked_nts": [ "///Z/2", "///Z/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -127.631, "beta": 47.675, "gamma": -174.195, "delta": 136.673, "epsilon": -155.259, "zeta": -113.525, "epsilon_zeta": -41.734, "bb_type": "BI", "chi": -133.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.691, 8.688, -0.088 ], "P_xyz": [ -2.289, 9.830, -2.427 ], "form": "B", "ssZp": 2.979, "Dp": 2.603, "splay_angle": 21.225, "splay_distance": 3.450, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -170.287, "theta": 134.312, "eta_prime": 177.943, "theta_prime": 169.943, "eta_base": -152.812, "theta_base": -149.569, "v0": -20.308, "v1": 32.907, "v2": -33.543, "v3": 21.945, "v4": -1.004, "amplitude": 34.955, "phase_angle": 163.660, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 27.882, 54.332, 157.702 ], "x_axis": [ 0.916, -0.307, -0.260 ], "y_axis": [ 0.136, -0.372, 0.918 ], "z_axis": [ -0.378, -0.876, -0.299 ], "quaternion": [ 0.558, 0.804, -0.053, -0.198 ] } }, { "index": 46, "index_chain": 4, "chain_name": "Z", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///Z/4", "linked_nts": [ "///Z/3", "///Z/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.072, "beta": 176.122, "gamma": 46.866, "delta": 147.111, "epsilon": 175.279, "zeta": -92.041, "epsilon_zeta": -92.681, "bb_type": "BI", "chi": -103.491, "glyco_bond": "anti", "C5prime_xyz": [ -2.023, 8.157, -1.767 ], "P_xyz": [ 0.368, 8.988, -1.243 ], "form": "B", "ssZp": 1.917, "Dp": 1.899, "splay_angle": 19.425, "splay_distance": 3.331, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 163.708, "theta": -126.560, "eta_prime": -162.715, "theta_prime": -146.929, "eta_base": -125.038, "theta_base": -108.939, "v0": -12.365, "v1": 29.812, "v2": -35.231, "v3": 28.607, "v4": -10.406, "amplitude": 35.246, "phase_angle": 178.329, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 26.415, 51.418, 156.579 ], "x_axis": [ 0.858, -0.394, 0.330 ], "y_axis": [ -0.434, -0.213, 0.876 ], "z_axis": [ -0.275, -0.894, -0.353 ], "quaternion": [ 0.568, 0.778, -0.266, 0.018 ] } }, { "index": 47, "index_chain": 5, "chain_name": "Z", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///Z/5", "linked_nts": [ "///Z/4", "///Z/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.969, "beta": -160.005, "gamma": 28.746, "delta": 150.004, "epsilon": 179.711, "zeta": -56.223, "epsilon_zeta": -124.067, "bb_type": "BI", "chi": -90.668, "glyco_bond": "anti", "C5prime_xyz": [ -2.579, 7.941, -2.054 ], "P_xyz": [ -0.791, 9.823, -1.780 ], "form": ".", "ssZp": 2.323, "Dp": 2.006, "splay_angle": 19.438, "splay_distance": 3.520, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 165.207, "theta": -129.565, "eta_prime": -170.190, "theta_prime": -158.929, "eta_base": -123.421, "theta_base": -120.378, "v0": -14.578, "v1": 32.535, "v2": -37.274, "v3": 29.769, "v4": -9.732, "amplitude": 37.356, "phase_angle": 176.204, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 26.329, 48.322, 155.353 ], "x_axis": [ 0.479, -0.433, 0.763 ], "y_axis": [ -0.848, -0.001, 0.531 ], "z_axis": [ -0.229, -0.901, -0.368 ], "quaternion": [ 0.527, 0.680, -0.471, 0.197 ] } }, { "index": 48, "index_chain": 6, "chain_name": "Z", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/6", "linked_nts": [ "///Z/5", "///Z/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -122.102, "beta": 65.013, "gamma": -171.897, "delta": 149.656, "epsilon": -151.210, "zeta": -120.912, "epsilon_zeta": -30.298, "bb_type": "BI", "chi": -151.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.662, 8.386, 0.648 ], "P_xyz": [ -1.545, 10.285, -1.163 ], "form": "B", "ssZp": 1.423, "Dp": 1.904, "splay_angle": 19.377, "splay_distance": 3.192, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -130.852, "theta": 163.805, "eta_prime": -151.034, "theta_prime": -172.499, "eta_base": -109.931, "theta_base": -128.017, "v0": -11.124, "v1": 28.933, "v2": -34.801, "v3": 29.172, "v4": -11.449, "amplitude": 34.801, "phase_angle": 180.302, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.014, "origin": [ 26.864, 44.926, 154.598 ], "x_axis": [ 0.039, -0.320, 0.947 ], "y_axis": [ -0.977, 0.189, 0.104 ], "z_axis": [ -0.212, -0.929, -0.305 ], "quaternion": [ -0.480, -0.537, 0.603, -0.342 ] } }, { "index": 49, "index_chain": 7, "chain_name": "Z", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/7", "linked_nts": [ "///Z/6", "///Z/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 142.369, "beta": -159.837, "gamma": 174.862, "delta": 140.665, "epsilon": -172.446, "zeta": -85.650, "epsilon_zeta": -86.795, "bb_type": "BI", "chi": -130.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.679, 8.611, -0.650 ], "P_xyz": [ 0.577, 9.322, -1.667 ], "form": "B", "ssZp": 1.664, "Dp": 2.165, "splay_angle": 19.901, "splay_distance": 3.339, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 143.688, "theta": -140.843, "eta_prime": -170.511, "theta_prime": -162.582, "eta_base": -123.951, "theta_base": -114.383, "v0": -18.051, "v1": 31.629, "v2": -33.227, "v3": 22.978, "v4": -3.235, "amplitude": 34.091, "phase_angle": 167.076, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.051, "frame": { "rmsd": 0.026, "origin": [ 26.673, 42.175, 152.989 ], "x_axis": [ -0.641, -0.205, 0.740 ], "y_axis": [ -0.752, 0.360, -0.552 ], "z_axis": [ -0.153, -0.910, -0.385 ], "quaternion": [ -0.289, -0.310, 0.772, -0.473 ] } }, { "index": 50, "index_chain": 8, "chain_name": "Z", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/8", "linked_nts": [ "///Z/7", "///Z/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -28.420, "beta": -150.132, "gamma": 4.609, "delta": 153.549, "epsilon": -176.854, "zeta": -118.108, "epsilon_zeta": -58.746, "bb_type": "BI", "chi": -100.636, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 7.659, -2.039 ], "P_xyz": [ 0.305, 9.643, -1.511 ], "form": "B", "ssZp": 1.209, "Dp": 1.666, "splay_angle": 19.482, "splay_distance": 3.400, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 178.628, "theta": -143.510, "eta_prime": -157.263, "theta_prime": -153.929, "eta_base": -105.779, "theta_base": -117.161, "v0": -0.782, "v1": 22.580, "v2": -34.275, "v3": 34.716, "v4": -21.543, "amplitude": 35.903, "phase_angle": 197.320, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.011, "origin": [ 26.198, 39.035, 151.960 ], "x_axis": [ -0.989, -0.028, 0.143 ], "y_axis": [ -0.141, 0.425, -0.894 ], "z_axis": [ -0.036, -0.905, -0.424 ], "quaternion": [ -0.053, -0.050, 0.842, -0.534 ] } }, { "index": 51, "index_chain": 9, "chain_name": "Z", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/9", "linked_nts": [ "///Z/8", "///Z/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 36.831, "beta": 176.338, "gamma": -55.197, "delta": 149.748, "epsilon": 148.343, "zeta": -71.937, "epsilon_zeta": -139.719, "bb_type": "BI", "chi": -98.103, "glyco_bond": "anti", "C5prime_xyz": [ -1.662, 7.779, -1.935 ], "P_xyz": [ -0.273, 9.879, -2.491 ], "form": "B", "ssZp": 2.074, "Dp": 1.683, "splay_angle": 20.985, "splay_distance": 3.500, "splay_ratio": 0.184, "d22": 4.125, "d64": 3.721, "eta": 167.298, "theta": -160.573, "eta_prime": -167.427, "theta_prime": -174.896, "eta_base": -127.245, "theta_base": -117.760, "v0": -4.465, "v1": 22.979, "v2": -31.695, "v3": 29.697, "v4": -15.936, "amplitude": 32.241, "phase_angle": 190.563, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.014, "origin": [ 26.112, 35.813, 150.875 ], "x_axis": [ -0.911, 0.115, -0.395 ], "y_axis": [ 0.410, 0.343, -0.845 ], "z_axis": [ 0.038, -0.932, -0.360 ], "quaternion": [ 0.134, 0.162, 0.808, -0.550 ] } }, { "index": 52, "index_chain": 10, "chain_name": "Z", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/10", "linked_nts": [ "///Z/9", "///Z/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -161.345, "beta": 143.438, "gamma": 166.956, "delta": 144.370, "epsilon": -147.446, "zeta": -94.413, "epsilon_zeta": -53.032, "bb_type": "BI", "chi": -139.957, "glyco_bond": "anti", "C5prime_xyz": [ -1.167, 8.399, 0.088 ], "P_xyz": [ 0.750, 9.683, -1.039 ], "form": ".", "ssZp": 1.762, "Dp": 2.103, "splay_angle": 17.726, "splay_distance": 3.261, "splay_ratio": 0.157, "d22": 4.269, "d64": 4.089, "eta": -160.068, "theta": -145.448, "eta_prime": -155.876, "theta_prime": -149.990, "eta_base": -97.852, "theta_base": -121.571, "v0": -7.848, "v1": 25.323, "v2": -32.381, "v3": 28.282, "v4": -13.007, "amplitude": 32.489, "phase_angle": 184.657, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.013, "origin": [ 25.295, 32.744, 149.406 ], "x_axis": [ -0.397, 0.277, -0.875 ], "y_axis": [ 0.914, 0.203, -0.351 ], "z_axis": [ 0.081, -0.939, -0.334 ], "quaternion": [ 0.343, 0.428, 0.696, -0.464 ] } }, { "index": 53, "index_chain": 11, "chain_name": "Z", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/11", "linked_nts": [ "///Z/10", "///Z/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 34.506, "beta": -162.656, "gamma": -78.453, "delta": 152.173, "epsilon": -162.740, "zeta": -107.724, "epsilon_zeta": -55.017, "bb_type": "BI", "chi": -118.240, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.252, -1.073 ], "P_xyz": [ -0.487, 10.554, -1.709 ], "form": ".", "ssZp": 2.009, "Dp": 2.002, "splay_angle": 18.727, "splay_distance": 3.406, "splay_ratio": 0.167, "d22": 4.401, "d64": 4.196, "eta": 163.727, "theta": -160.470, "eta_prime": -169.862, "theta_prime": -163.545, "eta_base": -134.422, "theta_base": -130.418, "v0": -9.723, "v1": 27.347, "v2": -33.428, "v3": 28.517, "v4": -12.052, "amplitude": 33.447, "phase_angle": 181.948, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.018, "origin": [ 24.766, 29.589, 148.773 ], "x_axis": [ 0.091, 0.355, -0.930 ], "y_axis": [ 0.995, 0.015, 0.103 ], "z_axis": [ 0.051, -0.935, -0.352 ], "quaternion": [ 0.434, 0.597, 0.565, -0.368 ] } }, { "index": 54, "index_chain": 12, "chain_name": "Z", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/12", "linked_nts": [ "///Z/11", "///Z/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 26.214, "beta": -164.462, "gamma": -62.099, "delta": 151.458, "epsilon": 175.245, "zeta": -89.016, "epsilon_zeta": -95.739, "bb_type": "BI", "chi": -113.981, "glyco_bond": "anti", "C5prime_xyz": [ -1.178, 8.133, -1.311 ], "P_xyz": [ 0.007, 10.451, -1.665 ], "form": "B", "ssZp": 2.158, "Dp": 2.086, "splay_angle": 20.580, "splay_distance": 3.408, "splay_ratio": 0.179, "d22": 4.227, "d64": 3.718, "eta": 167.641, "theta": -166.041, "eta_prime": -173.840, "theta_prime": -158.490, "eta_base": -135.450, "theta_base": -119.837, "v0": -5.815, "v1": 24.389, "v2": -32.762, "v3": 29.746, "v4": -15.216, "amplitude": 33.111, "phase_angle": 188.326, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.010, "origin": [ 23.910, 26.587, 147.410 ], "x_axis": [ 0.595, 0.357, -0.720 ], "y_axis": [ 0.802, -0.211, 0.559 ], "z_axis": [ 0.048, -0.910, -0.412 ], "quaternion": [ 0.493, 0.745, 0.389, -0.226 ] } }, { "index": 55, "index_chain": 13, "chain_name": "Z", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/13", "linked_nts": [ "///Z/12", "///Z/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.923, "beta": -162.569, "gamma": 39.436, "delta": 149.310, "epsilon": -170.473, "zeta": -136.086, "epsilon_zeta": -34.387, "bb_type": "--", "chi": -94.099, "glyco_bond": "anti", "C5prime_xyz": [ -2.201, 7.972, -2.102 ], "P_xyz": [ -0.088, 9.414, -1.613 ], "form": "B", "ssZp": 1.892, "Dp": 1.820, "splay_angle": 19.207, "splay_distance": 3.292, "splay_ratio": 0.168, "d22": 3.709, "d64": 3.613, "eta": 168.026, "theta": -132.772, "eta_prime": -162.541, "theta_prime": -143.237, "eta_base": -122.495, "theta_base": -107.804, "v0": -12.225, "v1": 30.336, "v2": -36.293, "v3": 29.867, "v4": -11.191, "amplitude": 36.296, "phase_angle": 179.229, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.013, "origin": [ 24.190, 23.605, 145.785 ], "x_axis": [ 0.924, 0.258, -0.283 ], "y_axis": [ 0.369, -0.402, 0.838 ], "z_axis": [ 0.103, -0.879, -0.467 ], "quaternion": [ 0.514, 0.836, 0.188, -0.054 ] } }, { "index": 56, "index_chain": 14, "chain_name": "Z", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/14", "linked_nts": [ "///Z/13", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 26.531, "beta": 144.442, "gamma": -27.826, "delta": 156.961, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -79.572, "glyco_bond": "anti", "C5prime_xyz": [ -2.965, 7.669, -1.947 ], "P_xyz": [ -1.304, 9.684, -2.029 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -12.158, "v1": 30.158, "v2": -35.388, "v3": 29.341, "v4": -10.907, "amplitude": 35.394, "phase_angle": 178.912, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.034, "origin": [ 25.332, 20.987, 144.147 ], "x_axis": [ 0.965, 0.134, 0.226 ], "y_axis": [ -0.123, -0.527, 0.841 ], "z_axis": [ 0.232, -0.839, -0.492 ], "quaternion": [ 0.486, 0.864, 0.003, 0.132 ] } }, { "index": 57, "index_chain": 1, "chain_name": "T", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/1", "linked_nts": [ null, "///T/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -60.913, "delta": 151.966, "epsilon": 173.095, "zeta": -78.051, "epsilon_zeta": -108.855, "bb_type": "BI", "chi": -122.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.418, -0.798 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.952, "Dp": 1.986, "splay_angle": 21.177, "splay_distance": 3.462, "splay_ratio": 0.185, "d22": 4.253, "d64": 3.605, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.080, "v1": 28.546, "v2": -35.212, "v3": 30.052, "v4": -12.636, "amplitude": 35.237, "phase_angle": 182.146, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.002, "origin": [ 44.877, -25.335, 149.882 ], "x_axis": [ -0.928, -0.102, -0.359 ], "y_axis": [ -0.334, 0.658, 0.675 ], "z_axis": [ 0.168, 0.746, -0.645 ], "quaternion": [ 0.147, -0.121, 0.899, 0.395 ] } }, { "index": 58, "index_chain": 2, "chain_name": "T", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/2", "linked_nts": [ "///T/1", "///T/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -77.537, "beta": -149.019, "gamma": 39.757, "delta": 150.103, "epsilon": -179.071, "zeta": -88.946, "epsilon_zeta": -90.125, "bb_type": "BI", "chi": -87.834, "glyco_bond": "anti", "C5prime_xyz": [ -2.357, 7.695, -2.356 ], "P_xyz": [ -0.364, 9.359, -1.936 ], "form": ".", "ssZp": 1.955, "Dp": 1.990, "splay_angle": 23.707, "splay_distance": 4.120, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 158.491, "theta": -126.331, "eta_prime": -169.337, "theta_prime": -135.641, "eta_base": -111.534, "theta_base": -123.781, "v0": -12.084, "v1": 30.138, "v2": -35.833, "v3": 29.738, "v4": -11.187, "amplitude": 35.835, "phase_angle": 179.326, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 44.360, -22.847, 147.530 ], "x_axis": [ -0.914, 0.352, 0.202 ], "y_axis": [ 0.386, 0.602, 0.699 ], "z_axis": [ 0.125, 0.717, -0.686 ], "quaternion": [ -0.021, 0.206, 0.895, 0.396 ] } }, { "index": 59, "index_chain": 3, "chain_name": "T", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/3", "linked_nts": [ "///T/2", "///T/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -63.671, "beta": -156.999, "gamma": 25.094, "delta": 152.517, "epsilon": -151.166, "zeta": -77.265, "epsilon_zeta": -73.901, "bb_type": "BI", "chi": -75.009, "glyco_bond": "anti", "C5prime_xyz": [ -3.229, 7.316, -2.607 ], "P_xyz": [ -2.004, 9.612, -2.892 ], "form": ".", "ssZp": 1.599, "Dp": 1.632, "splay_angle": 17.615, "splay_distance": 3.199, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 165.753, "theta": -131.166, "eta_prime": -171.432, "theta_prime": -164.564, "eta_base": -155.041, "theta_base": -125.455, "v0": -14.364, "v1": 33.714, "v2": -39.272, "v3": 32.141, "v4": -11.497, "amplitude": 39.298, "phase_angle": 177.896, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 44.214, -20.017, 144.540 ], "x_axis": [ -0.758, 0.154, 0.634 ], "y_axis": [ 0.624, 0.454, 0.636 ], "z_axis": [ -0.190, 0.878, -0.440 ], "quaternion": [ -0.253, 0.239, 0.814, 0.465 ] } }, { "index": 60, "index_chain": 4, "chain_name": "T", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/4", "linked_nts": [ "///T/3", "///T/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -27.982, "beta": -68.835, "gamma": -101.602, "delta": 150.449, "epsilon": -176.976, "zeta": -99.693, "epsilon_zeta": -77.283, "bb_type": "BI", "chi": -127.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.262, 8.282, -0.539 ], "P_xyz": [ -2.131, 10.024, -2.272 ], "form": "B", "ssZp": 3.007, "Dp": 2.439, "splay_angle": 21.947, "splay_distance": 3.492, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -167.709, "theta": 137.437, "eta_prime": 174.361, "theta_prime": 171.773, "eta_base": -142.818, "theta_base": -152.299, "v0": -10.020, "v1": 26.866, "v2": -32.429, "v3": 27.230, "v4": -10.909, "amplitude": 32.432, "phase_angle": 180.720, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.019, "origin": [ 42.676, -17.392, 143.549 ], "x_axis": [ -0.348, 0.256, 0.902 ], "y_axis": [ 0.894, 0.380, 0.237 ], "z_axis": [ -0.282, 0.889, -0.361 ], "quaternion": [ -0.410, 0.398, 0.723, 0.390 ] } }, { "index": 61, "index_chain": 5, "chain_name": "T", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/5", "linked_nts": [ "///T/4", "///T/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.248, "beta": -159.703, "gamma": 50.054, "delta": 150.333, "epsilon": -172.445, "zeta": -115.892, "epsilon_zeta": -56.553, "bb_type": "BI", "chi": -100.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.720, 8.007, -1.922 ], "P_xyz": [ 0.534, 8.998, -1.157 ], "form": "B", "ssZp": 1.449, "Dp": 1.483, "splay_angle": 19.016, "splay_distance": 3.416, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 174.439, "theta": -122.000, "eta_prime": -156.792, "theta_prime": -144.869, "eta_base": -126.755, "theta_base": -102.662, "v0": -7.043, "v1": 26.864, "v2": -35.489, "v3": 31.900, "v4": -15.908, "amplitude": 35.775, "phase_angle": 187.253, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 41.311, -14.563, 142.022 ], "x_axis": [ 0.237, 0.300, 0.924 ], "y_axis": [ 0.913, 0.257, -0.317 ], "z_axis": [ -0.333, 0.919, -0.213 ], "quaternion": [ 0.566, -0.546, -0.555, -0.271 ] } }, { "index": 62, "index_chain": 6, "chain_name": "T", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/6", "linked_nts": [ "///T/5", "///T/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 30.598, "beta": 176.576, "gamma": -51.229, "delta": 148.675, "epsilon": 168.615, "zeta": -59.614, "epsilon_zeta": -131.771, "bb_type": "BI", "chi": -102.173, "glyco_bond": "anti", "C5prime_xyz": [ -1.706, 7.985, -1.814 ], "P_xyz": [ -0.543, 10.270, -1.941 ], "form": ".", "ssZp": 1.759, "Dp": 1.744, "splay_angle": 19.724, "splay_distance": 3.462, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 168.585, "theta": -148.003, "eta_prime": -168.552, "theta_prime": -163.955, "eta_base": -119.922, "theta_base": -120.283, "v0": -8.257, "v1": 26.282, "v2": -33.569, "v3": 29.123, "v4": -13.398, "amplitude": 33.669, "phase_angle": 184.419, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 40.159, -11.351, 142.173 ], "x_axis": [ 0.732, 0.305, 0.609 ], "y_axis": [ 0.626, 0.049, -0.778 ], "z_axis": [ -0.268, 0.951, -0.155 ], "quaternion": [ 0.638, -0.678, -0.343, -0.126 ] } }, { "index": 63, "index_chain": 7, "chain_name": "T", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/7", "linked_nts": [ "///T/6", "///T/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -155.959, "beta": 108.474, "gamma": 171.106, "delta": 148.381, "epsilon": -154.741, "zeta": -104.632, "epsilon_zeta": -50.108, "bb_type": "BI", "chi": -142.104, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.438, 0.213 ], "P_xyz": [ -0.604, 10.103, -1.571 ], "form": "B", "ssZp": 1.988, "Dp": 1.960, "splay_angle": 19.749, "splay_distance": 3.247, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -151.655, "theta": 161.238, "eta_prime": -157.968, "theta_prime": -174.826, "eta_base": -112.910, "theta_base": -133.260, "v0": -12.600, "v1": 29.252, "v2": -34.125, "v3": 27.475, "v4": -9.499, "amplitude": 34.161, "phase_angle": 177.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.046, "frame": { "rmsd": 0.025, "origin": [ 39.357, -7.998, 142.481 ], "x_axis": [ 0.935, 0.346, 0.081 ], "y_axis": [ 0.131, -0.123, -0.984 ], "z_axis": [ -0.330, 0.930, -0.160 ], "quaternion": [ 0.643, -0.745, -0.160, 0.084 ] } }, { "index": 64, "index_chain": 8, "chain_name": "T", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/8", "linked_nts": [ "///T/7", "///T/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.400, "beta": -175.325, "gamma": 29.583, "delta": 140.717, "epsilon": 158.596, "zeta": -87.236, "epsilon_zeta": -114.168, "bb_type": "BI", "chi": -100.301, "glyco_bond": "anti", "C5prime_xyz": [ -1.800, 7.944, -2.019 ], "P_xyz": [ 0.330, 9.222, -1.305 ], "form": "B", "ssZp": 1.542, "Dp": 1.741, "splay_angle": 21.712, "splay_distance": 3.624, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 158.074, "theta": -141.235, "eta_prime": -165.400, "theta_prime": -161.309, "eta_base": -122.924, "theta_base": -117.688, "v0": -8.042, "v1": 25.999, "v2": -33.389, "v3": 29.136, "v4": -13.503, "amplitude": 33.505, "phase_angle": 184.782, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 37.614, -5.264, 142.302 ], "x_axis": [ 0.789, 0.291, -0.540 ], "y_axis": [ -0.463, -0.295, -0.836 ], "z_axis": [ -0.403, 0.910, -0.098 ], "quaternion": [ 0.591, -0.739, 0.058, 0.319 ] } }, { "index": 65, "index_chain": 9, "chain_name": "T", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/9", "linked_nts": [ "///T/8", "///T/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -145.138, "beta": 161.759, "gamma": 149.168, "delta": 143.999, "epsilon": -153.960, "zeta": -115.704, "epsilon_zeta": -38.256, "bb_type": "BI", "chi": -129.903, "glyco_bond": "anti", "C5prime_xyz": [ -1.826, 8.590, -0.480 ], "P_xyz": [ 0.317, 9.660, -1.394 ], "form": "B", "ssZp": 1.592, "Dp": 2.044, "splay_angle": 17.659, "splay_distance": 3.113, "splay_ratio": 0.156, "d22": 4.499, "d64": 4.044, "eta": -173.936, "theta": -139.294, "eta_prime": -157.758, "theta_prime": -155.194, "eta_base": -111.010, "theta_base": -112.626, "v0": -17.532, "v1": 33.378, "v2": -35.939, "v3": 26.730, "v4": -5.894, "amplitude": 36.427, "phase_angle": 170.613, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.015, "origin": [ 36.334, -1.874, 142.291 ], "x_axis": [ 0.306, 0.139, -0.942 ], "y_axis": [ -0.813, -0.476, -0.335 ], "z_axis": [ -0.495, 0.868, -0.033 ], "quaternion": [ -0.446, 0.674, -0.250, -0.533 ] } }, { "index": 66, "index_chain": 10, "chain_name": "T", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/10", "linked_nts": [ "///T/9", "///T/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 33.750, "beta": -179.451, "gamma": -63.370, "delta": 154.076, "epsilon": 167.083, "zeta": -95.312, "epsilon_zeta": -97.604, "bb_type": "BI", "chi": -104.951, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 7.869, -1.625 ], "P_xyz": [ -0.377, 10.011, -2.191 ], "form": "B", "ssZp": 2.360, "Dp": 2.002, "splay_angle": 19.078, "splay_distance": 3.212, "splay_ratio": 0.167, "d22": 4.201, "d64": 3.936, "eta": 159.863, "theta": -167.711, "eta_prime": -172.253, "theta_prime": -170.321, "eta_base": -122.457, "theta_base": -127.374, "v0": -5.572, "v1": 23.538, "v2": -30.922, "v3": 28.658, "v4": -14.621, "amplitude": 31.263, "phase_angle": 188.468, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 35.348, 1.064, 142.001 ], "x_axis": [ -0.313, -0.069, -0.947 ], "y_axis": [ -0.864, -0.394, 0.315 ], "z_axis": [ -0.395, 0.917, 0.064 ], "quaternion": [ 0.298, -0.504, 0.463, 0.665 ] } }, { "index": 67, "index_chain": 11, "chain_name": "T", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/11", "linked_nts": [ "///T/10", "///T/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -41.515, "beta": -176.949, "gamma": 41.498, "delta": 149.048, "epsilon": -160.450, "zeta": -115.702, "epsilon_zeta": -44.748, "bb_type": "BI", "chi": -100.486, "glyco_bond": "anti", "C5prime_xyz": [ -2.440, 8.221, -1.857 ], "P_xyz": [ -0.406, 9.721, -1.337 ], "form": ".", "ssZp": 1.564, "Dp": 1.672, "splay_angle": 18.223, "splay_distance": 3.414, "splay_ratio": 0.169, "d22": 3.927, "d64": 3.994, "eta": -179.075, "theta": -128.127, "eta_prime": -151.000, "theta_prime": -152.005, "eta_base": -108.344, "theta_base": -113.314, "v0": -14.519, "v1": 32.504, "v2": -37.413, "v3": 30.015, "v4": -9.846, "amplitude": 37.486, "phase_angle": 176.440, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 34.425, 4.113, 141.591 ], "x_axis": [ -0.756, -0.196, -0.624 ], "y_axis": [ -0.581, -0.238, 0.778 ], "z_axis": [ -0.301, 0.951, 0.066 ], "quaternion": [ 0.134, -0.322, 0.603, 0.718 ] } }, { "index": 68, "index_chain": 12, "chain_name": "T", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/12", "linked_nts": [ "///T/11", "///T/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 20.313, "beta": -160.158, "gamma": -62.777, "delta": 151.605, "epsilon": -170.483, "zeta": -124.335, "epsilon_zeta": -46.149, "bb_type": "BI", "chi": -109.737, "glyco_bond": "anti", "C5prime_xyz": [ -1.692, 8.129, -1.303 ], "P_xyz": [ -0.986, 10.517, -1.813 ], "form": "B", "ssZp": 1.873, "Dp": 1.606, "splay_angle": 21.083, "splay_distance": 3.670, "splay_ratio": 0.185, "d22": 4.572, "d64": 4.146, "eta": 175.721, "theta": -168.493, "eta_prime": -173.111, "theta_prime": -168.178, "eta_base": -129.098, "theta_base": -126.075, "v0": -8.217, "v1": 26.550, "v2": -33.384, "v3": 29.796, "v4": -13.859, "amplitude": 33.509, "phase_angle": 184.944, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.014, "origin": [ 33.389, 7.217, 140.618 ], "x_axis": [ -0.914, -0.392, -0.105 ], "y_axis": [ -0.077, -0.087, 0.993 ], "z_axis": [ -0.398, 0.916, 0.049 ], "quaternion": [ -0.110, -0.176, 0.667, 0.716 ] } }, { "index": 69, "index_chain": 13, "chain_name": "T", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/13", "linked_nts": [ "///T/12", "///T/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 44.565, "beta": 171.436, "gamma": -59.455, "delta": 158.239, "epsilon": -176.462, "zeta": -100.222, "epsilon_zeta": -76.240, "bb_type": "BI", "chi": -109.908, "glyco_bond": "anti", "C5prime_xyz": [ -1.255, 8.019, -1.539 ], "P_xyz": [ 0.303, 10.069, -1.547 ], "form": "B", "ssZp": 1.773, "Dp": 1.783, "splay_angle": 19.935, "splay_distance": 3.297, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 173.207, "theta": -157.901, "eta_prime": -167.110, "theta_prime": -155.693, "eta_base": -123.048, "theta_base": -121.056, "v0": -4.489, "v1": 24.173, "v2": -33.545, "v3": 31.365, "v4": -17.074, "amplitude": 34.155, "phase_angle": 190.844, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 31.821, 10.515, 140.246 ], "x_axis": [ -0.768, -0.400, 0.500 ], "y_axis": [ 0.487, 0.144, 0.862 ], "z_axis": [ -0.416, 0.905, 0.084 ], "quaternion": [ -0.339, 0.032, 0.676, 0.654 ] } }, { "index": 70, "index_chain": 14, "chain_name": "T", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/14", "linked_nts": [ "///T/13", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -78.317, "beta": -165.294, "gamma": 48.168, "delta": 156.156, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -93.786, "glyco_bond": "anti", "C5prime_xyz": [ -2.214, 7.831, -2.064 ], "P_xyz": [ 0.138, 8.925, -1.836 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.586, "v1": 29.639, "v2": -36.173, "v3": 31.033, "v4": -12.940, "amplitude": 36.193, "phase_angle": 181.929, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.011, "origin": [ 30.959, 13.678, 140.594 ], "x_axis": [ -0.340, -0.384, 0.859 ], "y_axis": [ 0.798, 0.366, 0.479 ], "z_axis": [ -0.499, 0.848, 0.182 ], "quaternion": [ 0.550, -0.168, -0.617, -0.537 ] } }, { "index": 71, "index_chain": 1, "chain_name": "W", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/1", "linked_nts": [ null, "///W/2" ], "nt_type": "DNA", "dbn": "}", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 63.522, "delta": 149.946, "epsilon": -163.640, "zeta": -110.484, "epsilon_zeta": -53.157, "bb_type": "BI", "chi": -118.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.626, 8.157, -1.286 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.440, "Dp": 1.988, "splay_angle": 17.725, "splay_distance": 3.180, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -8.346, "v1": 26.545, "v2": -33.355, "v3": 29.006, "v4": -13.230, "amplitude": 33.440, "phase_angle": 184.092, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.029, "origin": [ 26.768, 18.175, 142.678 ], "x_axis": [ 0.491, -0.125, 0.862 ], "y_axis": [ -0.805, -0.444, 0.394 ], "z_axis": [ 0.334, -0.887, -0.319 ], "quaternion": [ 0.427, 0.751, -0.310, 0.398 ] } }, { "index": 72, "index_chain": 2, "chain_name": "W", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/2", "linked_nts": [ "///W/1", "///W/3" ], "nt_type": "DNA", "dbn": "}", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": 31.279, "beta": 172.023, "gamma": -53.968, "delta": 160.582, "epsilon": -148.944, "zeta": -70.796, "epsilon_zeta": -78.148, "bb_type": "BI", "chi": -87.771, "glyco_bond": "anti", "C5prime_xyz": [ -2.636, 7.413, -2.289 ], "P_xyz": [ -1.959, 9.785, -2.989 ], "form": ".", "ssZp": 1.446, "Dp": 1.379, "splay_angle": 16.396, "splay_distance": 3.002, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 168.663, "theta": -134.943, "eta_prime": -165.829, "theta_prime": -159.807, "eta_base": -146.198, "theta_base": -140.987, "v0": -11.867, "v1": 30.920, "v2": -36.842, "v3": 30.956, "v4": -12.412, "amplitude": 36.842, "phase_angle": 180.294, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.015, "origin": [ 28.498, 16.003, 141.129 ], "x_axis": [ 0.139, -0.245, 0.959 ], "y_axis": [ -0.876, -0.483, 0.004 ], "z_axis": [ 0.462, -0.841, -0.282 ], "quaternion": [ 0.306, 0.690, -0.406, 0.515 ] } }, { "index": 73, "index_chain": 3, "chain_name": "W", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/3", "linked_nts": [ "///W/2", "///W/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -24.483, "beta": -78.058, "gamma": -99.889, "delta": 148.731, "epsilon": -176.159, "zeta": -109.117, "epsilon_zeta": -67.042, "bb_type": "BI", "chi": -110.094, "glyco_bond": "anti", "C5prime_xyz": [ -2.082, 8.260, -1.198 ], "P_xyz": [ -3.256, 9.484, -3.193 ], "form": "B", "ssZp": 2.706, "Dp": 2.119, "splay_angle": 23.648, "splay_distance": 3.798, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -173.716, "theta": 130.502, "eta_prime": 177.746, "theta_prime": 163.024, "eta_base": -163.316, "theta_base": -148.365, "v0": -12.345, "v1": 29.268, "v2": -33.890, "v3": 27.508, "v4": -9.754, "amplitude": 33.919, "phase_angle": 177.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.018, "origin": [ 30.671, 14.019, 140.530 ], "x_axis": [ -0.169, -0.319, 0.933 ], "y_axis": [ -0.793, -0.518, -0.321 ], "z_axis": [ 0.585, -0.794, -0.165 ], "quaternion": [ 0.192, 0.615, -0.452, 0.617 ] } }, { "index": 74, "index_chain": 4, "chain_name": "W", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///W/4", "linked_nts": [ "///W/3", "///W/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.012, "beta": -169.383, "gamma": 53.158, "delta": 152.189, "epsilon": -169.389, "zeta": -87.517, "epsilon_zeta": -81.871, "bb_type": "BI", "chi": -104.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.984, 8.191, -1.639 ], "P_xyz": [ 0.343, 9.088, -0.952 ], "form": ".", "ssZp": 1.733, "Dp": 1.595, "splay_angle": 19.625, "splay_distance": 3.595, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 171.514, "theta": -112.289, "eta_prime": -160.221, "theta_prime": -142.698, "eta_base": -117.002, "theta_base": -91.116, "v0": -10.557, "v1": 29.398, "v2": -36.039, "v3": 30.572, "v4": -12.844, "amplitude": 36.056, "phase_angle": 181.787, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 32.724, 10.840, 140.207 ], "x_axis": [ -0.720, -0.426, 0.548 ], "y_axis": [ -0.517, -0.198, -0.833 ], "z_axis": [ 0.463, -0.883, -0.078 ], "quaternion": [ 0.034, 0.373, -0.632, 0.678 ] } }, { "index": 75, "index_chain": 5, "chain_name": "W", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///W/5", "linked_nts": [ "///W/4", "///W/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -11.567, "beta": -142.582, "gamma": -46.418, "delta": 151.580, "epsilon": -178.402, "zeta": -55.218, "epsilon_zeta": -123.184, "bb_type": "BI", "chi": -112.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.427, 8.118, -1.231 ], "P_xyz": [ -0.484, 10.502, -1.560 ], "form": ".", "ssZp": 2.683, "Dp": 2.208, "splay_angle": 19.125, "splay_distance": 3.360, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 165.800, "theta": -156.238, "eta_prime": -177.569, "theta_prime": -164.510, "eta_base": -114.836, "theta_base": -127.759, "v0": -7.142, "v1": 24.676, "v2": -31.725, "v3": 27.960, "v4": -13.285, "amplitude": 31.872, "phase_angle": 185.514, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 33.122, 7.335, 140.898 ], "x_axis": [ -0.904, -0.409, -0.126 ], "y_axis": [ 0.082, 0.125, -0.989 ], "z_axis": [ 0.420, -0.904, -0.080 ], "quaternion": [ 0.188, -0.113, 0.726, -0.652 ] } }, { "index": 76, "index_chain": 6, "chain_name": "W", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/6", "linked_nts": [ "///W/5", "///W/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -133.081, "beta": 91.137, "gamma": 170.078, "delta": 150.009, "epsilon": -153.427, "zeta": -113.090, "epsilon_zeta": -40.337, "bb_type": "BI", "chi": -150.653, "glyco_bond": "anti", "C5prime_xyz": [ -1.561, 8.456, 0.663 ], "P_xyz": [ -0.574, 10.190, -0.983 ], "form": "B", "ssZp": 1.345, "Dp": 1.786, "splay_angle": 21.617, "splay_distance": 3.608, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -138.899, "theta": 178.138, "eta_prime": -145.779, "theta_prime": -165.936, "eta_base": -108.737, "theta_base": -131.180, "v0": -12.421, "v1": 29.457, "v2": -35.131, "v3": 28.609, "v4": -10.207, "amplitude": 35.145, "phase_angle": 178.378, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ 33.861, 4.088, 141.346 ], "x_axis": [ -0.769, -0.285, -0.572 ], "y_axis": [ 0.512, 0.262, -0.818 ], "z_axis": [ 0.383, -0.922, -0.056 ], "quaternion": [ 0.331, 0.079, 0.722, -0.602 ] } }, { "index": 77, "index_chain": 7, "chain_name": "W", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/7", "linked_nts": [ "///W/6", "///W/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 146.372, "beta": -170.157, "gamma": 175.758, "delta": 147.590, "epsilon": -172.514, "zeta": -110.978, "epsilon_zeta": -61.536, "bb_type": "BI", "chi": -129.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.829, 8.537, -0.519 ], "P_xyz": [ 0.278, 9.580, -1.546 ], "form": "B", "ssZp": 1.490, "Dp": 2.002, "splay_angle": 20.113, "splay_distance": 3.411, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 147.678, "theta": -142.109, "eta_prime": -167.898, "theta_prime": -163.285, "eta_base": -130.639, "theta_base": -101.087, "v0": -16.490, "v1": 32.555, "v2": -35.798, "v3": 27.168, "v4": -6.823, "amplitude": 36.130, "phase_angle": 172.220, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 35.481, 1.070, 142.479 ], "x_axis": [ -0.306, -0.148, -0.941 ], "y_axis": [ 0.840, 0.423, -0.340 ], "z_axis": [ 0.448, -0.894, -0.005 ], "quaternion": [ 0.527, 0.263, 0.658, -0.468 ] } }, { "index": 78, "index_chain": 8, "chain_name": "W", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/8", "linked_nts": [ "///W/7", "///W/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 34.550, "beta": -179.774, "gamma": -45.583, "delta": 154.269, "epsilon": -177.952, "zeta": -95.206, "epsilon_zeta": -82.746, "bb_type": "BI", "chi": -108.582, "glyco_bond": "anti", "C5prime_xyz": [ -0.999, 7.748, -1.722 ], "P_xyz": [ 0.549, 9.792, -1.461 ], "form": "B", "ssZp": 1.183, "Dp": 1.861, "splay_angle": 19.128, "splay_distance": 3.269, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 176.471, "theta": -154.549, "eta_prime": -160.255, "theta_prime": -154.664, "eta_base": -93.945, "theta_base": -129.694, "v0": -4.148, "v1": 23.054, "v2": -32.019, "v3": 30.139, "v4": -16.590, "amplitude": 32.641, "phase_angle": 191.209, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.021, "origin": [ 36.642, -2.021, 141.622 ], "x_axis": [ 0.496, 0.112, -0.861 ], "y_axis": [ 0.759, 0.425, 0.493 ], "z_axis": [ 0.422, -0.898, 0.126 ], "quaternion": [ 0.715, 0.486, 0.448, -0.226 ] } }, { "index": 79, "index_chain": 9, "chain_name": "W", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/9", "linked_nts": [ "///W/8", "///W/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.519, "beta": 179.154, "gamma": 44.841, "delta": 155.505, "epsilon": -142.572, "zeta": -171.867, "epsilon_zeta": 29.295, "bb_type": "--", "chi": -90.322, "glyco_bond": "anti", "C5prime_xyz": [ -2.951, 7.935, -2.095 ], "P_xyz": [ -0.959, 9.607, -2.182 ], "form": "B", "ssZp": 1.696, "Dp": 1.656, "splay_angle": 18.650, "splay_distance": 3.216, "splay_ratio": 0.166, "d22": 4.241, "d64": 3.870, "eta": 169.357, "theta": -149.006, "eta_prime": -157.997, "theta_prime": -172.033, "eta_base": -133.453, "theta_base": -113.538, "v0": -17.792, "v1": 36.477, "v2": -40.376, "v3": 31.453, "v4": -8.778, "amplitude": 40.632, "phase_angle": 173.554, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 37.209, -5.126, 142.472 ], "x_axis": [ 0.784, 0.173, -0.596 ], "y_axis": [ 0.527, 0.321, 0.787 ], "z_axis": [ 0.328, -0.931, 0.161 ], "quaternion": [ 0.753, 0.571, 0.307, -0.117 ] } }, { "index": 80, "index_chain": 10, "chain_name": "W", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/10", "linked_nts": [ "///W/9", "///W/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 82.621, "beta": -130.268, "gamma": -145.205, "delta": 149.377, "epsilon": -145.432, "zeta": -101.755, "epsilon_zeta": -43.677, "bb_type": "BI", "chi": -131.117, "glyco_bond": "anti", "C5prime_xyz": [ -2.021, 8.601, -0.191 ], "P_xyz": [ -0.512, 9.878, -1.771 ], "form": "B", "ssZp": 1.688, "Dp": 1.727, "splay_angle": 19.989, "splay_distance": 3.545, "splay_ratio": 0.178, "d22": 4.342, "d64": 3.762, "eta": -159.396, "theta": -151.168, "eta_prime": -157.430, "theta_prime": -155.173, "eta_base": -99.863, "theta_base": -100.812, "v0": -18.645, "v1": 34.649, "v2": -37.133, "v3": 27.045, "v4": -5.484, "amplitude": 37.741, "phase_angle": 169.702, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.007, "origin": [ 38.808, -7.911, 142.294 ], "x_axis": [ 0.972, 0.215, 0.093 ], "y_axis": [ -0.113, 0.084, 0.990 ], "z_axis": [ 0.205, -0.973, 0.106 ], "quaternion": [ 0.735, 0.667, 0.038, 0.112 ] } }, { "index": 81, "index_chain": 11, "chain_name": "W", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/11", "linked_nts": [ "///W/10", "///W/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 15.126, "beta": -170.016, "gamma": -59.936, "delta": 148.714, "epsilon": -161.249, "zeta": -107.989, "epsilon_zeta": -53.260, "bb_type": "BI", "chi": -103.901, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 7.908, -1.719 ], "P_xyz": [ -0.078, 10.092, -2.344 ], "form": "B", "ssZp": 1.804, "Dp": 1.971, "splay_angle": 20.281, "splay_distance": 3.563, "splay_ratio": 0.176, "d22": 4.505, "d64": 3.945, "eta": 161.150, "theta": -167.106, "eta_prime": -174.187, "theta_prime": -169.690, "eta_base": -115.095, "theta_base": -142.850, "v0": -4.571, "v1": 23.127, "v2": -31.866, "v3": 29.635, "v4": -16.017, "amplitude": 32.396, "phase_angle": 190.374, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.014, "origin": [ 40.701, -10.856, 142.851 ], "x_axis": [ 0.594, 0.258, 0.762 ], "y_axis": [ -0.751, -0.160, 0.640 ], "z_axis": [ 0.287, -0.953, 0.099 ], "quaternion": [ 0.619, 0.643, -0.192, 0.408 ] } }, { "index": 82, "index_chain": 12, "chain_name": "W", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/12", "linked_nts": [ "///W/11", "///W/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 6.667, "beta": -154.233, "gamma": -47.186, "delta": 156.244, "epsilon": 173.448, "zeta": -77.170, "epsilon_zeta": -109.382, "bb_type": "BI", "chi": -111.239, "glyco_bond": "anti", "C5prime_xyz": [ -0.954, 7.833, -1.492 ], "P_xyz": [ 0.534, 9.910, -1.787 ], "form": "B", "ssZp": 1.848, "Dp": 1.977, "splay_angle": 20.408, "splay_distance": 3.478, "splay_ratio": 0.178, "d22": 4.028, "d64": 3.743, "eta": 172.452, "theta": -152.193, "eta_prime": -170.997, "theta_prime": -149.868, "eta_base": -141.481, "theta_base": -117.199, "v0": -1.361, "v1": 21.123, "v2": -31.614, "v3": 31.437, "v4": -19.006, "amplitude": 32.893, "phase_angle": 196.032, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 41.495, -14.303, 142.432 ], "x_axis": [ 0.176, 0.278, 0.944 ], "y_axis": [ -0.928, -0.272, 0.253 ], "z_axis": [ 0.327, -0.921, 0.210 ], "quaternion": [ 0.528, 0.556, -0.292, 0.571 ] } }, { "index": 83, "index_chain": 13, "chain_name": "W", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/13", "linked_nts": [ "///W/12", "///W/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.970, "beta": -155.522, "gamma": 26.340, "delta": 148.257, "epsilon": 177.392, "zeta": -116.444, "epsilon_zeta": -66.163, "bb_type": "BI", "chi": -89.675, "glyco_bond": "anti", "C5prime_xyz": [ -2.338, 7.847, -2.280 ], "P_xyz": [ -0.537, 9.728, -1.993 ], "form": "B", "ssZp": 2.088, "Dp": 2.033, "splay_angle": 19.671, "splay_distance": 3.215, "splay_ratio": 0.171, "d22": 4.012, "d64": 3.265, "eta": 159.178, "theta": -158.188, "eta_prime": -169.039, "theta_prime": -161.579, "eta_base": -131.653, "theta_base": -118.994, "v0": -13.626, "v1": 31.494, "v2": -36.866, "v3": 29.376, "v4": -10.080, "amplitude": 36.912, "phase_angle": 177.142, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 42.904, -17.307, 143.477 ], "x_axis": [ -0.317, 0.215, 0.924 ], "y_axis": [ -0.891, -0.401, -0.212 ], "z_axis": [ 0.325, -0.890, 0.319 ], "quaternion": [ 0.388, 0.437, -0.386, 0.714 ] } }, { "index": 84, "index_chain": 14, "chain_name": "W", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/14", "linked_nts": [ "///W/13", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -52.359, "beta": -178.707, "gamma": 43.408, "delta": 148.217, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -96.769, "glyco_bond": "anti", "C5prime_xyz": [ -2.357, 8.126, -1.707 ], "P_xyz": [ 0.013, 9.175, -1.462 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.561, "v1": 31.533, "v2": -36.070, "v3": 29.350, "v4": -10.102, "amplitude": 36.117, "phase_angle": 177.091, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.014, "origin": [ 43.504, -20.169, 144.814 ], "x_axis": [ -0.808, 0.091, 0.582 ], "y_axis": [ -0.545, -0.488, -0.682 ], "z_axis": [ 0.222, -0.868, 0.444 ], "quaternion": [ 0.192, 0.243, -0.468, 0.828 ] } } ], "num_hbonds": 1402, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 843, "donAcc_type": "questionable", "distance": 2.194, "atom1_id": "///X/1/O5'", "atom2_id": "///V/14/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 892, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///X/1/N3", "atom2_id": "///Z/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 14, "atom2_serNum": 891, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///X/1/O4", "atom2_id": "///Z/2/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 32, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///X/2/N3", "atom2_id": "///Z/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 34, "atom2_serNum": 870, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///X/2/O4", "atom2_id": "///Z/1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 40, "atom2_serNum": 13010, "donAcc_type": "acceptable", "distance": 2.362, "atom1_id": "///X/3/OP2", "atom2_id": "///M/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 7, "atom1_serNum": 54, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///X/3/O6", "atom2_id": "///Y/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 55, "atom2_serNum": 565, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///X/3/N1", "atom2_id": "///Y/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 57, "atom2_serNum": 564, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///X/3/N2", "atom2_id": "///Y/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 13046, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///X/4/OP1", "atom2_id": "///M/434/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 11, "atom1_serNum": 76, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///X/4/N6", "atom2_id": "///Y/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 77, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///X/4/N1", "atom2_id": "///Y/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 94, "atom2_serNum": 13021, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///X/5/N7", "atom2_id": "///M/430/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 14, "atom1_serNum": 97, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///X/5/O6", "atom2_id": "///Y/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 97, "atom2_serNum": 13021, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///X/5/O6", "atom2_id": "///M/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 16, "atom1_serNum": 98, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///X/5/N1", "atom2_id": "///Y/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 100, "atom2_serNum": 525, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///X/5/N2", "atom2_id": "///Y/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 116, "atom2_serNum": 12947, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///X/6/N7", "atom2_id": "///M/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 19, "atom1_serNum": 119, "atom2_serNum": 509, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///X/6/O6", "atom2_id": "///Y/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 119, "atom2_serNum": 12948, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///X/6/O6", "atom2_id": "///M/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 120, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///X/6/N1", "atom2_id": "///Y/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 122, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///X/6/N2", "atom2_id": "///Y/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 126, "atom2_serNum": 14828, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///X/7/OP1", "atom2_id": "///M/664/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 24, "atom1_serNum": 138, "atom2_serNum": 14115, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///X/7/N7", "atom2_id": "///M/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 25, "atom1_serNum": 141, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///X/7/N6", "atom2_id": "///Y/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 141, "atom2_serNum": 14114, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///X/7/N6", "atom2_id": "///M/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 27, "atom1_serNum": 142, "atom2_serNum": 487, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///X/7/N1", "atom2_id": "///Y/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 162, "atom2_serNum": 469, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///X/8/N6", "atom2_id": "///Y/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 163, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///X/8/N1", "atom2_id": "///Y/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 168, "atom2_serNum": 11640, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///X/9/OP1", "atom2_id": "///L/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 180, "atom2_serNum": 193, "donAcc_type": "questionable", "distance": 3.050, "atom1_id": "///X/9/O2", "atom2_id": "///X/10/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 181, "atom2_serNum": 449, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///X/9/N3", "atom2_id": "///Y/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 183, "atom2_serNum": 448, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///X/9/O4", "atom2_id": "///Y/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 188, "atom2_serNum": 11523, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///X/10/OP1", "atom2_id": "///L/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 35, "atom1_serNum": 189, "atom2_serNum": 10766, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///X/10/OP2", "atom2_id": "///L/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 36, "atom1_serNum": 189, "atom2_serNum": 11503, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///X/10/OP2", "atom2_id": "///L/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 37, "atom1_serNum": 201, "atom2_serNum": 428, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///X/10/N3", "atom2_id": "///Y/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 203, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///X/10/O4", "atom2_id": "///Y/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 209, "atom2_serNum": 10781, "donAcc_type": "acceptable", "distance": 3.383, "atom1_id": "///X/11/OP2", "atom2_id": "///L/426/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 40, "atom1_serNum": 221, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///X/11/N3", "atom2_id": "///Y/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 223, "atom2_serNum": 406, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///X/11/O4", "atom2_id": "///Y/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 223, "atom2_serNum": 10739, "donAcc_type": "standard", "distance": 3.800, "atom1_id": "///X/11/O4", "atom2_id": "///L/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 240, "atom2_serNum": 387, "donAcc_type": "standard", "distance": 2.511, "atom1_id": "///X/12/O2", "atom2_id": "///Y/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 240, "atom2_serNum": 13848, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///X/12/O2", "atom2_id": "///M/537/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 45, "atom1_serNum": 241, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///X/12/N3", "atom2_id": "///Y/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 243, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///X/12/N4", "atom2_id": "///Y/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 243, "atom2_serNum": 10791, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///X/12/N4", "atom2_id": "///L/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 259, "atom2_serNum": 365, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///X/13/O2", "atom2_id": "///Y/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 260, "atom2_serNum": 363, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///X/13/N3", "atom2_id": "///Y/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 262, "atom2_serNum": 362, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///X/13/N4", "atom2_id": "///Y/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 281, "atom2_serNum": 342, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///X/14/N6", "atom2_id": "///Y/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 282, "atom2_serNum": 340, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///X/14/N1", "atom2_id": "///Y/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 307, "atom2_serNum": 10801, "donAcc_type": "acceptable", "distance": 2.399, "atom1_id": "///Y/2/OP2", "atom2_id": "///L/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 328, "atom2_serNum": 10837, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///Y/3/OP2", "atom2_id": "///L/434/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 359, "atom2_serNum": 10812, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///Y/4/N7", "atom2_id": "///L/430/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 362, "atom2_serNum": 10812, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///Y/4/O6", "atom2_id": "///L/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 381, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///Y/5/N7", "atom2_id": "///L/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 58, "atom1_serNum": 384, "atom2_serNum": 10739, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///Y/5/O6", "atom2_id": "///L/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 59, "atom1_serNum": 384, "atom2_serNum": 10812, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///Y/5/O6", "atom2_id": "///L/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 60, "atom1_serNum": 403, "atom2_serNum": 11906, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///Y/6/N7", "atom2_id": "///L/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 61, "atom1_serNum": 406, "atom2_serNum": 11905, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///Y/6/N6", "atom2_id": "///L/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 409, "atom2_serNum": 13848, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///Y/6/N3", "atom2_id": "///M/537/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 433, "atom2_serNum": 13849, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///Y/8/OP1", "atom2_id": "///M/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 454, "atom2_serNum": 13732, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///Y/9/OP1", "atom2_id": "///M/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 65, "atom1_serNum": 455, "atom2_serNum": 12975, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///Y/9/OP2", "atom2_id": "///M/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 455, "atom2_serNum": 13712, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///Y/9/OP2", "atom2_id": "///M/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 67, "atom1_serNum": 489, "atom2_serNum": 12948, "donAcc_type": "standard", "distance": 3.961, "atom1_id": "///Y/10/O4", "atom2_id": "///M/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 68, "atom1_serNum": 506, "atom2_serNum": 11639, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///Y/11/O2", "atom2_id": "///L/537/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 509, "atom2_serNum": 13000, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///Y/11/N4", "atom2_id": "///M/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 559, "atom2_serNum": 857, "donAcc_type": "questionable", "distance": 2.669, "atom1_id": "///Y/14/O3'", "atom2_id": "///Z/1/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 571, "atom2_serNum": 1413, "donAcc_type": "questionable", "distance": 2.273, "atom1_id": "///V/1/O5'", "atom2_id": "///T/14/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 582, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///V/1/N3", "atom2_id": "///W/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 584, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///V/1/O4", "atom2_id": "///W/2/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 602, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///V/2/N3", "atom2_id": "///W/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 604, "atom2_serNum": 1440, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///V/2/O4", "atom2_id": "///W/1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 610, "atom2_serNum": 8592, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///V/3/OP2", "atom2_id": "///I/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 77, "atom1_serNum": 624, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///V/3/O6", "atom2_id": "///Z/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 625, "atom2_serNum": 1135, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///V/3/N1", "atom2_id": "///Z/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 627, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///V/3/N2", "atom2_id": "///Z/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 646, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///V/4/N6", "atom2_id": "///Z/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 647, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///V/4/N1", "atom2_id": "///Z/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 667, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///V/5/O6", "atom2_id": "///Z/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 667, "atom2_serNum": 8603, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///V/5/O6", "atom2_id": "///I/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 84, "atom1_serNum": 668, "atom2_serNum": 1096, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///V/5/N1", "atom2_id": "///Z/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 670, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///V/5/N2", "atom2_id": "///Z/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 686, "atom2_serNum": 8529, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///V/6/N7", "atom2_id": "///I/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 689, "atom2_serNum": 1079, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///V/6/O6", "atom2_id": "///Z/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 689, "atom2_serNum": 8530, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///V/6/O6", "atom2_id": "///I/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 89, "atom1_serNum": 690, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///V/6/N1", "atom2_id": "///Z/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 692, "atom2_serNum": 1076, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///V/6/N2", "atom2_id": "///Z/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 697, "atom2_serNum": 10410, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///V/7/OP2", "atom2_id": "///I/664/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 697, "atom2_serNum": 10419, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///V/7/OP2", "atom2_id": "///I/665/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 708, "atom2_serNum": 9697, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///V/7/N7", "atom2_id": "///I/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 711, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///V/7/N6", "atom2_id": "///Z/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 711, "atom2_serNum": 9696, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///V/7/N6", "atom2_id": "///I/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 712, "atom2_serNum": 1057, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///V/7/N1", "atom2_id": "///Z/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 724, "atom2_serNum": 7222, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///V/8/O3'", "atom2_id": "///H/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 98, "atom1_serNum": 732, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///V/8/N6", "atom2_id": "///Z/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 733, "atom2_serNum": 1037, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///V/8/N1", "atom2_id": "///Z/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 735, "atom2_serNum": 743, "donAcc_type": "questionable", "distance": 3.304, "atom1_id": "///V/8/N3", "atom2_id": "///V/9/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 738, "atom2_serNum": 7222, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///V/9/OP1", "atom2_id": "///H/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 750, "atom2_serNum": 763, "donAcc_type": "questionable", "distance": 3.123, "atom1_id": "///V/9/O2", "atom2_id": "///V/10/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 751, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///V/9/N3", "atom2_id": "///Z/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 753, "atom2_serNum": 1018, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///V/9/O4", "atom2_id": "///Z/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 758, "atom2_serNum": 7105, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///V/10/OP1", "atom2_id": "///H/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 759, "atom2_serNum": 6348, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///V/10/OP2", "atom2_id": "///H/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 759, "atom2_serNum": 7085, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///V/10/OP2", "atom2_id": "///H/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 770, "atom2_serNum": 783, "donAcc_type": "questionable", "distance": 3.118, "atom1_id": "///V/10/O2", "atom2_id": "///V/11/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 771, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///V/10/N3", "atom2_id": "///Z/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 773, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///V/10/O4", "atom2_id": "///Z/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 779, "atom2_serNum": 6363, "donAcc_type": "acceptable", "distance": 3.604, "atom1_id": "///V/11/OP2", "atom2_id": "///H/426/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 791, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///V/11/N3", "atom2_id": "///Z/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 793, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///V/11/O4", "atom2_id": "///Z/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 793, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 3.786, "atom1_id": "///V/11/O4", "atom2_id": "///H/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 115, "atom1_serNum": 810, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///V/12/O2", "atom2_id": "///Z/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 810, "atom2_serNum": 9430, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///V/12/O2", "atom2_id": "///I/537/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 811, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///V/12/N3", "atom2_id": "///Z/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 813, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///V/12/N4", "atom2_id": "///Z/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 813, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///V/12/N4", "atom2_id": "///H/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 120, "atom1_serNum": 829, "atom2_serNum": 935, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///V/13/O2", "atom2_id": "///Z/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 830, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///V/13/N3", "atom2_id": "///Z/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 832, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///V/13/N4", "atom2_id": "///Z/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 851, "atom2_serNum": 912, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///V/14/N6", "atom2_id": "///Z/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 852, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///V/14/N1", "atom2_id": "///Z/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 877, "atom2_serNum": 6383, "donAcc_type": "acceptable", "distance": 2.688, "atom1_id": "///Z/2/OP2", "atom2_id": "///H/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 126, "atom1_serNum": 898, "atom2_serNum": 6419, "donAcc_type": "standard", "distance": 3.647, "atom1_id": "///Z/3/OP2", "atom2_id": "///H/434/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 127, "atom1_serNum": 929, "atom2_serNum": 6394, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///Z/4/N7", "atom2_id": "///H/430/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 128, "atom1_serNum": 932, "atom2_serNum": 6394, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///Z/4/O6", "atom2_id": "///H/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 129, "atom1_serNum": 951, "atom2_serNum": 6320, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///Z/5/N7", "atom2_id": "///H/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 130, "atom1_serNum": 954, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///Z/5/O6", "atom2_id": "///H/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 131, "atom1_serNum": 973, "atom2_serNum": 7488, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///Z/6/N7", "atom2_id": "///H/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 132, "atom1_serNum": 976, "atom2_serNum": 7487, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///Z/6/N6", "atom2_id": "///H/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 133, "atom1_serNum": 1000, "atom2_serNum": 1008, "donAcc_type": "questionable", "distance": 3.357, "atom1_id": "///Z/7/N3", "atom2_id": "///Z/8/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1003, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///Z/8/OP1", "atom2_id": "///I/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 135, "atom1_serNum": 1024, "atom2_serNum": 9314, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///Z/9/OP1", "atom2_id": "///I/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 136, "atom1_serNum": 1025, "atom2_serNum": 8557, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///Z/9/OP2", "atom2_id": "///I/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 137, "atom1_serNum": 1025, "atom2_serNum": 9294, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///Z/9/OP2", "atom2_id": "///I/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 138, "atom1_serNum": 1045, "atom2_serNum": 8572, "donAcc_type": "acceptable", "distance": 3.509, "atom1_id": "///Z/10/OP2", "atom2_id": "///I/426/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 139, "atom1_serNum": 1059, "atom2_serNum": 8530, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///Z/10/O4", "atom2_id": "///I/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 140, "atom1_serNum": 1076, "atom2_serNum": 7221, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///Z/11/O2", "atom2_id": "///H/537/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 141, "atom1_serNum": 1079, "atom2_serNum": 8582, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///Z/11/N4", "atom2_id": "///I/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 142, "atom1_serNum": 1129, "atom2_serNum": 1427, "donAcc_type": "questionable", "distance": 3.204, "atom1_id": "///Z/14/O3'", "atom2_id": "///W/1/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1159, "atom2_serNum": 4573, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///T/2/OP1", "atom2_id": "///D/480/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 144, "atom1_serNum": 1180, "atom2_serNum": 4174, "donAcc_type": "acceptable", "distance": 2.477, "atom1_id": "///T/3/OP2", "atom2_id": "///D/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 145, "atom1_serNum": 1194, "atom2_serNum": 1707, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///T/3/O6", "atom2_id": "///W/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1195, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///T/3/N1", "atom2_id": "///W/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1197, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///T/3/N2", "atom2_id": "///W/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1202, "atom2_serNum": 4210, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///T/4/OP2", "atom2_id": "///D/434/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 149, "atom1_serNum": 1216, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///T/4/N6", "atom2_id": "///W/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1217, "atom2_serNum": 1685, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///T/4/N1", "atom2_id": "///W/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1234, "atom2_serNum": 4185, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///T/5/N7", "atom2_id": "///D/430/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 152, "atom1_serNum": 1237, "atom2_serNum": 1668, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///T/5/O6", "atom2_id": "///W/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1237, "atom2_serNum": 4185, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///T/5/O6", "atom2_id": "///D/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 154, "atom1_serNum": 1238, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///T/5/N1", "atom2_id": "///W/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1240, "atom2_serNum": 1665, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///T/5/N2", "atom2_id": "///W/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1256, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///T/6/N7", "atom2_id": "///D/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 157, "atom1_serNum": 1259, "atom2_serNum": 1649, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///T/6/O6", "atom2_id": "///W/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1259, "atom2_serNum": 4112, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///T/6/O6", "atom2_id": "///D/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 159, "atom1_serNum": 1259, "atom2_serNum": 4185, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///T/6/O6", "atom2_id": "///D/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 160, "atom1_serNum": 1260, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///T/6/N1", "atom2_id": "///W/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1260, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///T/6/N1", "atom2_id": "///W/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1262, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///T/6/N2", "atom2_id": "///W/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1278, "atom2_serNum": 5279, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///T/7/N7", "atom2_id": "///D/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 164, "atom1_serNum": 1281, "atom2_serNum": 1629, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///T/7/N6", "atom2_id": "///W/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1281, "atom2_serNum": 5278, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///T/7/N6", "atom2_id": "///D/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 166, "atom1_serNum": 1282, "atom2_serNum": 1627, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///T/7/N1", "atom2_id": "///W/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1302, "atom2_serNum": 1609, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///T/8/N6", "atom2_id": "///W/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1303, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///T/8/N1", "atom2_id": "///W/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1308, "atom2_serNum": 2804, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///T/9/OP1", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 170, "atom1_serNum": 1321, "atom2_serNum": 1589, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///T/9/N3", "atom2_id": "///W/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1323, "atom2_serNum": 1588, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///T/9/O4", "atom2_id": "///W/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1328, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///T/10/OP1", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 173, "atom1_serNum": 1329, "atom2_serNum": 1930, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///T/10/OP2", "atom2_id": "///B/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 174, "atom1_serNum": 1329, "atom2_serNum": 2667, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///T/10/OP2", "atom2_id": "///B/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 175, "atom1_serNum": 1341, "atom2_serNum": 1568, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///T/10/N3", "atom2_id": "///W/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1343, "atom2_serNum": 1567, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///T/10/O4", "atom2_id": "///W/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1349, "atom2_serNum": 1945, "donAcc_type": "acceptable", "distance": 3.283, "atom1_id": "///T/11/OP2", "atom2_id": "///B/426/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 178, "atom1_serNum": 1361, "atom2_serNum": 1547, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///T/11/N3", "atom2_id": "///W/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1363, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///T/11/O4", "atom2_id": "///W/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1363, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///T/11/O4", "atom2_id": "///B/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 181, "atom1_serNum": 1380, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///T/12/O2", "atom2_id": "///W/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1381, "atom2_serNum": 1525, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///T/12/N3", "atom2_id": "///W/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1383, "atom2_serNum": 1524, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///T/12/N4", "atom2_id": "///W/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1383, "atom2_serNum": 1955, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///T/12/N4", "atom2_id": "///B/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 185, "atom1_serNum": 1399, "atom2_serNum": 1505, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///T/13/O2", "atom2_id": "///W/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1400, "atom2_serNum": 1503, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///T/13/N3", "atom2_id": "///W/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1402, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///T/13/N4", "atom2_id": "///W/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1421, "atom2_serNum": 1482, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///T/14/N6", "atom2_id": "///W/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1422, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///T/14/N1", "atom2_id": "///W/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1447, "atom2_serNum": 1965, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///W/2/OP2", "atom2_id": "///B/429/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 191, "atom1_serNum": 1468, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///W/3/OP2", "atom2_id": "///B/434/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 192, "atom1_serNum": 1499, "atom2_serNum": 1976, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///W/4/N7", "atom2_id": "///B/430/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 193, "atom1_serNum": 1516, "atom2_serNum": 3791, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///W/5/O3'", "atom2_id": "///B/664/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 194, "atom1_serNum": 1521, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///W/5/N7", "atom2_id": "///B/421/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 195, "atom1_serNum": 1524, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///W/5/O6", "atom2_id": "///B/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 196, "atom1_serNum": 1524, "atom2_serNum": 1976, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///W/5/O6", "atom2_id": "///B/430/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 197, "atom1_serNum": 1531, "atom2_serNum": 3801, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///W/6/OP1", "atom2_id": "///B/665/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 198, "atom1_serNum": 1532, "atom2_serNum": 3799, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///W/6/OP2", "atom2_id": "///B/665/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 199, "atom1_serNum": 1543, "atom2_serNum": 3070, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///W/6/N7", "atom2_id": "///B/571/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 200, "atom1_serNum": 1546, "atom2_serNum": 1903, "donAcc_type": "questionable", "distance": 3.036, "atom1_id": "///W/6/N6", "atom2_id": "///B/421/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 201, "atom1_serNum": 1546, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///W/6/N6", "atom2_id": "///B/571/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 202, "atom1_serNum": 1570, "atom2_serNum": 1578, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///W/7/N3", "atom2_id": "///W/8/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1573, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///W/8/OP1", "atom2_id": "///D/538/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 204, "atom1_serNum": 1594, "atom2_serNum": 4896, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///W/9/OP1", "atom2_id": "///D/523/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 205, "atom1_serNum": 1595, "atom2_serNum": 4139, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///W/9/OP2", "atom2_id": "///D/424/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 206, "atom1_serNum": 1595, "atom2_serNum": 4876, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///W/9/OP2", "atom2_id": "///D/520/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 207, "atom1_serNum": 1615, "atom2_serNum": 4154, "donAcc_type": "acceptable", "distance": 3.370, "atom1_id": "///W/10/OP2", "atom2_id": "///D/426/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 208, "atom1_serNum": 1629, "atom2_serNum": 4112, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///W/10/O4", "atom2_id": "///D/421/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 209, "atom1_serNum": 1649, "atom2_serNum": 4164, "donAcc_type": "standard", "distance": 2.426, "atom1_id": "///W/11/N4", "atom2_id": "///D/427/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 210, "atom1_serNum": 1714, "atom2_serNum": 2893, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/399/O", "atom2_id": "///B/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1735, "atom2_serNum": 2893, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/401/O", "atom2_id": "///B/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1743, "atom2_serNum": 1745, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///B/402/O", "atom2_id": "///B/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1755, "atom2_serNum": 1766, "donAcc_type": "acceptable", "distance": 2.497, "atom1_id": "///B/404/O", "atom2_id": "///B/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1755, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/404/O", "atom2_id": "///B/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1755, "atom2_serNum": 2994, "donAcc_type": "questionable", "distance": 2.683, "atom1_id": "///B/404/O", "atom2_id": "///B/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1792, "atom2_serNum": 2077, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/409/O", "atom2_id": "///B/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1806, "atom2_serNum": 2063, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/411/N", "atom2_id": "///B/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1809, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/411/O", "atom2_id": "///B/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1825, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/413/N", "atom2_id": "///B/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1834, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/414/N", "atom2_id": "///B/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1837, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/414/O", "atom2_id": "///B/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1848, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/415/OE1", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1857, "atom2_serNum": 1996, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/417/N", "atom2_id": "///B/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1869, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/418/O", "atom2_id": "///B/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1882, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/419/NE2", "atom2_id": "///B/576/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1883, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/420/N", "atom2_id": "///B/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1886, "atom2_serNum": 1904, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/420/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1892, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/420/NE2", "atom2_id": "///B/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1903, "atom2_serNum": 1955, "donAcc_type": "standard", "distance": 3.870, "atom1_id": "///B/421/NH2", "atom2_id": "///B/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1909, "atom2_serNum": 2646, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/423/N", "atom2_id": "///B/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1912, "atom2_serNum": 2659, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/423/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1919, "atom2_serNum": 1954, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/424/N", "atom2_id": "///B/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1922, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/424/O", "atom2_id": "///B/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1954, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///B/427/OE1", "atom2_id": "///B/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1955, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/427/OE2", "atom2_id": "///B/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1965, "atom2_serNum": 1977, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///B/429/OG", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1984, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/432/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1986, "atom2_serNum": 2637, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///B/433/N", "atom2_id": "///B/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1989, "atom2_serNum": 2035, "donAcc_type": "acceptable", "distance": 3.410, "atom1_id": "///B/433/O", "atom2_id": "///B/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2002, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///B/435/N", "atom2_id": "///B/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2005, "atom2_serNum": 2021, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/435/O", "atom2_id": "///B/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2019, "atom2_serNum": 2025, "donAcc_type": "acceptable", "distance": 3.219, "atom1_id": "///B/437/OG1", "atom2_id": "///B/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2042, "atom2_serNum": 2612, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/441/O", "atom2_id": "///B/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2053, "atom2_serNum": 2603, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/443/N", "atom2_id": "///B/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2056, "atom2_serNum": 2600, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/443/O", "atom2_id": "///B/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2067, "atom2_serNum": 2576, "donAcc_type": "questionable", "distance": 3.283, "atom1_id": "///B/444/OE1", "atom2_id": "///B/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2069, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/445/N", "atom2_id": "///B/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2080, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/446/O", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2102, "atom2_serNum": 2131, "donAcc_type": "acceptable", "distance": 2.993, "atom1_id": "///B/448/OH", "atom2_id": "///B/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2144, "atom2_serNum": 2535, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/454/N", "atom2_id": "///B/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2147, "atom2_serNum": 2532, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/454/O", "atom2_id": "///B/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2156, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/456/N", "atom2_id": "///B/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2159, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/456/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2164, "atom2_serNum": 2886, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///B/457/N", "atom2_id": "///B/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2167, "atom2_serNum": 2868, "donAcc_type": "questionable", "distance": 3.351, "atom1_id": "///B/457/O", "atom2_id": "///B/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2167, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/457/O", "atom2_id": "///B/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2172, "atom2_serNum": 2515, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/457/NE2", "atom2_id": "///B/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2173, "atom2_serNum": 2503, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///B/458/N", "atom2_id": "///B/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2176, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/458/O", "atom2_id": "///B/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2181, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/459/N", "atom2_id": "///B/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2184, "atom2_serNum": 2865, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/459/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2195, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/460/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2200, "atom2_serNum": 2849, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/461/N", "atom2_id": "///B/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2203, "atom2_serNum": 2846, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/461/O", "atom2_id": "///B/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2204, "atom2_serNum": 2263, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/462/N", "atom2_id": "///B/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2207, "atom2_serNum": 2853, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/462/O", "atom2_id": "///B/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2209, "atom2_serNum": 2260, "donAcc_type": "acceptable", "distance": 3.501, "atom1_id": "///B/462/OG1", "atom2_id": "///B/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2222, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/464/OD1", "atom2_id": "///B/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2279, "atom2_serNum": 2305, "donAcc_type": "questionable", "distance": 3.153, "atom1_id": "///B/471/O", "atom2_id": "///B/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2282, "atom2_serNum": 2291, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///B/471/ND1", "atom2_id": "///B/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2285, "atom2_serNum": 2831, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///B/471/NE2", "atom2_id": "///B/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2294, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/473/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2305, "atom2_serNum": 2322, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///B/474/O", "atom2_id": "///B/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2314, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///B/475/N", "atom2_id": "///B/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2317, "atom2_serNum": 2651, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/475/O", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2321, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/475/OE1", "atom2_id": "///B/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2326, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///B/476/O", "atom2_id": "///B/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2333, "atom2_serNum": 2351, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/477/O", "atom2_id": "///B/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2333, "atom2_serNum": 2631, "donAcc_type": "questionable", "distance": 3.192, "atom1_id": "///B/477/O", "atom2_id": "///B/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2333, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///B/477/O", "atom2_id": "///B/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2351, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/479/N", "atom2_id": "///B/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2362, "atom2_serNum": 2370, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/480/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2369, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///B/481/O", "atom2_id": "///B/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2398, "atom2_serNum": 2410, "donAcc_type": "acceptable", "distance": 3.582, "atom1_id": "///B/485/OG1", "atom2_id": "///B/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2400, "atom2_serNum": 2626, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/486/N", "atom2_id": "///B/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2405, "atom2_serNum": 2627, "donAcc_type": "acceptable", "distance": 3.362, "atom1_id": "///B/486/OG1", "atom2_id": "///B/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2412, "atom2_serNum": 2608, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///B/487/OG1", "atom2_id": "///B/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2435, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/490/O", "atom2_id": "///B/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2449, "atom2_serNum": 2492, "donAcc_type": "questionable", "distance": 3.253, "atom1_id": "///B/491/NZ", "atom2_id": "///B/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2450, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///B/492/N", "atom2_id": "///B/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2480, "atom2_serNum": 2482, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///B/496/O", "atom2_id": "///B/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2543, "atom2_serNum": 2565, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/504/O", "atom2_id": "///B/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2543, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/504/O", "atom2_id": "///B/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2552, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///B/505/O", "atom2_id": "///B/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2667, "atom2_serNum": 2671, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/520/NZ", "atom2_id": "///B/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2679, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/522/O", "atom2_id": "///B/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2679, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/522/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2683, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/522/NE", "atom2_id": "///B/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2686, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/522/NH2", "atom2_id": "///B/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2690, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/523/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2690, "atom2_serNum": 2716, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/523/O", "atom2_id": "///B/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2698, "atom2_serNum": 2725, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/524/O", "atom2_id": "///B/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2711, "atom2_serNum": 2733, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/526/O", "atom2_id": "///B/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2736, "atom2_serNum": 2757, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///B/529/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2764, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///B/532/OE1", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2779, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/534/OD1", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2784, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///B/535/O", "atom2_id": "///B/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2792, "atom2_serNum": 2813, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/536/O", "atom2_id": "///B/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2824, "atom2_serNum": 3050, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/540/O", "atom2_id": "///B/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2826, "atom2_serNum": 3049, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///B/540/OG1", "atom2_id": "///B/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2839, "atom2_serNum": 3036, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/542/N", "atom2_id": "///B/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2842, "atom2_serNum": 3033, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///B/542/O", "atom2_id": "///B/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2857, "atom2_serNum": 3017, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///B/544/N", "atom2_id": "///B/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2860, "atom2_serNum": 3012, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/544/O", "atom2_id": "///B/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2872, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/546/N", "atom2_id": "///B/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2875, "atom2_serNum": 3000, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/546/O", "atom2_id": "///B/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2890, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 2.395, "atom1_id": "///B/547/NE", "atom2_id": "///B/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2893, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/547/NH2", "atom2_id": "///B/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2894, "atom2_serNum": 2986, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///B/548/N", "atom2_id": "///B/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2897, "atom2_serNum": 2983, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///B/548/O", "atom2_id": "///B/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2907, "atom2_serNum": 2982, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///B/549/ND1", "atom2_id": "///B/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2911, "atom2_serNum": 2973, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/550/N", "atom2_id": "///B/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2914, "atom2_serNum": 2970, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/550/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2926, "atom2_serNum": 2954, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/552/N", "atom2_id": "///B/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2929, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///B/552/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2933, "atom2_serNum": 2960, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/552/OE1", "atom2_id": "///B/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3017, "atom2_serNum": 3021, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///B/564/OG", "atom2_id": "///B/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3049, "atom2_serNum": 3061, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///B/568/OE2", "atom2_id": "///B/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3059, "atom2_serNum": 3061, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///B/570/O", "atom2_id": "///B/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3095, "atom2_serNum": 3265, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///B/579/N", "atom2_id": "///B/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3098, "atom2_serNum": 3262, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/579/O", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3110, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/581/N", "atom2_id": "///B/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3119, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/582/N", "atom2_id": "///B/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3122, "atom2_serNum": 3251, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/582/O", "atom2_id": "///B/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3138, "atom2_serNum": 3150, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/583/NE2", "atom2_id": "///B/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3138, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/583/NE2", "atom2_id": "///B/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3139, "atom2_serNum": 3238, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/584/N", "atom2_id": "///B/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3146, "atom2_serNum": 3221, "donAcc_type": "questionable", "distance": 3.331, "atom1_id": "///B/584/OD2", "atom2_id": "///B/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3157, "atom2_serNum": 3875, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///B/586/O", "atom2_id": "///B/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3165, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///B/587/O", "atom2_id": "///B/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3171, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/588/O", "atom2_id": "///B/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3177, "atom2_serNum": 3189, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/589/O", "atom2_id": "///B/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3177, "atom2_serNum": 3201, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///B/589/O", "atom2_id": "///B/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3182, "atom2_serNum": 3897, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///B/590/N", "atom2_id": "///B/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3185, "atom2_serNum": 3619, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/590/O", "atom2_id": "///B/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3205, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///B/593/N", "atom2_id": "///B/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3212, "atom2_serNum": 3595, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/594/O", "atom2_id": "///B/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3227, "atom2_serNum": 3582, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/596/N", "atom2_id": "///B/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3230, "atom2_serNum": 3579, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/596/O", "atom2_id": "///B/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3243, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/598/N", "atom2_id": "///B/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3246, "atom2_serNum": 3560, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/598/O", "atom2_id": "///B/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3258, "atom2_serNum": 3547, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///B/600/N", "atom2_id": "///B/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3265, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///B/601/O", "atom2_id": "///B/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3270, "atom2_serNum": 3277, "donAcc_type": "standard", "distance": 3.807, "atom1_id": "///B/601/NE2", "atom2_id": "///B/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3271, "atom2_serNum": 3277, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/602/N", "atom2_id": "///B/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3271, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 3.615, "atom1_id": "///B/602/N", "atom2_id": "///B/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3274, "atom2_serNum": 3290, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/602/O", "atom2_id": "///B/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3290, "atom2_serNum": 3317, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///B/604/N", "atom2_id": "///B/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3293, "atom2_serNum": 3312, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/604/O", "atom2_id": "///B/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3293, "atom2_serNum": 3317, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///B/604/O", "atom2_id": "///B/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3317, "atom2_serNum": 3777, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///B/607/OG", "atom2_id": "///B/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3318, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/608/N", "atom2_id": "///B/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3321, "atom2_serNum": 3763, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/608/O", "atom2_id": "///B/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3330, "atom2_serNum": 3469, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/609/O", "atom2_id": "///B/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3334, "atom2_serNum": 3747, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///B/610/N", "atom2_id": "///B/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3337, "atom2_serNum": 3744, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/610/O", "atom2_id": "///B/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3341, "atom2_serNum": 3455, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/611/N", "atom2_id": "///B/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3344, "atom2_serNum": 3452, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/611/O", "atom2_id": "///B/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3352, "atom2_serNum": 3728, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///B/612/N", "atom2_id": "///B/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3355, "atom2_serNum": 3725, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/612/O", "atom2_id": "///B/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3357, "atom2_serNum": 3376, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///B/612/OG1", "atom2_id": "///B/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3359, "atom2_serNum": 3432, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/613/N", "atom2_id": "///B/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3362, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/613/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3362, "atom2_serNum": 3429, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///B/613/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3366, "atom2_serNum": 3630, "donAcc_type": "acceptable", "distance": 2.589, "atom1_id": "///B/613/OE1", "atom2_id": "///B/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3371, "atom2_serNum": 5338, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/614/O", "atom2_id": "///D/582/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3376, "atom2_serNum": 5327, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/614/NZ", "atom2_id": "///D/581/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3377, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/615/N", "atom2_id": "///B/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3380, "atom2_serNum": 3391, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///B/615/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3382, "atom2_serNum": 3403, "donAcc_type": "acceptable", "distance": 3.392, "atom1_id": "///B/615/OG1", "atom2_id": "///B/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3387, "atom2_serNum": 5465, "donAcc_type": "acceptable", "distance": 2.530, "atom1_id": "///B/616/O", "atom2_id": "///D/599/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3402, "atom2_serNum": 3412, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/618/O", "atom2_id": "///B/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3406, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/619/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3419, "atom2_serNum": 3450, "donAcc_type": "questionable", "distance": 2.763, "atom1_id": "///B/620/OE1", "atom2_id": "///B/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3477, "atom2_serNum": 3479, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///B/627/O", "atom2_id": "///B/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3477, "atom2_serNum": 3586, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/627/O", "atom2_id": "///B/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3479, "atom2_serNum": 3593, "donAcc_type": "acceptable", "distance": 3.677, "atom1_id": "///B/627/OG1", "atom2_id": "///B/641/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3491, "atom2_serNum": 3508, "donAcc_type": "questionable", "distance": 2.762, "atom1_id": "///B/629/O", "atom2_id": "///B/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3516, "atom2_serNum": 3528, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/632/O", "atom2_id": "///B/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3525, "atom2_serNum": 3536, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/633/O", "atom2_id": "///B/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3528, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/634/N", "atom2_id": "///B/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3606, "atom2_serNum": 3893, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///B/643/O", "atom2_id": "///B/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3653, "atom2_serNum": 3669, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/648/O", "atom2_id": "///B/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3659, "atom2_serNum": 3665, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///B/649/N", "atom2_id": "///B/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3680, "atom2_serNum": 3693, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///B/651/O", "atom2_id": "///B/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3702, "atom2_serNum": 3885, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/654/N", "atom2_id": "///B/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3705, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/654/O", "atom2_id": "///B/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3712, "atom2_serNum": 5338, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/655/O", "atom2_id": "///D/582/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3718, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/656/N", "atom2_id": "///B/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3721, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/656/O", "atom2_id": "///B/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3732, "atom2_serNum": 5322, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/657/ND2", "atom2_id": "///D/581/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3733, "atom2_serNum": 3848, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/658/N", "atom2_id": "///B/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3736, "atom2_serNum": 3845, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/658/O", "atom2_id": "///B/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3756, "atom2_serNum": 3828, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///B/660/N", "atom2_id": "///B/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3759, "atom2_serNum": 3806, "donAcc_type": "questionable", "distance": 3.364, "atom1_id": "///B/660/O", "atom2_id": "///B/666/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3759, "atom2_serNum": 3823, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/660/O", "atom2_id": "///B/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3771, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/662/N", "atom2_id": "///B/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3786, "atom2_serNum": 3803, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/664/O", "atom2_id": "///B/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3822, "atom2_serNum": 5478, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/667/NH2", "atom2_id": "///D/601/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3836, "atom2_serNum": 6038, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///B/669/OE1", "atom2_id": "///D/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3837, "atom2_serNum": 5300, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/669/NE2", "atom2_id": "///D/578/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3852, "atom2_serNum": 6045, "donAcc_type": "questionable", "distance": 2.584, "atom1_id": "///B/671/OE1", "atom2_id": "///D/669/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3853, "atom2_serNum": 6045, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/671/NE2", "atom2_id": "///D/669/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3863, "atom2_serNum": 6061, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///B/672/NE2", "atom2_id": "///D/671/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3880, "atom2_serNum": 3903, "donAcc_type": "acceptable", "distance": 3.610, "atom1_id": "///B/674/OG1", "atom2_id": "///B/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3923, "atom2_serNum": 5102, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///D/399/O", "atom2_id": "///D/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3944, "atom2_serNum": 5102, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///D/401/O", "atom2_id": "///D/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3952, "atom2_serNum": 3954, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///D/402/O", "atom2_id": "///D/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3964, "atom2_serNum": 3975, "donAcc_type": "acceptable", "distance": 2.517, "atom1_id": "///D/404/O", "atom2_id": "///D/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3964, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///D/404/O", "atom2_id": "///D/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3964, "atom2_serNum": 5203, "donAcc_type": "questionable", "distance": 2.692, "atom1_id": "///D/404/O", "atom2_id": "///D/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3997, "atom2_serNum": 5143, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///D/408/OH", "atom2_id": "///D/552/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 4001, "atom2_serNum": 4286, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/409/O", "atom2_id": "///D/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 4015, "atom2_serNum": 4272, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///D/411/N", "atom2_id": "///D/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 4018, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/411/O", "atom2_id": "///D/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 4034, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///D/413/N", "atom2_id": "///D/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 4043, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/414/N", "atom2_id": "///D/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 4046, "atom2_serNum": 4255, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/414/O", "atom2_id": "///D/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4057, "atom2_serNum": 5227, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///D/415/OE1", "atom2_id": "///D/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4066, "atom2_serNum": 4205, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/417/N", "atom2_id": "///D/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 4078, "atom2_serNum": 5250, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///D/418/O", "atom2_id": "///D/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4092, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/420/N", "atom2_id": "///D/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4095, "atom2_serNum": 4113, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///D/420/O", "atom2_id": "///D/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4101, "atom2_serNum": 4189, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///D/420/NE2", "atom2_id": "///D/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4112, "atom2_serNum": 4164, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///D/421/NH2", "atom2_id": "///D/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4118, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///D/423/N", "atom2_id": "///D/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4121, "atom2_serNum": 4868, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///D/423/O", "atom2_id": "///D/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4128, "atom2_serNum": 4163, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///D/424/N", "atom2_id": "///D/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4131, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///D/424/O", "atom2_id": "///D/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4163, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///D/427/OE1", "atom2_id": "///D/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4164, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///D/427/OE2", "atom2_id": "///D/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4174, "atom2_serNum": 4186, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///D/429/OG", "atom2_id": "///D/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4193, "atom2_serNum": 4202, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/432/O", "atom2_id": "///D/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4195, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///D/433/N", "atom2_id": "///D/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4198, "atom2_serNum": 4244, "donAcc_type": "acceptable", "distance": 3.472, "atom1_id": "///D/433/O", "atom2_id": "///D/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4211, "atom2_serNum": 4237, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///D/435/N", "atom2_id": "///D/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4214, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///D/435/O", "atom2_id": "///D/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4228, "atom2_serNum": 4234, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///D/437/OG1", "atom2_id": "///D/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4251, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/441/O", "atom2_id": "///D/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4262, "atom2_serNum": 4812, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///D/443/N", "atom2_id": "///D/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4265, "atom2_serNum": 4809, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/443/O", "atom2_id": "///D/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4276, "atom2_serNum": 4785, "donAcc_type": "questionable", "distance": 3.287, "atom1_id": "///D/444/OE1", "atom2_id": "///D/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4278, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///D/445/N", "atom2_id": "///D/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4289, "atom2_serNum": 4300, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///D/446/O", "atom2_id": "///D/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4311, "atom2_serNum": 4340, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///D/448/OH", "atom2_id": "///D/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4353, "atom2_serNum": 4744, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///D/454/N", "atom2_id": "///D/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4356, "atom2_serNum": 4741, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/454/O", "atom2_id": "///D/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4365, "atom2_serNum": 4729, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/456/N", "atom2_id": "///D/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4368, "atom2_serNum": 4726, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/456/O", "atom2_id": "///D/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4373, "atom2_serNum": 5095, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///D/457/N", "atom2_id": "///D/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4376, "atom2_serNum": 5077, "donAcc_type": "questionable", "distance": 3.347, "atom1_id": "///D/457/O", "atom2_id": "///D/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4376, "atom2_serNum": 5092, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///D/457/O", "atom2_id": "///D/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4381, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/457/NE2", "atom2_id": "///D/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4382, "atom2_serNum": 4712, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///D/458/N", "atom2_id": "///D/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4385, "atom2_serNum": 4709, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///D/458/O", "atom2_id": "///D/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4390, "atom2_serNum": 5077, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/459/N", "atom2_id": "///D/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4393, "atom2_serNum": 5074, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///D/459/O", "atom2_id": "///D/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4404, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///D/460/O", "atom2_id": "///D/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4409, "atom2_serNum": 5058, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/461/N", "atom2_id": "///D/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4412, "atom2_serNum": 5055, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/461/O", "atom2_id": "///D/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4413, "atom2_serNum": 4472, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///D/462/N", "atom2_id": "///D/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4416, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///D/462/O", "atom2_id": "///D/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4418, "atom2_serNum": 4469, "donAcc_type": "acceptable", "distance": 3.456, "atom1_id": "///D/462/OG1", "atom2_id": "///D/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4431, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/464/OD1", "atom2_id": "///D/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4488, "atom2_serNum": 4514, "donAcc_type": "questionable", "distance": 3.172, "atom1_id": "///D/471/O", "atom2_id": "///D/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4491, "atom2_serNum": 4500, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///D/471/ND1", "atom2_id": "///D/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4494, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///D/471/NE2", "atom2_id": "///D/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4503, "atom2_serNum": 4877, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///D/473/O", "atom2_id": "///D/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4514, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///D/474/O", "atom2_id": "///D/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4523, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///D/475/N", "atom2_id": "///D/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4526, "atom2_serNum": 4860, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///D/475/O", "atom2_id": "///D/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4530, "atom2_serNum": 4693, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/475/OE1", "atom2_id": "///D/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4535, "atom2_serNum": 4701, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///D/476/O", "atom2_id": "///D/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4542, "atom2_serNum": 4560, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///D/477/O", "atom2_id": "///D/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4542, "atom2_serNum": 4840, "donAcc_type": "questionable", "distance": 3.198, "atom1_id": "///D/477/O", "atom2_id": "///D/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4542, "atom2_serNum": 4848, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///D/477/O", "atom2_id": "///D/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4560, "atom2_serNum": 4840, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///D/479/N", "atom2_id": "///D/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4571, "atom2_serNum": 4579, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///D/480/O", "atom2_id": "///D/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4578, "atom2_serNum": 4602, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///D/481/O", "atom2_id": "///D/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4607, "atom2_serNum": 4619, "donAcc_type": "acceptable", "distance": 3.621, "atom1_id": "///D/485/OG1", "atom2_id": "///D/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4609, "atom2_serNum": 4835, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///D/486/N", "atom2_id": "///D/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4614, "atom2_serNum": 4836, "donAcc_type": "acceptable", "distance": 3.385, "atom1_id": "///D/486/OG1", "atom2_id": "///D/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4621, "atom2_serNum": 4817, "donAcc_type": "acceptable", "distance": 2.775, "atom1_id": "///D/487/OG1", "atom2_id": "///D/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4644, "atom2_serNum": 4717, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///D/490/O", "atom2_id": "///D/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4658, "atom2_serNum": 4701, "donAcc_type": "questionable", "distance": 3.330, "atom1_id": "///D/491/NZ", "atom2_id": "///D/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4659, "atom2_serNum": 4705, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///D/492/N", "atom2_id": "///D/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4681, "atom2_serNum": 4685, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///D/495/O", "atom2_id": "///D/495/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4689, "atom2_serNum": 4691, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///D/496/O", "atom2_id": "///D/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4752, "atom2_serNum": 4774, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///D/504/O", "atom2_id": "///D/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4752, "atom2_serNum": 4790, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///D/504/O", "atom2_id": "///D/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4761, "atom2_serNum": 4782, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///D/505/O", "atom2_id": "///D/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4876, "atom2_serNum": 4880, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///D/520/NZ", "atom2_id": "///D/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4888, "atom2_serNum": 4909, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///D/522/O", "atom2_id": "///D/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4888, "atom2_serNum": 4917, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///D/522/O", "atom2_id": "///D/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4892, "atom2_serNum": 4916, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///D/522/NE", "atom2_id": "///D/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4899, "atom2_serNum": 4917, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///D/523/O", "atom2_id": "///D/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4899, "atom2_serNum": 4925, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/523/O", "atom2_id": "///D/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4907, "atom2_serNum": 4934, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/524/O", "atom2_id": "///D/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4920, "atom2_serNum": 4942, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///D/526/O", "atom2_id": "///D/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4945, "atom2_serNum": 4966, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///D/529/O", "atom2_id": "///D/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4973, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///D/532/OE1", "atom2_id": "///D/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4988, "atom2_serNum": 4990, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///D/534/OD1", "atom2_id": "///D/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4993, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///D/535/O", "atom2_id": "///D/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 5001, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///D/536/O", "atom2_id": "///D/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 5005, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/537/O", "atom2_id": "///D/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 5033, "atom2_serNum": 5259, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/540/O", "atom2_id": "///D/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 5035, "atom2_serNum": 5258, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///D/540/OG1", "atom2_id": "///D/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 5048, "atom2_serNum": 5245, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/542/N", "atom2_id": "///D/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 5051, "atom2_serNum": 5242, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///D/542/O", "atom2_id": "///D/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 5066, "atom2_serNum": 5226, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///D/544/N", "atom2_id": "///D/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 5069, "atom2_serNum": 5221, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/544/O", "atom2_id": "///D/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 5081, "atom2_serNum": 5212, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/546/N", "atom2_id": "///D/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 5084, "atom2_serNum": 5209, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///D/546/O", "atom2_id": "///D/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 5099, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 2.406, "atom1_id": "///D/547/NE", "atom2_id": "///D/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 5102, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/547/NH2", "atom2_id": "///D/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 5103, "atom2_serNum": 5195, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///D/548/N", "atom2_id": "///D/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 5106, "atom2_serNum": 5192, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/548/O", "atom2_id": "///D/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 5116, "atom2_serNum": 5191, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///D/549/ND1", "atom2_id": "///D/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 5120, "atom2_serNum": 5182, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///D/550/N", "atom2_id": "///D/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 5123, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/550/O", "atom2_id": "///D/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 5135, "atom2_serNum": 5163, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/552/N", "atom2_id": "///D/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 5138, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///D/552/O", "atom2_id": "///D/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 5142, "atom2_serNum": 5169, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///D/552/OE1", "atom2_id": "///D/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 5226, "atom2_serNum": 5230, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "///D/564/OG", "atom2_id": "///D/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 5258, "atom2_serNum": 5270, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///D/568/OE2", "atom2_id": "///D/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 5304, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///D/579/N", "atom2_id": "///D/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 5307, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/579/O", "atom2_id": "///D/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 5319, "atom2_serNum": 5463, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/581/N", "atom2_id": "///D/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 5328, "atom2_serNum": 5463, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///D/582/N", "atom2_id": "///D/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 5331, "atom2_serNum": 5460, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/582/O", "atom2_id": "///D/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 5347, "atom2_serNum": 5359, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///D/583/NE2", "atom2_id": "///D/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 5347, "atom2_serNum": 6066, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///D/583/NE2", "atom2_id": "///D/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 5348, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///D/584/N", "atom2_id": "///D/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 5355, "atom2_serNum": 5430, "donAcc_type": "questionable", "distance": 3.356, "atom1_id": "///D/584/OD2", "atom2_id": "///D/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 5366, "atom2_serNum": 6084, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///D/586/O", "atom2_id": "///D/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 5374, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///D/587/O", "atom2_id": "///D/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 5380, "atom2_serNum": 6103, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/588/O", "atom2_id": "///D/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 5386, "atom2_serNum": 5398, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///D/589/O", "atom2_id": "///D/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 5386, "atom2_serNum": 5410, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///D/589/O", "atom2_id": "///D/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 5391, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///D/590/N", "atom2_id": "///D/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 5394, "atom2_serNum": 5828, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///D/590/O", "atom2_id": "///D/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 5414, "atom2_serNum": 5807, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///D/593/N", "atom2_id": "///D/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 5421, "atom2_serNum": 5804, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///D/594/O", "atom2_id": "///D/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5436, "atom2_serNum": 5791, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/596/N", "atom2_id": "///D/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5439, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/596/O", "atom2_id": "///D/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5452, "atom2_serNum": 5772, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/598/N", "atom2_id": "///D/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5455, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///D/598/O", "atom2_id": "///D/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5467, "atom2_serNum": 5756, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/600/N", "atom2_id": "///D/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 5474, "atom2_serNum": 5488, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///D/601/O", "atom2_id": "///D/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5479, "atom2_serNum": 5486, "donAcc_type": "standard", "distance": 3.833, "atom1_id": "///D/601/NE2", "atom2_id": "///D/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 5480, "atom2_serNum": 5486, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/602/N", "atom2_id": "///D/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 5480, "atom2_serNum": 5749, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///D/602/N", "atom2_id": "///D/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 5483, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/602/O", "atom2_id": "///D/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5499, "atom2_serNum": 5526, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///D/604/N", "atom2_id": "///D/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5502, "atom2_serNum": 5521, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/604/O", "atom2_id": "///D/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5502, "atom2_serNum": 5526, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///D/604/O", "atom2_id": "///D/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5504, "atom2_serNum": 5512, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///D/604/OG1", "atom2_id": "///D/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5526, "atom2_serNum": 5986, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///D/607/OG", "atom2_id": "///D/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5527, "atom2_serNum": 5975, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/608/N", "atom2_id": "///D/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5530, "atom2_serNum": 5972, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/608/O", "atom2_id": "///D/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5539, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/609/O", "atom2_id": "///D/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5543, "atom2_serNum": 5956, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///D/610/N", "atom2_id": "///D/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5546, "atom2_serNum": 5953, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/610/O", "atom2_id": "///D/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5550, "atom2_serNum": 5664, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/611/N", "atom2_id": "///D/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5553, "atom2_serNum": 5661, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/611/O", "atom2_id": "///D/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5561, "atom2_serNum": 5937, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///D/612/N", "atom2_id": "///D/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5564, "atom2_serNum": 5934, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///D/612/O", "atom2_id": "///D/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5566, "atom2_serNum": 5585, "donAcc_type": "acceptable", "distance": 3.586, "atom1_id": "///D/612/OG1", "atom2_id": "///D/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5568, "atom2_serNum": 5641, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///D/613/N", "atom2_id": "///D/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5571, "atom2_serNum": 5630, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///D/613/O", "atom2_id": "///D/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5571, "atom2_serNum": 5638, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///D/613/O", "atom2_id": "///D/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5575, "atom2_serNum": 5839, "donAcc_type": "acceptable", "distance": 2.606, "atom1_id": "///D/613/OE1", "atom2_id": "///D/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5586, "atom2_serNum": 5615, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/615/N", "atom2_id": "///D/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5589, "atom2_serNum": 5608, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/615/O", "atom2_id": "///D/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5591, "atom2_serNum": 5612, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///D/615/OG1", "atom2_id": "///D/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5611, "atom2_serNum": 5621, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/618/O", "atom2_id": "///D/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5615, "atom2_serNum": 5630, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///D/619/O", "atom2_id": "///D/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5628, "atom2_serNum": 5659, "donAcc_type": "questionable", "distance": 2.715, "atom1_id": "///D/620/OE1", "atom2_id": "///D/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5686, "atom2_serNum": 5688, "donAcc_type": "acceptable", "distance": 3.043, "atom1_id": "///D/627/O", "atom2_id": "///D/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5686, "atom2_serNum": 5795, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///D/627/O", "atom2_id": "///D/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5700, "atom2_serNum": 5717, "donAcc_type": "questionable", "distance": 2.824, "atom1_id": "///D/629/O", "atom2_id": "///D/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5725, "atom2_serNum": 5737, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/632/O", "atom2_id": "///D/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5734, "atom2_serNum": 5745, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/633/O", "atom2_id": "///D/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5737, "atom2_serNum": 5764, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/634/N", "atom2_id": "///D/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5815, "atom2_serNum": 6102, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///D/643/O", "atom2_id": "///D/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5862, "atom2_serNum": 5878, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/648/O", "atom2_id": "///D/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5868, "atom2_serNum": 5874, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///D/649/N", "atom2_id": "///D/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5889, "atom2_serNum": 5902, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///D/651/O", "atom2_id": "///D/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5911, "atom2_serNum": 6094, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///D/654/N", "atom2_id": "///D/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5914, "atom2_serNum": 6091, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///D/654/O", "atom2_id": "///D/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5927, "atom2_serNum": 6076, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/656/N", "atom2_id": "///D/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5930, "atom2_serNum": 6073, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///D/656/O", "atom2_id": "///D/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5942, "atom2_serNum": 6057, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/658/N", "atom2_id": "///D/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5945, "atom2_serNum": 6054, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///D/658/O", "atom2_id": "///D/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5965, "atom2_serNum": 6037, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///D/660/N", "atom2_id": "///D/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5968, "atom2_serNum": 6032, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///D/660/O", "atom2_id": "///D/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5980, "atom2_serNum": 6015, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///D/662/N", "atom2_id": "///D/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5995, "atom2_serNum": 6012, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///D/664/O", "atom2_id": "///D/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 6089, "atom2_serNum": 6112, "donAcc_type": "acceptable", "distance": 3.619, "atom1_id": "///D/674/OG1", "atom2_id": "///D/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 6132, "atom2_serNum": 7311, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///H/399/O", "atom2_id": "///H/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 6153, "atom2_serNum": 7311, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///H/401/O", "atom2_id": "///H/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 6161, "atom2_serNum": 6163, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///H/402/O", "atom2_id": "///H/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 6173, "atom2_serNum": 6184, "donAcc_type": "acceptable", "distance": 2.578, "atom1_id": "///H/404/O", "atom2_id": "///H/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 6173, "atom2_serNum": 7409, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///H/404/O", "atom2_id": "///H/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 6173, "atom2_serNum": 7412, "donAcc_type": "questionable", "distance": 2.698, "atom1_id": "///H/404/O", "atom2_id": "///H/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 6206, "atom2_serNum": 7352, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///H/408/OH", "atom2_id": "///H/552/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 6210, "atom2_serNum": 6495, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///H/409/O", "atom2_id": "///H/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 6224, "atom2_serNum": 6481, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///H/411/N", "atom2_id": "///H/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 6227, "atom2_serNum": 6243, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///H/411/O", "atom2_id": "///H/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 6227, "atom2_serNum": 6478, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/411/O", "atom2_id": "///H/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 6243, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///H/413/N", "atom2_id": "///H/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 6252, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///H/414/N", "atom2_id": "///H/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 6255, "atom2_serNum": 6464, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///H/414/O", "atom2_id": "///H/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 6266, "atom2_serNum": 7436, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///H/415/OE1", "atom2_id": "///H/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 6275, "atom2_serNum": 6414, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/417/N", "atom2_id": "///H/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 6287, "atom2_serNum": 7459, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///H/418/O", "atom2_id": "///H/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 6301, "atom2_serNum": 7462, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///H/420/N", "atom2_id": "///H/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 6304, "atom2_serNum": 6322, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///H/420/O", "atom2_id": "///H/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 6310, "atom2_serNum": 6398, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///H/420/NE2", "atom2_id": "///H/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 6321, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 3.904, "atom1_id": "///H/421/NH2", "atom2_id": "///H/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 6327, "atom2_serNum": 7064, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///H/423/N", "atom2_id": "///H/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 6330, "atom2_serNum": 7077, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///H/423/O", "atom2_id": "///H/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 6337, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///H/424/N", "atom2_id": "///H/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 6340, "atom2_serNum": 6365, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///H/424/O", "atom2_id": "///H/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 6372, "atom2_serNum": 6393, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///H/427/OE1", "atom2_id": "///H/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 6373, "atom2_serNum": 6393, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///H/427/OE2", "atom2_id": "///H/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 6383, "atom2_serNum": 6395, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///H/429/OG", "atom2_id": "///H/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 6402, "atom2_serNum": 6411, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///H/432/O", "atom2_id": "///H/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 6404, "atom2_serNum": 7055, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///H/433/N", "atom2_id": "///H/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 6407, "atom2_serNum": 6453, "donAcc_type": "acceptable", "distance": 3.418, "atom1_id": "///H/433/O", "atom2_id": "///H/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 6420, "atom2_serNum": 6446, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///H/435/N", "atom2_id": "///H/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 6423, "atom2_serNum": 6439, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///H/435/O", "atom2_id": "///H/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 6437, "atom2_serNum": 6443, "donAcc_type": "acceptable", "distance": 3.246, "atom1_id": "///H/437/OG1", "atom2_id": "///H/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 6460, "atom2_serNum": 7030, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/441/O", "atom2_id": "///H/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 6471, "atom2_serNum": 7021, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///H/443/N", "atom2_id": "///H/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 6474, "atom2_serNum": 7018, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///H/443/O", "atom2_id": "///H/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 6485, "atom2_serNum": 6994, "donAcc_type": "questionable", "distance": 3.310, "atom1_id": "///H/444/OE1", "atom2_id": "///H/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 6487, "atom2_serNum": 7002, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///H/445/N", "atom2_id": "///H/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 6498, "atom2_serNum": 6509, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///H/446/O", "atom2_id": "///H/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 6520, "atom2_serNum": 6549, "donAcc_type": "acceptable", "distance": 2.968, "atom1_id": "///H/448/OH", "atom2_id": "///H/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 6562, "atom2_serNum": 6953, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///H/454/N", "atom2_id": "///H/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 6565, "atom2_serNum": 6950, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///H/454/O", "atom2_id": "///H/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 6574, "atom2_serNum": 6938, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///H/456/N", "atom2_id": "///H/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 6577, "atom2_serNum": 6935, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///H/456/O", "atom2_id": "///H/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 6582, "atom2_serNum": 7304, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///H/457/N", "atom2_id": "///H/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 6585, "atom2_serNum": 7286, "donAcc_type": "questionable", "distance": 3.295, "atom1_id": "///H/457/O", "atom2_id": "///H/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 6585, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///H/457/O", "atom2_id": "///H/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 6590, "atom2_serNum": 6933, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///H/457/NE2", "atom2_id": "///H/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 6591, "atom2_serNum": 6921, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///H/458/N", "atom2_id": "///H/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 6594, "atom2_serNum": 6918, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///H/458/O", "atom2_id": "///H/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 6599, "atom2_serNum": 7286, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///H/459/N", "atom2_id": "///H/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 6602, "atom2_serNum": 7283, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///H/459/O", "atom2_id": "///H/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 6613, "atom2_serNum": 6694, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///H/460/O", "atom2_id": "///H/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 6618, "atom2_serNum": 7267, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///H/461/N", "atom2_id": "///H/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 6621, "atom2_serNum": 7264, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///H/461/O", "atom2_id": "///H/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 6622, "atom2_serNum": 6681, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///H/462/N", "atom2_id": "///H/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 6625, "atom2_serNum": 7271, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///H/462/O", "atom2_id": "///H/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 6627, "atom2_serNum": 6678, "donAcc_type": "acceptable", "distance": 3.508, "atom1_id": "///H/462/OG1", "atom2_id": "///H/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 6640, "atom2_serNum": 7253, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///H/464/OD1", "atom2_id": "///H/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 6697, "atom2_serNum": 6723, "donAcc_type": "questionable", "distance": 3.160, "atom1_id": "///H/471/O", "atom2_id": "///H/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 6700, "atom2_serNum": 6709, "donAcc_type": "acceptable", "distance": 3.091, "atom1_id": "///H/471/ND1", "atom2_id": "///H/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 6703, "atom2_serNum": 7249, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///H/471/NE2", "atom2_id": "///H/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 6712, "atom2_serNum": 7086, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///H/473/O", "atom2_id": "///H/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 6723, "atom2_serNum": 6740, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///H/474/O", "atom2_id": "///H/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 6732, "atom2_serNum": 7072, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///H/475/N", "atom2_id": "///H/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 6735, "atom2_serNum": 7069, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///H/475/O", "atom2_id": "///H/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 6739, "atom2_serNum": 6902, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///H/475/OE1", "atom2_id": "///H/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 6744, "atom2_serNum": 6910, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///H/476/O", "atom2_id": "///H/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 6751, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///H/477/O", "atom2_id": "///H/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 6751, "atom2_serNum": 7049, "donAcc_type": "questionable", "distance": 3.233, "atom1_id": "///H/477/O", "atom2_id": "///H/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 6751, "atom2_serNum": 7057, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///H/477/O", "atom2_id": "///H/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 6769, "atom2_serNum": 7049, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///H/479/N", "atom2_id": "///H/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 6780, "atom2_serNum": 6788, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///H/480/O", "atom2_id": "///H/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 6787, "atom2_serNum": 6811, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///H/481/O", "atom2_id": "///H/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 6816, "atom2_serNum": 6828, "donAcc_type": "acceptable", "distance": 3.598, "atom1_id": "///H/485/OG1", "atom2_id": "///H/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 6818, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///H/486/N", "atom2_id": "///H/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 6823, "atom2_serNum": 7045, "donAcc_type": "acceptable", "distance": 3.436, "atom1_id": "///H/486/OG1", "atom2_id": "///H/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 6830, "atom2_serNum": 7026, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///H/487/OG1", "atom2_id": "///H/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 6853, "atom2_serNum": 6926, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///H/490/O", "atom2_id": "///H/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 6867, "atom2_serNum": 6910, "donAcc_type": "questionable", "distance": 3.264, "atom1_id": "///H/491/NZ", "atom2_id": "///H/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 6868, "atom2_serNum": 6914, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///H/492/N", "atom2_id": "///H/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 6898, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///H/496/O", "atom2_id": "///H/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 6961, "atom2_serNum": 6983, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///H/504/O", "atom2_id": "///H/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 6961, "atom2_serNum": 6999, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///H/504/O", "atom2_id": "///H/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 6970, "atom2_serNum": 6991, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///H/505/O", "atom2_id": "///H/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 7085, "atom2_serNum": 7089, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///H/520/NZ", "atom2_id": "///H/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 7097, "atom2_serNum": 7118, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///H/522/O", "atom2_id": "///H/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 7097, "atom2_serNum": 7126, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///H/522/O", "atom2_id": "///H/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 7101, "atom2_serNum": 7125, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///H/522/NE", "atom2_id": "///H/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 7108, "atom2_serNum": 7126, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///H/523/O", "atom2_id": "///H/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 7108, "atom2_serNum": 7134, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///H/523/O", "atom2_id": "///H/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 7116, "atom2_serNum": 7143, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///H/524/O", "atom2_id": "///H/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 7129, "atom2_serNum": 7151, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///H/526/O", "atom2_id": "///H/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 7154, "atom2_serNum": 7175, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///H/529/O", "atom2_id": "///H/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 7182, "atom2_serNum": 7191, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///H/532/OE1", "atom2_id": "///H/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 7197, "atom2_serNum": 7199, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///H/534/OD1", "atom2_id": "///H/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 7202, "atom2_serNum": 7238, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///H/535/O", "atom2_id": "///H/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 7210, "atom2_serNum": 7231, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///H/536/O", "atom2_id": "///H/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 7214, "atom2_serNum": 7231, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///H/537/O", "atom2_id": "///H/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 7242, "atom2_serNum": 7468, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///H/540/O", "atom2_id": "///H/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 7244, "atom2_serNum": 7467, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///H/540/OG1", "atom2_id": "///H/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 7257, "atom2_serNum": 7454, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///H/542/N", "atom2_id": "///H/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 7260, "atom2_serNum": 7451, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///H/542/O", "atom2_id": "///H/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 7275, "atom2_serNum": 7435, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///H/544/N", "atom2_id": "///H/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 7278, "atom2_serNum": 7430, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///H/544/O", "atom2_id": "///H/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 7290, "atom2_serNum": 7421, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///H/546/N", "atom2_id": "///H/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 7293, "atom2_serNum": 7418, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///H/546/O", "atom2_id": "///H/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 7308, "atom2_serNum": 7416, "donAcc_type": "standard", "distance": 2.362, "atom1_id": "///H/547/NE", "atom2_id": "///H/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 7311, "atom2_serNum": 7416, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///H/547/NH2", "atom2_id": "///H/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 7312, "atom2_serNum": 7404, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///H/548/N", "atom2_id": "///H/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 7315, "atom2_serNum": 7401, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///H/548/O", "atom2_id": "///H/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 7325, "atom2_serNum": 7400, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///H/549/ND1", "atom2_id": "///H/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 7329, "atom2_serNum": 7391, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///H/550/N", "atom2_id": "///H/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 7332, "atom2_serNum": 7388, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///H/550/O", "atom2_id": "///H/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 7344, "atom2_serNum": 7372, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///H/552/N", "atom2_id": "///H/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 7347, "atom2_serNum": 7365, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///H/552/O", "atom2_id": "///H/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 7351, "atom2_serNum": 7378, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///H/552/OE1", "atom2_id": "///H/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 7435, "atom2_serNum": 7439, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///H/564/OG", "atom2_id": "///H/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 7467, "atom2_serNum": 7479, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///H/568/OE2", "atom2_id": "///H/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 7509, "atom2_serNum": 10464, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///H/578/O", "atom2_id": "///I/669/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 7513, "atom2_serNum": 7683, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///H/579/N", "atom2_id": "///H/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 7516, "atom2_serNum": 7680, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///H/579/O", "atom2_id": "///H/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 7528, "atom2_serNum": 7672, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///H/581/N", "atom2_id": "///H/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 7531, "atom2_serNum": 10359, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///H/581/O", "atom2_id": "///I/657/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 7536, "atom2_serNum": 10003, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///H/581/OE2", "atom2_id": "///I/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 7537, "atom2_serNum": 7672, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///H/582/N", "atom2_id": "///H/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 7540, "atom2_serNum": 7669, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///H/582/O", "atom2_id": "///H/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 7547, "atom2_serNum": 9998, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///H/582/NH2", "atom2_id": "///I/614/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 7547, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///H/582/NH2", "atom2_id": "///I/655/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 7556, "atom2_serNum": 7568, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///H/583/NE2", "atom2_id": "///H/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 7556, "atom2_serNum": 8275, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///H/583/NE2", "atom2_id": "///H/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 7557, "atom2_serNum": 7656, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///H/584/N", "atom2_id": "///H/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 7564, "atom2_serNum": 7639, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///H/584/OD2", "atom2_id": "///H/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 7575, "atom2_serNum": 8293, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///H/586/O", "atom2_id": "///H/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 7583, "atom2_serNum": 7635, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///H/587/O", "atom2_id": "///H/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 7589, "atom2_serNum": 8312, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///H/588/O", "atom2_id": "///H/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 7595, "atom2_serNum": 7607, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///H/589/O", "atom2_id": "///H/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 7595, "atom2_serNum": 7619, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///H/589/O", "atom2_id": "///H/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 7600, "atom2_serNum": 8315, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///H/590/N", "atom2_id": "///H/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 7603, "atom2_serNum": 8037, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///H/590/O", "atom2_id": "///H/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 7623, "atom2_serNum": 8016, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///H/593/N", "atom2_id": "///H/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 7630, "atom2_serNum": 8013, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///H/594/O", "atom2_id": "///H/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 7645, "atom2_serNum": 8000, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///H/596/N", "atom2_id": "///H/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 7648, "atom2_serNum": 7997, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///H/596/O", "atom2_id": "///H/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 7661, "atom2_serNum": 7981, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///H/598/N", "atom2_id": "///H/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 7664, "atom2_serNum": 7978, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///H/598/O", "atom2_id": "///H/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 7674, "atom2_serNum": 10014, "donAcc_type": "acceptable", "distance": 2.763, "atom1_id": "///H/599/OG1", "atom2_id": "///I/616/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 7676, "atom2_serNum": 7965, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///H/600/N", "atom2_id": "///H/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 7683, "atom2_serNum": 7697, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///H/601/O", "atom2_id": "///H/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 7689, "atom2_serNum": 7695, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///H/602/N", "atom2_id": "///H/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 7689, "atom2_serNum": 7958, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///H/602/N", "atom2_id": "///H/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 7692, "atom2_serNum": 7708, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///H/602/O", "atom2_id": "///H/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 7700, "atom2_serNum": 7949, "donAcc_type": "questionable", "distance": 3.124, "atom1_id": "///H/603/O", "atom2_id": "///H/634/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 7708, "atom2_serNum": 7735, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///H/604/N", "atom2_id": "///H/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 7711, "atom2_serNum": 7730, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///H/604/O", "atom2_id": "///H/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 7711, "atom2_serNum": 7735, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///H/604/O", "atom2_id": "///H/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 7735, "atom2_serNum": 8195, "donAcc_type": "acceptable", "distance": 2.529, "atom1_id": "///H/607/OG", "atom2_id": "///H/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 7736, "atom2_serNum": 8184, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///H/608/N", "atom2_id": "///H/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 7739, "atom2_serNum": 8181, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///H/608/O", "atom2_id": "///H/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 7748, "atom2_serNum": 7887, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///H/609/O", "atom2_id": "///H/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 7752, "atom2_serNum": 8165, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///H/610/N", "atom2_id": "///H/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 7755, "atom2_serNum": 8162, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///H/610/O", "atom2_id": "///H/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 7759, "atom2_serNum": 7873, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///H/611/N", "atom2_id": "///H/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 7762, "atom2_serNum": 7870, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/611/O", "atom2_id": "///H/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 7770, "atom2_serNum": 8146, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///H/612/N", "atom2_id": "///H/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 7773, "atom2_serNum": 8143, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///H/612/O", "atom2_id": "///H/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 7775, "atom2_serNum": 7794, "donAcc_type": "acceptable", "distance": 3.610, "atom1_id": "///H/612/OG1", "atom2_id": "///H/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 7777, "atom2_serNum": 7850, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///H/613/N", "atom2_id": "///H/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 7780, "atom2_serNum": 7839, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///H/613/O", "atom2_id": "///H/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 7780, "atom2_serNum": 7847, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///H/613/O", "atom2_id": "///H/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 7784, "atom2_serNum": 8048, "donAcc_type": "acceptable", "distance": 2.558, "atom1_id": "///H/613/OE1", "atom2_id": "///H/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 7795, "atom2_serNum": 7824, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///H/615/N", "atom2_id": "///H/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 7798, "atom2_serNum": 7817, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/615/O", "atom2_id": "///H/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 7800, "atom2_serNum": 7821, "donAcc_type": "acceptable", "distance": 3.395, "atom1_id": "///H/615/OG1", "atom2_id": "///H/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 7820, "atom2_serNum": 7830, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/618/O", "atom2_id": "///H/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 7824, "atom2_serNum": 7839, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///H/619/O", "atom2_id": "///H/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 7837, "atom2_serNum": 7868, "donAcc_type": "questionable", "distance": 2.744, "atom1_id": "///H/620/OE1", "atom2_id": "///H/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 7895, "atom2_serNum": 7897, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///H/627/O", "atom2_id": "///H/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 7895, "atom2_serNum": 8004, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///H/627/O", "atom2_id": "///H/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 7897, "atom2_serNum": 8011, "donAcc_type": "acceptable", "distance": 3.645, "atom1_id": "///H/627/OG1", "atom2_id": "///H/641/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 7909, "atom2_serNum": 7926, "donAcc_type": "questionable", "distance": 2.783, "atom1_id": "///H/629/O", "atom2_id": "///H/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 7943, "atom2_serNum": 7954, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///H/633/O", "atom2_id": "///H/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 7946, "atom2_serNum": 7973, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///H/634/N", "atom2_id": "///H/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 8024, "atom2_serNum": 8311, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///H/643/O", "atom2_id": "///H/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 8071, "atom2_serNum": 8087, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/648/O", "atom2_id": "///H/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 8077, "atom2_serNum": 8083, "donAcc_type": "acceptable", "distance": 2.997, "atom1_id": "///H/649/N", "atom2_id": "///H/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 8098, "atom2_serNum": 8111, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///H/651/O", "atom2_id": "///H/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 8120, "atom2_serNum": 8303, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///H/654/N", "atom2_id": "///H/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 8123, "atom2_serNum": 8300, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///H/654/O", "atom2_id": "///H/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 8136, "atom2_serNum": 8285, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///H/656/N", "atom2_id": "///H/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 8139, "atom2_serNum": 8282, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///H/656/O", "atom2_id": "///H/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 8151, "atom2_serNum": 8266, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/658/N", "atom2_id": "///H/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 8154, "atom2_serNum": 8263, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///H/658/O", "atom2_id": "///H/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 8174, "atom2_serNum": 8246, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///H/660/N", "atom2_id": "///H/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 8177, "atom2_serNum": 8241, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/660/O", "atom2_id": "///H/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 8189, "atom2_serNum": 8224, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///H/662/N", "atom2_id": "///H/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 8204, "atom2_serNum": 8221, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///H/664/O", "atom2_id": "///H/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 8247, "atom2_serNum": 10463, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///H/669/N", "atom2_id": "///I/669/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 8254, "atom2_serNum": 10480, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///H/669/OE1", "atom2_id": "///I/671/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 8270, "atom2_serNum": 10490, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///H/671/OE1", "atom2_id": "///I/672/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 8298, "atom2_serNum": 8321, "donAcc_type": "acceptable", "distance": 3.612, "atom1_id": "///H/674/OG1", "atom2_id": "///H/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 8341, "atom2_serNum": 9520, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///I/399/O", "atom2_id": "///I/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 8362, "atom2_serNum": 9520, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/401/O", "atom2_id": "///I/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 8370, "atom2_serNum": 8372, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///I/402/O", "atom2_id": "///I/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 8382, "atom2_serNum": 8393, "donAcc_type": "acceptable", "distance": 2.503, "atom1_id": "///I/404/O", "atom2_id": "///I/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 8382, "atom2_serNum": 9618, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///I/404/O", "atom2_id": "///I/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 8382, "atom2_serNum": 9621, "donAcc_type": "questionable", "distance": 2.718, "atom1_id": "///I/404/O", "atom2_id": "///I/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 8415, "atom2_serNum": 9561, "donAcc_type": "acceptable", "distance": 3.291, "atom1_id": "///I/408/OH", "atom2_id": "///I/552/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 8419, "atom2_serNum": 8704, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///I/409/O", "atom2_id": "///I/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 8433, "atom2_serNum": 8690, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///I/411/N", "atom2_id": "///I/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 8436, "atom2_serNum": 8687, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/411/O", "atom2_id": "///I/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 8452, "atom2_serNum": 8676, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///I/413/N", "atom2_id": "///I/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 8461, "atom2_serNum": 8676, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///I/414/N", "atom2_id": "///I/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 8464, "atom2_serNum": 8673, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///I/414/O", "atom2_id": "///I/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 8475, "atom2_serNum": 9645, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///I/415/OE1", "atom2_id": "///I/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 8484, "atom2_serNum": 8623, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///I/417/N", "atom2_id": "///I/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 8496, "atom2_serNum": 9668, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///I/418/O", "atom2_id": "///I/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 8510, "atom2_serNum": 9671, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///I/420/N", "atom2_id": "///I/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 8513, "atom2_serNum": 8531, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///I/420/O", "atom2_id": "///I/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 8519, "atom2_serNum": 8607, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///I/420/NE2", "atom2_id": "///I/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 8530, "atom2_serNum": 8582, "donAcc_type": "standard", "distance": 3.880, "atom1_id": "///I/421/NH2", "atom2_id": "///I/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 8536, "atom2_serNum": 9273, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///I/423/N", "atom2_id": "///I/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 8539, "atom2_serNum": 9286, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///I/423/O", "atom2_id": "///I/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 8546, "atom2_serNum": 8581, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///I/424/N", "atom2_id": "///I/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 8549, "atom2_serNum": 8574, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///I/424/O", "atom2_id": "///I/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 8581, "atom2_serNum": 8602, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///I/427/OE1", "atom2_id": "///I/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 8582, "atom2_serNum": 8602, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///I/427/OE2", "atom2_id": "///I/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 8592, "atom2_serNum": 8604, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///I/429/OG", "atom2_id": "///I/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 8611, "atom2_serNum": 8620, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///I/432/O", "atom2_id": "///I/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 8613, "atom2_serNum": 9264, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///I/433/N", "atom2_id": "///I/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 8616, "atom2_serNum": 8662, "donAcc_type": "acceptable", "distance": 3.407, "atom1_id": "///I/433/O", "atom2_id": "///I/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 8629, "atom2_serNum": 8655, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///I/435/N", "atom2_id": "///I/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 8632, "atom2_serNum": 8648, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/435/O", "atom2_id": "///I/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 8646, "atom2_serNum": 8652, "donAcc_type": "acceptable", "distance": 3.246, "atom1_id": "///I/437/OG1", "atom2_id": "///I/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 8669, "atom2_serNum": 9239, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///I/441/O", "atom2_id": "///I/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 8680, "atom2_serNum": 9230, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///I/443/N", "atom2_id": "///I/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 8683, "atom2_serNum": 9227, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///I/443/O", "atom2_id": "///I/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 8694, "atom2_serNum": 9203, "donAcc_type": "questionable", "distance": 3.293, "atom1_id": "///I/444/OE1", "atom2_id": "///I/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 8696, "atom2_serNum": 9211, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///I/445/N", "atom2_id": "///I/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 8707, "atom2_serNum": 8718, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///I/446/O", "atom2_id": "///I/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 8729, "atom2_serNum": 8758, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///I/448/OH", "atom2_id": "///I/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 8771, "atom2_serNum": 9162, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///I/454/N", "atom2_id": "///I/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 8774, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///I/454/O", "atom2_id": "///I/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 8783, "atom2_serNum": 9147, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///I/456/N", "atom2_id": "///I/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 8786, "atom2_serNum": 9144, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///I/456/O", "atom2_id": "///I/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 8791, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///I/457/N", "atom2_id": "///I/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 8794, "atom2_serNum": 9495, "donAcc_type": "questionable", "distance": 3.349, "atom1_id": "///I/457/O", "atom2_id": "///I/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 8794, "atom2_serNum": 9510, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///I/457/O", "atom2_id": "///I/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 8799, "atom2_serNum": 9142, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/457/NE2", "atom2_id": "///I/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 8800, "atom2_serNum": 9130, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///I/458/N", "atom2_id": "///I/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 8803, "atom2_serNum": 9127, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///I/458/O", "atom2_id": "///I/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 8808, "atom2_serNum": 9495, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///I/459/N", "atom2_id": "///I/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 8811, "atom2_serNum": 9492, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/459/O", "atom2_id": "///I/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 8822, "atom2_serNum": 8903, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///I/460/O", "atom2_id": "///I/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 8827, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///I/461/N", "atom2_id": "///I/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 8830, "atom2_serNum": 9473, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///I/461/O", "atom2_id": "///I/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 8831, "atom2_serNum": 8890, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///I/462/N", "atom2_id": "///I/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 8834, "atom2_serNum": 9480, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///I/462/O", "atom2_id": "///I/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 8836, "atom2_serNum": 8887, "donAcc_type": "acceptable", "distance": 3.522, "atom1_id": "///I/462/OG1", "atom2_id": "///I/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 8849, "atom2_serNum": 9462, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///I/464/OD1", "atom2_id": "///I/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 8906, "atom2_serNum": 8932, "donAcc_type": "questionable", "distance": 3.168, "atom1_id": "///I/471/O", "atom2_id": "///I/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 8909, "atom2_serNum": 8918, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///I/471/ND1", "atom2_id": "///I/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 8912, "atom2_serNum": 9458, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///I/471/NE2", "atom2_id": "///I/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 8921, "atom2_serNum": 9295, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///I/473/O", "atom2_id": "///I/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 8932, "atom2_serNum": 8949, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///I/474/O", "atom2_id": "///I/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 8941, "atom2_serNum": 9281, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///I/475/N", "atom2_id": "///I/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 8944, "atom2_serNum": 9278, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/475/O", "atom2_id": "///I/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 8948, "atom2_serNum": 9111, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///I/475/OE1", "atom2_id": "///I/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 8953, "atom2_serNum": 9119, "donAcc_type": "standard", "distance": 3.564, "atom1_id": "///I/476/O", "atom2_id": "///I/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 8960, "atom2_serNum": 8978, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///I/477/O", "atom2_id": "///I/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 8960, "atom2_serNum": 9258, "donAcc_type": "questionable", "distance": 3.186, "atom1_id": "///I/477/O", "atom2_id": "///I/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 8960, "atom2_serNum": 9266, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///I/477/O", "atom2_id": "///I/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 8978, "atom2_serNum": 9258, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/479/N", "atom2_id": "///I/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 8989, "atom2_serNum": 8997, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///I/480/O", "atom2_id": "///I/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 8996, "atom2_serNum": 9020, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///I/481/O", "atom2_id": "///I/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 9025, "atom2_serNum": 9037, "donAcc_type": "acceptable", "distance": 3.616, "atom1_id": "///I/485/OG1", "atom2_id": "///I/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 9027, "atom2_serNum": 9253, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///I/486/N", "atom2_id": "///I/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 9032, "atom2_serNum": 9254, "donAcc_type": "acceptable", "distance": 3.364, "atom1_id": "///I/486/OG1", "atom2_id": "///I/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 9039, "atom2_serNum": 9235, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///I/487/OG1", "atom2_id": "///I/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 9062, "atom2_serNum": 9135, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///I/490/O", "atom2_id": "///I/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 9076, "atom2_serNum": 9119, "donAcc_type": "questionable", "distance": 3.298, "atom1_id": "///I/491/NZ", "atom2_id": "///I/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 9077, "atom2_serNum": 9123, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///I/492/N", "atom2_id": "///I/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 9107, "atom2_serNum": 9109, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///I/496/O", "atom2_id": "///I/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 9170, "atom2_serNum": 9192, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///I/504/O", "atom2_id": "///I/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 9170, "atom2_serNum": 9208, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///I/504/O", "atom2_id": "///I/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 9179, "atom2_serNum": 9200, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///I/505/O", "atom2_id": "///I/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 9294, "atom2_serNum": 9298, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///I/520/NZ", "atom2_id": "///I/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 9298, "atom2_serNum": 9314, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///I/521/O", "atom2_id": "///I/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 9306, "atom2_serNum": 9327, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///I/522/O", "atom2_id": "///I/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 9306, "atom2_serNum": 9335, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///I/522/O", "atom2_id": "///I/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 9310, "atom2_serNum": 9334, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///I/522/NE", "atom2_id": "///I/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 9313, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///I/522/NH2", "atom2_id": "///I/525/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 9317, "atom2_serNum": 9335, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///I/523/O", "atom2_id": "///I/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 9317, "atom2_serNum": 9343, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///I/523/O", "atom2_id": "///I/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 9325, "atom2_serNum": 9352, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///I/524/O", "atom2_id": "///I/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 9338, "atom2_serNum": 9360, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///I/526/O", "atom2_id": "///I/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 9363, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///I/529/O", "atom2_id": "///I/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 9391, "atom2_serNum": 9400, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///I/532/OE1", "atom2_id": "///I/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 9406, "atom2_serNum": 9408, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///I/534/OD1", "atom2_id": "///I/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 9411, "atom2_serNum": 9447, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///I/535/O", "atom2_id": "///I/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 9419, "atom2_serNum": 9440, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///I/536/O", "atom2_id": "///I/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 9423, "atom2_serNum": 9440, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///I/537/O", "atom2_id": "///I/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 9451, "atom2_serNum": 9677, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///I/540/O", "atom2_id": "///I/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 9453, "atom2_serNum": 9676, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///I/540/OG1", "atom2_id": "///I/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 9466, "atom2_serNum": 9663, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/542/N", "atom2_id": "///I/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 9469, "atom2_serNum": 9660, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///I/542/O", "atom2_id": "///I/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 9484, "atom2_serNum": 9644, "donAcc_type": "acceptable", "distance": 2.578, "atom1_id": "///I/544/N", "atom2_id": "///I/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 9487, "atom2_serNum": 9639, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/544/O", "atom2_id": "///I/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 9499, "atom2_serNum": 9630, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/546/N", "atom2_id": "///I/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 9502, "atom2_serNum": 9627, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/546/O", "atom2_id": "///I/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 9517, "atom2_serNum": 9625, "donAcc_type": "standard", "distance": 2.410, "atom1_id": "///I/547/NE", "atom2_id": "///I/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 9520, "atom2_serNum": 9625, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///I/547/NH2", "atom2_id": "///I/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 9521, "atom2_serNum": 9613, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///I/548/N", "atom2_id": "///I/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 9524, "atom2_serNum": 9610, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///I/548/O", "atom2_id": "///I/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 9534, "atom2_serNum": 9609, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///I/549/ND1", "atom2_id": "///I/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 9538, "atom2_serNum": 9600, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///I/550/N", "atom2_id": "///I/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 9541, "atom2_serNum": 9597, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///I/550/O", "atom2_id": "///I/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 9553, "atom2_serNum": 9581, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///I/552/N", "atom2_id": "///I/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 9556, "atom2_serNum": 9574, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///I/552/O", "atom2_id": "///I/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 9560, "atom2_serNum": 9587, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///I/552/OE1", "atom2_id": "///I/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 9644, "atom2_serNum": 9648, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///I/564/OG", "atom2_id": "///I/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 9676, "atom2_serNum": 9688, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///I/568/OE2", "atom2_id": "///I/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 9692, "atom2_serNum": 9706, "donAcc_type": "questionable", "distance": 2.204, "atom1_id": "///I/571/O", "atom2_id": "///I/576/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 9722, "atom2_serNum": 9892, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///I/579/N", "atom2_id": "///I/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 9725, "atom2_serNum": 9889, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///I/579/O", "atom2_id": "///I/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 9737, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///I/581/N", "atom2_id": "///I/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 9746, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///I/582/N", "atom2_id": "///I/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 9749, "atom2_serNum": 9878, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///I/582/O", "atom2_id": "///I/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 9765, "atom2_serNum": 9777, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///I/583/NE2", "atom2_id": "///I/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 9765, "atom2_serNum": 10484, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///I/583/NE2", "atom2_id": "///I/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 9766, "atom2_serNum": 9865, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///I/584/N", "atom2_id": "///I/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 9773, "atom2_serNum": 9848, "donAcc_type": "questionable", "distance": 3.318, "atom1_id": "///I/584/OD2", "atom2_id": "///I/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 9784, "atom2_serNum": 10502, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///I/586/O", "atom2_id": "///I/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 9792, "atom2_serNum": 9844, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///I/587/O", "atom2_id": "///I/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 9798, "atom2_serNum": 10521, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/588/O", "atom2_id": "///I/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 9804, "atom2_serNum": 9816, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///I/589/O", "atom2_id": "///I/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 9804, "atom2_serNum": 9828, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///I/589/O", "atom2_id": "///I/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 9809, "atom2_serNum": 10524, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///I/590/N", "atom2_id": "///I/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 9812, "atom2_serNum": 10246, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///I/590/O", "atom2_id": "///I/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 9832, "atom2_serNum": 10225, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///I/593/N", "atom2_id": "///I/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 9839, "atom2_serNum": 10222, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///I/594/O", "atom2_id": "///I/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 9854, "atom2_serNum": 10209, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/596/N", "atom2_id": "///I/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 9857, "atom2_serNum": 10206, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///I/596/O", "atom2_id": "///I/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 9870, "atom2_serNum": 10190, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///I/598/N", "atom2_id": "///I/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 9873, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///I/598/O", "atom2_id": "///I/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 9885, "atom2_serNum": 10174, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///I/600/N", "atom2_id": "///I/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 9892, "atom2_serNum": 9906, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///I/601/O", "atom2_id": "///I/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 9898, "atom2_serNum": 9904, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///I/602/N", "atom2_id": "///I/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 9898, "atom2_serNum": 10167, "donAcc_type": "standard", "distance": 3.593, "atom1_id": "///I/602/N", "atom2_id": "///I/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 9901, "atom2_serNum": 9917, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/602/O", "atom2_id": "///I/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 9917, "atom2_serNum": 9944, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///I/604/N", "atom2_id": "///I/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 9920, "atom2_serNum": 9939, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///I/604/O", "atom2_id": "///I/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 9920, "atom2_serNum": 9944, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///I/604/O", "atom2_id": "///I/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 9944, "atom2_serNum": 10404, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///I/607/OG", "atom2_id": "///I/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 9945, "atom2_serNum": 10393, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///I/608/N", "atom2_id": "///I/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 9948, "atom2_serNum": 10390, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/608/O", "atom2_id": "///I/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 9957, "atom2_serNum": 10096, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/609/O", "atom2_id": "///I/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 9961, "atom2_serNum": 10374, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///I/610/N", "atom2_id": "///I/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 9964, "atom2_serNum": 10371, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///I/610/O", "atom2_id": "///I/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 9968, "atom2_serNum": 10082, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/611/N", "atom2_id": "///I/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 9971, "atom2_serNum": 10079, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///I/611/O", "atom2_id": "///I/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 9979, "atom2_serNum": 10355, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///I/612/N", "atom2_id": "///I/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 9982, "atom2_serNum": 10352, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///I/612/O", "atom2_id": "///I/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 9984, "atom2_serNum": 10003, "donAcc_type": "acceptable", "distance": 3.601, "atom1_id": "///I/612/OG1", "atom2_id": "///I/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 9986, "atom2_serNum": 10059, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///I/613/N", "atom2_id": "///I/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 9989, "atom2_serNum": 10048, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///I/613/O", "atom2_id": "///I/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 9989, "atom2_serNum": 10056, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///I/613/O", "atom2_id": "///I/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 9993, "atom2_serNum": 10257, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///I/613/OE1", "atom2_id": "///I/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 10004, "atom2_serNum": 10033, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///I/615/N", "atom2_id": "///I/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 10007, "atom2_serNum": 10026, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/615/O", "atom2_id": "///I/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 10009, "atom2_serNum": 10030, "donAcc_type": "acceptable", "distance": 3.399, "atom1_id": "///I/615/OG1", "atom2_id": "///I/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 10029, "atom2_serNum": 10039, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/618/O", "atom2_id": "///I/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 10033, "atom2_serNum": 10048, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///I/619/O", "atom2_id": "///I/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 10046, "atom2_serNum": 10077, "donAcc_type": "questionable", "distance": 2.743, "atom1_id": "///I/620/OE1", "atom2_id": "///I/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 10104, "atom2_serNum": 10106, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///I/627/O", "atom2_id": "///I/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 10104, "atom2_serNum": 10213, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///I/627/O", "atom2_id": "///I/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 10106, "atom2_serNum": 10220, "donAcc_type": "acceptable", "distance": 3.630, "atom1_id": "///I/627/OG1", "atom2_id": "///I/641/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 10118, "atom2_serNum": 10135, "donAcc_type": "questionable", "distance": 2.781, "atom1_id": "///I/629/O", "atom2_id": "///I/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 10143, "atom2_serNum": 10155, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/632/O", "atom2_id": "///I/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 10152, "atom2_serNum": 10163, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///I/633/O", "atom2_id": "///I/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 10155, "atom2_serNum": 10182, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///I/634/N", "atom2_id": "///I/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 10233, "atom2_serNum": 10520, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///I/643/O", "atom2_id": "///I/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 10280, "atom2_serNum": 10296, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/648/O", "atom2_id": "///I/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 10286, "atom2_serNum": 10292, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///I/649/N", "atom2_id": "///I/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 10307, "atom2_serNum": 10320, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///I/651/O", "atom2_id": "///I/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 10329, "atom2_serNum": 10512, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///I/654/N", "atom2_id": "///I/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 10332, "atom2_serNum": 10509, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///I/654/O", "atom2_id": "///I/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 10345, "atom2_serNum": 10494, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///I/656/N", "atom2_id": "///I/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 10348, "atom2_serNum": 10491, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///I/656/O", "atom2_id": "///I/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 10360, "atom2_serNum": 10475, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/658/N", "atom2_id": "///I/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 10363, "atom2_serNum": 10472, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///I/658/O", "atom2_id": "///I/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 10383, "atom2_serNum": 10455, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///I/660/N", "atom2_id": "///I/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 10386, "atom2_serNum": 10450, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/660/O", "atom2_id": "///I/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 10398, "atom2_serNum": 10433, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///I/662/N", "atom2_id": "///I/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 10413, "atom2_serNum": 10430, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///I/664/O", "atom2_id": "///I/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 10507, "atom2_serNum": 10530, "donAcc_type": "acceptable", "distance": 3.633, "atom1_id": "///I/674/OG1", "atom2_id": "///I/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 10550, "atom2_serNum": 11729, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///L/399/O", "atom2_id": "///L/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 10571, "atom2_serNum": 11729, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///L/401/O", "atom2_id": "///L/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 10579, "atom2_serNum": 10581, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///L/402/O", "atom2_id": "///L/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 10591, "atom2_serNum": 10602, "donAcc_type": "acceptable", "distance": 2.538, "atom1_id": "///L/404/O", "atom2_id": "///L/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 10591, "atom2_serNum": 11827, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///L/404/O", "atom2_id": "///L/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 10591, "atom2_serNum": 11830, "donAcc_type": "questionable", "distance": 2.706, "atom1_id": "///L/404/O", "atom2_id": "///L/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 10624, "atom2_serNum": 11770, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///L/408/OH", "atom2_id": "///L/552/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 10628, "atom2_serNum": 10913, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///L/409/O", "atom2_id": "///L/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 10642, "atom2_serNum": 10899, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///L/411/N", "atom2_id": "///L/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 10645, "atom2_serNum": 10896, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///L/411/O", "atom2_id": "///L/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 10661, "atom2_serNum": 10885, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///L/413/N", "atom2_id": "///L/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 10670, "atom2_serNum": 10885, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///L/414/N", "atom2_id": "///L/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 10673, "atom2_serNum": 10882, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///L/414/O", "atom2_id": "///L/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 10684, "atom2_serNum": 11854, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///L/415/OE1", "atom2_id": "///L/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 10693, "atom2_serNum": 10832, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///L/417/N", "atom2_id": "///L/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 10705, "atom2_serNum": 11877, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///L/418/O", "atom2_id": "///L/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 10719, "atom2_serNum": 11880, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///L/420/N", "atom2_id": "///L/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 10722, "atom2_serNum": 10740, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///L/420/O", "atom2_id": "///L/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 10728, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///L/420/NE2", "atom2_id": "///L/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 10739, "atom2_serNum": 10791, "donAcc_type": "standard", "distance": 3.861, "atom1_id": "///L/421/NH2", "atom2_id": "///L/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 10745, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///L/423/N", "atom2_id": "///L/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 10748, "atom2_serNum": 11495, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///L/423/O", "atom2_id": "///L/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 10755, "atom2_serNum": 10790, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///L/424/N", "atom2_id": "///L/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 10758, "atom2_serNum": 10783, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///L/424/O", "atom2_id": "///L/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 10790, "atom2_serNum": 10811, "donAcc_type": "standard", "distance": 2.430, "atom1_id": "///L/427/OE1", "atom2_id": "///L/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 10791, "atom2_serNum": 10811, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///L/427/OE2", "atom2_id": "///L/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 10801, "atom2_serNum": 10813, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///L/429/OG", "atom2_id": "///L/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 10820, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///L/432/O", "atom2_id": "///L/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 10822, "atom2_serNum": 11473, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///L/433/N", "atom2_id": "///L/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 10825, "atom2_serNum": 10871, "donAcc_type": "acceptable", "distance": 3.422, "atom1_id": "///L/433/O", "atom2_id": "///L/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 10838, "atom2_serNum": 10864, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///L/435/N", "atom2_id": "///L/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 10841, "atom2_serNum": 10857, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///L/435/O", "atom2_id": "///L/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 10855, "atom2_serNum": 10861, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///L/437/OG1", "atom2_id": "///L/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 10878, "atom2_serNum": 11448, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///L/441/O", "atom2_id": "///L/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 10889, "atom2_serNum": 11439, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///L/443/N", "atom2_id": "///L/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 10892, "atom2_serNum": 11436, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///L/443/O", "atom2_id": "///L/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 10903, "atom2_serNum": 11412, "donAcc_type": "questionable", "distance": 3.283, "atom1_id": "///L/444/OE1", "atom2_id": "///L/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 10905, "atom2_serNum": 11420, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///L/445/N", "atom2_id": "///L/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 10938, "atom2_serNum": 10967, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///L/448/OH", "atom2_id": "///L/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 10980, "atom2_serNum": 11371, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///L/454/N", "atom2_id": "///L/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 10983, "atom2_serNum": 11368, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///L/454/O", "atom2_id": "///L/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 10992, "atom2_serNum": 11356, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///L/456/N", "atom2_id": "///L/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 10995, "atom2_serNum": 11353, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///L/456/O", "atom2_id": "///L/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 11000, "atom2_serNum": 11722, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///L/457/N", "atom2_id": "///L/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 11003, "atom2_serNum": 11704, "donAcc_type": "questionable", "distance": 3.310, "atom1_id": "///L/457/O", "atom2_id": "///L/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 11003, "atom2_serNum": 11719, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///L/457/O", "atom2_id": "///L/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 11008, "atom2_serNum": 11351, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///L/457/NE2", "atom2_id": "///L/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 11009, "atom2_serNum": 11339, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///L/458/N", "atom2_id": "///L/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 11012, "atom2_serNum": 11336, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///L/458/O", "atom2_id": "///L/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 11017, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///L/459/N", "atom2_id": "///L/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 11020, "atom2_serNum": 11701, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///L/459/O", "atom2_id": "///L/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 11031, "atom2_serNum": 11112, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///L/460/O", "atom2_id": "///L/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 11036, "atom2_serNum": 11685, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///L/461/N", "atom2_id": "///L/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 11039, "atom2_serNum": 11682, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///L/461/O", "atom2_id": "///L/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 11040, "atom2_serNum": 11099, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///L/462/N", "atom2_id": "///L/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 11043, "atom2_serNum": 11689, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///L/462/O", "atom2_id": "///L/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 11045, "atom2_serNum": 11096, "donAcc_type": "acceptable", "distance": 3.597, "atom1_id": "///L/462/OG1", "atom2_id": "///L/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 11058, "atom2_serNum": 11671, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///L/464/OD1", "atom2_id": "///L/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 11115, "atom2_serNum": 11141, "donAcc_type": "questionable", "distance": 3.190, "atom1_id": "///L/471/O", "atom2_id": "///L/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 11118, "atom2_serNum": 11127, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///L/471/ND1", "atom2_id": "///L/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 11121, "atom2_serNum": 11667, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///L/471/NE2", "atom2_id": "///L/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 11130, "atom2_serNum": 11504, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///L/473/O", "atom2_id": "///L/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 11141, "atom2_serNum": 11158, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///L/474/O", "atom2_id": "///L/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 11150, "atom2_serNum": 11490, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///L/475/N", "atom2_id": "///L/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 11153, "atom2_serNum": 11487, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///L/475/O", "atom2_id": "///L/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 11157, "atom2_serNum": 11320, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///L/475/OE1", "atom2_id": "///L/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 11162, "atom2_serNum": 11328, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///L/476/O", "atom2_id": "///L/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 11169, "atom2_serNum": 11187, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///L/477/O", "atom2_id": "///L/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 11169, "atom2_serNum": 11467, "donAcc_type": "questionable", "distance": 3.216, "atom1_id": "///L/477/O", "atom2_id": "///L/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 11169, "atom2_serNum": 11475, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///L/477/O", "atom2_id": "///L/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 11187, "atom2_serNum": 11467, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///L/479/N", "atom2_id": "///L/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 11198, "atom2_serNum": 11206, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///L/480/O", "atom2_id": "///L/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 11205, "atom2_serNum": 11229, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///L/481/O", "atom2_id": "///L/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 11234, "atom2_serNum": 11246, "donAcc_type": "acceptable", "distance": 3.591, "atom1_id": "///L/485/OG1", "atom2_id": "///L/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 11236, "atom2_serNum": 11462, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///L/486/N", "atom2_id": "///L/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 11241, "atom2_serNum": 11463, "donAcc_type": "acceptable", "distance": 3.405, "atom1_id": "///L/486/OG1", "atom2_id": "///L/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 11248, "atom2_serNum": 11444, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///L/487/OG1", "atom2_id": "///L/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 11271, "atom2_serNum": 11344, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///L/490/O", "atom2_id": "///L/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 11285, "atom2_serNum": 11328, "donAcc_type": "questionable", "distance": 3.313, "atom1_id": "///L/491/NZ", "atom2_id": "///L/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 11286, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///L/492/N", "atom2_id": "///L/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 11316, "atom2_serNum": 11318, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///L/496/O", "atom2_id": "///L/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 11379, "atom2_serNum": 11401, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///L/504/O", "atom2_id": "///L/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 11379, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///L/504/O", "atom2_id": "///L/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 11388, "atom2_serNum": 11409, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///L/505/O", "atom2_id": "///L/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 11503, "atom2_serNum": 11507, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///L/520/NZ", "atom2_id": "///L/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 11507, "atom2_serNum": 11523, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///L/521/O", "atom2_id": "///L/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 11515, "atom2_serNum": 11536, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///L/522/O", "atom2_id": "///L/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 11515, "atom2_serNum": 11544, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///L/522/O", "atom2_id": "///L/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 11519, "atom2_serNum": 11543, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///L/522/NE", "atom2_id": "///L/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 11526, "atom2_serNum": 11544, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///L/523/O", "atom2_id": "///L/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 11526, "atom2_serNum": 11552, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///L/523/O", "atom2_id": "///L/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 11534, "atom2_serNum": 11561, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///L/524/O", "atom2_id": "///L/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 11547, "atom2_serNum": 11569, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///L/526/O", "atom2_id": "///L/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 11572, "atom2_serNum": 11593, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///L/529/O", "atom2_id": "///L/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 11600, "atom2_serNum": 11609, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///L/532/OE1", "atom2_id": "///L/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 11615, "atom2_serNum": 11617, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///L/534/OD1", "atom2_id": "///L/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 11620, "atom2_serNum": 11656, "donAcc_type": "standard", "distance": 3.626, "atom1_id": "///L/535/O", "atom2_id": "///L/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 11628, "atom2_serNum": 11649, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///L/536/O", "atom2_id": "///L/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 11660, "atom2_serNum": 11886, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///L/540/O", "atom2_id": "///L/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 11662, "atom2_serNum": 11885, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///L/540/OG1", "atom2_id": "///L/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 11675, "atom2_serNum": 11872, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///L/542/N", "atom2_id": "///L/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 11678, "atom2_serNum": 11869, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///L/542/O", "atom2_id": "///L/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 11693, "atom2_serNum": 11853, "donAcc_type": "acceptable", "distance": 2.512, "atom1_id": "///L/544/N", "atom2_id": "///L/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 11696, "atom2_serNum": 11848, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///L/544/O", "atom2_id": "///L/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 11708, "atom2_serNum": 11839, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///L/546/N", "atom2_id": "///L/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 11711, "atom2_serNum": 11836, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///L/546/O", "atom2_id": "///L/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 11726, "atom2_serNum": 11834, "donAcc_type": "standard", "distance": 2.413, "atom1_id": "///L/547/NE", "atom2_id": "///L/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 11729, "atom2_serNum": 11834, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///L/547/NH2", "atom2_id": "///L/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 11730, "atom2_serNum": 11822, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///L/548/N", "atom2_id": "///L/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 11733, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///L/548/O", "atom2_id": "///L/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 11743, "atom2_serNum": 11818, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///L/549/ND1", "atom2_id": "///L/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 11747, "atom2_serNum": 11809, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///L/550/N", "atom2_id": "///L/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 11750, "atom2_serNum": 11806, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///L/550/O", "atom2_id": "///L/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 11762, "atom2_serNum": 11790, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///L/552/N", "atom2_id": "///L/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 11765, "atom2_serNum": 11783, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///L/552/O", "atom2_id": "///L/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 11769, "atom2_serNum": 11796, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///L/552/OE1", "atom2_id": "///L/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 11853, "atom2_serNum": 11857, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///L/564/OG", "atom2_id": "///L/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 11885, "atom2_serNum": 11897, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///L/568/OE2", "atom2_id": "///L/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 11927, "atom2_serNum": 14882, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///L/578/O", "atom2_id": "///M/669/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 11931, "atom2_serNum": 12101, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///L/579/N", "atom2_id": "///L/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 11934, "atom2_serNum": 12098, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///L/579/O", "atom2_id": "///L/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 11946, "atom2_serNum": 12090, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///L/581/N", "atom2_id": "///L/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 11949, "atom2_serNum": 14777, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///L/581/O", "atom2_id": "///M/657/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 11949, "atom2_serNum": 14905, "donAcc_type": "acceptable", "distance": 3.752, "atom1_id": "///L/581/O", "atom2_id": "///M/672/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 11954, "atom2_serNum": 14421, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///L/581/OE2", "atom2_id": "///M/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 11955, "atom2_serNum": 12090, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///L/582/N", "atom2_id": "///L/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 11958, "atom2_serNum": 12087, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///L/582/O", "atom2_id": "///L/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 11965, "atom2_serNum": 14416, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///L/582/NH2", "atom2_id": "///M/614/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 11965, "atom2_serNum": 14757, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///L/582/NH2", "atom2_id": "///M/655/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 11974, "atom2_serNum": 11986, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///L/583/NE2", "atom2_id": "///L/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 11974, "atom2_serNum": 12693, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///L/583/NE2", "atom2_id": "///L/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 11975, "atom2_serNum": 12074, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///L/584/N", "atom2_id": "///L/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 11982, "atom2_serNum": 12057, "donAcc_type": "questionable", "distance": 3.318, "atom1_id": "///L/584/OD2", "atom2_id": "///L/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 11993, "atom2_serNum": 12711, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///L/586/O", "atom2_id": "///L/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 12001, "atom2_serNum": 12053, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///L/587/O", "atom2_id": "///L/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 12007, "atom2_serNum": 12730, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///L/588/O", "atom2_id": "///L/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 12013, "atom2_serNum": 12025, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///L/589/O", "atom2_id": "///L/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 12013, "atom2_serNum": 12037, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///L/589/O", "atom2_id": "///L/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 12018, "atom2_serNum": 12733, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///L/590/N", "atom2_id": "///L/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 12021, "atom2_serNum": 12455, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///L/590/O", "atom2_id": "///L/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 12041, "atom2_serNum": 12434, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///L/593/N", "atom2_id": "///L/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 12048, "atom2_serNum": 12431, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///L/594/O", "atom2_id": "///L/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 12063, "atom2_serNum": 12418, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///L/596/N", "atom2_id": "///L/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 12066, "atom2_serNum": 12415, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///L/596/O", "atom2_id": "///L/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 12079, "atom2_serNum": 12399, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///L/598/N", "atom2_id": "///L/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 12082, "atom2_serNum": 12396, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///L/598/O", "atom2_id": "///L/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 12092, "atom2_serNum": 14432, "donAcc_type": "acceptable", "distance": 2.573, "atom1_id": "///L/599/OG1", "atom2_id": "///M/616/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 12094, "atom2_serNum": 12383, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///L/600/N", "atom2_id": "///L/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 12101, "atom2_serNum": 12115, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///L/601/O", "atom2_id": "///L/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 12105, "atom2_serNum": 14867, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///L/601/OE1", "atom2_id": "///M/667/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 12106, "atom2_serNum": 12113, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///L/601/NE2", "atom2_id": "///L/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 12107, "atom2_serNum": 12113, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///L/602/N", "atom2_id": "///L/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 12107, "atom2_serNum": 12376, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///L/602/N", "atom2_id": "///L/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 12110, "atom2_serNum": 12126, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///L/602/O", "atom2_id": "///L/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 12126, "atom2_serNum": 12153, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///L/604/N", "atom2_id": "///L/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 12129, "atom2_serNum": 12148, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///L/604/O", "atom2_id": "///L/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 12129, "atom2_serNum": 12153, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///L/604/O", "atom2_id": "///L/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 12153, "atom2_serNum": 12613, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///L/607/OG", "atom2_id": "///L/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 12154, "atom2_serNum": 12602, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///L/608/N", "atom2_id": "///L/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 12157, "atom2_serNum": 12599, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///L/608/O", "atom2_id": "///L/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 12166, "atom2_serNum": 12305, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///L/609/O", "atom2_id": "///L/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 12170, "atom2_serNum": 12583, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///L/610/N", "atom2_id": "///L/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 12173, "atom2_serNum": 12580, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///L/610/O", "atom2_id": "///L/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 12177, "atom2_serNum": 12291, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///L/611/N", "atom2_id": "///L/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 12180, "atom2_serNum": 12288, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///L/611/O", "atom2_id": "///L/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 12188, "atom2_serNum": 12564, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///L/612/N", "atom2_id": "///L/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 12191, "atom2_serNum": 12561, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///L/612/O", "atom2_id": "///L/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 12193, "atom2_serNum": 12212, "donAcc_type": "acceptable", "distance": 3.638, "atom1_id": "///L/612/OG1", "atom2_id": "///L/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 12195, "atom2_serNum": 12268, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///L/613/N", "atom2_id": "///L/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 12198, "atom2_serNum": 12257, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///L/613/O", "atom2_id": "///L/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 12198, "atom2_serNum": 12265, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///L/613/O", "atom2_id": "///L/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 12202, "atom2_serNum": 12466, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///L/613/OE1", "atom2_id": "///L/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 12213, "atom2_serNum": 12242, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///L/615/N", "atom2_id": "///L/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 12216, "atom2_serNum": 12235, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///L/615/O", "atom2_id": "///L/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 12218, "atom2_serNum": 12239, "donAcc_type": "acceptable", "distance": 3.456, "atom1_id": "///L/615/OG1", "atom2_id": "///L/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 12238, "atom2_serNum": 12248, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///L/618/O", "atom2_id": "///L/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 12242, "atom2_serNum": 12257, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///L/619/O", "atom2_id": "///L/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 12255, "atom2_serNum": 12286, "donAcc_type": "questionable", "distance": 2.740, "atom1_id": "///L/620/OE1", "atom2_id": "///L/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 12313, "atom2_serNum": 12315, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///L/627/O", "atom2_id": "///L/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 12313, "atom2_serNum": 12422, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///L/627/O", "atom2_id": "///L/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 12315, "atom2_serNum": 12429, "donAcc_type": "acceptable", "distance": 3.649, "atom1_id": "///L/627/OG1", "atom2_id": "///L/641/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 12327, "atom2_serNum": 12344, "donAcc_type": "questionable", "distance": 2.771, "atom1_id": "///L/629/O", "atom2_id": "///L/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 12352, "atom2_serNum": 12364, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///L/632/O", "atom2_id": "///L/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 12361, "atom2_serNum": 12372, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///L/633/O", "atom2_id": "///L/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 12364, "atom2_serNum": 12391, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///L/634/N", "atom2_id": "///L/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 12442, "atom2_serNum": 12729, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///L/643/O", "atom2_id": "///L/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 12489, "atom2_serNum": 12505, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///L/648/O", "atom2_id": "///L/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 12495, "atom2_serNum": 12501, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///L/649/N", "atom2_id": "///L/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 12516, "atom2_serNum": 12529, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///L/651/O", "atom2_id": "///L/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 12538, "atom2_serNum": 12721, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///L/654/N", "atom2_id": "///L/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 12541, "atom2_serNum": 12718, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///L/654/O", "atom2_id": "///L/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 12554, "atom2_serNum": 12703, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///L/656/N", "atom2_id": "///L/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 12557, "atom2_serNum": 12700, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///L/656/O", "atom2_id": "///L/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 12569, "atom2_serNum": 12684, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///L/658/N", "atom2_id": "///L/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 12572, "atom2_serNum": 12681, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///L/658/O", "atom2_id": "///L/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 12592, "atom2_serNum": 12664, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///L/660/N", "atom2_id": "///L/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 12595, "atom2_serNum": 12659, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///L/660/O", "atom2_id": "///L/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 12607, "atom2_serNum": 12642, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///L/662/N", "atom2_id": "///L/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 12622, "atom2_serNum": 12639, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///L/664/O", "atom2_id": "///L/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 12665, "atom2_serNum": 14881, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///L/669/N", "atom2_id": "///M/669/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 12672, "atom2_serNum": 14898, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///L/669/OE1", "atom2_id": "///M/671/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 12688, "atom2_serNum": 14908, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///L/671/OE1", "atom2_id": "///M/672/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 12716, "atom2_serNum": 12739, "donAcc_type": "acceptable", "distance": 3.627, "atom1_id": "///L/674/OG1", "atom2_id": "///L/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 12759, "atom2_serNum": 13938, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///M/399/O", "atom2_id": "///M/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 12780, "atom2_serNum": 13938, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///M/401/O", "atom2_id": "///M/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 12788, "atom2_serNum": 12790, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///M/402/O", "atom2_id": "///M/402/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 12800, "atom2_serNum": 12811, "donAcc_type": "acceptable", "distance": 2.424, "atom1_id": "///M/404/O", "atom2_id": "///M/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 12800, "atom2_serNum": 14036, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///M/404/O", "atom2_id": "///M/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 12800, "atom2_serNum": 14039, "donAcc_type": "questionable", "distance": 2.690, "atom1_id": "///M/404/O", "atom2_id": "///M/561/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 12837, "atom2_serNum": 13122, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///M/409/O", "atom2_id": "///M/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 12851, "atom2_serNum": 13108, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///M/411/N", "atom2_id": "///M/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 12854, "atom2_serNum": 13105, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///M/411/O", "atom2_id": "///M/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 12870, "atom2_serNum": 13094, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///M/413/N", "atom2_id": "///M/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 12879, "atom2_serNum": 13094, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///M/414/N", "atom2_id": "///M/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 12882, "atom2_serNum": 13091, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///M/414/O", "atom2_id": "///M/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 12893, "atom2_serNum": 14063, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///M/415/OE1", "atom2_id": "///M/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 12902, "atom2_serNum": 13041, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///M/417/N", "atom2_id": "///M/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 12914, "atom2_serNum": 14086, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///M/418/O", "atom2_id": "///M/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 12928, "atom2_serNum": 14089, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///M/420/N", "atom2_id": "///M/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 12931, "atom2_serNum": 12949, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///M/420/O", "atom2_id": "///M/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 12937, "atom2_serNum": 13025, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///M/420/NE2", "atom2_id": "///M/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 12948, "atom2_serNum": 13000, "donAcc_type": "standard", "distance": 3.914, "atom1_id": "///M/421/NH2", "atom2_id": "///M/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 12954, "atom2_serNum": 13691, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///M/423/N", "atom2_id": "///M/518/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 12957, "atom2_serNum": 13704, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///M/423/O", "atom2_id": "///M/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 12964, "atom2_serNum": 12999, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///M/424/N", "atom2_id": "///M/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 12967, "atom2_serNum": 12992, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///M/424/O", "atom2_id": "///M/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 12999, "atom2_serNum": 13020, "donAcc_type": "standard", "distance": 2.431, "atom1_id": "///M/427/OE1", "atom2_id": "///M/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 13000, "atom2_serNum": 13020, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///M/427/OE2", "atom2_id": "///M/430/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 13010, "atom2_serNum": 13022, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///M/429/OG", "atom2_id": "///M/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 13029, "atom2_serNum": 13038, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///M/432/O", "atom2_id": "///M/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 13031, "atom2_serNum": 13682, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///M/433/N", "atom2_id": "///M/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 13034, "atom2_serNum": 13080, "donAcc_type": "acceptable", "distance": 3.442, "atom1_id": "///M/433/O", "atom2_id": "///M/440/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 13047, "atom2_serNum": 13073, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///M/435/N", "atom2_id": "///M/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 13050, "atom2_serNum": 13066, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///M/435/O", "atom2_id": "///M/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 13064, "atom2_serNum": 13070, "donAcc_type": "acceptable", "distance": 3.272, "atom1_id": "///M/437/OG1", "atom2_id": "///M/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 13087, "atom2_serNum": 13657, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///M/441/O", "atom2_id": "///M/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 13098, "atom2_serNum": 13648, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///M/443/N", "atom2_id": "///M/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 13101, "atom2_serNum": 13645, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///M/443/O", "atom2_id": "///M/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 13112, "atom2_serNum": 13621, "donAcc_type": "questionable", "distance": 3.255, "atom1_id": "///M/444/OE1", "atom2_id": "///M/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 13114, "atom2_serNum": 13629, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///M/445/N", "atom2_id": "///M/509/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 13125, "atom2_serNum": 13136, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///M/446/O", "atom2_id": "///M/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 13147, "atom2_serNum": 13176, "donAcc_type": "acceptable", "distance": 3.009, "atom1_id": "///M/448/OH", "atom2_id": "///M/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 13189, "atom2_serNum": 13580, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///M/454/N", "atom2_id": "///M/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 13192, "atom2_serNum": 13577, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///M/454/O", "atom2_id": "///M/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 13201, "atom2_serNum": 13565, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///M/456/N", "atom2_id": "///M/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 13204, "atom2_serNum": 13562, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///M/456/O", "atom2_id": "///M/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 13209, "atom2_serNum": 13931, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///M/457/N", "atom2_id": "///M/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 13212, "atom2_serNum": 13913, "donAcc_type": "questionable", "distance": 3.329, "atom1_id": "///M/457/O", "atom2_id": "///M/545/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 13212, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///M/457/O", "atom2_id": "///M/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 13217, "atom2_serNum": 13560, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///M/457/NE2", "atom2_id": "///M/500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 13218, "atom2_serNum": 13548, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///M/458/N", "atom2_id": "///M/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 13221, "atom2_serNum": 13545, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///M/458/O", "atom2_id": "///M/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 13226, "atom2_serNum": 13913, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///M/459/N", "atom2_id": "///M/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 13229, "atom2_serNum": 13910, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///M/459/O", "atom2_id": "///M/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 13240, "atom2_serNum": 13321, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///M/460/O", "atom2_id": "///M/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 13245, "atom2_serNum": 13894, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///M/461/N", "atom2_id": "///M/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 13248, "atom2_serNum": 13891, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///M/461/O", "atom2_id": "///M/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 13249, "atom2_serNum": 13308, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///M/462/N", "atom2_id": "///M/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 13252, "atom2_serNum": 13898, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///M/462/O", "atom2_id": "///M/543/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 13254, "atom2_serNum": 13305, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///M/462/OG1", "atom2_id": "///M/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 13267, "atom2_serNum": 13880, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///M/464/OD1", "atom2_id": "///M/541/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 13324, "atom2_serNum": 13350, "donAcc_type": "questionable", "distance": 3.177, "atom1_id": "///M/471/O", "atom2_id": "///M/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 13327, "atom2_serNum": 13336, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///M/471/ND1", "atom2_id": "///M/473/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 13330, "atom2_serNum": 13876, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///M/471/NE2", "atom2_id": "///M/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 13339, "atom2_serNum": 13713, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///M/473/O", "atom2_id": "///M/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 13350, "atom2_serNum": 13367, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///M/474/O", "atom2_id": "///M/475/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 13359, "atom2_serNum": 13699, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///M/475/N", "atom2_id": "///M/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 13362, "atom2_serNum": 13696, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///M/475/O", "atom2_id": "///M/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 13366, "atom2_serNum": 13529, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///M/475/OE1", "atom2_id": "///M/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 13371, "atom2_serNum": 13537, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///M/476/O", "atom2_id": "///M/497/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 13378, "atom2_serNum": 13396, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///M/477/O", "atom2_id": "///M/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 13378, "atom2_serNum": 13676, "donAcc_type": "questionable", "distance": 3.191, "atom1_id": "///M/477/O", "atom2_id": "///M/515/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 13378, "atom2_serNum": 13684, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///M/477/O", "atom2_id": "///M/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 13396, "atom2_serNum": 13676, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///M/479/N", "atom2_id": "///M/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 13407, "atom2_serNum": 13415, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///M/480/O", "atom2_id": "///M/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 13414, "atom2_serNum": 13438, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///M/481/O", "atom2_id": "///M/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 13443, "atom2_serNum": 13455, "donAcc_type": "acceptable", "distance": 3.653, "atom1_id": "///M/485/OG1", "atom2_id": "///M/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 13445, "atom2_serNum": 13671, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///M/486/N", "atom2_id": "///M/514/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 13450, "atom2_serNum": 13672, "donAcc_type": "acceptable", "distance": 3.395, "atom1_id": "///M/486/OG1", "atom2_id": "///M/514/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 13457, "atom2_serNum": 13653, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///M/487/OG1", "atom2_id": "///M/512/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 13480, "atom2_serNum": 13553, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///M/490/O", "atom2_id": "///M/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 13494, "atom2_serNum": 13537, "donAcc_type": "questionable", "distance": 3.325, "atom1_id": "///M/491/NZ", "atom2_id": "///M/497/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 13495, "atom2_serNum": 13541, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///M/492/N", "atom2_id": "///M/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 13525, "atom2_serNum": 13527, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///M/496/O", "atom2_id": "///M/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 13588, "atom2_serNum": 13610, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///M/504/O", "atom2_id": "///M/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 13588, "atom2_serNum": 13626, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///M/504/O", "atom2_id": "///M/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 13597, "atom2_serNum": 13618, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///M/505/O", "atom2_id": "///M/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 13712, "atom2_serNum": 13716, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///M/520/NZ", "atom2_id": "///M/521/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 13716, "atom2_serNum": 13732, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///M/521/O", "atom2_id": "///M/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 13724, "atom2_serNum": 13745, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///M/522/O", "atom2_id": "///M/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 13724, "atom2_serNum": 13753, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///M/522/O", "atom2_id": "///M/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 13728, "atom2_serNum": 13752, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///M/522/NE", "atom2_id": "///M/525/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 13735, "atom2_serNum": 13753, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///M/523/O", "atom2_id": "///M/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 13735, "atom2_serNum": 13761, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///M/523/O", "atom2_id": "///M/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 13743, "atom2_serNum": 13770, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///M/524/O", "atom2_id": "///M/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 13756, "atom2_serNum": 13778, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///M/526/O", "atom2_id": "///M/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 13781, "atom2_serNum": 13802, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///M/529/O", "atom2_id": "///M/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 13809, "atom2_serNum": 13818, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///M/532/OE1", "atom2_id": "///M/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 13824, "atom2_serNum": 13826, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///M/534/OD1", "atom2_id": "///M/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 13829, "atom2_serNum": 13865, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///M/535/O", "atom2_id": "///M/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 13837, "atom2_serNum": 13858, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///M/536/O", "atom2_id": "///M/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 13841, "atom2_serNum": 13858, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///M/537/O", "atom2_id": "///M/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 13869, "atom2_serNum": 14095, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///M/540/O", "atom2_id": "///M/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 13871, "atom2_serNum": 14094, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///M/540/OG1", "atom2_id": "///M/568/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 13884, "atom2_serNum": 14081, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///M/542/N", "atom2_id": "///M/567/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 13887, "atom2_serNum": 14078, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///M/542/O", "atom2_id": "///M/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 13902, "atom2_serNum": 14062, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///M/544/N", "atom2_id": "///M/564/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 13905, "atom2_serNum": 14057, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///M/544/O", "atom2_id": "///M/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 13917, "atom2_serNum": 14048, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///M/546/N", "atom2_id": "///M/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 13920, "atom2_serNum": 14045, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///M/546/O", "atom2_id": "///M/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 13935, "atom2_serNum": 14043, "donAcc_type": "standard", "distance": 2.378, "atom1_id": "///M/547/NE", "atom2_id": "///M/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 13938, "atom2_serNum": 14043, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///M/547/NH2", "atom2_id": "///M/561/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 13939, "atom2_serNum": 14031, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///M/548/N", "atom2_id": "///M/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 13942, "atom2_serNum": 14028, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///M/548/O", "atom2_id": "///M/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 13952, "atom2_serNum": 14027, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///M/549/ND1", "atom2_id": "///M/559/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 13956, "atom2_serNum": 14018, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///M/550/N", "atom2_id": "///M/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 13959, "atom2_serNum": 14015, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///M/550/O", "atom2_id": "///M/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 13971, "atom2_serNum": 13999, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///M/552/N", "atom2_id": "///M/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 13974, "atom2_serNum": 13992, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///M/552/O", "atom2_id": "///M/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 13978, "atom2_serNum": 14005, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///M/552/OE1", "atom2_id": "///M/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 14062, "atom2_serNum": 14066, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///M/564/OG", "atom2_id": "///M/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 14094, "atom2_serNum": 14106, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///M/568/OE2", "atom2_id": "///M/570/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 14140, "atom2_serNum": 14310, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///M/579/N", "atom2_id": "///M/601/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 14143, "atom2_serNum": 14307, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///M/579/O", "atom2_id": "///M/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 14155, "atom2_serNum": 14299, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///M/581/N", "atom2_id": "///M/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 14164, "atom2_serNum": 14299, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///M/582/N", "atom2_id": "///M/599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 14167, "atom2_serNum": 14296, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///M/582/O", "atom2_id": "///M/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 14183, "atom2_serNum": 14195, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///M/583/NE2", "atom2_id": "///M/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 14183, "atom2_serNum": 14902, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///M/583/NE2", "atom2_id": "///M/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 14184, "atom2_serNum": 14283, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///M/584/N", "atom2_id": "///M/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 14191, "atom2_serNum": 14266, "donAcc_type": "questionable", "distance": 3.307, "atom1_id": "///M/584/OD2", "atom2_id": "///M/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 14202, "atom2_serNum": 14920, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///M/586/O", "atom2_id": "///M/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 14210, "atom2_serNum": 14262, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///M/587/O", "atom2_id": "///M/594/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 14216, "atom2_serNum": 14939, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///M/588/O", "atom2_id": "///M/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 14222, "atom2_serNum": 14234, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///M/589/O", "atom2_id": "///M/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 14222, "atom2_serNum": 14246, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///M/589/O", "atom2_id": "///M/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 14227, "atom2_serNum": 14942, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///M/590/N", "atom2_id": "///M/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 14230, "atom2_serNum": 14664, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///M/590/O", "atom2_id": "///M/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 14250, "atom2_serNum": 14643, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///M/593/N", "atom2_id": "///M/642/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 14257, "atom2_serNum": 14640, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///M/594/O", "atom2_id": "///M/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 14272, "atom2_serNum": 14627, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///M/596/N", "atom2_id": "///M/640/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 14275, "atom2_serNum": 14624, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///M/596/O", "atom2_id": "///M/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 14288, "atom2_serNum": 14608, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///M/598/N", "atom2_id": "///M/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 14291, "atom2_serNum": 14605, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///M/598/O", "atom2_id": "///M/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 14303, "atom2_serNum": 14592, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///M/600/N", "atom2_id": "///M/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 14310, "atom2_serNum": 14324, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///M/601/O", "atom2_id": "///M/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 14315, "atom2_serNum": 14322, "donAcc_type": "standard", "distance": 3.831, "atom1_id": "///M/601/NE2", "atom2_id": "///M/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 14316, "atom2_serNum": 14322, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///M/602/N", "atom2_id": "///M/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 14316, "atom2_serNum": 14585, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///M/602/N", "atom2_id": "///M/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 14319, "atom2_serNum": 14335, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///M/602/O", "atom2_id": "///M/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 14335, "atom2_serNum": 14362, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///M/604/N", "atom2_id": "///M/607/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 14338, "atom2_serNum": 14357, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///M/604/O", "atom2_id": "///M/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 14362, "atom2_serNum": 14822, "donAcc_type": "acceptable", "distance": 2.517, "atom1_id": "///M/607/OG", "atom2_id": "///M/662/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 14363, "atom2_serNum": 14811, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///M/608/N", "atom2_id": "///M/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 14366, "atom2_serNum": 14808, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///M/608/O", "atom2_id": "///M/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 14375, "atom2_serNum": 14514, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///M/609/O", "atom2_id": "///M/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 14379, "atom2_serNum": 14792, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///M/610/N", "atom2_id": "///M/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 14382, "atom2_serNum": 14789, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///M/610/O", "atom2_id": "///M/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 14386, "atom2_serNum": 14500, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///M/611/N", "atom2_id": "///M/624/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 14389, "atom2_serNum": 14497, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///M/611/O", "atom2_id": "///M/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 14397, "atom2_serNum": 14773, "donAcc_type": "standard", "distance": 2.555, "atom1_id": "///M/612/N", "atom2_id": "///M/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 14400, "atom2_serNum": 14770, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///M/612/O", "atom2_id": "///M/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 14402, "atom2_serNum": 14421, "donAcc_type": "acceptable", "distance": 3.647, "atom1_id": "///M/612/OG1", "atom2_id": "///M/614/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 14404, "atom2_serNum": 14477, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///M/613/N", "atom2_id": "///M/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 14407, "atom2_serNum": 14466, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///M/613/O", "atom2_id": "///M/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 14407, "atom2_serNum": 14474, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///M/613/O", "atom2_id": "///M/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 14411, "atom2_serNum": 14675, "donAcc_type": "acceptable", "distance": 2.598, "atom1_id": "///M/613/OE1", "atom2_id": "///M/645/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 14422, "atom2_serNum": 14451, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///M/615/N", "atom2_id": "///M/619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 14425, "atom2_serNum": 14436, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///M/615/O", "atom2_id": "///M/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 14425, "atom2_serNum": 14444, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///M/615/O", "atom2_id": "///M/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 14427, "atom2_serNum": 14448, "donAcc_type": "acceptable", "distance": 3.437, "atom1_id": "///M/615/OG1", "atom2_id": "///M/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 14447, "atom2_serNum": 14457, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///M/618/O", "atom2_id": "///M/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 14451, "atom2_serNum": 14466, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///M/619/O", "atom2_id": "///M/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 14464, "atom2_serNum": 14495, "donAcc_type": "questionable", "distance": 2.729, "atom1_id": "///M/620/OE1", "atom2_id": "///M/623/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 14522, "atom2_serNum": 14524, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///M/627/O", "atom2_id": "///M/627/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 14522, "atom2_serNum": 14631, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///M/627/O", "atom2_id": "///M/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 14524, "atom2_serNum": 14638, "donAcc_type": "acceptable", "distance": 3.652, "atom1_id": "///M/627/OG1", "atom2_id": "///M/641/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 14536, "atom2_serNum": 14553, "donAcc_type": "questionable", "distance": 2.784, "atom1_id": "///M/629/O", "atom2_id": "///M/631/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 14561, "atom2_serNum": 14573, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///M/632/O", "atom2_id": "///M/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 14570, "atom2_serNum": 14581, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///M/633/O", "atom2_id": "///M/634/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 14573, "atom2_serNum": 14600, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///M/634/N", "atom2_id": "///M/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 14651, "atom2_serNum": 14938, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///M/643/O", "atom2_id": "///M/675/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 14698, "atom2_serNum": 14714, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///M/648/O", "atom2_id": "///M/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 14704, "atom2_serNum": 14710, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///M/649/N", "atom2_id": "///M/649/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 14725, "atom2_serNum": 14738, "donAcc_type": "acceptable", "distance": 2.739, "atom1_id": "///M/651/O", "atom2_id": "///M/652/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 14747, "atom2_serNum": 14930, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///M/654/N", "atom2_id": "///M/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 14750, "atom2_serNum": 14927, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///M/654/O", "atom2_id": "///M/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 14763, "atom2_serNum": 14912, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///M/656/N", "atom2_id": "///M/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 14766, "atom2_serNum": 14909, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///M/656/O", "atom2_id": "///M/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 14778, "atom2_serNum": 14893, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///M/658/N", "atom2_id": "///M/671/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 14781, "atom2_serNum": 14890, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///M/658/O", "atom2_id": "///M/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 14801, "atom2_serNum": 14873, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///M/660/N", "atom2_id": "///M/668/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 14804, "atom2_serNum": 14868, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///M/660/O", "atom2_id": "///M/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 14816, "atom2_serNum": 14851, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///M/662/N", "atom2_id": "///M/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 14831, "atom2_serNum": 14848, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///M/664/O", "atom2_id": "///M/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 14925, "atom2_serNum": 14948, "donAcc_type": "acceptable", "distance": 3.603, "atom1_id": "///M/674/OG1", "atom2_id": "///M/676/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1pzu", "num_aaChains": 6, "aaChains": "B=276,D=276,H=276,I=276,L=276,M=276", "num_naChains": 6, "naChains": "T=14,V=14,W=14,X=14,Y=14,Z=14", "num_atoms": 14952, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }