{ "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///E/1002", "nt2": "///F/1121", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -143.444, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.880, "chi2": -157.959, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 38.014, "C1C1_dist": 11.420, "N1N9_dist": 9.270, "C6C8_dist": 9.737, "CNNC_torsion": -17.500, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 24.000, "planarity": 0.291, "simple_Shear": 1.165, "simple_Stretch": -0.012, "simple_Buckle": 4.283, "simple_Propeller": -23.615, "bp_simpleParams": [ 1.165, -0.012, -0.071, 4.283, -23.615, -20.344 ], "bp_params": [ 1.156, -0.147, -0.071, 1.452, -23.956, -20.786 ], "frame": { "rmsd": null, "origin": [ 24.364, 17.948, 78.802 ], "x_axis": [ -0.044, -0.173, 0.984 ], "y_axis": [ 0.647, -0.755, -0.104 ], "z_axis": [ 0.761, 0.632, 0.146 ], "quaternion": [ -0.294, 0.626, 0.189, 0.697 ] } }, { "index": 2, "nt1": "///E/1003", "nt2": "///F/1120", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.930, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 54.281, "chi2": -60.888, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 49.390, "C1C1_dist": 10.265, "N1N9_dist": 8.430, "C6C8_dist": 9.278, "CNNC_torsion": -2.505, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.48],O4(carbonyl)-N6(amino)[2.34]", "interBase_angle": 20.434, "planarity": 0.278, "simple_Shear": -0.038, "simple_Stretch": -0.570, "simple_Buckle": -17.274, "simple_Propeller": -10.915, "bp_simpleParams": [ -0.038, -0.570, -0.259, -17.274, -10.915, -3.645 ], "bp_params": [ -0.037, -0.570, -0.259, -17.279, -10.907, -3.620 ], "frame": { "rmsd": null, "origin": [ 26.724, 20.749, 79.975 ], "x_axis": [ 0.304, -0.351, 0.885 ], "y_axis": [ 0.669, -0.583, -0.461 ], "z_axis": [ 0.678, 0.733, 0.058 ], "quaternion": [ -0.441, 0.676, 0.117, 0.578 ] } }, { "index": 3, "nt1": "///E/1004", "nt2": "///F/1119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.384, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.781, "chi2": -121.666, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 43.541, "C1C1_dist": 10.794, "N1N9_dist": 8.709, "C6C8_dist": 9.262, "CNNC_torsion": -20.735, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.03],N3-N1(imino)[2.57],N4(amino)-O6(carbonyl)[2.20]", "interBase_angle": 16.612, "planarity": 0.222, "simple_Shear": 0.384, "simple_Stretch": -0.671, "simple_Buckle": 2.371, "simple_Propeller": -16.442, "bp_simpleParams": [ 0.384, -0.671, 0.238, 2.371, -16.442, -15.168 ], "bp_params": [ 0.361, -0.684, 0.238, 1.804, -16.514, -15.323 ], "frame": { "rmsd": null, "origin": [ 28.148, 23.000, 81.272 ], "x_axis": [ 0.544, -0.714, 0.440 ], "y_axis": [ 0.360, -0.275, -0.891 ], "z_axis": [ 0.758, 0.644, 0.108 ], "quaternion": [ 0.587, -0.654, 0.135, -0.458 ] } }, { "index": 4, "nt1": "///E/1005", "nt2": "///F/1118", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 168.058, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.157, "chi2": -93.724, "conf2": "anti", "pucker2": "----", "lambda2": 47.059, "C1C1_dist": 10.503, "N1N9_dist": 8.591, "C6C8_dist": 9.237, "CNNC_torsion": -10.079, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.60],N4(amino)-O6(carbonyl)[2.28]", "interBase_angle": 17.299, "planarity": 0.230, "simple_Shear": 0.734, "simple_Stretch": -0.663, "simple_Buckle": -14.932, "simple_Propeller": -8.735, "bp_simpleParams": [ 0.734, -0.663, 0.534, -14.932, -8.735, -11.324 ], "bp_params": [ 0.683, -0.716, 0.534, -15.553, -7.575, -11.245 ], "frame": { "rmsd": null, "origin": [ 31.272, 25.034, 81.932 ], "x_axis": [ 0.537, -0.837, -0.102 ], "y_axis": [ -0.024, 0.106, -0.994 ], "z_axis": [ 0.843, 0.536, 0.037 ], "quaternion": [ 0.648, -0.590, 0.365, -0.314 ] } }, { "index": 5, "nt1": "///E/1006", "nt2": "///F/1117", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.550, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.507, "chi2": -111.128, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.903, "C1C1_dist": 10.995, "N1N9_dist": 8.976, "C6C8_dist": 9.585, "CNNC_torsion": -12.594, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.34]", "interBase_angle": 18.823, "planarity": 0.233, "simple_Shear": -0.661, "simple_Stretch": -0.182, "simple_Buckle": -17.246, "simple_Propeller": -7.541, "bp_simpleParams": [ -0.661, -0.182, 0.300, -17.246, -7.541, -14.449 ], "bp_params": [ -0.648, -0.224, 0.300, -16.744, -8.598, -14.337 ], "frame": { "rmsd": null, "origin": [ 33.745, 27.219, 83.621 ], "x_axis": [ 0.291, -0.811, -0.508 ], "y_axis": [ -0.248, 0.448, -0.859 ], "z_axis": [ 0.924, 0.376, -0.070 ], "quaternion": [ 0.646, -0.478, 0.554, -0.218 ] } }, { "index": 6, "nt1": "///E/1007", "nt2": "///F/1116", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.507, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.583, "chi2": -136.963, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 57.961, "C1C1_dist": 10.416, "N1N9_dist": 8.671, "C6C8_dist": 9.619, "CNNC_torsion": -11.643, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86],N1-N3(imino)[2.73]", "interBase_angle": 8.873, "planarity": 0.151, "simple_Shear": -0.565, "simple_Stretch": -0.353, "simple_Buckle": 0.080, "simple_Propeller": -8.872, "bp_simpleParams": [ -0.565, -0.353, 0.483, 0.080, -8.872, -0.331 ], "bp_params": [ -0.546, -0.382, 0.483, 0.543, -8.856, -0.332 ], "frame": { "rmsd": null, "origin": [ 36.594, 27.898, 82.611 ], "x_axis": [ 0.115, -0.564, -0.818 ], "y_axis": [ -0.415, 0.721, -0.555 ], "z_axis": [ 0.902, 0.403, -0.152 ], "quaternion": [ 0.649, -0.369, 0.663, -0.057 ] } }, { "index": 7, "nt1": "///E/1008", "nt2": "///F/1115", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.473, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.605, "chi2": -133.070, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.271, "C1C1_dist": 11.257, "N1N9_dist": 9.407, "C6C8_dist": 10.198, "CNNC_torsion": -8.179, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N4(amino)[2.55],N2(amino)-N3[2.50]", "unusual_base2base_hbonds": 1, "interBase_angle": 16.775, "planarity": 0.264, "simple_Shear": 2.457, "simple_Stretch": 0.558, "simple_Buckle": 16.309, "simple_Propeller": -3.927, "bp_simpleParams": [ 2.457, 0.558, -0.114, 16.309, -3.927, -3.026 ], "bp_params": [ 2.519, -0.072, -0.114, 14.827, -7.846, -3.008 ], "frame": { "rmsd": null, "origin": [ 39.493, 29.113, 82.904 ], "x_axis": [ -0.125, 0.339, -0.933 ], "y_axis": [ -0.308, 0.880, 0.361 ], "z_axis": [ 0.943, 0.333, -0.006 ], "quaternion": [ 0.661, 0.011, 0.709, 0.245 ] } }, { "index": 8, "nt1": "///E/1009", "nt2": "///F/1114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.988, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.053, "chi2": -143.232, "conf2": "anti", "pucker2": "----", "lambda2": 51.520, "C1C1_dist": 10.382, "N1N9_dist": 8.536, "C6C8_dist": 9.355, "CNNC_torsion": -12.401, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.47],N1-N3(imino)[2.49]", "interBase_angle": 24.820, "planarity": 0.306, "simple_Shear": 0.367, "simple_Stretch": -0.411, "simple_Buckle": 22.333, "simple_Propeller": -10.829, "bp_simpleParams": [ 0.367, -0.411, 0.225, 22.333, -10.829, -3.853 ], "bp_params": [ 0.353, -0.422, 0.225, 22.019, -11.456, -3.802 ], "frame": { "rmsd": null, "origin": [ 42.573, 29.763, 82.917 ], "x_axis": [ -0.363, 0.584, -0.726 ], "y_axis": [ -0.269, 0.681, 0.681 ], "z_axis": [ 0.892, 0.443, -0.090 ], "quaternion": [ 0.554, 0.108, 0.730, 0.385 ] } }, { "index": 9, "nt1": "///E/1010", "nt2": "///F/1113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -140.635, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.994, "chi2": -147.930, "conf2": "anti", "pucker2": "----", "lambda2": 50.288, "C1C1_dist": 10.730, "N1N9_dist": 8.819, "C6C8_dist": 9.479, "CNNC_torsion": -19.047, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.13],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.39]", "interBase_angle": 30.740, "planarity": 0.330, "simple_Shear": 0.265, "simple_Stretch": -0.358, "simple_Buckle": 21.180, "simple_Propeller": -22.279, "bp_simpleParams": [ 0.265, -0.358, -0.586, 21.180, -22.279, -8.986 ], "bp_params": [ 0.263, -0.359, -0.586, 21.063, -22.390, -9.012 ], "frame": { "rmsd": null, "origin": [ 45.531, 30.742, 82.040 ], "x_axis": [ -0.313, 0.924, -0.219 ], "y_axis": [ -0.006, 0.229, 0.973 ], "z_axis": [ 0.950, 0.306, -0.066 ], "quaternion": [ 0.461, 0.362, 0.634, 0.505 ] } }, { "index": 10, "nt1": "///E/1011", "nt2": "///F/1112", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.062, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.781, "chi2": -126.619, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.945, "C1C1_dist": 10.713, "N1N9_dist": 9.108, "C6C8_dist": 10.179, "CNNC_torsion": -31.640, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.19],O4(carbonyl)-N6(amino)[3.60]", "interBase_angle": 24.704, "planarity": 0.338, "simple_Shear": 0.414, "simple_Stretch": 0.210, "simple_Buckle": -1.308, "simple_Propeller": -24.669, "bp_simpleParams": [ 0.414, 0.210, 0.604, -1.308, -24.669, 3.564 ], "bp_params": [ 0.422, 0.193, 0.604, -2.272, -24.599, 3.647 ], "frame": { "rmsd": null, "origin": [ 49.090, 32.244, 81.501 ], "x_axis": [ -0.366, 0.821, 0.438 ], "y_axis": [ 0.195, -0.393, 0.899 ], "z_axis": [ 0.910, 0.415, -0.016 ], "quaternion": [ 0.237, 0.511, 0.497, 0.660 ] } }, { "index": 11, "nt1": "///E/1012", "nt2": "///F/1111", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.145, "conf1": "anti", "pucker1": "----", "lambda1": 56.975, "chi2": -85.164, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.054, "C1C1_dist": 10.096, "N1N9_dist": 8.381, "C6C8_dist": 9.372, "CNNC_torsion": -3.888, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.38],O4(carbonyl)-N6(amino)[2.55]", "interBase_angle": 9.731, "planarity": 0.121, "simple_Shear": 0.187, "simple_Stretch": -0.575, "simple_Buckle": -7.419, "simple_Propeller": -6.297, "bp_simpleParams": [ 0.187, -0.575, 0.001, -7.419, -6.297, 2.206 ], "bp_params": [ 0.178, -0.577, 0.001, -7.513, -6.184, 2.205 ], "frame": { "rmsd": null, "origin": [ 52.223, 34.202, 82.300 ], "x_axis": [ -0.107, 0.521, 0.847 ], "y_axis": [ 0.465, -0.726, 0.506 ], "z_axis": [ 0.879, 0.448, -0.165 ], "quaternion": [ 0.022, 0.668, 0.369, 0.646 ] } }, { "index": 12, "nt1": "///E/1013", "nt2": "///F/1110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.617, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.673, "chi2": -130.976, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.956, "C1C1_dist": 10.620, "N1N9_dist": 8.783, "C6C8_dist": 9.574, "CNNC_torsion": -1.725, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.52],N1(imino)-N3[2.69],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 6.282, "planarity": 0.097, "simple_Shear": -0.318, "simple_Stretch": -0.435, "simple_Buckle": 4.459, "simple_Propeller": -4.425, "bp_simpleParams": [ -0.318, -0.435, 0.436, 4.459, -4.425, -5.452 ], "bp_params": [ -0.306, -0.444, 0.436, 4.578, -4.302, -5.451 ], "frame": { "rmsd": null, "origin": [ 55.315, 34.659, 81.796 ], "x_axis": [ 0.111, -0.031, 0.993 ], "y_axis": [ 0.404, -0.912, -0.074 ], "z_axis": [ 0.908, 0.409, -0.089 ], "quaternion": [ -0.166, 0.727, 0.128, 0.654 ] } }, { "index": 13, "nt1": "///E/1014", "nt2": "///F/1109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.556, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.760, "chi2": -106.417, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.100, "C1C1_dist": 10.618, "N1N9_dist": 8.805, "C6C8_dist": 9.669, "CNNC_torsion": 6.305, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[2.76]", "interBase_angle": 6.867, "planarity": 0.077, "simple_Shear": 0.240, "simple_Stretch": -0.308, "simple_Buckle": 6.655, "simple_Propeller": -1.690, "bp_simpleParams": [ 0.240, -0.308, -0.234, 6.655, -1.690, -0.849 ], "bp_params": [ 0.234, -0.312, -0.234, 6.624, -1.810, -0.848 ], "frame": { "rmsd": null, "origin": [ 58.126, 36.357, 82.286 ], "x_axis": [ 0.293, -0.517, 0.804 ], "y_axis": [ 0.396, -0.700, -0.595 ], "z_axis": [ 0.870, 0.493, -0.000 ], "quaternion": [ -0.385, 0.706, -0.043, 0.593 ] } }, { "index": 14, "nt1": "///E/1015", "nt2": "///F/1108", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.783, "conf1": "anti", "pucker1": "----", "lambda1": 57.873, "chi2": -100.320, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.236, "C1C1_dist": 10.305, "N1N9_dist": 8.598, "C6C8_dist": 9.520, "CNNC_torsion": -7.722, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.46],N3-N1(imino)[2.54],N4(amino)-O6(carbonyl)[2.62]", "interBase_angle": 13.079, "planarity": 0.151, "simple_Shear": 0.391, "simple_Stretch": -0.497, "simple_Buckle": 7.129, "simple_Propeller": -10.965, "bp_simpleParams": [ 0.391, -0.497, -0.289, 7.129, -10.965, 1.064 ], "bp_params": [ 0.376, -0.508, -0.289, 6.790, -11.179, 1.068 ], "frame": { "rmsd": null, "origin": [ 60.485, 38.892, 81.678 ], "x_axis": [ 0.507, -0.801, 0.318 ], "y_axis": [ 0.129, -0.294, -0.947 ], "z_axis": [ 0.852, 0.522, -0.046 ], "quaternion": [ 0.540, -0.680, 0.247, -0.430 ] } }, { "index": 15, "nt1": "///E/1016", "nt2": "///F/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.859, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.174, "chi2": -90.718, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.401, "C1C1_dist": 10.612, "N1N9_dist": 8.748, "C6C8_dist": 9.526, "CNNC_torsion": -3.980, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.56],N4(amino)-O6(carbonyl)[2.40]", "interBase_angle": 5.424, "planarity": 0.074, "simple_Shear": -0.107, "simple_Stretch": -0.482, "simple_Buckle": 0.506, "simple_Propeller": -5.400, "bp_simpleParams": [ -0.107, -0.482, -0.104, 0.506, -5.400, -4.613 ], "bp_params": [ -0.099, -0.483, -0.104, 0.596, -5.391, -4.618 ], "frame": { "rmsd": null, "origin": [ 63.924, 40.207, 81.763 ], "x_axis": [ 0.425, -0.872, -0.245 ], "y_axis": [ -0.098, 0.225, -0.970 ], "z_axis": [ 0.900, 0.436, 0.010 ], "quaternion": [ 0.644, -0.545, 0.444, -0.300 ] } }, { "index": 16, "nt1": "///E/1017", "nt2": "///F/1106", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.821, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.316, "chi2": -117.492, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 55.737, "C1C1_dist": 10.140, "N1N9_dist": 8.519, "C6C8_dist": 9.570, "CNNC_torsion": -10.853, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.59]", "interBase_angle": 17.810, "planarity": 0.247, "simple_Shear": 0.618, "simple_Stretch": -0.361, "simple_Buckle": 3.967, "simple_Propeller": -17.362, "bp_simpleParams": [ 0.618, -0.361, -0.423, 3.967, -17.362, 5.790 ], "bp_params": [ 0.593, -0.401, -0.423, 2.788, -17.590, 5.857 ], "frame": { "rmsd": null, "origin": [ 66.852, 41.592, 80.951 ], "x_axis": [ 0.219, -0.554, -0.803 ], "y_axis": [ -0.291, 0.748, -0.596 ], "z_axis": [ 0.931, 0.364, 0.003 ], "quaternion": [ 0.702, -0.342, 0.618, -0.094 ] } }, { "index": 17, "nt1": "///E/1018", "nt2": "///F/1105", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.732, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.167, "chi2": -134.823, "conf2": "anti", "pucker2": "----", "lambda2": 51.162, "C1C1_dist": 10.788, "N1N9_dist": 8.872, "C6C8_dist": 9.684, "CNNC_torsion": -14.101, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.80]", "interBase_angle": 18.611, "planarity": 0.225, "simple_Shear": -0.032, "simple_Stretch": -0.221, "simple_Buckle": 10.074, "simple_Propeller": -15.649, "bp_simpleParams": [ -0.032, -0.221, 0.385, 10.074, -15.649, -5.269 ], "bp_params": [ -0.031, -0.221, 0.385, 10.124, -15.617, -5.297 ], "frame": { "rmsd": null, "origin": [ 69.642, 42.649, 81.382 ], "x_axis": [ -0.008, -0.070, -0.998 ], "y_axis": [ -0.455, 0.889, -0.059 ], "z_axis": [ 0.891, 0.453, -0.039 ], "quaternion": [ 0.679, -0.189, 0.696, 0.142 ] } }, { "index": 18, "nt1": "///E/1019", "nt2": "///F/1104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.018, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.603, "chi2": -111.759, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.051, "C1C1_dist": 10.305, "N1N9_dist": 8.910, "C6C8_dist": 10.231, "CNNC_torsion": -7.555, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.13],O4(carbonyl)-N6(amino)[3.91]", "interBase_angle": 9.208, "planarity": 0.122, "simple_Shear": 0.045, "simple_Stretch": 0.374, "simple_Buckle": 0.218, "simple_Propeller": -9.205, "bp_simpleParams": [ 0.045, 0.374, 0.198, 0.218, -9.205, 16.830 ], "bp_params": [ 0.044, 0.374, 0.198, 0.243, -9.205, 16.884 ], "frame": { "rmsd": null, "origin": [ 73.044, 43.853, 79.784 ], "x_axis": [ -0.222, 0.375, -0.900 ], "y_axis": [ -0.366, 0.823, 0.433 ], "z_axis": [ 0.903, 0.426, -0.046 ], "quaternion": [ 0.624, 0.003, 0.723, 0.297 ] } }, { "index": 19, "nt1": "///E/1020", "nt2": "///F/1103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.694, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.993, "chi2": -113.797, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.333, "C1C1_dist": 10.380, "N1N9_dist": 8.697, "C6C8_dist": 9.706, "CNNC_torsion": -3.586, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 4.992, "planarity": 0.059, "simple_Shear": 0.257, "simple_Stretch": -0.241, "simple_Buckle": -3.136, "simple_Propeller": -3.884, "bp_simpleParams": [ 0.257, -0.241, 0.128, -3.136, -3.884, 2.513 ], "bp_params": [ 0.252, -0.246, 0.128, -3.215, -3.819, 2.513 ], "frame": { "rmsd": null, "origin": [ 76.127, 44.991, 80.204 ], "x_axis": [ -0.357, 0.848, -0.391 ], "y_axis": [ -0.160, 0.357, 0.920 ], "z_axis": [ 0.920, 0.391, 0.008 ], "quaternion": [ 0.502, 0.264, 0.653, 0.502 ] } }, { "index": 20, "nt1": "///E/1021", "nt2": "///F/1102", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.461, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.132, "chi2": -106.761, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 50.217, "C1C1_dist": 10.724, "N1N9_dist": 8.822, "C6C8_dist": 9.565, "CNNC_torsion": -1.356, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.38],N1-N3(imino)[2.72]", "interBase_angle": 12.055, "planarity": 0.174, "simple_Shear": 0.174, "simple_Stretch": -0.367, "simple_Buckle": -4.447, "simple_Propeller": -11.205, "bp_simpleParams": [ 0.174, -0.367, -0.597, -4.447, -11.205, -8.693 ], "bp_params": [ 0.166, -0.371, -0.597, -4.690, -11.106, -8.727 ], "frame": { "rmsd": null, "origin": [ 79.502, 46.315, 80.478 ], "x_axis": [ -0.582, 0.784, 0.217 ], "y_axis": [ 0.233, -0.095, 0.968 ], "z_axis": [ 0.779, 0.614, -0.127 ], "quaternion": [ 0.221, 0.400, 0.635, 0.622 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "TTCCTAGACTTGCCCAATTA", "strand2": "AAGGATCTGAACGGGTTAAT", "bp_type": "||||||||||||||||||||", "helix_form": "..B.B...B.BB.BBB.BB", "helical_rise": 3.246, "helical_rise_std": 0.506, "helical_radius": 9.690, "helical_radius_std": 1.024, "helical_axis": [ 0.871, 0.490, -0.027 ], "point1": [ 24.626, 18.290, 82.345 ], "point2": [ 78.320, 48.510, 80.671 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///E/1002", "nt2": "///F/1121", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.156, -0.147, -0.071, 1.452, -23.956, -20.786 ], "step_params": [ 0.645, -0.620, 3.741, 5.708, -6.993, 22.259 ], "heli_params": [ 1.215, 0.659, 3.803, -17.230, -14.065, 23.998 ], "bp2_params": [ -0.037, -0.570, -0.259, -17.279, -10.907, -3.620 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.741, "simple_Twist": 28.895, "simple_hRise": 3.837, "simple_hTwist": 30.244 }, { "index": 2, "nt1": "///E/1003", "nt2": "///F/1120", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, -0.570, -0.259, -17.279, -10.907, -3.620 ], "step_params": [ 0.298, -1.217, 2.684, -2.725, 6.898, 35.638 ], "heli_params": [ -2.702, -0.774, 2.387, 11.121, 4.394, 36.377 ], "bp2_params": [ 0.361, -0.684, 0.238, 1.804, -16.514, -15.323 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.684, "simple_Twist": 33.088, "simple_hRise": 2.359, "simple_hTwist": 33.887 }, { "index": 3, "nt1": "///E/1004", "nt2": "///F/1119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.361, -0.684, 0.238, 1.804, -16.514, -15.323 ], "step_params": [ 0.282, -0.345, 3.760, -5.425, 7.036, 31.594 ], "heli_params": [ -1.981, -1.556, 3.509, 12.613, 9.725, 32.788 ], "bp2_params": [ 0.683, -0.716, 0.534, -15.553, -7.575, -11.245 ], "groove_widths": [ 14.840, null, 21.869, null ], "simple_Rise": 3.760, "simple_Twist": 29.208, "simple_hRise": 3.477, "simple_hTwist": 30.501 }, { "index": 4, "nt1": "///E/1005", "nt2": "///F/1118", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.683, -0.716, 0.534, -15.553, -7.575, -11.245 ], "step_params": [ -1.316, -1.400, 3.170, -2.577, 11.715, 24.875 ], "heli_params": [ -5.504, 2.195, 2.401, 25.396, 5.586, 27.575 ], "bp2_params": [ -0.648, -0.224, 0.300, -16.744, -8.598, -14.337 ], "groove_widths": [ 14.602, 14.417, 18.956, 17.956 ], "simple_Rise": 3.170, "simple_Twist": 32.443, "simple_hRise": 2.617, "simple_hTwist": 34.533 }, { "index": 5, "nt1": "///E/1006", "nt2": "///F/1117", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.648, -0.224, 0.300, -16.744, -8.598, -14.337 ], "step_params": [ 0.827, 0.160, 2.981, -4.735, 1.800, 25.029 ], "heli_params": [ -0.094, -3.075, 2.784, 4.100, 10.786, 25.528 ], "bp2_params": [ -0.546, -0.382, 0.483, 0.543, -8.856, -0.332 ], "groove_widths": [ 14.177, 13.998, 18.204, 18.204 ], "simple_Rise": 2.981, "simple_Twist": 24.214, "simple_hRise": 2.776, "simple_hTwist": 24.731 }, { "index": 6, "nt1": "///E/1007", "nt2": "///F/1116", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.546, -0.382, 0.483, 0.543, -8.856, -0.332 ], "step_params": [ -0.543, -0.008, 3.109, 5.555, -7.797, 55.692 ], "heli_params": [ 0.406, 0.869, 3.023, -8.278, -5.898, 56.444 ], "bp2_params": [ 2.519, -0.072, -0.114, 14.827, -7.846, -3.008 ], "groove_widths": [ 11.555, 11.397, 17.362, 17.000 ], "simple_Rise": 3.109, "simple_Twist": 39.880, "simple_hRise": 2.961, "simple_hTwist": 40.968 }, { "index": 7, "nt1": "///E/1008", "nt2": "///F/1115", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.519, -0.072, -0.114, 14.827, -7.846, -3.008 ], "step_params": [ -0.456, -0.423, 3.087, -3.337, 7.779, 21.684 ], "heli_params": [ -3.547, 0.058, 2.805, 19.736, 8.466, 23.259 ], "bp2_params": [ 0.353, -0.422, 0.225, 22.019, -11.456, -3.802 ], "groove_widths": [ 10.669, 10.661, 18.244, 18.007 ], "simple_Rise": 3.087, "simple_Twist": 33.225, "simple_hRise": 2.946, "simple_hTwist": 34.257 }, { "index": 8, "nt1": "///E/1009", "nt2": "///F/1114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.353, -0.422, 0.225, 22.019, -11.456, -3.802 ], "step_params": [ 0.134, -0.651, 3.168, 3.030, -8.083, 34.798 ], "heli_params": [ 0.095, 0.215, 3.234, -13.264, -4.972, 35.820 ], "bp2_params": [ 0.263, -0.359, -0.586, 21.063, -22.390, -9.012 ], "groove_widths": [ 10.598, 10.583, 16.197, 15.859 ], "simple_Rise": 3.168, "simple_Twist": 36.162, "simple_hRise": 3.234, "simple_hTwist": 37.144 }, { "index": 9, "nt1": "///E/1010", "nt2": "///F/1113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.263, -0.359, -0.586, 21.063, -22.390, -9.012 ], "step_params": [ 0.069, -0.391, 3.880, -2.048, 6.933, 38.429 ], "heli_params": [ -1.566, -0.394, 3.748, 10.421, 3.078, 39.078 ], "bp2_params": [ 0.422, 0.193, 0.604, -2.272, -24.599, 3.647 ], "groove_widths": [ 10.658, 10.632, 16.514, 16.017 ], "simple_Rise": 3.880, "simple_Twist": 36.156, "simple_hRise": 3.735, "simple_hTwist": 36.848 }, { "index": 10, "nt1": "///E/1011", "nt2": "///F/1112", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.422, 0.193, 0.604, -2.272, -24.599, 3.647 ], "step_params": [ 1.059, 0.560, 3.585, 7.979, -3.980, 32.899 ], "heli_params": [ 1.670, -0.379, 3.644, -6.872, -13.775, 34.053 ], "bp2_params": [ 0.178, -0.577, 0.001, -7.513, -6.184, 2.205 ], "groove_widths": [ 11.923, 11.912, 16.780, 16.747 ], "simple_Rise": 3.585, "simple_Twist": 34.807, "simple_hRise": 3.647, "simple_hTwist": 35.896 }, { "index": 11, "nt1": "///E/1012", "nt2": "///F/1111", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.577, 0.001, -7.513, -6.184, 2.205 ], "step_params": [ -0.331, 0.871, 3.025, -3.653, 3.670, 35.456 ], "heli_params": [ 0.919, 0.043, 3.114, 5.986, 5.959, 35.820 ], "bp2_params": [ -0.306, -0.444, 0.436, 4.578, -4.302, -5.451 ], "groove_widths": [ 12.277, 12.272, 17.470, 17.419 ], "simple_Rise": 3.025, "simple_Twist": 37.917, "simple_hRise": 3.110, "simple_hTwist": 38.256 }, { "index": 12, "nt1": "///E/1013", "nt2": "///F/1110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.444, 0.436, 4.578, -4.302, -5.451 ], "step_params": [ 0.511, -0.448, 3.250, 6.710, 2.917, 32.007 ], "heli_params": [ -1.297, 0.252, 3.236, 5.206, -11.974, 32.811 ], "bp2_params": [ 0.234, -0.312, -0.234, 6.624, -1.810, -0.848 ], "groove_widths": [ 12.041, 12.036, 19.500, 19.500 ], "simple_Rise": 3.250, "simple_Twist": 29.171, "simple_hRise": 3.226, "simple_hTwist": 30.055 }, { "index": 13, "nt1": "///E/1014", "nt2": "///F/1109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.312, -0.234, 6.624, -1.810, -0.848 ], "step_params": [ -1.110, -0.151, 3.332, -0.972, -3.113, 34.909 ], "heli_params": [ 0.228, 1.694, 3.362, -5.175, 1.616, 35.056 ], "bp2_params": [ 0.376, -0.508, -0.289, 6.790, -11.179, 1.068 ], "groove_widths": [ 12.240, 12.213, 17.557, 17.457 ], "simple_Rise": 3.332, "simple_Twist": 34.233, "simple_hRise": 3.362, "simple_hTwist": 34.384 }, { "index": 14, "nt1": "///E/1015", "nt2": "///F/1108", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.508, -0.289, 6.790, -11.179, 1.068 ], "step_params": [ 0.501, -0.130, 3.647, 2.985, 5.759, 32.834 ], "heli_params": [ -1.290, -0.318, 3.603, 10.066, -5.217, 33.451 ], "bp2_params": [ -0.099, -0.483, -0.104, 0.596, -5.391, -4.618 ], "groove_widths": [ 12.974, 12.939, 17.838, 17.800 ], "simple_Rise": 3.647, "simple_Twist": 35.221, "simple_hRise": 3.610, "simple_hTwist": 35.794 }, { "index": 15, "nt1": "///E/1016", "nt2": "///F/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.099, -0.483, -0.104, 0.596, -5.391, -4.618 ], "step_params": [ 0.383, 0.745, 3.232, 2.139, 3.968, 39.211 ], "heli_params": [ 0.635, -0.314, 3.304, 5.889, -3.175, 39.459 ], "bp2_params": [ 0.593, -0.401, -0.423, 2.788, -17.590, 5.857 ], "groove_widths": [ 12.535, 12.463, 17.159, 16.921 ], "simple_Rise": 3.232, "simple_Twist": 34.830, "simple_hRise": 3.311, "simple_hTwist": 35.112 }, { "index": 16, "nt1": "///E/1017", "nt2": "///F/1106", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.593, -0.401, -0.423, 2.788, -17.590, 5.857 ], "step_params": [ -0.395, -0.332, 2.970, -6.086, 0.308, 33.133 ], "heli_params": [ -0.620, -0.229, 2.990, 0.535, 10.562, 33.673 ], "bp2_params": [ -0.031, -0.221, 0.385, 10.124, -15.617, -5.297 ], "groove_widths": [ 11.414, 11.348, 17.949, 17.824 ], "simple_Rise": 2.970, "simple_Twist": 36.973, "simple_hRise": 2.993, "simple_hTwist": 37.454 }, { "index": 17, "nt1": "///E/1018", "nt2": "///F/1105", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.031, -0.221, 0.385, 10.124, -15.617, -5.297 ], "step_params": [ 1.337, -0.688, 3.649, 1.758, 0.063, 29.134 ], "heli_params": [ -1.381, -2.223, 3.720, 0.125, -3.491, 29.186 ], "bp2_params": [ 0.044, 0.374, 0.198, 0.243, -9.205, 16.884 ], "groove_widths": [ 10.267, null, 18.162, null ], "simple_Rise": 3.649, "simple_Twist": 29.131, "simple_hRise": 3.720, "simple_hTwist": 29.183 }, { "index": 18, "nt1": "///E/1019", "nt2": "///F/1104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, 0.374, 0.198, 0.243, -9.205, 16.884 ], "step_params": [ -0.493, 0.195, 3.271, -0.683, -3.751, 41.341 ], "heli_params": [ 0.674, 0.623, 3.249, -5.299, 0.965, 41.509 ], "bp2_params": [ 0.252, -0.246, 0.128, -3.215, -3.819, 2.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.271, "simple_Twist": 40.128, "simple_hRise": 3.248, "simple_hTwist": 40.301 }, { "index": 19, "nt1": "///E/1020", "nt2": "///F/1103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.252, -0.246, 0.128, -3.215, -3.819, 2.513 ], "step_params": [ -0.621, 0.432, 3.556, 6.310, 15.825, 34.720 ], "heli_params": [ -1.511, 1.804, 3.286, 24.760, -9.873, 38.559 ], "bp2_params": [ 0.166, -0.371, -0.597, -4.690, -11.106, -8.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.556, "simple_Twist": 34.330, "simple_hRise": 3.280, "simple_hTwist": 38.211 }, { "index": 20, "nt1": "///E/1021", "nt2": "///F/1102", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "TTCCTAGACTTGCCCAATTA", "strand2": "AAGGATCTGAACGGGTTAAT", "bp_type": "||||||||||||||||||||", "helix_form": "..B.B...B.BB.BBB.BB", "helical_rise": 3.246, "helical_rise_std": 0.506, "helical_radius": 9.690, "helical_radius_std": 1.024, "helical_axis": [ 0.871, 0.490, -0.027 ], "point1": [ 24.626, 18.290, 82.345 ], "point2": [ 78.320, 48.510, 80.671 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///E/1002", "nt2": "///F/1121", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.156, -0.147, -0.071, 1.452, -23.956, -20.786 ], "step_params": [ 0.645, -0.620, 3.741, 5.708, -6.993, 22.259 ], "heli_params": [ 1.215, 0.659, 3.803, -17.230, -14.065, 23.998 ], "bp2_params": [ -0.037, -0.570, -0.259, -17.279, -10.907, -3.620 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.741, "simple_Twist": 28.895, "simple_hRise": 3.837, "simple_hTwist": 30.244 }, { "index": 2, "nt1": "///E/1003", "nt2": "///F/1120", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, -0.570, -0.259, -17.279, -10.907, -3.620 ], "step_params": [ 0.298, -1.217, 2.684, -2.725, 6.898, 35.638 ], "heli_params": [ -2.702, -0.774, 2.387, 11.121, 4.394, 36.377 ], "bp2_params": [ 0.361, -0.684, 0.238, 1.804, -16.514, -15.323 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.684, "simple_Twist": 33.088, "simple_hRise": 2.359, "simple_hTwist": 33.887 }, { "index": 3, "nt1": "///E/1004", "nt2": "///F/1119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.361, -0.684, 0.238, 1.804, -16.514, -15.323 ], "step_params": [ 0.282, -0.345, 3.760, -5.425, 7.036, 31.594 ], "heli_params": [ -1.981, -1.556, 3.509, 12.613, 9.725, 32.788 ], "bp2_params": [ 0.683, -0.716, 0.534, -15.553, -7.575, -11.245 ], "groove_widths": [ 14.840, null, 21.869, null ], "simple_Rise": 3.760, "simple_Twist": 29.208, "simple_hRise": 3.477, "simple_hTwist": 30.501 }, { "index": 4, "nt1": "///E/1005", "nt2": "///F/1118", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.683, -0.716, 0.534, -15.553, -7.575, -11.245 ], "step_params": [ -1.316, -1.400, 3.170, -2.577, 11.715, 24.875 ], "heli_params": [ -5.504, 2.195, 2.401, 25.396, 5.586, 27.575 ], "bp2_params": [ -0.648, -0.224, 0.300, -16.744, -8.598, -14.337 ], "groove_widths": [ 14.602, 14.417, 18.956, 17.956 ], "simple_Rise": 3.170, "simple_Twist": 32.443, "simple_hRise": 2.617, "simple_hTwist": 34.533 }, { "index": 5, "nt1": "///E/1006", "nt2": "///F/1117", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.648, -0.224, 0.300, -16.744, -8.598, -14.337 ], "step_params": [ 0.827, 0.160, 2.981, -4.735, 1.800, 25.029 ], "heli_params": [ -0.094, -3.075, 2.784, 4.100, 10.786, 25.528 ], "bp2_params": [ -0.546, -0.382, 0.483, 0.543, -8.856, -0.332 ], "groove_widths": [ 14.177, 13.998, 18.204, 18.204 ], "simple_Rise": 2.981, "simple_Twist": 24.214, "simple_hRise": 2.776, "simple_hTwist": 24.731 }, { "index": 6, "nt1": "///E/1007", "nt2": "///F/1116", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.546, -0.382, 0.483, 0.543, -8.856, -0.332 ], "step_params": [ -0.543, -0.008, 3.109, 5.555, -7.797, 55.692 ], "heli_params": [ 0.406, 0.869, 3.023, -8.278, -5.898, 56.444 ], "bp2_params": [ 2.519, -0.072, -0.114, 14.827, -7.846, -3.008 ], "groove_widths": [ 11.555, 11.397, 17.362, 17.000 ], "simple_Rise": 3.109, "simple_Twist": 39.880, "simple_hRise": 2.961, "simple_hTwist": 40.968 }, { "index": 7, "nt1": "///E/1008", "nt2": "///F/1115", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.519, -0.072, -0.114, 14.827, -7.846, -3.008 ], "step_params": [ -0.456, -0.423, 3.087, -3.337, 7.779, 21.684 ], "heli_params": [ -3.547, 0.058, 2.805, 19.736, 8.466, 23.259 ], "bp2_params": [ 0.353, -0.422, 0.225, 22.019, -11.456, -3.802 ], "groove_widths": [ 10.669, 10.661, 18.244, 18.007 ], "simple_Rise": 3.087, "simple_Twist": 33.225, "simple_hRise": 2.946, "simple_hTwist": 34.257 }, { "index": 8, "nt1": "///E/1009", "nt2": "///F/1114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.353, -0.422, 0.225, 22.019, -11.456, -3.802 ], "step_params": [ 0.134, -0.651, 3.168, 3.030, -8.083, 34.798 ], "heli_params": [ 0.095, 0.215, 3.234, -13.264, -4.972, 35.820 ], "bp2_params": [ 0.263, -0.359, -0.586, 21.063, -22.390, -9.012 ], "groove_widths": [ 10.598, 10.583, 16.197, 15.859 ], "simple_Rise": 3.168, "simple_Twist": 36.162, "simple_hRise": 3.234, "simple_hTwist": 37.144 }, { "index": 9, "nt1": "///E/1010", "nt2": "///F/1113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.263, -0.359, -0.586, 21.063, -22.390, -9.012 ], "step_params": [ 0.069, -0.391, 3.880, -2.048, 6.933, 38.429 ], "heli_params": [ -1.566, -0.394, 3.748, 10.421, 3.078, 39.078 ], "bp2_params": [ 0.422, 0.193, 0.604, -2.272, -24.599, 3.647 ], "groove_widths": [ 10.658, 10.632, 16.514, 16.017 ], "simple_Rise": 3.880, "simple_Twist": 36.156, "simple_hRise": 3.735, "simple_hTwist": 36.848 }, { "index": 10, "nt1": "///E/1011", "nt2": "///F/1112", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.422, 0.193, 0.604, -2.272, -24.599, 3.647 ], "step_params": [ 1.059, 0.560, 3.585, 7.979, -3.980, 32.899 ], "heli_params": [ 1.670, -0.379, 3.644, -6.872, -13.775, 34.053 ], "bp2_params": [ 0.178, -0.577, 0.001, -7.513, -6.184, 2.205 ], "groove_widths": [ 11.923, 11.912, 16.780, 16.747 ], "simple_Rise": 3.585, "simple_Twist": 34.807, "simple_hRise": 3.647, "simple_hTwist": 35.896 }, { "index": 11, "nt1": "///E/1012", "nt2": "///F/1111", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.577, 0.001, -7.513, -6.184, 2.205 ], "step_params": [ -0.331, 0.871, 3.025, -3.653, 3.670, 35.456 ], "heli_params": [ 0.919, 0.043, 3.114, 5.986, 5.959, 35.820 ], "bp2_params": [ -0.306, -0.444, 0.436, 4.578, -4.302, -5.451 ], "groove_widths": [ 12.277, 12.272, 17.470, 17.419 ], "simple_Rise": 3.025, "simple_Twist": 37.917, "simple_hRise": 3.110, "simple_hTwist": 38.256 }, { "index": 12, "nt1": "///E/1013", "nt2": "///F/1110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.444, 0.436, 4.578, -4.302, -5.451 ], "step_params": [ 0.511, -0.448, 3.250, 6.710, 2.917, 32.007 ], "heli_params": [ -1.297, 0.252, 3.236, 5.206, -11.974, 32.811 ], "bp2_params": [ 0.234, -0.312, -0.234, 6.624, -1.810, -0.848 ], "groove_widths": [ 12.041, 12.036, 19.500, 19.500 ], "simple_Rise": 3.250, "simple_Twist": 29.171, "simple_hRise": 3.226, "simple_hTwist": 30.055 }, { "index": 13, "nt1": "///E/1014", "nt2": "///F/1109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.312, -0.234, 6.624, -1.810, -0.848 ], "step_params": [ -1.110, -0.151, 3.332, -0.972, -3.113, 34.909 ], "heli_params": [ 0.228, 1.694, 3.362, -5.175, 1.616, 35.056 ], "bp2_params": [ 0.376, -0.508, -0.289, 6.790, -11.179, 1.068 ], "groove_widths": [ 12.240, 12.213, 17.557, 17.457 ], "simple_Rise": 3.332, "simple_Twist": 34.233, "simple_hRise": 3.362, "simple_hTwist": 34.384 }, { "index": 14, "nt1": "///E/1015", "nt2": "///F/1108", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.508, -0.289, 6.790, -11.179, 1.068 ], "step_params": [ 0.501, -0.130, 3.647, 2.985, 5.759, 32.834 ], "heli_params": [ -1.290, -0.318, 3.603, 10.066, -5.217, 33.451 ], "bp2_params": [ -0.099, -0.483, -0.104, 0.596, -5.391, -4.618 ], "groove_widths": [ 12.974, 12.939, 17.838, 17.800 ], "simple_Rise": 3.647, "simple_Twist": 35.221, "simple_hRise": 3.610, "simple_hTwist": 35.794 }, { "index": 15, "nt1": "///E/1016", "nt2": "///F/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.099, -0.483, -0.104, 0.596, -5.391, -4.618 ], "step_params": [ 0.383, 0.745, 3.232, 2.139, 3.968, 39.211 ], "heli_params": [ 0.635, -0.314, 3.304, 5.889, -3.175, 39.459 ], "bp2_params": [ 0.593, -0.401, -0.423, 2.788, -17.590, 5.857 ], "groove_widths": [ 12.535, 12.463, 17.159, 16.921 ], "simple_Rise": 3.232, "simple_Twist": 34.830, "simple_hRise": 3.311, "simple_hTwist": 35.112 }, { "index": 16, "nt1": "///E/1017", "nt2": "///F/1106", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.593, -0.401, -0.423, 2.788, -17.590, 5.857 ], "step_params": [ -0.395, -0.332, 2.970, -6.086, 0.308, 33.133 ], "heli_params": [ -0.620, -0.229, 2.990, 0.535, 10.562, 33.673 ], "bp2_params": [ -0.031, -0.221, 0.385, 10.124, -15.617, -5.297 ], "groove_widths": [ 11.414, 11.348, 17.949, 17.824 ], "simple_Rise": 2.970, "simple_Twist": 36.973, "simple_hRise": 2.993, "simple_hTwist": 37.454 }, { "index": 17, "nt1": "///E/1018", "nt2": "///F/1105", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.031, -0.221, 0.385, 10.124, -15.617, -5.297 ], "step_params": [ 1.337, -0.688, 3.649, 1.758, 0.063, 29.134 ], "heli_params": [ -1.381, -2.223, 3.720, 0.125, -3.491, 29.186 ], "bp2_params": [ 0.044, 0.374, 0.198, 0.243, -9.205, 16.884 ], "groove_widths": [ 10.267, null, 18.162, null ], "simple_Rise": 3.649, "simple_Twist": 29.131, "simple_hRise": 3.720, "simple_hTwist": 29.183 }, { "index": 18, "nt1": "///E/1019", "nt2": "///F/1104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, 0.374, 0.198, 0.243, -9.205, 16.884 ], "step_params": [ -0.493, 0.195, 3.271, -0.683, -3.751, 41.341 ], "heli_params": [ 0.674, 0.623, 3.249, -5.299, 0.965, 41.509 ], "bp2_params": [ 0.252, -0.246, 0.128, -3.215, -3.819, 2.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.271, "simple_Twist": 40.128, "simple_hRise": 3.248, "simple_hTwist": 40.301 }, { "index": 19, "nt1": "///E/1020", "nt2": "///F/1103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.252, -0.246, 0.128, -3.215, -3.819, 2.513 ], "step_params": [ -0.621, 0.432, 3.556, 6.310, 15.825, 34.720 ], "heli_params": [ -1.511, 1.804, 3.286, 24.760, -9.873, 38.559 ], "bp2_params": [ 0.166, -0.371, -0.597, -4.690, -11.106, -8.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.556, "simple_Twist": 34.330, "simple_hRise": 3.280, "simple_hTwist": 38.211 }, { "index": 20, "nt1": "///E/1021", "nt2": "///F/1102", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///E/1001,///E/1002" }, { "index": 2, "num_nts": 2, "nts_short": "AT", "nts_long": "///F/1101,///F/1102" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "T", "nts_long": "///E/1001" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///F/1101" } ], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "TTTCCTAGACTTGCCCAATTA&ATAATTGGGCAAGTCTAGGAA", "sstr": ".((((((((((((((((((((&.))))))))))))))))))))", "form": "...BAB.BBB.BBBBBB.BB-&.BB..BB.BB.....B...B-" }, "chain_E": { "num_nts": 21, "num_chars": 21, "bseq": "TTTCCTAGACTTGCCCAATTA", "sstr": ".((((((((((((((((((((", "form": "...BAB.BBB.BBBBBB.BB-" }, "chain_F": { "num_nts": 21, "num_chars": 21, "bseq": "ATAATTGGGCAAGTCTAGGAA", "sstr": ".))))))))))))))))))))", "form": ".BB..BB.BB.....B...B-" } }, "chains": { "chain_E": { "num_nts": 21, "bseq": "TTTCCTAGACTTGCCCAATTA", "sstr": ".((((((((((((((((((((", "form": "...BAB.BBB.BBBBBB.BB-", "helical_rise": 3.249, "helical_rise_std": 0.526, "helical_axis": [ 0.874, 0.484, -0.028 ], "point1": [ 21.671, 16.967, 82.453 ], "point2": [ 78.596, 48.489, 80.657 ], "num_chars": 61, "suite": "T!!T!!T!!C!!C!!T!!A!!G!!A!!C1bT!!T!!G!!C4aC!!C!!A!!A!!T!!T!!A" }, "chain_F": { "num_nts": 21, "bseq": "ATAATTGGGCAAGTCTAGGAA", "sstr": ".))))))))))))))))))))", "form": ".BB..BB.BB.....B...B-", "helical_rise": 3.243, "helical_rise_std": 0.491, "helical_axis": [ -0.860, -0.509, 0.017 ], "point1": [ 80.321, 50.281, 80.857 ], "point2": [ 24.491, 17.241, 81.936 ], "num_chars": 61, "suite": "A!!T!!A!!A!!T!!T!!G!!G!!G!!C!!A!!A!!G!!T!!C!!T!!A!!G!!G!!A!!A" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 1001, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1001", "linked_nts": [ null, "///E/1002" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -91.716, "delta": 91.389, "epsilon": 168.826, "zeta": -108.256, "epsilon_zeta": -82.918, "bb_type": "BI", "chi": -144.547, "glyco_bond": "anti", "C5prime_xyz": [ -2.982, 8.851, -0.836 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 3.333, "Dp": 3.313, "splay_angle": 14.080, "splay_distance": 2.372, "splay_ratio": 0.125, "d22": 4.329, "d64": 3.829, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -36.001, "v1": 15.078, "v2": 9.589, "v3": -30.128, "v4": 41.561, "amplitude": 41.026, "phase_angle": 76.484, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 22.713, 16.094, 79.537 ], "x_axis": [ -0.219, 0.523, 0.824 ], "y_axis": [ 0.333, -0.753, 0.567 ], "z_axis": [ 0.917, 0.399, -0.009 ], "quaternion": [ 0.068, 0.621, 0.345, 0.701 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 1002, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1002", "linked_nts": [ "///E/1001", "///E/1003" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -177.930, "beta": -124.250, "gamma": 152.038, "delta": 111.442, "epsilon": -139.316, "zeta": -118.478, "epsilon_zeta": -20.838, "bb_type": "--", "chi": -143.444, "glyco_bond": "anti", "C5prime_xyz": [ -2.888, 8.916, -0.656 ], "P_xyz": [ -0.651, 9.515, -1.877 ], "form": ".", "ssZp": 2.661, "Dp": 2.522, "splay_angle": 20.493, "splay_distance": 3.731, "splay_ratio": 0.182, "d22": 3.938, "d64": 4.231, "eta": -177.112, "theta": -147.372, "eta_prime": -162.309, "theta_prime": -159.886, "eta_base": -129.616, "theta_base": -121.863, "v0": -41.398, "v1": 35.004, "v2": -15.898, "v3": -7.741, "v4": 30.882, "amplitude": 40.615, "phase_angle": 113.043, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ 24.263, 17.881, 79.373 ], "x_axis": [ -0.007, 0.098, 0.995 ], "y_axis": [ 0.666, -0.742, 0.078 ], "z_axis": [ 0.746, 0.664, -0.060 ], "quaternion": [ -0.219, 0.670, 0.285, 0.650 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 1003, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1003", "linked_nts": [ "///E/1002", "///E/1004" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -31.193, "beta": 128.010, "gamma": 30.579, "delta": 71.577, "epsilon": 52.226, "zeta": 60.895, "epsilon_zeta": -8.669, "bb_type": "--", "chi": -145.930, "glyco_bond": "anti", "C5prime_xyz": [ -3.669, 8.773, -0.536 ], "P_xyz": [ -1.603, 10.504, -0.722 ], "form": ".", "ssZp": 2.741, "Dp": 2.397, "splay_angle": 15.984, "splay_distance": 3.251, "splay_ratio": 0.156, "d22": 3.970, "d64": 4.304, "eta": 179.485, "theta": -138.518, "eta_prime": -162.843, "theta_prime": -151.526, "eta_base": -117.865, "theta_base": -114.614, "v0": -33.420, "v1": 5.013, "v2": 23.376, "v3": -43.120, "v4": 48.325, "amplitude": 48.242, "phase_angle": 61.016, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 26.440, 20.827, 80.083 ], "x_axis": [ 0.354, -0.263, 0.898 ], "y_axis": [ 0.573, -0.697, -0.430 ], "z_axis": [ 0.739, 0.667, -0.096 ], "quaternion": [ -0.374, 0.733, 0.106, 0.558 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 1004, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1004", "linked_nts": [ "///E/1003", "///E/1005" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 71.758, "beta": -161.697, "gamma": -155.516, "delta": 77.644, "epsilon": -133.688, "zeta": -22.888, "epsilon_zeta": -110.800, "bb_type": "--", "chi": -164.384, "glyco_bond": "anti", "C5prime_xyz": [ -2.696, 9.043, -0.140 ], "P_xyz": [ -2.070, 10.818, -1.939 ], "form": "B", "ssZp": 3.167, "Dp": 3.512, "splay_angle": 22.569, "splay_distance": 3.965, "splay_ratio": 0.196, "d22": 3.270, "d64": 3.311, "eta": 176.576, "theta": -159.926, "eta_prime": -177.050, "theta_prime": -170.583, "eta_base": -133.075, "theta_base": -119.626, "v0": -29.742, "v1": 2.864, "v2": 22.803, "v3": -40.966, "v4": 44.944, "amplitude": 44.753, "phase_angle": 59.367, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.012, "origin": [ 28.213, 23.042, 81.669 ], "x_axis": [ 0.592, -0.573, 0.567 ], "y_axis": [ 0.455, -0.343, -0.822 ], "z_axis": [ 0.666, 0.744, 0.058 ], "quaternion": [ 0.571, -0.685, 0.043, -0.450 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 1005, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1005", "linked_nts": [ "///E/1004", "///E/1006" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -121.551, "beta": 73.392, "gamma": 151.477, "delta": 90.977, "epsilon": -129.918, "zeta": -142.487, "epsilon_zeta": 12.569, "bb_type": "--", "chi": 168.058, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 7.925, 2.338 ], "P_xyz": [ -0.999, 10.022, 0.760 ], "form": "A", "ssZp": 4.759, "Dp": 4.770, "splay_angle": 24.764, "splay_distance": 3.749, "splay_ratio": 0.214, "d22": 4.626, "d64": 4.599, "eta": 163.490, "theta": 149.100, "eta_prime": 165.369, "theta_prime": -179.926, "eta_base": -130.525, "theta_base": -157.658, "v0": 11.839, "v1": -28.939, "v2": 33.973, "v3": -27.636, "v4": 10.327, "amplitude": 33.985, "phase_angle": 358.458, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 31.689, 24.854, 82.263 ], "x_axis": [ 0.602, -0.799, -0.007 ], "y_axis": [ -0.077, -0.050, -0.996 ], "z_axis": [ 0.795, 0.600, -0.092 ], "quaternion": [ 0.604, -0.660, 0.332, -0.299 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 1006, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1006", "linked_nts": [ "///E/1005", "///E/1007" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 25.422, "beta": 98.999, "gamma": 9.933, "delta": 84.942, "epsilon": -128.121, "zeta": -57.588, "epsilon_zeta": -70.533, "bb_type": "--", "chi": -154.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.170, 8.932, 0.121 ], "P_xyz": [ -0.175, 8.553, 1.711 ], "form": "B", "ssZp": 3.417, "Dp": 3.948, "splay_angle": 18.592, "splay_distance": 3.236, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": -166.416, "theta": -108.786, "eta_prime": -158.358, "theta_prime": -121.181, "eta_base": -146.162, "theta_base": -86.950, "v0": -17.389, "v1": -5.831, "v2": 25.497, "v3": -36.064, "v4": 33.761, "amplitude": 36.734, "phase_angle": 46.043, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 33.817, 27.488, 83.872 ], "x_axis": [ 0.402, -0.820, -0.407 ], "y_axis": [ -0.330, 0.284, -0.900 ], "z_axis": [ 0.854, 0.497, -0.156 ], "quaternion": [ 0.619, -0.564, 0.510, -0.198 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 1007, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1007", "linked_nts": [ "///E/1006", "///E/1008" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -100.442, "beta": 96.387, "gamma": 148.076, "delta": 110.276, "epsilon": 175.641, "zeta": -67.523, "epsilon_zeta": -116.837, "bb_type": "BI", "chi": -173.507, "glyco_bond": "anti", "C5prime_xyz": [ -1.203, 8.477, 1.433 ], "P_xyz": [ 0.109, 9.980, -0.545 ], "form": ".", "ssZp": 3.180, "Dp": 3.272, "splay_angle": 19.977, "splay_distance": 3.083, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -147.601, "theta": 167.443, "eta_prime": -157.046, "theta_prime": -156.994, "eta_base": -102.667, "theta_base": -96.200, "v0": -0.584, "v1": -1.611, "v2": 3.043, "v3": -3.398, "v4": 2.529, "amplitude": 3.434, "phase_angle": 27.619, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 36.860, 28.012, 82.904 ], "x_axis": [ 0.185, -0.533, -0.825 ], "y_axis": [ -0.411, 0.721, -0.558 ], "z_axis": [ 0.893, 0.442, -0.085 ], "quaternion": [ 0.675, -0.371, 0.637, -0.046 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 1008, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/1008", "linked_nts": [ "///E/1007", "///E/1009" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -142.855, "beta": -125.897, "gamma": 98.596, "delta": 139.043, "epsilon": -167.031, "zeta": -116.844, "epsilon_zeta": -50.187, "bb_type": "BI", "chi": -105.473, "glyco_bond": "anti", "C5prime_xyz": [ -1.677, 8.230, -2.092 ], "P_xyz": [ 0.945, 8.124, -1.725 ], "form": "B", "ssZp": 1.871, "Dp": 2.032, "splay_angle": 20.321, "splay_distance": 3.508, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 153.844, "theta": -127.793, "eta_prime": -158.516, "theta_prime": -149.497, "eta_base": -93.355, "theta_base": -135.699, "v0": -18.025, "v1": 31.066, "v2": -31.513, "v3": 21.432, "v4": -2.330, "amplitude": 32.570, "phase_angle": 165.363, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 39.292, 29.488, 81.717 ], "x_axis": [ -0.054, 0.332, -0.942 ], "y_axis": [ -0.185, 0.923, 0.337 ], "z_axis": [ 0.981, 0.193, 0.011 ], "quaternion": [ 0.686, 0.053, 0.701, 0.189 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 1009, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1009", "linked_nts": [ "///E/1008", "///E/1010" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -59.462, "beta": 172.145, "gamma": 36.751, "delta": 147.501, "epsilon": -51.190, "zeta": 179.053, "epsilon_zeta": 129.757, "bb_type": "BII", "chi": -90.988, "glyco_bond": "anti", "C5prime_xyz": [ -2.865, 8.056, -2.152 ], "P_xyz": [ -0.501, 9.386, -2.148 ], "form": "B", "ssZp": 0.514, "Dp": 0.755, "splay_angle": 15.982, "splay_distance": 2.831, "splay_ratio": 0.142, "d22": null, "d64": null, "eta": -172.015, "theta": -129.130, "eta_prime": -148.715, "theta_prime": -163.617, "eta_base": -135.151, "theta_base": -107.313, "v0": -27.536, "v1": 42.173, "v2": -40.399, "v3": 25.445, "v4": 1.080, "amplitude": 43.001, "phase_angle": 159.963, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.016, "origin": [ 42.667, 29.772, 82.635 ], "x_axis": [ -0.267, 0.593, -0.760 ], "y_axis": [ -0.100, 0.767, 0.634 ], "z_axis": [ 0.959, 0.245, -0.146 ], "quaternion": [ 0.582, 0.167, 0.738, 0.298 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 1010, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1010", "linked_nts": [ "///E/1009", "///E/1011" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 5.866, "beta": -103.933, "gamma": -132.718, "delta": 107.122, "epsilon": -176.730, "zeta": -80.765, "epsilon_zeta": -95.966, "bb_type": "BI", "chi": -140.635, "glyco_bond": "anti", "C5prime_xyz": [ -2.215, 8.951, -0.646 ], "P_xyz": [ -1.826, 9.629, -3.050 ], "form": "B", "ssZp": 2.577, "Dp": 2.715, "splay_angle": 27.635, "splay_distance": 4.464, "splay_ratio": 0.239, "d22": 4.563, "d64": 3.789, "eta": -174.215, "theta": 155.199, "eta_prime": 177.304, "theta_prime": -174.422, "eta_base": -125.863, "theta_base": -121.614, "v0": -28.574, "v1": 22.516, "v2": -8.933, "v3": -7.221, "v4": 22.453, "amplitude": 27.721, "phase_angle": 108.799, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ 45.213, 30.733, 81.856 ], "x_axis": [ -0.137, 0.938, -0.319 ], "y_axis": [ 0.162, 0.339, 0.927 ], "z_axis": [ 0.977, 0.075, -0.198 ], "quaternion": [ 0.501, 0.425, 0.647, 0.387 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 1011, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1011", "linked_nts": [ "///E/1010", "///E/1012" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.287, "beta": -160.826, "gamma": 66.115, "delta": 144.944, "epsilon": -165.467, "zeta": -93.496, "epsilon_zeta": -71.971, "bb_type": "BI", "chi": -103.062, "glyco_bond": "anti", "C5prime_xyz": [ -2.170, 8.136, -2.069 ], "P_xyz": [ 0.281, 9.069, -1.292 ], "form": ".", "ssZp": 1.532, "Dp": 1.789, "splay_angle": 19.335, "splay_distance": 3.437, "splay_ratio": 0.173, "d22": 4.040, "d64": 3.844, "eta": 168.609, "theta": -108.132, "eta_prime": -153.870, "theta_prime": -131.357, "eta_base": -103.282, "theta_base": -90.913, "v0": -26.056, "v1": 40.317, "v2": -40.135, "v3": 25.852, "v4": -0.184, "amplitude": 42.221, "phase_angle": 161.915, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.016, "filter_rmsd": 0.099, "frame": { "rmsd": 0.012, "origin": [ 49.306, 32.505, 81.676 ], "x_axis": [ -0.158, 0.876, 0.455 ], "y_axis": [ 0.182, -0.427, 0.886 ], "z_axis": [ 0.971, 0.223, -0.092 ], "quaternion": [ 0.284, 0.583, 0.453, 0.611 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 1012, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1012", "linked_nts": [ "///E/1011", "///E/1013" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -70.228, "beta": 173.457, "gamma": 46.506, "delta": 109.642, "epsilon": -169.492, "zeta": -145.189, "epsilon_zeta": -24.303, "bb_type": "--", "chi": -105.145, "glyco_bond": "anti", "C5prime_xyz": [ -3.749, 7.874, -2.184 ], "P_xyz": [ -2.162, 9.560, -3.332 ], "form": "B", "ssZp": 2.554, "Dp": 2.822, "splay_angle": 19.778, "splay_distance": 3.414, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 159.913, "theta": 162.757, "eta_prime": -178.143, "theta_prime": 164.002, "eta_base": -129.122, "theta_base": -154.773, "v0": -46.436, "v1": 34.515, "v2": -10.782, "v3": -15.887, "v4": 39.366, "amplitude": 45.550, "phase_angle": 103.692, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 52.080, 34.458, 82.229 ], "x_axis": [ -0.050, 0.529, 0.847 ], "y_axis": [ 0.407, -0.764, 0.501 ], "z_axis": [ 0.912, 0.370, -0.177 ], "quaternion": [ 0.048, 0.687, 0.340, 0.640 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 1013, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/1013", "linked_nts": [ "///E/1012", "///E/1014" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -47.212, "beta": 143.960, "gamma": 56.199, "delta": 140.508, "epsilon": -164.783, "zeta": -98.027, "epsilon_zeta": -66.756, "bb_type": "BI", "chi": -121.617, "glyco_bond": "anti", "C5prime_xyz": [ -2.088, 8.624, -1.340 ], "P_xyz": [ 0.529, 8.756, -1.454 ], "form": "B", "ssZp": 2.332, "Dp": 2.159, "splay_angle": 17.603, "splay_distance": 3.057, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 165.343, "theta": -113.115, "eta_prime": -164.163, "theta_prime": -141.556, "eta_base": -124.594, "theta_base": -102.056, "v0": -24.349, "v1": 34.636, "v2": -31.317, "v3": 17.706, "v4": 4.193, "amplitude": 34.627, "phase_angle": 154.743, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 55.406, 34.956, 81.641 ], "x_axis": [ 0.124, 0.028, 0.992 ], "y_axis": [ 0.446, -0.895, -0.031 ], "z_axis": [ 0.886, 0.446, -0.123 ], "quaternion": [ -0.163, 0.732, 0.162, 0.642 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 1014, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1014", "linked_nts": [ "///E/1013", "///E/1015" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -70.453, "beta": 172.766, "gamma": 45.169, "delta": 143.629, "epsilon": -126.698, "zeta": -177.715, "epsilon_zeta": 51.017, "bb_type": "BII", "chi": -103.556, "glyco_bond": "anti", "C5prime_xyz": [ -3.111, 8.238, -1.951 ], "P_xyz": [ -1.097, 9.794, -2.234 ], "form": "B", "ssZp": 1.904, "Dp": 1.774, "splay_angle": 20.719, "splay_distance": 3.443, "splay_ratio": 0.181, "d22": 5.048, "d64": 4.248, "eta": 169.248, "theta": -176.264, "eta_prime": -160.479, "theta_prime": 174.586, "eta_base": -113.094, "theta_base": -142.628, "v0": -40.244, "v1": 48.605, "v2": -37.873, "v3": 16.009, "v4": 15.091, "amplitude": 47.441, "phase_angle": 142.970, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 57.997, 36.348, 82.473 ], "x_axis": [ 0.303, -0.504, 0.809 ], "y_axis": [ 0.448, -0.673, -0.588 ], "z_axis": [ 0.841, 0.541, 0.021 ], "quaternion": [ -0.404, 0.699, -0.020, 0.590 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 1015, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1015", "linked_nts": [ "///E/1014", "///E/1016" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -46.069, "beta": 142.780, "gamma": 34.634, "delta": 103.409, "epsilon": 162.357, "zeta": -31.422, "epsilon_zeta": -166.221, "bb_type": "BI", "chi": -121.783, "glyco_bond": "anti", "C5prime_xyz": [ -1.881, 8.487, -1.619 ], "P_xyz": [ 0.639, 9.215, -1.374 ], "form": "B", "ssZp": 1.943, "Dp": 2.338, "splay_angle": 21.029, "splay_distance": 3.741, "splay_ratio": 0.183, "d22": 4.143, "d64": 3.784, "eta": -176.214, "theta": -124.638, "eta_prime": -168.107, "theta_prime": -133.952, "eta_base": -126.580, "theta_base": -102.360, "v0": -14.201, "v1": 8.427, "v2": 0.136, "v3": -8.383, "v4": 14.268, "amplitude": 14.713, "phase_angle": 89.469, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "4a", "suiteness": 0.053, "filter_rmsd": 0.059, "frame": { "rmsd": 0.012, "origin": [ 60.424, 38.741, 81.985 ], "x_axis": [ 0.589, -0.748, 0.306 ], "y_axis": [ 0.172, -0.254, -0.952 ], "z_axis": [ 0.789, 0.614, -0.021 ], "quaternion": [ 0.573, -0.683, 0.211, -0.401 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 1016, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1016", "linked_nts": [ "///E/1015", "///E/1017" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -88.631, "beta": -174.712, "gamma": 45.967, "delta": 135.676, "epsilon": -172.711, "zeta": -173.626, "epsilon_zeta": 0.915, "bb_type": "--", "chi": -103.859, "glyco_bond": "anti", "C5prime_xyz": [ -2.807, 8.153, -2.262 ], "P_xyz": [ -1.125, 9.965, -2.665 ], "form": "B", "ssZp": 1.985, "Dp": 2.125, "splay_angle": 20.488, "splay_distance": 3.292, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 159.755, "theta": -173.369, "eta_prime": -163.356, "theta_prime": -173.076, "eta_base": -125.578, "theta_base": -108.715, "v0": -35.691, "v1": 43.306, "v2": -34.692, "v3": 15.040, "v4": 12.861, "amplitude": 42.738, "phase_angle": 144.266, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.008, "origin": [ 63.880, 40.173, 82.009 ], "x_axis": [ 0.470, -0.859, -0.205 ], "y_axis": [ -0.074, 0.192, -0.978 ], "z_axis": [ 0.879, 0.475, 0.027 ], "quaternion": [ 0.650, -0.559, 0.417, -0.302 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 1017, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1017", "linked_nts": [ "///E/1016", "///E/1018" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 28.001, "beta": 99.497, "gamma": 22.896, "delta": 110.502, "epsilon": 168.608, "zeta": -86.714, "epsilon_zeta": -104.678, "bb_type": "BI", "chi": -104.821, "glyco_bond": "anti", "C5prime_xyz": [ -2.608, 8.127, -2.344 ], "P_xyz": [ -0.045, 8.623, -1.937 ], "form": "B", "ssZp": 2.128, "Dp": 2.406, "splay_angle": 19.938, "splay_distance": 3.451, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 175.433, "theta": -142.662, "eta_prime": -166.753, "theta_prime": -160.183, "eta_base": -102.648, "theta_base": -131.288, "v0": -32.020, "v1": 27.056, "v2": -12.753, "v3": -5.297, "v4": 23.587, "amplitude": 31.296, "phase_angle": 114.047, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 66.778, 41.200, 80.832 ], "x_axis": [ 0.345, -0.454, -0.821 ], "y_axis": [ -0.287, 0.782, -0.553 ], "z_axis": [ 0.894, 0.426, 0.140 ], "quaternion": [ 0.753, -0.325, 0.569, -0.056 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 1018, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1018", "linked_nts": [ "///E/1017", "///E/1019" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -67.043, "beta": 178.798, "gamma": 53.107, "delta": 141.910, "epsilon": 156.999, "zeta": -153.123, "epsilon_zeta": -49.877, "bb_type": "--", "chi": -111.732, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.483, -1.684 ], "P_xyz": [ -0.117, 9.743, -1.819 ], "form": ".", "ssZp": 2.651, "Dp": 2.611, "splay_angle": 24.210, "splay_distance": 3.827, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 153.865, "theta": -136.875, "eta_prime": -171.283, "theta_prime": -149.657, "eta_base": -132.083, "theta_base": -99.705, "v0": -32.606, "v1": 45.015, "v2": -38.904, "v3": 21.080, "v4": 7.062, "amplitude": 44.053, "phase_angle": 152.023, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 69.864, 42.639, 81.397 ], "x_axis": [ 0.133, -0.056, -0.990 ], "y_axis": [ -0.369, 0.924, -0.102 ], "z_axis": [ 0.920, 0.379, 0.102 ], "quaternion": [ 0.735, -0.163, 0.650, 0.107 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 1019, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1019", "linked_nts": [ "///E/1018", "///E/1020" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 70.717, "beta": 72.882, "gamma": 31.211, "delta": 124.918, "epsilon": -139.850, "zeta": -149.299, "epsilon_zeta": 9.448, "bb_type": "--", "chi": -112.018, "glyco_bond": "anti", "C5prime_xyz": [ -3.452, 8.237, -1.971 ], "P_xyz": [ -1.093, 9.202, -1.040 ], "form": "B", "ssZp": 1.988, "Dp": 2.077, "splay_angle": 19.490, "splay_distance": 3.271, "splay_ratio": 0.169, "d22": 4.443, "d64": 3.812, "eta": -177.998, "theta": -148.856, "eta_prime": -156.832, "theta_prime": -165.265, "eta_base": -99.728, "theta_base": -124.691, "v0": -44.032, "v1": 45.679, "v2": -30.549, "v3": 6.265, "v4": 23.217, "amplitude": 46.199, "phase_angle": 131.395, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ 73.060, 44.058, 79.840 ], "x_axis": [ -0.201, 0.524, -0.828 ], "y_axis": [ -0.339, 0.755, 0.561 ], "z_axis": [ 0.919, 0.393, 0.026 ], "quaternion": [ 0.629, 0.067, 0.695, 0.343 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 1020, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/1020", "linked_nts": [ "///E/1019", "///E/1021" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -60.718, "beta": 125.647, "gamma": 73.518, "delta": 108.209, "epsilon": -107.854, "zeta": -103.443, "epsilon_zeta": -4.412, "bb_type": "--", "chi": -145.694, "glyco_bond": "anti", "C5prime_xyz": [ -2.802, 8.815, -0.748 ], "P_xyz": [ -0.283, 9.510, -1.152 ], "form": "B", "ssZp": 1.767, "Dp": 1.779, "splay_angle": 18.288, "splay_distance": 3.239, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": -163.452, "theta": -127.797, "eta_prime": -160.975, "theta_prime": -140.549, "eta_base": -118.851, "theta_base": -114.606, "v0": -41.864, "v1": 33.619, "v2": -13.241, "v3": -10.380, "v4": 32.732, "amplitude": 40.746, "phase_angle": 108.964, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 76.161, 45.079, 80.042 ], "x_axis": [ -0.330, 0.869, -0.370 ], "y_axis": [ -0.178, 0.327, 0.928 ], "z_axis": [ 0.927, 0.372, 0.047 ], "quaternion": [ 0.511, 0.272, 0.634, 0.512 ] } }, { "index": 21, "index_chain": 21, "chain_name": "E", "nt_resnum": 1021, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1021", "linked_nts": [ "///E/1020", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -56.569, "beta": 142.668, "gamma": 17.851, "delta": 82.382, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -113.461, "glyco_bond": "anti", "C5prime_xyz": [ -2.890, 8.226, -2.195 ], "P_xyz": [ -0.993, 9.426, -3.367 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -30.053, "v1": 5.129, "v2": 19.619, "v3": -37.689, "v4": 42.927, "amplitude": 42.432, "phase_angle": 62.461, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 79.178, 46.215, 80.354 ], "x_axis": [ -0.517, 0.846, 0.131 ], "y_axis": [ 0.161, -0.054, 0.986 ], "z_axis": [ 0.841, 0.531, -0.108 ], "quaternion": [ 0.283, 0.402, 0.627, 0.605 ] } }, { "index": 22, "index_chain": 1, "chain_name": "F", "nt_resnum": 1101, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1101", "linked_nts": [ null, "///F/1102" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -62.319, "delta": 118.753, "epsilon": -115.874, "zeta": -138.704, "epsilon_zeta": 22.830, "bb_type": "--", "chi": -143.397, "glyco_bond": "anti", "C5prime_xyz": [ -2.900, 8.868, -0.676 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.062, "Dp": 1.958, "splay_angle": 18.875, "splay_distance": 3.418, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -46.267, "v1": 44.890, "v2": -26.565, "v3": 0.778, "v4": 28.065, "amplitude": 46.763, "phase_angle": 124.616, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 80.672, 49.620, 79.765 ], "x_axis": [ -0.669, 0.518, 0.533 ], "y_axis": [ -0.392, 0.362, -0.845 ], "z_axis": [ -0.631, -0.775, -0.039 ], "quaternion": [ -0.404, 0.044, 0.720, -0.563 ] } }, { "index": 23, "index_chain": 2, "chain_name": "F", "nt_resnum": 1102, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1102", "linked_nts": [ "///F/1101", "///F/1103" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": -9.683, "beta": 106.753, "gamma": -6.909, "delta": 74.341, "epsilon": 40.182, "zeta": 44.682, "epsilon_zeta": -4.500, "bb_type": "--", "chi": -106.761, "glyco_bond": "anti", "C5prime_xyz": [ -4.085, 7.789, -2.144 ], "P_xyz": [ -2.578, 9.848, -2.779 ], "form": "B", "ssZp": 1.486, "Dp": 1.624, "splay_angle": 23.545, "splay_distance": 4.033, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 157.675, "theta": -166.330, "eta_prime": 176.245, "theta_prime": -165.153, "eta_base": -173.399, "theta_base": -117.444, "v0": -36.133, "v1": 7.517, "v2": 21.891, "v3": -43.755, "v4": 49.910, "amplitude": 49.697, "phase_angle": 63.865, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 79.826, 46.416, 80.601 ], "x_axis": [ -0.632, 0.713, 0.303 ], "y_axis": [ -0.312, 0.123, -0.942 ], "z_axis": [ -0.709, -0.690, 0.145 ], "quaternion": [ 0.399, -0.158, -0.634, 0.643 ] } }, { "index": 24, "index_chain": 3, "chain_name": "F", "nt_resnum": 1103, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1103", "linked_nts": [ "///F/1102", "///F/1104" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 101.627, "beta": 159.341, "gamma": -179.624, "delta": 168.032, "epsilon": -175.012, "zeta": -146.645, "epsilon_zeta": -28.367, "bb_type": "--", "chi": -113.797, "glyco_bond": "anti", "C5prime_xyz": [ -1.313, 8.256, -1.063 ], "P_xyz": [ 0.395, 9.513, -2.514 ], "form": "B", "ssZp": 2.146, "Dp": 2.151, "splay_angle": 21.514, "splay_distance": 3.374, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 157.877, "theta": -164.745, "eta_prime": -171.019, "theta_prime": -175.531, "eta_base": -121.174, "theta_base": -113.022, "v0": -13.672, "v1": 38.202, "v2": -46.227, "v3": 39.625, "v4": -16.352, "amplitude": 46.246, "phase_angle": 181.651, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 76.094, 44.903, 80.366 ], "x_axis": [ -0.384, 0.827, -0.410 ], "y_axis": [ 0.142, -0.386, -0.911 ], "z_axis": [ -0.912, -0.409, 0.031 ], "quaternion": [ 0.255, -0.493, -0.492, 0.671 ] } }, { "index": 25, "index_chain": 4, "chain_name": "F", "nt_resnum": 1104, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1104", "linked_nts": [ "///F/1103", "///F/1105" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -0.339, "beta": 146.297, "gamma": 20.770, "delta": 147.756, "epsilon": -153.904, "zeta": -138.705, "epsilon_zeta": -15.198, "bb_type": "--", "chi": -111.759, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.207, -1.651 ], "P_xyz": [ 1.137, 8.620, -1.021 ], "form": ".", "ssZp": 1.869, "Dp": 1.842, "splay_angle": 22.742, "splay_distance": 4.085, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 176.844, "theta": -128.369, "eta_prime": -158.620, "theta_prime": -150.227, "eta_base": -95.940, "theta_base": -132.025, "v0": -8.150, "v1": 26.369, "v2": -33.227, "v3": 29.353, "v4": -13.618, "amplitude": 33.340, "phase_angle": 184.725, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 73.028, 43.649, 79.727 ], "x_axis": [ -0.237, 0.215, -0.948 ], "y_axis": [ 0.408, -0.863, -0.298 ], "z_axis": [ -0.882, -0.457, 0.117 ], "quaternion": [ -0.065, -0.614, -0.253, 0.744 ] } }, { "index": 26, "index_chain": 5, "chain_name": "F", "nt_resnum": 1105, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1105", "linked_nts": [ "///F/1104", "///F/1106" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -8.136, "beta": 127.943, "gamma": 23.163, "delta": 95.716, "epsilon": 146.676, "zeta": -64.480, "epsilon_zeta": -148.845, "bb_type": "BI", "chi": -134.823, "glyco_bond": "anti", "C5prime_xyz": [ -3.024, 8.700, -1.461 ], "P_xyz": [ -1.091, 10.429, -1.124 ], "form": ".", "ssZp": 2.392, "Dp": 2.496, "splay_angle": 15.033, "splay_distance": 2.602, "splay_ratio": 0.136, "d22": 4.387, "d64": 3.839, "eta": 171.607, "theta": -156.680, "eta_prime": -166.915, "theta_prime": -163.998, "eta_base": -139.727, "theta_base": -118.285, "v0": -43.823, "v1": 30.851, "v2": -7.301, "v3": -18.066, "v4": 39.478, "amplitude": 43.576, "phase_angle": 99.645, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.008, "origin": [ 69.420, 42.659, 81.368 ], "x_axis": [ -0.150, -0.097, -0.984 ], "y_axis": [ 0.525, -0.851, 0.003 ], "z_axis": [ -0.838, -0.516, 0.179 ], "quaternion": [ -0.210, -0.617, -0.174, 0.738 ] } }, { "index": 27, "index_chain": 6, "chain_name": "F", "nt_resnum": 1106, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1106", "linked_nts": [ "///F/1105", "///F/1107" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -119.231, "beta": -142.972, "gamma": 58.892, "delta": 88.000, "epsilon": 62.330, "zeta": 53.827, "epsilon_zeta": 8.503, "bb_type": "--", "chi": -117.492, "glyco_bond": "anti", "C5prime_xyz": [ -2.671, 8.345, -1.876 ], "P_xyz": [ -0.474, 9.683, -2.130 ], "form": "B", "ssZp": 1.679, "Dp": 2.026, "splay_angle": 20.694, "splay_distance": 3.461, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -179.979, "theta": -157.878, "eta_prime": -165.961, "theta_prime": -155.545, "eta_base": -117.066, "theta_base": -114.737, "v0": -17.926, "v1": -5.229, "v2": 24.736, "v3": -35.653, "v4": 33.491, "amplitude": 36.318, "phase_angle": 47.070, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 66.926, 41.983, 81.070 ], "x_axis": [ 0.091, -0.642, -0.761 ], "y_axis": [ 0.310, -0.708, 0.634 ], "z_axis": [ -0.947, -0.293, 0.135 ], "quaternion": [ -0.359, -0.645, 0.129, 0.662 ] } }, { "index": 28, "index_chain": 7, "chain_name": "F", "nt_resnum": 1107, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1107", "linked_nts": [ "///F/1106", "///F/1108" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -134.868, "beta": -157.697, "gamma": 41.401, "delta": 143.282, "epsilon": 137.778, "zeta": -129.438, "epsilon_zeta": -92.784, "bb_type": "--", "chi": -90.718, "glyco_bond": "anti", "C5prime_xyz": [ -2.211, 7.818, -2.420 ], "P_xyz": [ 0.005, 9.155, -2.579 ], "form": "B", "ssZp": 2.031, "Dp": 1.947, "splay_angle": 22.592, "splay_distance": 3.629, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 154.027, "theta": -156.386, "eta_prime": -165.485, "theta_prime": -174.360, "eta_base": -122.987, "theta_base": -133.549, "v0": -11.045, "v1": 27.717, "v2": -32.759, "v3": 27.107, "v4": -10.370, "amplitude": 32.762, "phase_angle": 179.270, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 63.968, 40.241, 81.517 ], "x_axis": [ 0.378, -0.881, -0.284 ], "y_axis": [ 0.118, -0.258, 0.959 ], "z_axis": [ -0.918, -0.396, 0.006 ], "quaternion": [ 0.531, 0.638, -0.299, -0.471 ] } }, { "index": 29, "index_chain": 8, "chain_name": "F", "nt_resnum": 1108, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1108", "linked_nts": [ "///F/1107", "///F/1109" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 70.721, "beta": 122.769, "gamma": -20.049, "delta": 150.462, "epsilon": 169.082, "zeta": -82.152, "epsilon_zeta": -108.766, "bb_type": "BI", "chi": -100.320, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 7.964, -2.109 ], "P_xyz": [ 0.612, 9.178, -1.098 ], "form": ".", "ssZp": 2.155, "Dp": 2.170, "splay_angle": 20.571, "splay_distance": 3.597, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 175.385, "theta": -128.374, "eta_prime": -172.309, "theta_prime": -140.152, "eta_base": -128.221, "theta_base": -97.215, "v0": -7.697, "v1": 26.627, "v2": -34.143, "v3": 30.038, "v4": -14.328, "amplitude": 34.299, "phase_angle": 185.459, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 60.546, 39.043, 81.371 ], "x_axis": [ 0.421, -0.844, 0.332 ], "y_axis": [ -0.081, 0.330, 0.940 ], "z_axis": [ -0.903, -0.423, 0.071 ], "quaternion": [ 0.675, 0.505, -0.458, -0.283 ] } }, { "index": 30, "index_chain": 9, "chain_name": "F", "nt_resnum": 1109, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1109", "linked_nts": [ "///F/1108", "///F/1110" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.058, "beta": -168.113, "gamma": 28.976, "delta": 150.458, "epsilon": -153.491, "zeta": -147.025, "epsilon_zeta": -6.466, "bb_type": "--", "chi": -106.417, "glyco_bond": "anti", "C5prime_xyz": [ -2.439, 8.378, -1.745 ], "P_xyz": [ -0.641, 10.099, -1.554 ], "form": "B", "ssZp": 2.399, "Dp": 2.187, "splay_angle": 21.755, "splay_distance": 3.637, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 175.630, "theta": -163.606, "eta_prime": -156.838, "theta_prime": -168.422, "eta_base": -105.245, "theta_base": -129.711, "v0": -31.751, "v1": 46.115, "v2": -41.614, "v3": 24.280, "v4": 4.763, "amplitude": 45.729, "phase_angle": 155.506, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 58.255, 36.366, 82.099 ], "x_axis": [ 0.282, -0.530, 0.800 ], "y_axis": [ -0.343, 0.723, 0.600 ], "z_axis": [ -0.896, -0.444, 0.022 ], "quaternion": [ 0.712, 0.366, -0.596, -0.066 ] } }, { "index": 31, "index_chain": 10, "chain_name": "F", "nt_resnum": 1110, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/1110", "linked_nts": [ "///F/1109", "///F/1111" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -50.385, "beta": 149.369, "gamma": 43.663, "delta": 134.503, "epsilon": -118.474, "zeta": -148.491, "epsilon_zeta": 30.018, "bb_type": "--", "chi": -130.976, "glyco_bond": "anti", "C5prime_xyz": [ -2.710, 8.761, -0.855 ], "P_xyz": [ -0.369, 9.717, -0.415 ], "form": "B", "ssZp": 2.107, "Dp": 1.873, "splay_angle": 17.285, "splay_distance": 2.917, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": -173.801, "theta": -143.356, "eta_prime": -159.179, "theta_prime": -146.017, "eta_base": -118.627, "theta_base": -98.829, "v0": -41.344, "v1": 43.937, "v2": -30.030, "v3": 7.162, "v4": 21.246, "amplitude": 44.093, "phase_angle": 132.927, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 55.223, 34.363, 81.951 ], "x_axis": [ 0.094, -0.090, 0.992 ], "y_axis": [ -0.363, 0.924, 0.118 ], "z_axis": [ -0.927, -0.371, 0.054 ], "quaternion": [ 0.720, 0.170, -0.666, 0.095 ] } }, { "index": 32, "index_chain": 11, "chain_name": "F", "nt_resnum": 1111, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1111", "linked_nts": [ "///F/1110", "///F/1112" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.583, "beta": 145.820, "gamma": 23.239, "delta": 155.127, "epsilon": -89.270, "zeta": 124.231, "epsilon_zeta": 146.499, "bb_type": "--", "chi": -85.164, "glyco_bond": "anti", "C5prime_xyz": [ -2.670, 7.783, -2.433 ], "P_xyz": [ -0.261, 8.811, -2.517 ], "form": ".", "ssZp": 0.582, "Dp": 0.617, "splay_angle": 24.659, "splay_distance": 4.139, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": -179.056, "theta": -169.283, "eta_prime": -150.013, "theta_prime": 179.295, "eta_base": -104.048, "theta_base": -127.870, "v0": -27.463, "v1": 45.524, "v2": -45.942, "v3": 31.315, "v4": -2.566, "amplitude": 47.667, "phase_angle": 164.540, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.046, "frame": { "rmsd": 0.013, "origin": [ 52.367, 33.945, 82.370 ], "x_axis": [ -0.163, 0.509, 0.845 ], "y_axis": [ -0.518, 0.685, -0.512 ], "z_axis": [ -0.840, -0.522, 0.152 ], "quaternion": [ 0.647, 0.004, -0.651, 0.397 ] } }, { "index": 33, "index_chain": 12, "chain_name": "F", "nt_resnum": 1112, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1112", "linked_nts": [ "///F/1111", "///F/1113" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 104.850, "beta": -105.170, "gamma": 149.161, "delta": 120.377, "epsilon": -157.319, "zeta": -97.458, "epsilon_zeta": -59.861, "bb_type": "BI", "chi": -126.619, "glyco_bond": "anti", "C5prime_xyz": [ -2.646, 8.697, -1.170 ], "P_xyz": [ -0.054, 8.745, -1.826 ], "form": ".", "ssZp": 2.109, "Dp": 2.351, "splay_angle": 18.314, "splay_distance": 3.387, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 162.507, "theta": -120.519, "eta_prime": -171.585, "theta_prime": -153.938, "eta_base": -121.124, "theta_base": -113.506, "v0": -33.476, "v1": 35.622, "v2": -25.464, "v3": 7.163, "v4": 16.126, "amplitude": 35.940, "phase_angle": 135.113, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.016, "origin": [ 48.874, 31.984, 81.327 ], "x_axis": [ -0.558, 0.724, 0.405 ], "y_axis": [ -0.195, 0.360, -0.912 ], "z_axis": [ -0.807, -0.588, -0.060 ], "quaternion": [ -0.431, 0.188, 0.703, -0.533 ] } }, { "index": 34, "index_chain": 13, "chain_name": "F", "nt_resnum": 1113, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1113", "linked_nts": [ "///F/1112", "///F/1114" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.473, "beta": 151.628, "gamma": 62.845, "delta": 85.184, "epsilon": 172.226, "zeta": -90.339, "epsilon_zeta": -97.435, "bb_type": "BI", "chi": -147.930, "glyco_bond": "anti", "C5prime_xyz": [ -3.150, 8.780, -1.114 ], "P_xyz": [ -1.289, 10.511, -1.135 ], "form": ".", "ssZp": 2.064, "Dp": 2.519, "splay_angle": 18.920, "splay_distance": 3.647, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": -179.449, "theta": -153.644, "eta_prime": -162.705, "theta_prime": -165.494, "eta_base": -114.685, "theta_base": -122.037, "v0": -42.781, "v1": 22.870, "v2": 4.362, "v3": -29.701, "v4": 45.633, "amplitude": 46.016, "phase_angle": 84.561, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 45.850, 30.751, 82.225 ], "x_axis": [ -0.502, 0.853, -0.143 ], "y_axis": [ 0.134, -0.086, -0.987 ], "z_axis": [ -0.854, -0.515, -0.071 ], "quaternion": [ 0.292, -0.405, -0.610, 0.616 ] } }, { "index": 35, "index_chain": 14, "chain_name": "F", "nt_resnum": 1114, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1114", "linked_nts": [ "///F/1113", "///F/1115" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": 91.299, "beta": -175.075, "gamma": -117.614, "delta": 112.636, "epsilon": -155.148, "zeta": -62.406, "epsilon_zeta": -92.742, "bb_type": "BI", "chi": -143.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.700, 8.779, -0.272 ], "P_xyz": [ -0.879, 10.947, -0.956 ], "form": ".", "ssZp": 2.660, "Dp": 2.980, "splay_angle": 16.689, "splay_distance": 3.098, "splay_ratio": 0.150, "d22": 4.236, "d64": 4.267, "eta": 179.414, "theta": -161.938, "eta_prime": -174.391, "theta_prime": -156.166, "eta_base": -123.973, "theta_base": -135.504, "v0": -15.551, "v1": 9.519, "v2": -0.631, "v3": -8.288, "v4": 14.960, "amplitude": 15.712, "phase_angle": 92.301, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.010, "origin": [ 42.480, 29.754, 83.199 ], "x_axis": [ -0.461, 0.549, -0.697 ], "y_axis": [ 0.416, -0.560, -0.716 ], "z_axis": [ -0.784, -0.620, 0.030 ], "quaternion": [ 0.047, -0.517, -0.467, 0.716 ] } }, { "index": 36, "index_chain": 15, "chain_name": "F", "nt_resnum": 1115, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/1115", "linked_nts": [ "///F/1114", "///F/1116" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -94.613, "beta": 160.252, "gamma": 92.252, "delta": 118.902, "epsilon": 166.476, "zeta": -80.410, "epsilon_zeta": -113.114, "bb_type": "BI", "chi": -133.070, "glyco_bond": "anti", "C5prime_xyz": [ -2.986, 8.905, -1.115 ], "P_xyz": [ -1.048, 10.488, -2.045 ], "form": ".", "ssZp": 2.349, "Dp": 2.692, "splay_angle": 23.132, "splay_distance": 3.920, "splay_ratio": 0.209, "d22": 4.314, "d64": 4.041, "eta": 159.626, "theta": -156.215, "eta_prime": -162.185, "theta_prime": -172.489, "eta_base": -138.793, "theta_base": -101.204, "v0": -40.220, "v1": 42.027, "v2": -27.962, "v3": 5.449, "v4": 21.574, "amplitude": 42.468, "phase_angle": 131.180, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 39.693, 28.737, 84.091 ], "x_axis": [ -0.199, 0.333, -0.922 ], "y_axis": [ 0.422, -0.820, -0.387 ], "z_axis": [ -0.885, -0.466, 0.023 ], "quaternion": [ -0.031, -0.632, -0.298, 0.714 ] } }, { "index": 37, "index_chain": 16, "chain_name": "F", "nt_resnum": 1116, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1116", "linked_nts": [ "///F/1115", "///F/1117" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -104.005, "beta": -168.369, "gamma": 77.199, "delta": 90.312, "epsilon": 41.055, "zeta": 113.061, "epsilon_zeta": -72.006, "bb_type": "--", "chi": -136.963, "glyco_bond": "anti", "C5prime_xyz": [ -1.782, 8.830, -0.807 ], "P_xyz": [ 0.666, 9.868, -0.972 ], "form": "B", "ssZp": 1.380, "Dp": 1.737, "splay_angle": 16.884, "splay_distance": 2.976, "splay_ratio": 0.147, "d22": null, "d64": null, "eta": -152.211, "theta": -121.367, "eta_prime": -147.073, "theta_prime": -128.815, "eta_base": -75.124, "theta_base": -116.023, "v0": -5.641, "v1": -5.702, "v2": 13.904, "v3": -17.592, "v4": 14.669, "amplitude": 17.400, "phase_angle": 36.961, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.010, "origin": [ 36.328, 27.784, 82.319 ], "x_axis": [ 0.044, -0.591, -0.805 ], "y_axis": [ 0.420, -0.721, 0.552 ], "z_axis": [ -0.907, -0.362, 0.217 ], "quaternion": [ -0.367, -0.622, 0.069, 0.688 ] } }, { "index": 38, "index_chain": 17, "chain_name": "F", "nt_resnum": 1117, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1117", "linked_nts": [ "///F/1116", "///F/1118" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 27.543, "beta": -129.185, "gamma": -159.633, "delta": 137.384, "epsilon": 169.186, "zeta": -153.816, "epsilon_zeta": -36.999, "bb_type": "--", "chi": -111.128, "glyco_bond": "anti", "C5prime_xyz": [ -2.952, 8.494, -1.649 ], "P_xyz": [ -2.194, 8.793, -4.116 ], "form": ".", "ssZp": 2.724, "Dp": 2.724, "splay_angle": 21.700, "splay_distance": 3.753, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 140.994, "theta": -165.511, "eta_prime": -170.132, "theta_prime": -169.799, "eta_base": -156.655, "theta_base": -136.135, "v0": -39.892, "v1": 49.251, "v2": -39.057, "v3": 16.660, "v4": 14.403, "amplitude": 48.191, "phase_angle": 144.140, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.012, "origin": [ 33.673, 26.950, 83.371 ], "x_axis": [ 0.205, -0.766, -0.609 ], "y_axis": [ 0.136, -0.594, 0.793 ], "z_axis": [ -0.969, -0.245, -0.018 ], "quaternion": [ 0.385, 0.674, -0.234, -0.586 ] } }, { "index": 39, "index_chain": 18, "chain_name": "F", "nt_resnum": 1118, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1118", "linked_nts": [ "///F/1117", "///F/1119" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": 80.587, "beta": 68.279, "gamma": 3.303, "delta": 89.256, "epsilon": 7.646, "zeta": 107.070, "epsilon_zeta": -99.423, "bb_type": "--", "chi": -93.724, "glyco_bond": "anti", "C5prime_xyz": [ -4.411, 7.353, -2.342 ], "P_xyz": [ -2.731, 9.405, -2.100 ], "form": ".", "ssZp": 1.202, "Dp": 1.134, "splay_angle": 19.805, "splay_distance": 3.648, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -170.745, "theta": -149.661, "eta_prime": -158.281, "theta_prime": -160.911, "eta_base": -125.750, "theta_base": -120.399, "v0": -44.185, "v1": 30.025, "v2": -5.714, "v3": -19.142, "v4": 39.334, "amplitude": 43.489, "phase_angle": 97.550, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 30.855, 25.215, 81.601 ], "x_axis": [ 0.487, -0.849, -0.205 ], "y_axis": [ -0.045, -0.258, 0.965 ], "z_axis": [ -0.872, -0.461, -0.164 ], "quaternion": [ 0.516, 0.691, -0.323, -0.390 ] } }, { "index": 40, "index_chain": 19, "chain_name": "F", "nt_resnum": 1119, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1119", "linked_nts": [ "///F/1118", "///F/1120" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -110.202, "beta": 132.742, "gamma": 65.598, "delta": 115.292, "epsilon": 129.989, "zeta": -91.349, "epsilon_zeta": -138.662, "bb_type": "--", "chi": -121.666, "glyco_bond": "anti", "C5prime_xyz": [ -3.927, 8.388, -1.614 ], "P_xyz": [ -2.291, 10.160, -2.725 ], "form": ".", "ssZp": 2.277, "Dp": 2.797, "splay_angle": 17.807, "splay_distance": 2.720, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 144.641, "theta": -171.341, "eta_prime": -168.283, "theta_prime": -173.579, "eta_base": -131.550, "theta_base": -133.500, "v0": -52.226, "v1": 55.959, "v2": -36.265, "v3": 7.189, "v4": 27.845, "amplitude": 55.386, "phase_angle": 130.902, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 28.082, 22.958, 80.875 ], "x_axis": [ 0.472, -0.830, 0.298 ], "y_axis": [ -0.288, 0.175, 0.942 ], "z_axis": [ -0.833, -0.530, -0.156 ], "quaternion": [ 0.611, 0.603, -0.463, -0.222 ] } }, { "index": 41, "index_chain": 20, "chain_name": "F", "nt_resnum": 1120, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1120", "linked_nts": [ "///F/1119", "///F/1121" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -115.300, "beta": -69.589, "gamma": 41.973, "delta": 155.535, "epsilon": 167.805, "zeta": -178.234, "epsilon_zeta": -13.961, "bb_type": "--", "chi": -60.888, "glyco_bond": "--", "C5prime_xyz": [ -2.318, 6.337, -3.347 ], "P_xyz": [ -0.376, 8.096, -2.765 ], "form": "B", "ssZp": 1.034, "Dp": 1.891, "splay_angle": 24.280, "splay_distance": 4.025, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": -176.096, "theta": -162.767, "eta_prime": 172.461, "theta_prime": 177.680, "eta_base": -141.486, "theta_base": -151.910, "v0": -10.290, "v1": 32.778, "v2": -41.929, "v3": 36.464, "v4": -16.575, "amplitude": 42.054, "phase_angle": 184.418, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 27.008, 20.671, 79.868 ], "x_axis": [ 0.267, -0.438, 0.858 ], "y_axis": [ -0.757, 0.455, 0.468 ], "z_axis": [ -0.596, -0.775, -0.210 ], "quaternion": [ 0.615, 0.506, -0.591, 0.130 ] } }, { "index": 42, "index_chain": 21, "chain_name": "F", "nt_resnum": 1121, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/1121", "linked_nts": [ "///F/1120", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": 90.371, "beta": -74.291, "gamma": -161.211, "delta": 149.708, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -157.959, "glyco_bond": "anti", "C5prime_xyz": [ -2.622, 8.670, 0.963 ], "P_xyz": [ -0.946, 9.530, -0.805 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.730, "v1": 44.772, "v2": -43.702, "v3": 28.548, "v4": -0.727, "amplitude": 45.904, "phase_angle": 162.183, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.016, "origin": [ 24.464, 18.015, 78.231 ], "x_axis": [ -0.084, -0.432, 0.898 ], "y_axis": [ -0.663, 0.697, 0.273 ], "z_axis": [ -0.744, -0.573, -0.345 ], "quaternion": [ 0.563, 0.376, -0.729, 0.103 ] } } ], "num_hbonds": 576, "hbonds": [ { "index": 1, "atom1_serNum": 6, "atom2_serNum": 5074, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///E/1001/O3'", "atom2_id": "///C/241/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 2, "atom1_serNum": 14, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///E/1001/O4", "atom2_id": "///F/1121/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 34, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///E/1002/O4", "atom2_id": "///F/1121/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 52, "atom2_serNum": 832, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///E/1003/N3", "atom2_id": "///F/1120/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 54, "atom2_serNum": 831, "donAcc_type": "standard", "distance": 2.335, "atom1_id": "///E/1003/O4", "atom2_id": "///F/1120/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 71, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///E/1004/O2", "atom2_id": "///F/1119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 72, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///E/1004/N3", "atom2_id": "///F/1119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 74, "atom2_serNum": 809, "donAcc_type": "standard", "distance": 2.199, "atom1_id": "///E/1004/N4", "atom2_id": "///F/1119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 90, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///E/1005/O2", "atom2_id": "///F/1118/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 91, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///E/1005/N3", "atom2_id": "///F/1118/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 93, "atom2_serNum": 787, "donAcc_type": "standard", "distance": 2.276, "atom1_id": "///E/1005/N4", "atom2_id": "///F/1118/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 99, "atom2_serNum": 118, "donAcc_type": "questionable", "distance": 2.288, "atom1_id": "///E/1006/O5'", "atom2_id": "///E/1007/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 110, "atom2_serNum": 767, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///E/1006/N3", "atom2_id": "///F/1117/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 112, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 2.340, "atom1_id": "///E/1006/O4", "atom2_id": "///F/1117/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 132, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/1007/N6", "atom2_id": "///F/1116/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 133, "atom2_serNum": 744, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///E/1007/N1", "atom2_id": "///F/1116/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 154, "atom2_serNum": 727, "donAcc_type": "questionable", "distance": 2.553, "atom1_id": "///E/1008/N1", "atom2_id": "///F/1115/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 156, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.496, "atom1_id": "///E/1008/N2", "atom2_id": "///F/1115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 175, "atom2_serNum": 707, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///E/1009/N6", "atom2_id": "///F/1114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 176, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///E/1009/N1", "atom2_id": "///F/1114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 193, "atom2_serNum": 688, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///E/1010/O2", "atom2_id": "///F/1113/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 194, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///E/1010/N3", "atom2_id": "///F/1113/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 196, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 2.392, "atom1_id": "///E/1010/N4", "atom2_id": "///F/1113/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 213, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///E/1011/N3", "atom2_id": "///F/1112/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 215, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 3.604, "atom1_id": "///E/1011/O4", "atom2_id": "///F/1112/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 221, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///E/1012/OP2", "atom2_id": "///B/273/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 27, "atom1_serNum": 222, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///E/1012/O5'", "atom2_id": "///B/273/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 28, "atom1_serNum": 233, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 2.379, "atom1_id": "///E/1012/N3", "atom2_id": "///F/1111/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 235, "atom2_serNum": 643, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///E/1012/O4", "atom2_id": "///F/1111/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 240, "atom2_serNum": 3544, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///E/1013/OP1", "atom2_id": "///B/241/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 241, "atom2_serNum": 3803, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///E/1013/OP2", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 32, "atom1_serNum": 252, "atom2_serNum": 3835, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///E/1013/N7", "atom2_id": "///B/280/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 33, "atom1_serNum": 255, "atom2_serNum": 624, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///E/1013/O6", "atom2_id": "///F/1110/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 255, "atom2_serNum": 3834, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///E/1013/O6", "atom2_id": "///B/280/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 35, "atom1_serNum": 256, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///E/1013/N1", "atom2_id": "///F/1110/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 258, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///E/1013/N2", "atom2_id": "///F/1110/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 262, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///E/1014/OP1", "atom2_id": "///A/168/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 38, "atom1_serNum": 263, "atom2_serNum": 1423, "donAcc_type": "standard", "distance": 3.829, "atom1_id": "///E/1014/OP2", "atom2_id": "///A/167/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 39, "atom1_serNum": 274, "atom2_serNum": 605, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///E/1014/O2", "atom2_id": "///F/1109/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 275, "atom2_serNum": 603, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///E/1014/N3", "atom2_id": "///F/1109/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 277, "atom2_serNum": 602, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///E/1014/N4", "atom2_id": "///F/1109/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 281, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///E/1015/OP1", "atom2_id": "///A/165/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 282, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///E/1015/OP2", "atom2_id": "///A/165/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 293, "atom2_serNum": 583, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///E/1015/O2", "atom2_id": "///F/1108/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 294, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///E/1015/N3", "atom2_id": "///F/1108/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 296, "atom2_serNum": 580, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///E/1015/N4", "atom2_id": "///F/1108/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 312, "atom2_serNum": 561, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///E/1016/O2", "atom2_id": "///F/1107/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 313, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///E/1016/N3", "atom2_id": "///F/1107/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 315, "atom2_serNum": 558, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///E/1016/N4", "atom2_id": "///F/1107/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 334, "atom2_serNum": 518, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///E/1017/N6", "atom2_id": "///F/1105/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 334, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///E/1017/N6", "atom2_id": "///F/1106/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 335, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///E/1017/N1", "atom2_id": "///F/1106/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 355, "atom2_serNum": 518, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///E/1018/N6", "atom2_id": "///F/1105/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 356, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///E/1018/N1", "atom2_id": "///F/1105/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 374, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///E/1019/N3", "atom2_id": "///F/1104/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 376, "atom2_serNum": 497, "donAcc_type": "standard", "distance": 3.915, "atom1_id": "///E/1019/O4", "atom2_id": "///F/1104/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 394, "atom2_serNum": 477, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///E/1020/N3", "atom2_id": "///F/1103/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 396, "atom2_serNum": 476, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/1020/O4", "atom2_id": "///F/1103/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 416, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///E/1021/N6", "atom2_id": "///F/1102/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 417, "atom2_serNum": 454, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///E/1021/N1", "atom2_id": "///F/1102/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 530, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///F/1106/O3'", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 544, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///F/1107/OP2", "atom2_id": "///B/283/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 577, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///F/1108/N7", "atom2_id": "///B/120/NZ", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 580, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 2.377, "atom1_id": "///F/1108/O6", "atom2_id": "///B/120/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 65, "atom1_serNum": 602, "atom2_serNum": 3834, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///F/1109/O6", "atom2_id": "///B/280/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 858, "atom2_serNum": 2734, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///A/94/N", "atom2_id": "///B/140/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 858, "atom2_serNum": 3195, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/94/N", "atom2_id": "///B/198/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 858, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 2.387, "atom1_id": "///A/94/N", "atom2_id": "///B/198/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 863, "atom2_serNum": 2729, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/94/OG", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 864, "atom2_serNum": 2718, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/95/N", "atom2_id": "///B/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 899, "atom2_serNum": 2228, "donAcc_type": "acceptable", "distance": 3.667, "atom1_id": "///A/100/O", "atom2_id": "///A/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 908, "atom2_serNum": 2211, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/101/O", "atom2_id": "///A/267/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 908, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/101/O", "atom2_id": "///A/267/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 921, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/103/N", "atom2_id": "///A/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 924, "atom2_serNum": 2204, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/103/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 936, "atom2_serNum": 968, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/104/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 945, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/105/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 949, "atom2_serNum": 1284, "donAcc_type": "acceptable", "distance": 3.768, "atom1_id": "///A/106/O", "atom2_id": "///A/149/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 955, "atom2_serNum": 1271, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/107/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 967, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/108/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 971, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/109/O", "atom2_id": "///A/268/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 979, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/110/N", "atom2_id": "///A/146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 982, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/110/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 998, "atom2_serNum": 1236, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///A/112/N", "atom2_id": "///A/144/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 1001, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/112/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 1016, "atom2_serNum": 1031, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/114/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 1036, "atom2_serNum": 1085, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///A/116/OG", "atom2_id": "///A/124/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 1040, "atom2_serNum": 1093, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///A/117/O", "atom2_id": "///A/125/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 1046, "atom2_serNum": 2341, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///A/118/OG1", "atom2_id": "///A/283/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 1051, "atom2_serNum": 1068, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/119/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 1078, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/123/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 1088, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/125/N", "atom2_id": "///A/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 1091, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/125/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 1093, "atom2_serNum": 2330, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///A/125/OG1", "atom2_id": "///A/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 1106, "atom2_serNum": 1140, "donAcc_type": "acceptable", "distance": 2.594, "atom1_id": "///A/126/OH", "atom2_id": "///A/131/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 1107, "atom2_serNum": 1144, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/127/N", "atom2_id": "///A/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 1110, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/127/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 1110, "atom2_serNum": 1133, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 1110, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/127/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 1112, "atom2_serNum": 1125, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///A/127/OG", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 1112, "atom2_serNum": 2367, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///A/127/OG", "atom2_id": "///A/286/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1136, "atom2_serNum": 2240, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/131/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1139, "atom2_serNum": 2226, "donAcc_type": "questionable", "distance": 2.916, "atom1_id": "///A/131/OD1", "atom2_id": "///A/269/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1149, "atom2_serNum": 2357, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/132/NZ", "atom2_id": "///A/285/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1149, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/132/NZ", "atom2_id": "///A/285/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1150, "atom2_serNum": 2243, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/133/N", "atom2_id": "///A/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1153, "atom2_serNum": 2256, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/133/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1169, "atom2_serNum": 2259, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/135/N", "atom2_id": "///A/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1172, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/135/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1178, "atom2_serNum": 1197, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/136/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1183, "atom2_serNum": 2283, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///A/136/NE2", "atom2_id": "///A/276/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1192, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/138/N", "atom2_id": "///A/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1211, "atom2_serNum": 1672, "donAcc_type": "acceptable", "distance": 2.395, "atom1_id": "///A/140/OG1", "atom2_id": "///A/198/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1211, "atom2_serNum": 1673, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/140/OG1", "atom2_id": "///A/198/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1213, "atom2_serNum": 1959, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/141/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1216, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/141/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1226, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/143/N", "atom2_id": "///A/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1229, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/143/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1242, "atom2_serNum": 1927, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/145/N", "atom2_id": "///A/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1245, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/145/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1282, "atom2_serNum": 1284, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///A/149/O", "atom2_id": "///A/149/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1302, "atom2_serNum": 1322, "donAcc_type": "acceptable", "distance": 2.809, "atom1_id": "///A/152/O", "atom2_id": "///A/155/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1320, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/155/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1324, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/156/N", "atom2_id": "///A/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1327, "atom2_serNum": 2143, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/156/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1333, "atom2_serNum": 1719, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/156/NH1", "atom2_id": "///A/204/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1334, "atom2_serNum": 1720, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/156/NH2", "atom2_id": "///A/204/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1335, "atom2_serNum": 1838, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/157/N", "atom2_id": "///A/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1338, "atom2_serNum": 1835, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/157/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1342, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/158/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1345, "atom2_serNum": 2128, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/158/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1349, "atom2_serNum": 1820, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///A/158/NE", "atom2_id": "///A/215/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1351, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 2.446, "atom1_id": "///A/158/NH1", "atom2_id": "///A/258/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1351, "atom2_serNum": 2151, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/158/NH1", "atom2_id": "///A/258/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1353, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/159/N", "atom2_id": "///A/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1356, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/159/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1358, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/160/N", "atom2_id": "///A/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1361, "atom2_serNum": 2112, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///A/160/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1371, "atom2_serNum": 2100, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/162/N", "atom2_id": "///A/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1374, "atom2_serNum": 2097, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/162/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1391, "atom2_serNum": 2085, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/164/N", "atom2_id": "///A/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1399, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/164/NZ", "atom2_id": "///A/271/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1403, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/165/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1403, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1407, "atom2_serNum": 1430, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///A/165/OE1", "atom2_id": "///A/168/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1415, "atom2_serNum": 1422, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/167/N", "atom2_id": "///A/167/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1427, "atom2_serNum": 1449, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/168/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1437, "atom2_serNum": 1803, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/169/O", "atom2_id": "///A/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1437, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/169/O", "atom2_id": "///A/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1456, "atom2_serNum": 2080, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/171/OE1", "atom2_id": "///A/249/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1456, "atom2_serNum": 3049, "donAcc_type": "standard", "distance": 3.800, "atom1_id": "///A/171/OE1", "atom2_id": "///B/179/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1457, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/171/OE2", "atom2_id": "///A/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1457, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/171/OE2", "atom2_id": "///B/178/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1458, "atom2_serNum": 3073, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/172/N", "atom2_id": "///B/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1468, "atom2_serNum": 1811, "donAcc_type": "acceptable", "distance": 3.748, "atom1_id": "///A/173/O", "atom2_id": "///A/214/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1481, "atom2_serNum": 3062, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/174/NH1", "atom2_id": "///B/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1482, "atom2_serNum": 1534, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///A/174/NH2", "atom2_id": "///A/180/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1483, "atom2_serNum": 1615, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/175/N", "atom2_id": "///A/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1486, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/175/O", "atom2_id": "///B/181/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1490, "atom2_serNum": 1991, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/175/NE", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1492, "atom2_serNum": 1565, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/175/NH1", "atom2_id": "///A/184/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1492, "atom2_serNum": 1608, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/175/NH1", "atom2_id": "///A/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1493, "atom2_serNum": 1565, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/175/NH2", "atom2_id": "///A/184/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1493, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 2.282, "atom1_id": "///A/175/NH2", "atom2_id": "///A/184/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1497, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1503, "atom2_serNum": 1536, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1520, "atom2_serNum": 1547, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/179/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1550, "atom2_serNum": 1559, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/182/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1562, "atom2_serNum": 1656, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/184/O", "atom2_id": "///A/196/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1572, "atom2_serNum": 1581, "donAcc_type": "acceptable", "distance": 3.161, "atom1_id": "///A/185/OG", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1573, "atom2_serNum": 1579, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/186/N", "atom2_id": "///A/186/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1579, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/186/OD1", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1579, "atom2_serNum": 1593, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/186/OD1", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1601, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/190/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1619, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 3.615, "atom1_id": "///A/192/OE1", "atom2_id": "///A/214/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1630, "atom2_serNum": 1747, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/193/NE2", "atom2_id": "///A/207/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1634, "atom2_serNum": 1988, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/194/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1647, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/196/N", "atom2_id": "///A/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1650, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/196/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1658, "atom2_serNum": 1732, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///A/197/N", "atom2_id": "///A/205/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1665, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///A/198/N", "atom2_id": "///A/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1672, "atom2_serNum": 1974, "donAcc_type": "questionable", "distance": 2.749, "atom1_id": "///A/198/OE1", "atom2_id": "///A/235/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1681, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/200/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1684, "atom2_serNum": 1694, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/200/OD1", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1704, "atom2_serNum": 1869, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///A/202/NH2", "atom2_id": "///A/221/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1712, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/204/N", "atom2_id": "///A/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1715, "atom2_serNum": 1828, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/204/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1733, "atom2_serNum": 1818, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/206/N", "atom2_id": "///A/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1736, "atom2_serNum": 1815, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/206/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1749, "atom2_serNum": 1797, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/208/N", "atom2_id": "///A/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1752, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/208/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1755, "atom2_serNum": 1768, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/208/OD1", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1755, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/208/OD1", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1766, "atom2_serNum": 1775, "donAcc_type": "questionable", "distance": 2.493, "atom1_id": "///A/209/NH1", "atom2_id": "///A/210/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1771, "atom2_serNum": 3104, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/210/O", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1864, "atom2_serNum": 1929, "donAcc_type": "acceptable", "distance": 2.492, "atom1_id": "///A/221/O", "atom2_id": "///A/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1880, "atom2_serNum": 1893, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/223/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1887, "atom2_serNum": 1904, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1891, "atom2_serNum": 1909, "donAcc_type": "acceptable", "distance": 3.233, "atom1_id": "///A/224/OE1", "atom2_id": "///A/227/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1891, "atom2_serNum": 1921, "donAcc_type": "questionable", "distance": 3.015, "atom1_id": "///A/224/OE1", "atom2_id": "///A/229/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1892, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 3.576, "atom1_id": "///A/224/OE2", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1909, "atom2_serNum": 1921, "donAcc_type": "acceptable", "distance": 3.473, "atom1_id": "///A/227/OG", "atom2_id": "///A/229/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1987, "atom2_serNum": 2110, "donAcc_type": "acceptable", "distance": 2.825, "atom1_id": "///A/236/OH", "atom2_id": "///A/253/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 2005, "atom2_serNum": 2022, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/239/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2010, "atom2_serNum": 2270, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/240/N", "atom2_id": "///A/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2013, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.309, "atom1_id": "///A/240/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2015, "atom2_serNum": 2267, "donAcc_type": "acceptable", "distance": 3.232, "atom1_id": "///A/240/OG", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2019, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/241/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2025, "atom2_serNum": 2040, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/242/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2025, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/242/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2039, "atom2_serNum": 3068, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///A/244/O", "atom2_id": "///B/181/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2043, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/245/O", "atom2_id": "///A/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2047, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/246/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2047, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///A/246/O", "atom2_id": "///A/249/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2058, "atom2_serNum": 2070, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/247/OD1", "atom2_id": "///A/248/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2092, "atom2_serNum": 2249, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/251/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2105, "atom2_serNum": 2232, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/253/N", "atom2_id": "///A/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2108, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/253/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2120, "atom2_serNum": 2218, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/255/N", "atom2_id": "///A/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2123, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/255/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2135, "atom2_serNum": 2203, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/257/N", "atom2_id": "///A/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2138, "atom2_serNum": 2192, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/257/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2138, "atom2_serNum": 2200, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/257/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2152, "atom2_serNum": 2179, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/259/N", "atom2_id": "///A/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2155, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/259/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2158, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/259/OD1", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2158, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/259/OD1", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2158, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/259/OD1", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2159, "atom2_serNum": 2183, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/259/OD2", "atom2_id": "///A/263/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2265, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 3.752, "atom1_id": "///A/273/NH1", "atom2_id": "///A/285/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2288, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/277/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2294, "atom2_serNum": 2321, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2301, "atom2_serNum": 2332, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/279/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2305, "atom2_serNum": 2343, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/280/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2305, "atom2_serNum": 2348, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///A/280/O", "atom2_id": "///A/284/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2309, "atom2_serNum": 2319, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/280/NE", "atom2_id": "///A/281/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2316, "atom2_serNum": 2350, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2324, "atom2_serNum": 2359, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/282/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2328, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/282/NE", "atom2_id": "///A/286/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2335, "atom2_serNum": 2359, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/283/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2335, "atom2_serNum": 2368, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2346, "atom2_serNum": 2368, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/284/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2346, "atom2_serNum": 2377, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/284/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2362, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/286/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2375, "atom2_serNum": 2383, "donAcc_type": "questionable", "distance": 2.894, "atom1_id": "///A/287/OE1", "atom2_id": "///A/288/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2394, "atom2_serNum": 3294, "donAcc_type": "standard", "distance": 3.869, "atom1_id": "///B/96/N", "atom2_id": "///B/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2418, "atom2_serNum": 4944, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///B/99/OG", "atom2_id": "///C/224/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2418, "atom2_serNum": 4945, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///B/99/OG", "atom2_id": "///C/224/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2431, "atom2_serNum": 3734, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/101/O", "atom2_id": "///B/267/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2431, "atom2_serNum": 3737, "donAcc_type": "standard", "distance": 2.286, "atom1_id": "///B/101/O", "atom2_id": "///B/267/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2444, "atom2_serNum": 3730, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/103/N", "atom2_id": "///B/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2447, "atom2_serNum": 3727, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/103/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2468, "atom2_serNum": 2487, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///B/105/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2472, "atom2_serNum": 2807, "donAcc_type": "acceptable", "distance": 3.914, "atom1_id": "///B/106/O", "atom2_id": "///B/149/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2478, "atom2_serNum": 2794, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///B/107/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2478, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/107/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2490, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///B/108/O", "atom2_id": "///B/110/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2490, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/108/O", "atom2_id": "///B/110/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2490, "atom2_serNum": 2776, "donAcc_type": "questionable", "distance": 3.172, "atom1_id": "///B/108/O", "atom2_id": "///B/146/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2502, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/110/N", "atom2_id": "///B/146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2505, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/110/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2521, "atom2_serNum": 2759, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/112/N", "atom2_id": "///B/144/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2524, "atom2_serNum": 2756, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/112/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2539, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/114/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2559, "atom2_serNum": 2608, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///B/116/OG", "atom2_id": "///B/124/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2563, "atom2_serNum": 2616, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///B/117/O", "atom2_id": "///B/125/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2567, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 2.276, "atom1_id": "///B/118/O", "atom2_id": "///B/283/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2574, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/119/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2574, "atom2_serNum": 2591, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/119/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2601, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/123/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2611, "atom2_serNum": 2684, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/125/N", "atom2_id": "///B/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2614, "atom2_serNum": 2681, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/125/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2629, "atom2_serNum": 2663, "donAcc_type": "acceptable", "distance": 2.269, "atom1_id": "///B/126/OH", "atom2_id": "///B/131/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2630, "atom2_serNum": 2667, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/127/N", "atom2_id": "///B/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2633, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///B/127/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2633, "atom2_serNum": 2664, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/127/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2635, "atom2_serNum": 3851, "donAcc_type": "acceptable", "distance": 2.262, "atom1_id": "///B/127/OG", "atom2_id": "///B/282/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2635, "atom2_serNum": 3890, "donAcc_type": "acceptable", "distance": 2.458, "atom1_id": "///B/127/OG", "atom2_id": "///B/286/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2659, "atom2_serNum": 3763, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/131/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2662, "atom2_serNum": 3749, "donAcc_type": "questionable", "distance": 3.309, "atom1_id": "///B/131/OD1", "atom2_id": "///B/269/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2672, "atom2_serNum": 3880, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///B/132/NZ", "atom2_id": "///B/285/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2672, "atom2_serNum": 3881, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/132/NZ", "atom2_id": "///B/285/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2673, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/133/N", "atom2_id": "///B/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2676, "atom2_serNum": 3779, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/133/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2692, "atom2_serNum": 3782, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/135/N", "atom2_id": "///B/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2695, "atom2_serNum": 3797, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/135/O", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2701, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/136/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2715, "atom2_serNum": 3502, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/138/N", "atom2_id": "///B/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2723, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/139/O", "atom2_id": "///B/235/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2734, "atom2_serNum": 3195, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///B/140/OG1", "atom2_id": "///B/198/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2736, "atom2_serNum": 3482, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/141/N", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2739, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/141/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2749, "atom2_serNum": 3464, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///B/143/N", "atom2_id": "///B/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2752, "atom2_serNum": 3461, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/143/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2763, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/144/OE1", "atom2_id": "///B/146/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2765, "atom2_serNum": 3450, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///B/145/N", "atom2_id": "///B/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2768, "atom2_serNum": 3447, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/145/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2825, "atom2_serNum": 2845, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///B/152/O", "atom2_id": "///B/155/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2832, "atom2_serNum": 3681, "donAcc_type": "questionable", "distance": 2.778, "atom1_id": "///B/153/O", "atom2_id": "///B/259/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2843, "atom2_serNum": 3372, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/155/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2845, "atom2_serNum": 3682, "donAcc_type": "acceptable", "distance": 2.464, "atom1_id": "///B/155/OG1", "atom2_id": "///B/259/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2847, "atom2_serNum": 3669, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///B/156/N", "atom2_id": "///B/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2850, "atom2_serNum": 3666, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///B/156/O", "atom2_id": "///B/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2857, "atom2_serNum": 3674, "donAcc_type": "standard", "distance": 2.268, "atom1_id": "///B/156/NH2", "atom2_id": "///B/258/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2857, "atom2_serNum": 3678, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///B/156/NH2", "atom2_id": "///B/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2858, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/157/N", "atom2_id": "///B/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2861, "atom2_serNum": 3358, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/157/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2865, "atom2_serNum": 3654, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///B/158/N", "atom2_id": "///B/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2868, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/158/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2872, "atom2_serNum": 3673, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///B/158/NE", "atom2_id": "///B/258/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2874, "atom2_serNum": 3343, "donAcc_type": "acceptable", "distance": 2.486, "atom1_id": "///B/158/NH1", "atom2_id": "///B/215/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2875, "atom2_serNum": 3674, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/158/NH2", "atom2_id": "///B/258/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2876, "atom2_serNum": 3347, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/159/N", "atom2_id": "///B/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2879, "atom2_serNum": 3344, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/159/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2881, "atom2_serNum": 3638, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///B/160/N", "atom2_id": "///B/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2884, "atom2_serNum": 3635, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/160/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2894, "atom2_serNum": 3623, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/162/N", "atom2_id": "///B/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2897, "atom2_serNum": 3620, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///B/162/O", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2914, "atom2_serNum": 3608, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///B/164/N", "atom2_id": "///B/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2926, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/165/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2941, "atom2_serNum": 2970, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///B/167/O", "atom2_id": "///B/170/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2945, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///B/167/OE1", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2950, "atom2_serNum": 2972, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/168/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2960, "atom2_serNum": 3326, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/169/O", "atom2_id": "///B/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2960, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///B/169/O", "atom2_id": "///B/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2968, "atom2_serNum": 2981, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///B/170/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2979, "atom2_serNum": 3603, "donAcc_type": "standard", "distance": 2.393, "atom1_id": "///B/171/OE1", "atom2_id": "///B/249/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2979, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/171/OE1", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2980, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///B/171/OE2", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3004, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/174/NH1", "atom2_id": "///B/180/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3006, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/175/N", "atom2_id": "///B/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3015, "atom2_serNum": 3081, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///B/175/NH1", "atom2_id": "///B/183/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3015, "atom2_serNum": 3131, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///B/175/NH1", "atom2_id": "///B/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3020, "atom2_serNum": 3050, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/176/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3026, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/177/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3033, "atom2_serNum": 3070, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/178/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3053, "atom2_serNum": 3076, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///B/180/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3081, "atom2_serNum": 3085, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///B/183/OG", "atom2_id": "///B/184/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3081, "atom2_serNum": 3180, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///B/183/OG", "atom2_id": "///B/196/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3085, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/184/O", "atom2_id": "///B/196/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3088, "atom2_serNum": 3179, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///B/184/OD1", "atom2_id": "///B/196/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3088, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/184/OD1", "atom2_id": "///B/196/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3095, "atom2_serNum": 3104, "donAcc_type": "acceptable", "distance": 3.385, "atom1_id": "///B/185/OG", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3095, "atom2_serNum": 3119, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///B/185/OG", "atom2_id": "///B/189/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3102, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/186/OD1", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3102, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/186/OD1", "atom2_id": "///B/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3135, "atom2_serNum": 3142, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/192/N", "atom2_id": "///B/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3153, "atom2_serNum": 3270, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///B/193/NE2", "atom2_id": "///B/207/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3157, "atom2_serNum": 3494, "donAcc_type": "questionable", "distance": 3.340, "atom1_id": "///B/194/O", "atom2_id": "///B/235/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3157, "atom2_serNum": 3511, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/194/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3170, "atom2_serNum": 3494, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/196/N", "atom2_id": "///B/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3173, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/196/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3181, "atom2_serNum": 3255, "donAcc_type": "acceptable", "distance": 3.321, "atom1_id": "///B/197/N", "atom2_id": "///B/205/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3188, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/198/N", "atom2_id": "///B/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3195, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/198/OE1", "atom2_id": "///B/235/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3204, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///B/200/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3204, "atom2_serNum": 3228, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/200/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3207, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/200/OD1", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3235, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/204/N", "atom2_id": "///B/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3238, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/204/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3256, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/206/N", "atom2_id": "///B/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3259, "atom2_serNum": 3338, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/206/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3267, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/207/O", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3270, "atom2_serNum": 3334, "donAcc_type": "acceptable", "distance": 2.200, "atom1_id": "///B/207/OD1", "atom2_id": "///B/214/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3271, "atom2_serNum": 3309, "donAcc_type": "questionable", "distance": 2.948, "atom1_id": "///B/207/OD2", "atom2_id": "///B/212/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3272, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/208/N", "atom2_id": "///B/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3275, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/208/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3275, "atom2_serNum": 3306, "donAcc_type": "standard", "distance": 2.388, "atom1_id": "///B/208/O", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3279, "atom2_serNum": 3304, "donAcc_type": "acceptable", "distance": 3.498, "atom1_id": "///B/208/OD2", "atom2_id": "///B/211/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3304, "atom2_serNum": 3317, "donAcc_type": "acceptable", "distance": 3.051, "atom1_id": "///B/211/OG1", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3387, "atom2_serNum": 3452, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///B/221/O", "atom2_id": "///B/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3410, "atom2_serNum": 3427, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///B/224/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3510, "atom2_serNum": 3633, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///B/236/OH", "atom2_id": "///B/253/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3528, "atom2_serNum": 3545, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/239/O", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3533, "atom2_serNum": 3793, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/240/N", "atom2_id": "///B/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3536, "atom2_serNum": 3583, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/240/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3538, "atom2_serNum": 3775, "donAcc_type": "acceptable", "distance": 3.955, "atom1_id": "///B/240/OG", "atom2_id": "///B/272/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3538, "atom2_serNum": 3790, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///B/240/OG", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3542, "atom2_serNum": 3551, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/241/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3548, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/242/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3548, "atom2_serNum": 3575, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/242/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3566, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/245/O", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3570, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/246/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3570, "atom2_serNum": 3601, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/246/O", "atom2_id": "///B/249/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3615, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/251/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3628, "atom2_serNum": 3755, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/253/N", "atom2_id": "///B/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3631, "atom2_serNum": 3752, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/253/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3643, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/255/N", "atom2_id": "///B/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3646, "atom2_serNum": 3738, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/255/O", "atom2_id": "///B/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3658, "atom2_serNum": 3726, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/257/N", "atom2_id": "///B/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3661, "atom2_serNum": 3715, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///B/257/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3661, "atom2_serNum": 3723, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///B/257/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3675, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/259/N", "atom2_id": "///B/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3678, "atom2_serNum": 3695, "donAcc_type": "standard", "distance": 2.455, "atom1_id": "///B/259/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3681, "atom2_serNum": 3683, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///B/259/OD1", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3681, "atom2_serNum": 3688, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///B/259/OD1", "atom2_id": "///B/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3694, "atom2_serNum": 3699, "donAcc_type": "acceptable", "distance": 3.425, "atom1_id": "///B/261/OG", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3741, "atom2_serNum": 3751, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///B/268/O", "atom2_id": "///B/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3788, "atom2_serNum": 3843, "donAcc_type": "standard", "distance": 2.060, "atom1_id": "///B/273/NH1", "atom2_id": "///B/281/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3811, "atom2_serNum": 3836, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///B/277/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3817, "atom2_serNum": 3844, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/278/O", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3824, "atom2_serNum": 3855, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///B/279/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3828, "atom2_serNum": 3866, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///B/280/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3828, "atom2_serNum": 3871, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///B/280/O", "atom2_id": "///B/284/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3832, "atom2_serNum": 3842, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/280/NE", "atom2_id": "///B/281/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3839, "atom2_serNum": 3873, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/281/O", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3847, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/282/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3858, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/283/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3858, "atom2_serNum": 3891, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///B/283/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3869, "atom2_serNum": 3900, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/284/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3885, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///B/286/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3899, "atom2_serNum": 3906, "donAcc_type": "questionable", "distance": 2.551, "atom1_id": "///B/287/OE2", "atom2_id": "///B/288/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3926, "atom2_serNum": 4856, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///C/96/O", "atom2_id": "///C/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3939, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 2.283, "atom1_id": "///C/98/O", "atom2_id": "///C/100/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3948, "atom2_serNum": 3958, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///C/99/OG", "atom2_id": "///C/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3952, "atom2_serNum": 5281, "donAcc_type": "acceptable", "distance": 3.984, "atom1_id": "///C/100/O", "atom2_id": "///C/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3961, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/101/O", "atom2_id": "///C/267/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3974, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///C/103/N", "atom2_id": "///C/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3977, "atom2_serNum": 5257, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///C/103/O", "atom2_id": "///C/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3989, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 3.830, "atom1_id": "///C/104/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3989, "atom2_serNum": 4021, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/104/O", "atom2_id": "///C/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3998, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///C/105/O", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 4008, "atom2_serNum": 4324, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///C/107/O", "atom2_id": "///C/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 4008, "atom2_serNum": 4332, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/107/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 4032, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/110/N", "atom2_id": "///C/146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 4035, "atom2_serNum": 4303, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///C/110/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 4042, "atom2_serNum": 4330, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/110/NH2", "atom2_id": "///C/148/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 4042, "atom2_serNum": 4331, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///C/110/NH2", "atom2_id": "///C/148/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4051, "atom2_serNum": 4289, "donAcc_type": "standard", "distance": 2.368, "atom1_id": "///C/112/N", "atom2_id": "///C/144/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4054, "atom2_serNum": 4286, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/112/O", "atom2_id": "///C/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 4087, "atom2_serNum": 5383, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///C/116/O", "atom2_id": "///C/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4089, "atom2_serNum": 4138, "donAcc_type": "acceptable", "distance": 3.835, "atom1_id": "///C/116/OG", "atom2_id": "///C/124/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4104, "atom2_serNum": 4121, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/119/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4124, "atom2_serNum": 5351, "donAcc_type": "standard", "distance": 3.832, "atom1_id": "///C/122/O", "atom2_id": "///C/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4131, "atom2_serNum": 4228, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///C/123/O", "atom2_id": "///C/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4133, "atom2_serNum": 4258, "donAcc_type": "acceptable", "distance": 3.620, "atom1_id": "///C/123/OG1", "atom2_id": "///C/139/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4141, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///C/125/N", "atom2_id": "///C/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4144, "atom2_serNum": 4211, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///C/125/O", "atom2_id": "///C/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4146, "atom2_serNum": 5383, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///C/125/OG1", "atom2_id": "///C/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4159, "atom2_serNum": 4193, "donAcc_type": "acceptable", "distance": 2.263, "atom1_id": "///C/126/OH", "atom2_id": "///C/131/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4160, "atom2_serNum": 4197, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///C/127/N", "atom2_id": "///C/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4163, "atom2_serNum": 4165, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///C/127/O", "atom2_id": "///C/127/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4163, "atom2_serNum": 4186, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///C/127/O", "atom2_id": "///C/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4163, "atom2_serNum": 4194, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///C/127/O", "atom2_id": "///C/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4165, "atom2_serNum": 4178, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///C/127/OG", "atom2_id": "///C/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4189, "atom2_serNum": 5293, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///C/131/O", "atom2_id": "///C/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4203, "atom2_serNum": 5296, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///C/133/N", "atom2_id": "///C/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4206, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/133/O", "atom2_id": "///C/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4222, "atom2_serNum": 5312, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///C/135/N", "atom2_id": "///C/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4225, "atom2_serNum": 5327, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/135/O", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4231, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///C/136/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4235, "atom2_serNum": 5338, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///C/136/OE1", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4236, "atom2_serNum": 4258, "donAcc_type": "questionable", "distance": 3.244, "atom1_id": "///C/136/NE2", "atom2_id": "///C/139/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4245, "atom2_serNum": 5032, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/138/N", "atom2_id": "///C/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4253, "atom2_serNum": 5028, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///C/139/O", "atom2_id": "///C/235/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4264, "atom2_serNum": 4726, "donAcc_type": "acceptable", "distance": 2.056, "atom1_id": "///C/140/OG1", "atom2_id": "///C/198/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4266, "atom2_serNum": 5012, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///C/141/N", "atom2_id": "///C/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4269, "atom2_serNum": 4994, "donAcc_type": "questionable", "distance": 3.218, "atom1_id": "///C/141/O", "atom2_id": "///C/232/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4269, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.373, "atom1_id": "///C/141/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4279, "atom2_serNum": 4994, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///C/143/N", "atom2_id": "///C/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4282, "atom2_serNum": 4991, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/143/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4295, "atom2_serNum": 4980, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///C/145/N", "atom2_id": "///C/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4298, "atom2_serNum": 4977, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///C/145/O", "atom2_id": "///C/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4311, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/146/NE1", "atom2_id": "///C/228/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4335, "atom2_serNum": 4345, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///C/149/O", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4355, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/152/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4355, "atom2_serNum": 4375, "donAcc_type": "acceptable", "distance": 2.790, "atom1_id": "///C/152/O", "atom2_id": "///C/155/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4369, "atom2_serNum": 5218, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///C/154/O", "atom2_id": "///C/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4373, "atom2_serNum": 4902, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///C/155/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4377, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/156/N", "atom2_id": "///C/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4380, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/156/O", "atom2_id": "///C/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4386, "atom2_serNum": 4772, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/156/NH1", "atom2_id": "///C/204/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4388, "atom2_serNum": 4891, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/157/N", "atom2_id": "///C/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4391, "atom2_serNum": 4888, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/157/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4395, "atom2_serNum": 5184, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/158/N", "atom2_id": "///C/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4398, "atom2_serNum": 5181, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/158/O", "atom2_id": "///C/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4406, "atom2_serNum": 4877, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/159/N", "atom2_id": "///C/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4409, "atom2_serNum": 4874, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/159/O", "atom2_id": "///C/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4411, "atom2_serNum": 5168, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/160/N", "atom2_id": "///C/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4414, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/160/O", "atom2_id": "///C/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4424, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/162/N", "atom2_id": "///C/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4427, "atom2_serNum": 5150, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/162/O", "atom2_id": "///C/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4444, "atom2_serNum": 5138, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/164/N", "atom2_id": "///C/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4452, "atom2_serNum": 5300, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///C/164/NZ", "atom2_id": "///C/271/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4456, "atom2_serNum": 4477, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/165/O", "atom2_id": "///C/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4456, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4465, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/166/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4480, "atom2_serNum": 4502, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///C/168/O", "atom2_id": "///C/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4490, "atom2_serNum": 4856, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///C/169/O", "atom2_id": "///C/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4490, "atom2_serNum": 4857, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///C/169/O", "atom2_id": "///C/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4509, "atom2_serNum": 5134, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///C/171/OE1", "atom2_id": "///C/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4510, "atom2_serNum": 5134, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/171/OE2", "atom2_id": "///C/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4521, "atom2_serNum": 4864, "donAcc_type": "acceptable", "distance": 3.898, "atom1_id": "///C/173/O", "atom2_id": "///C/214/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4535, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/174/NH2", "atom2_id": "///C/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4536, "atom2_serNum": 4668, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/175/N", "atom2_id": "///C/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4543, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///C/175/NE", "atom2_id": "///C/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4545, "atom2_serNum": 4609, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/175/NH1", "atom2_id": "///C/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4545, "atom2_serNum": 4661, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/175/NH1", "atom2_id": "///C/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4546, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/175/NH2", "atom2_id": "///C/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4550, "atom2_serNum": 4580, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/176/O", "atom2_id": "///C/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4563, "atom2_serNum": 4589, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/178/O", "atom2_id": "///C/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4573, "atom2_serNum": 4606, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///C/179/O", "atom2_id": "///C/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4603, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///C/182/O", "atom2_id": "///C/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4603, "atom2_serNum": 4618, "donAcc_type": "questionable", "distance": 2.702, "atom1_id": "///C/182/O", "atom2_id": "///C/184/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4612, "atom2_serNum": 4618, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///C/184/N", "atom2_id": "///C/184/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4629, "atom2_serNum": 4638, "donAcc_type": "standard", "distance": 2.164, "atom1_id": "///C/186/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4629, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///C/186/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4632, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///C/186/OD1", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4633, "atom2_serNum": 4707, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///C/186/OD2", "atom2_id": "///C/196/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4633, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 2.347, "atom1_id": "///C/186/OD2", "atom2_id": "///C/196/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4654, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///C/190/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4672, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/192/OE1", "atom2_id": "///C/214/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4683, "atom2_serNum": 4801, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///C/193/NE2", "atom2_id": "///C/207/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4687, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///C/194/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4700, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/196/N", "atom2_id": "///C/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4703, "atom2_serNum": 5021, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///C/196/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4710, "atom2_serNum": 5027, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///C/196/NH2", "atom2_id": "///C/235/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4711, "atom2_serNum": 4785, "donAcc_type": "acceptable", "distance": 3.591, "atom1_id": "///C/197/N", "atom2_id": "///C/205/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4718, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/198/N", "atom2_id": "///C/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4726, "atom2_serNum": 5028, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///C/198/OE2", "atom2_id": "///C/235/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4734, "atom2_serNum": 4758, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/200/O", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4737, "atom2_serNum": 4739, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/200/OD1", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4737, "atom2_serNum": 4747, "donAcc_type": "standard", "distance": 2.462, "atom1_id": "///C/200/OD1", "atom2_id": "///C/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4756, "atom2_serNum": 4922, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/202/NH1", "atom2_id": "///C/221/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4765, "atom2_serNum": 4884, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///C/204/N", "atom2_id": "///C/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4768, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///C/204/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4773, "atom2_serNum": 4777, "donAcc_type": "questionable", "distance": 3.355, "atom1_id": "///C/204/OE2", "atom2_id": "///C/205/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4786, "atom2_serNum": 4871, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///C/206/N", "atom2_id": "///C/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4802, "atom2_serNum": 4850, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///C/208/N", "atom2_id": "///C/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4805, "atom2_serNum": 4836, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///C/208/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4808, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///C/208/OD1", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4917, "atom2_serNum": 4982, "donAcc_type": "acceptable", "distance": 2.237, "atom1_id": "///C/221/O", "atom2_id": "///C/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4940, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 2.312, "atom1_id": "///C/224/O", "atom2_id": "///C/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4940, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 2.106, "atom1_id": "///C/224/O", "atom2_id": "///C/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4940, "atom2_serNum": 4962, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///C/224/O", "atom2_id": "///C/227/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 5040, "atom2_serNum": 5163, "donAcc_type": "acceptable", "distance": 3.211, "atom1_id": "///C/236/OH", "atom2_id": "///C/253/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 5058, "atom2_serNum": 5075, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/239/O", "atom2_id": "///C/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 5062, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.688, "atom1_id": "///C/239/ND2", "atom2_id": "///C/275/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 5063, "atom2_serNum": 5323, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/240/N", "atom2_id": "///C/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 5066, "atom2_serNum": 5113, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///C/240/O", "atom2_id": "///C/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 5068, "atom2_serNum": 5127, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///C/240/OG", "atom2_id": "///C/249/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 5072, "atom2_serNum": 5081, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/241/O", "atom2_id": "///C/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 5078, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///C/242/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 5078, "atom2_serNum": 5105, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///C/242/O", "atom2_id": "///C/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 5096, "atom2_serNum": 5133, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///C/245/O", "atom2_id": "///C/249/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 5100, "atom2_serNum": 5124, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/246/O", "atom2_id": "///C/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 5145, "atom2_serNum": 5302, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/251/O", "atom2_id": "///C/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 5158, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///C/253/N", "atom2_id": "///C/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 5161, "atom2_serNum": 5282, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/253/O", "atom2_id": "///C/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 5173, "atom2_serNum": 5271, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/255/N", "atom2_id": "///C/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 5176, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/255/O", "atom2_id": "///C/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 5186, "atom2_serNum": 5203, "donAcc_type": "acceptable", "distance": 3.349, "atom1_id": "///C/256/OG1", "atom2_id": "///C/258/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 5188, "atom2_serNum": 5256, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///C/257/N", "atom2_id": "///C/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5191, "atom2_serNum": 5245, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///C/257/O", "atom2_id": "///C/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5191, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/257/O", "atom2_id": "///C/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5205, "atom2_serNum": 5232, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///C/259/N", "atom2_id": "///C/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5208, "atom2_serNum": 5225, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///C/259/O", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5211, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///C/259/OD1", "atom2_id": "///C/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 5211, "atom2_serNum": 5225, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///C/259/OD1", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5211, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///C/259/OD1", "atom2_id": "///C/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 5212, "atom2_serNum": 5235, "donAcc_type": "questionable", "distance": 3.168, "atom1_id": "///C/259/OD2", "atom2_id": "///C/263/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 5316, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///C/273/NE", "atom2_id": "///C/281/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 5318, "atom2_serNum": 5410, "donAcc_type": "standard", "distance": 2.290, "atom1_id": "///C/273/NH1", "atom2_id": "///C/285/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5347, "atom2_serNum": 5366, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/278/O", "atom2_id": "///C/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5347, "atom2_serNum": 5374, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///C/278/O", "atom2_id": "///C/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5354, "atom2_serNum": 5385, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/279/O", "atom2_id": "///C/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5358, "atom2_serNum": 5394, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///C/280/O", "atom2_id": "///C/283/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5358, "atom2_serNum": 5396, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/280/O", "atom2_id": "///C/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5364, "atom2_serNum": 5395, "donAcc_type": "questionable", "distance": 3.303, "atom1_id": "///C/280/NH1", "atom2_id": "///C/283/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5369, "atom2_serNum": 5403, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///C/281/O", "atom2_id": "///C/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5377, "atom2_serNum": 5412, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///C/282/O", "atom2_id": "///C/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5381, "atom2_serNum": 5419, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///C/282/NE", "atom2_id": "///C/286/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5388, "atom2_serNum": 5428, "donAcc_type": "questionable", "distance": 2.589, "atom1_id": "///C/283/O", "atom2_id": "///C/287/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5394, "atom2_serNum": 5401, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///C/283/NH1", "atom2_id": "///C/284/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5399, "atom2_serNum": 5421, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///C/284/O", "atom2_id": "///C/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5399, "atom2_serNum": 5430, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///C/284/O", "atom2_id": "///C/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1tup", "num_aaChains": 3, "aaChains": "A=196,B=194,C=195", "num_naChains": 2, "naChains": "E=21,F=21", "num_atoms": 5828, "num_waters": 384, "num_metals": 3, "metals_desc": "Zn=3", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }