{ "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///A/257", "nt2": "///A/299", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.458, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.384, "chi2": -138.405, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.789, "C1C1_dist": 10.625, "N1N9_dist": 8.896, "C6C8_dist": 9.758, "CNNC_torsion": -7.546, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 22.605, "planarity": 0.284, "simple_Shear": -0.308, "simple_Stretch": -0.115, "simple_Buckle": -19.747, "simple_Propeller": -11.002, "bp_simpleParams": [ -0.308, -0.115, 0.057, -19.747, -11.002, -2.217 ], "bp_params": [ -0.306, -0.120, 0.057, -19.578, -11.301, -2.196 ], "frame": { "rmsd": null, "origin": [ -47.321, 25.673, -48.464 ], "x_axis": [ -0.716, -0.568, -0.406 ], "y_axis": [ 0.514, -0.822, 0.244 ], "z_axis": [ -0.473, -0.034, 0.881 ], "quaternion": [ -0.293, -0.238, 0.057, 0.924 ] } }, { "index": 2, "nt1": "///A/258", "nt2": "///A/298", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -134.622, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.080, "chi2": -164.689, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.702, "C1C1_dist": 10.257, "N1N9_dist": 8.691, "C6C8_dist": 9.746, "CNNC_torsion": -4.188, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.71]", "interBase_angle": 12.128, "planarity": 0.165, "simple_Shear": 0.185, "simple_Stretch": -0.216, "simple_Buckle": 0.070, "simple_Propeller": -12.128, "bp_simpleParams": [ 0.185, -0.216, -0.399, 0.070, -12.128, 4.779 ], "bp_params": [ 0.180, -0.221, -0.399, -0.231, -12.126, 4.806 ], "frame": { "rmsd": null, "origin": [ -50.618, 25.031, -46.362 ], "x_axis": [ -0.352, -0.925, -0.139 ], "y_axis": [ 0.752, -0.369, 0.547 ], "z_axis": [ -0.558, 0.088, 0.825 ], "quaternion": [ 0.526, 0.218, -0.199, -0.798 ] } }, { "index": 3, "nt1": "///A/259", "nt2": "///A/297", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.801, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.338, "chi2": -151.041, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.007, "C1C1_dist": 10.717, "N1N9_dist": 9.014, "C6C8_dist": 9.910, "CNNC_torsion": 3.066, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 13.983, "planarity": 0.182, "simple_Shear": 0.275, "simple_Stretch": -0.037, "simple_Buckle": -13.863, "simple_Propeller": -1.829, "bp_simpleParams": [ 0.275, -0.037, -0.070, -13.863, -1.829, -1.249 ], "bp_params": [ 0.274, -0.046, -0.070, -13.917, -1.362, -1.240 ], "frame": { "rmsd": null, "origin": [ -54.224, 24.558, -44.710 ], "x_axis": [ 0.283, -0.910, -0.304 ], "y_axis": [ 0.810, 0.057, 0.584 ], "z_axis": [ -0.514, -0.411, 0.753 ], "quaternion": [ 0.723, 0.344, -0.073, -0.594 ] } }, { "index": 4, "nt1": "///A/260", "nt2": "///A/296", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -145.526, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.170, "chi2": -146.935, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.577, "C1C1_dist": 10.766, "N1N9_dist": 9.014, "C6C8_dist": 9.879, "CNNC_torsion": -9.871, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 18.851, "planarity": 0.228, "simple_Shear": 0.590, "simple_Stretch": -0.079, "simple_Buckle": -10.154, "simple_Propeller": -15.883, "bp_simpleParams": [ 0.590, -0.079, 0.140, -10.154, -15.883, -2.682 ], "bp_params": [ 0.583, -0.120, 0.140, -11.216, -15.151, -2.693 ], "frame": { "rmsd": null, "origin": [ -56.827, 23.441, -42.216 ], "x_axis": [ 0.767, -0.635, 0.086 ], "y_axis": [ 0.446, 0.625, 0.641 ], "z_axis": [ -0.461, -0.453, 0.763 ], "quaternion": [ 0.888, 0.308, -0.154, -0.304 ] } }, { "index": 5, "nt1": "///A/261", "nt2": "///A/295", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.161, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.796, "chi2": -158.041, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.262, "C1C1_dist": 10.353, "N1N9_dist": 8.753, "C6C8_dist": 9.781, "CNNC_torsion": 0.270, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 5.415, "planarity": 0.063, "simple_Shear": -0.175, "simple_Stretch": -0.173, "simple_Buckle": -2.809, "simple_Propeller": -4.630, "bp_simpleParams": [ -0.175, -0.173, 0.071, -2.809, -4.630, 2.739 ], "bp_params": [ -0.171, -0.177, 0.071, -2.702, -4.693, 2.741 ], "frame": { "rmsd": null, "origin": [ -56.723, 20.088, -40.763 ], "x_axis": [ 0.935, -0.237, 0.266 ], "y_axis": [ 0.037, 0.807, 0.589 ], "z_axis": [ -0.354, -0.540, 0.763 ], "quaternion": [ 0.936, 0.302, -0.165, -0.073 ] } }, { "index": 6, "nt1": "///A/263", "nt2": "///A/294", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.515, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 52.287, "chi2": -142.832, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.956, "C1C1_dist": 10.431, "N1N9_dist": 8.772, "C6C8_dist": 9.731, "CNNC_torsion": -12.408, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 22.960, "planarity": 0.296, "simple_Shear": -0.638, "simple_Stretch": -0.268, "simple_Buckle": 0.556, "simple_Propeller": -22.953, "bp_simpleParams": [ -0.638, -0.268, -0.003, 0.556, -22.953, 2.208 ], "bp_params": [ -0.621, -0.306, -0.003, 1.940, -22.878, 2.252 ], "frame": { "rmsd": null, "origin": [ -58.860, 16.878, -39.897 ], "x_axis": [ 0.897, 0.297, 0.328 ], "y_axis": [ -0.425, 0.787, 0.447 ], "z_axis": [ -0.126, -0.540, 0.832 ], "quaternion": [ 0.938, 0.263, -0.121, 0.192 ] } }, { "index": 7, "nt1": "///A/264", "nt2": "///A/293", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.320, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.345, "chi2": -154.153, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.506, "C1C1_dist": 10.674, "N1N9_dist": 8.982, "C6C8_dist": 9.916, "CNNC_torsion": -3.867, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 14.602, "planarity": 0.193, "simple_Shear": 0.434, "simple_Stretch": -0.102, "simple_Buckle": -1.604, "simple_Propeller": -14.514, "bp_simpleParams": [ 0.434, -0.102, -0.312, -1.604, -14.514, 1.293 ], "bp_params": [ 0.429, -0.123, -0.312, -2.316, -14.418, 1.303 ], "frame": { "rmsd": null, "origin": [ -58.354, 13.830, -37.440 ], "x_axis": [ 0.500, 0.809, 0.310 ], "y_axis": [ -0.866, 0.474, 0.160 ], "z_axis": [ -0.017, -0.349, 0.937 ], "quaternion": [ 0.853, 0.149, -0.096, 0.491 ] } }, { "index": 8, "nt1": "///A/265", "nt2": "///A/292", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -128.919, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.449, "chi2": 177.245, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.206, "C1C1_dist": 10.763, "N1N9_dist": 9.006, "C6C8_dist": 9.877, "CNNC_torsion": 15.874, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 12.836, "planarity": 0.180, "simple_Shear": 0.128, "simple_Stretch": -0.148, "simple_Buckle": -2.324, "simple_Propeller": 12.624, "bp_simpleParams": [ 0.128, -0.148, -0.348, -2.324, 12.624, -2.850 ], "bp_params": [ 0.127, -0.149, -0.348, -2.222, 12.643, -2.867 ], "frame": { "rmsd": null, "origin": [ -56.333, 11.662, -34.453 ], "x_axis": [ -0.127, 0.892, 0.434 ], "y_axis": [ -0.992, -0.117, -0.050 ], "z_axis": [ 0.006, -0.437, 0.900 ], "quaternion": [ 0.643, 0.150, -0.166, 0.732 ] } }, { "index": 9, "nt1": "///A/266", "nt2": "///A/292", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -134.877, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.743, "chi2": 177.245, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.817, "C1C1_dist": 9.916, "N1N9_dist": 8.551, "C6C8_dist": 9.691, "CNNC_torsion": 6.237, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.19],N3-N1(imino)[3.27],N4(amino)-O6(carbonyl)[3.57]", "interBase_angle": 34.908, "planarity": 0.644, "simple_Shear": 0.702, "simple_Stretch": 0.102, "simple_Buckle": 30.752, "simple_Propeller": 16.519, "bp_simpleParams": [ 0.702, 0.102, 0.897, 30.752, 16.519, 14.847 ], "bp_params": [ 0.708, 0.043, 0.897, 32.136, 13.632, 14.382 ], "frame": { "rmsd": null, "origin": [ -56.398, 11.665, -33.774 ], "x_axis": [ -0.290, 0.863, 0.415 ], "y_axis": [ -0.918, -0.374, 0.135 ], "z_axis": [ 0.271, -0.341, 0.900 ], "quaternion": [ 0.556, 0.214, -0.064, 0.801 ] } }, { "index": 10, "nt1": "///A/267", "nt2": "///A/268", "bp": "C+G", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -133.531, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 158.098, "chi2": -125.798, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 27.536, "C1C1_dist": 5.860, "N1N9_dist": 5.959, "C6C8_dist": 5.722, "CNNC_torsion": 56.139, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N7[2.96],O2(carbonyl)*O6(carbonyl)[3.21]", "interBase_angle": 60.512, "planarity": 0.666, "simple_Shear": -0.055, "simple_Stretch": 7.443, "simple_Buckle": -44.401, "simple_Propeller": -41.113, "bp_simpleParams": [ -0.055, 7.443, 1.424, -44.401, -41.113, 21.579 ], "bp_params": [ 7.360, -1.110, 1.424, -33.454, 50.424, 22.991 ], "frame": { "rmsd": null, "origin": [ -60.993, 13.343, -25.561 ], "x_axis": [ -0.889, -0.272, -0.368 ], "y_axis": [ 0.335, -0.935, -0.118 ], "z_axis": [ -0.311, -0.229, 0.922 ], "quaternion": [ -0.157, -0.175, -0.090, 0.968 ] } }, { "index": 11, "nt1": "///A/267", "nt2": "///A/269", "bp": "C+A", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -133.531, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 142.693, "chi2": -135.367, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.281, "C1C1_dist": 7.976, "N1N9_dist": 7.858, "C6C8_dist": 8.308, "CNNC_torsion": 41.607, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N7[3.78],O2(carbonyl)-N6(amino)[2.88]", "interBase_angle": 50.814, "planarity": 0.564, "simple_Shear": 0.434, "simple_Stretch": 6.473, "simple_Buckle": -30.909, "simple_Propeller": -40.332, "bp_simpleParams": [ 0.434, 6.473, -0.100, -30.909, -40.332, -17.587 ], "bp_params": [ 6.186, -1.955, -0.100, -32.224, 39.289, -18.017 ], "frame": { "rmsd": null, "origin": [ -62.098, 13.428, -24.359 ], "x_axis": [ -0.675, -0.505, -0.538 ], "y_axis": [ 0.526, -0.841, 0.130 ], "z_axis": [ -0.518, -0.195, 0.833 ], "quaternion": [ -0.282, -0.289, -0.018, 0.915 ] } }, { "index": 12, "nt1": "///A/268", "nt2": "///A/288", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -125.798, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.126, "chi2": -157.081, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.802, "C1C1_dist": 10.604, "N1N9_dist": 8.895, "C6C8_dist": 9.788, "CNNC_torsion": -7.494, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 16.656, "planarity": 0.231, "simple_Shear": -0.423, "simple_Stretch": -0.171, "simple_Buckle": 11.700, "simple_Propeller": -11.855, "bp_simpleParams": [ -0.423, -0.171, 0.209, 11.700, -11.855, -1.316 ], "bp_params": [ -0.415, -0.189, 0.209, 12.201, -11.339, -1.315 ], "frame": { "rmsd": null, "origin": [ -57.501, 13.866, -25.042 ], "x_axis": [ -0.991, -0.114, -0.069 ], "y_axis": [ 0.109, -0.992, 0.070 ], "z_axis": [ -0.076, 0.062, 0.995 ], "quaternion": [ -0.056, -0.036, 0.033, 0.997 ] } }, { "index": 13, "nt1": "///A/269", "nt2": "///A/287", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -135.367, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.479, "chi2": -150.633, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.108, "C1C1_dist": 10.354, "N1N9_dist": 8.686, "C6C8_dist": 9.646, "CNNC_torsion": -21.843, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.73]", "interBase_angle": 34.013, "planarity": 0.420, "simple_Shear": 0.610, "simple_Stretch": -0.230, "simple_Buckle": 15.415, "simple_Propeller": -30.319, "bp_simpleParams": [ 0.610, -0.230, -0.209, 15.415, -30.319, 2.289 ], "bp_params": [ 0.597, -0.261, -0.209, 13.616, -31.168, 2.361 ], "frame": { "rmsd": null, "origin": [ -59.311, 14.244, -22.272 ], "x_axis": [ -0.647, -0.635, -0.423 ], "y_axis": [ 0.560, -0.772, 0.301 ], "z_axis": [ -0.518, -0.042, 0.855 ], "quaternion": [ -0.330, -0.260, 0.072, 0.905 ] } }, { "index": 14, "nt1": "///A/270", "nt2": "///A/286", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.600, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.996, "chi2": 178.605, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.266, "C1C1_dist": 10.727, "N1N9_dist": 8.984, "C6C8_dist": 9.858, "CNNC_torsion": -1.227, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 7.890, "planarity": 0.113, "simple_Shear": 0.318, "simple_Stretch": -0.164, "simple_Buckle": -2.202, "simple_Propeller": -7.576, "bp_simpleParams": [ 0.318, -0.164, 0.381, -2.202, -7.576, -2.573 ], "bp_params": [ 0.313, -0.173, 0.381, -2.410, -7.513, -2.578 ], "frame": { "rmsd": null, "origin": [ -62.454, 14.785, -19.324 ], "x_axis": [ -0.170, -0.943, -0.285 ], "y_axis": [ 0.878, -0.277, 0.390 ], "z_axis": [ -0.447, -0.184, 0.875 ], "quaternion": [ 0.598, 0.240, -0.068, -0.762 ] } }, { "index": 15, "nt1": "///A/271", "nt2": "///A/285", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -158.326, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.443, "chi2": 49.111, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 26.536, "C1C1_dist": 10.297, "N1N9_dist": 8.795, "C6C8_dist": 10.096, "CNNC_torsion": 142.406, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.69]", "interBase_angle": 33.910, "planarity": 0.453, "simple_Shear": 2.950, "simple_Stretch": 1.516, "simple_Buckle": 11.608, "simple_Propeller": -31.861, "bp_simpleParams": [ 2.950, 1.516, 0.652, 11.608, -31.861, -131.667 ], "bp_params": [ 0.498, -3.279, 0.652, -33.904, -0.609, -129.738 ], "frame": { "rmsd": null, "origin": [ -66.304, 14.022, -17.520 ], "x_axis": [ 0.866, -0.297, 0.401 ], "y_axis": [ -0.071, 0.722, 0.689 ], "z_axis": [ -0.494, -0.625, 0.604 ], "quaternion": [ 0.893, 0.368, -0.251, -0.063 ] } } ], "num_multiplets": 2, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "CGC", "nts_long": "///A/267,///A/268,///A/288", "planarity": 0.569 }, { "index": 2, "num_nts": 3, "nts_short": "CAU", "nts_long": "///A/267,///A/269,///A/287", "planarity": 0.467 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GAGGUGGCGACU", "strand2": "CUCCACCGCUGG", "bp_type": "|||||||||||.", "helix_form": "....x..x...", "helical_rise": 3.424, "helical_rise_std": 1.223, "helical_radius": 10.329, "helical_radius_std": 2.606, "helical_axis": [ -0.410, -0.552, 0.726 ], "point1": [ -49.532, 28.476, -49.682 ], "point2": [ -64.997, 7.648, -22.269 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/257", "nt2": "///A/299", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.120, 0.057, -19.578, -11.301, -2.196 ], "step_params": [ 1.658, -0.897, 3.486, 8.917, -1.860, 33.478 ], "heli_params": [ -1.181, -1.223, 3.831, -3.156, -15.134, 34.661 ], "bp2_params": [ 0.180, -0.221, -0.399, -0.231, -12.126, 4.806 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.486, "simple_Twist": 31.250, "simple_hRise": 3.846, "simple_hTwist": 32.519 }, { "index": 2, "nt1": "///A/258", "nt2": "///A/298", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.221, -0.399, -0.231, -12.126, 4.806 ], "step_params": [ 0.224, -2.046, 3.423, -4.369, 28.992, 25.342 ], "heli_params": [ -5.894, -0.760, 0.736, 49.461, 7.453, 38.572 ], "bp2_params": [ 0.274, -0.046, -0.070, -13.917, -1.362, -1.240 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.423, "simple_Twist": 24.906, "simple_hRise": 0.701, "simple_hTwist": 38.293 }, { "index": 3, "nt1": "///A/259", "nt2": "///A/297", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.274, -0.046, -0.070, -13.917, -1.362, -1.240 ], "step_params": [ -0.807, -0.560, 3.644, -1.499, 3.598, 39.585 ], "heli_params": [ -1.287, 0.993, 3.609, 5.297, 2.207, 39.769 ], "bp2_params": [ 0.583, -0.120, 0.140, -11.216, -15.151, -2.693 ], "groove_widths": [ 19.436, null, 20.284, null ], "simple_Rise": 3.644, "simple_Twist": 37.592, "simple_hRise": 3.606, "simple_hTwist": 37.786 }, { "index": 4, "nt1": "///A/260", "nt2": "///A/296", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.120, 0.140, -11.216, -15.151, -2.693 ], "step_params": [ 1.847, -1.566, 2.739, 2.137, 7.634, 25.997 ], "heli_params": [ -4.858, -3.506, 2.334, 16.488, -4.615, 27.159 ], "bp2_params": [ -0.171, -0.177, 0.071, -2.702, -4.693, 2.741 ], "groove_widths": [ 18.843, 16.375, 21.208, 18.991 ], "simple_Rise": 2.739, "simple_Twist": 30.127, "simple_hRise": 2.402, "simple_hTwist": 31.129 }, { "index": 5, "nt1": "///A/261", "nt2": "///A/295", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.177, 0.071, -2.702, -4.693, 2.741 ], "step_params": [ -1.868, -1.838, 2.958, 0.487, 13.670, 28.186 ], "heli_params": [ -5.421, 3.537, 1.857, 26.206, -0.933, 31.269 ], "bp2_params": [ -0.621, -0.306, -0.003, 1.940, -22.878, 2.252 ], "groove_widths": [ 16.917, 14.998, 17.608, 11.677 ], "simple_Rise": 2.958, "simple_Twist": 31.044, "simple_hRise": 1.969, "simple_hTwist": 33.856 }, { "index": 6, "nt1": "///A/263", "nt2": "///A/294", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.621, -0.306, -0.003, 1.940, -22.878, 2.252 ], "step_params": [ -0.534, -1.709, 3.517, -4.998, 13.074, 35.565 ], "heli_params": [ -4.270, 0.184, 2.789, 20.454, 7.819, 38.137 ], "bp2_params": [ 0.429, -0.123, -0.312, -2.316, -14.418, 1.303 ], "groove_widths": [ 20.099, 14.576, 19.421, 17.182 ], "simple_Rise": 3.517, "simple_Twist": 29.654, "simple_hRise": 2.607, "simple_hTwist": 32.724 }, { "index": 7, "nt1": "///A/264", "nt2": "///A/293", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.429, -0.123, -0.312, -2.316, -14.418, 1.303 ], "step_params": [ -0.402, -2.162, 3.588, 2.394, -5.099, 37.240 ], "heli_params": [ -2.597, 0.976, 3.809, -7.929, -3.723, 37.648 ], "bp2_params": [ 0.127, -0.149, -0.348, -2.222, 12.643, -2.867 ], "groove_widths": [ 23.097, 14.940, 11.728, 11.549 ], "simple_Rise": 3.588, "simple_Twist": 38.763, "simple_hRise": 3.801, "simple_hTwist": 39.154 }, { "index": 8, "nt1": "///A/265", "nt2": "///A/292", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.149, -0.348, -2.222, 12.643, -2.867 ], "step_params": [ 3.122, -2.624, 8.840, 20.251, 21.828, 90.037 ], "heli_params": [ -2.903, -1.111, 8.612, 15.100, -14.010, 93.820 ], "bp2_params": [ -0.415, -0.189, 0.209, 12.201, -11.339, -1.315 ], "groove_widths": [ 23.528, 15.464, 11.625, 11.019 ], "simple_Rise": 8.840, "simple_Twist": 93.477, "simple_hRise": 8.639, "simple_hTwist": 97.046 }, { "index": 9, "nt1": "///A/268", "nt2": "///A/288", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.415, -0.189, 0.209, 12.201, -11.339, -1.315 ], "step_params": [ 0.669, -0.664, 3.195, 5.133, 26.981, 32.628 ], "heli_params": [ -3.491, -0.435, 2.149, 40.299, -7.667, 42.407 ], "bp2_params": [ 0.597, -0.261, -0.209, 13.616, -31.168, 2.361 ], "groove_widths": [ 24.899, null, 15.010, null ], "simple_Rise": 3.195, "simple_Twist": 27.596, "simple_hRise": 1.931, "simple_hTwist": 38.745 }, { "index": 10, "nt1": "///A/269", "nt2": "///A/287", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.597, -0.261, -0.209, 13.616, -31.168, 2.361 ], "step_params": [ -0.112, -1.646, 4.018, -7.969, 4.568, 33.747 ], "heli_params": [ -3.570, -1.261, 3.700, 7.693, 13.421, 34.939 ], "bp2_params": [ 0.313, -0.173, 0.381, -2.410, -7.513, -2.578 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.018, "simple_Twist": 34.254, "simple_hRise": 3.707, "simple_hTwist": 35.429 }, { "index": 11, "nt1": "///A/270", "nt2": "///A/286", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.313, -0.173, 0.381, -2.410, -7.513, -2.578 ], "step_params": [ -1.746, -1.675, 3.578, 22.235, 20.364, 89.225 ], "heli_params": [ -1.540, 1.624, 2.843, 14.172, -15.475, 93.155 ], "bp2_params": [ 0.498, -3.279, 0.652, -33.904, -0.609, -129.738 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.578, "simple_Twist": 6.752, "simple_hRise": -1.568, "simple_hTwist": 30.881 }, { "index": 12, "nt1": "///A/271", "nt2": "///A/285", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GAGGU", "strand2": "CUCCA", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.890, "helical_rise_std": 0.313, "helical_radius": 10.010, "helical_radius_std": 1.495, "helical_axis": [ -0.242, -0.309, 0.919 ], "point1": [ -50.918, 23.693, -50.951 ], "point2": [ -53.722, 20.114, -40.318 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/257", "nt2": "///A/299", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.120, 0.057, -19.578, -11.301, -2.196 ], "step_params": [ 1.658, -0.897, 3.486, 8.917, -1.860, 33.478 ], "heli_params": [ -1.181, -1.223, 3.831, -3.156, -15.134, 34.661 ], "bp2_params": [ 0.180, -0.221, -0.399, -0.231, -12.126, 4.806 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.486, "simple_Twist": 31.250, "simple_hRise": 3.846, "simple_hTwist": 32.519 }, { "index": 2, "nt1": "///A/258", "nt2": "///A/298", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.221, -0.399, -0.231, -12.126, 4.806 ], "step_params": [ 0.224, -2.046, 3.423, -4.369, 28.992, 25.342 ], "heli_params": [ -5.894, -0.760, 0.736, 49.461, 7.453, 38.572 ], "bp2_params": [ 0.274, -0.046, -0.070, -13.917, -1.362, -1.240 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.423, "simple_Twist": 24.906, "simple_hRise": 0.701, "simple_hTwist": 38.293 }, { "index": 3, "nt1": "///A/259", "nt2": "///A/297", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.274, -0.046, -0.070, -13.917, -1.362, -1.240 ], "step_params": [ -0.807, -0.560, 3.644, -1.499, 3.598, 39.585 ], "heli_params": [ -1.287, 0.993, 3.609, 5.297, 2.207, 39.769 ], "bp2_params": [ 0.583, -0.120, 0.140, -11.216, -15.151, -2.693 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.644, "simple_Twist": 37.592, "simple_hRise": 3.606, "simple_hTwist": 37.786 }, { "index": 4, "nt1": "///A/260", "nt2": "///A/296", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.120, 0.140, -11.216, -15.151, -2.693 ], "step_params": [ 1.847, -1.566, 2.739, 2.137, 7.634, 25.997 ], "heli_params": [ -4.858, -3.506, 2.334, 16.488, -4.615, 27.159 ], "bp2_params": [ -0.171, -0.177, 0.071, -2.702, -4.693, 2.741 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.739, "simple_Twist": 30.127, "simple_hRise": 2.402, "simple_hTwist": 31.129 }, { "index": 5, "nt1": "///A/261", "nt2": "///A/295", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GGC", "strand2": "CCG", "bp_type": "|||", "helix_form": "..", "helical_rise": 1.673, "helical_rise_std": 0.372, "helical_radius": 9.483, "helical_radius_std": 1.694, "helical_axis": [ -0.411, -0.084, 0.908 ], "point1": [ -54.260, 17.141, -37.436 ], "point2": [ -55.518, 16.883, -34.657 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/263", "nt2": "///A/294", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.621, -0.306, -0.003, 1.940, -22.878, 2.252 ], "step_params": [ -0.534, -1.709, 3.517, -4.998, 13.074, 35.565 ], "heli_params": [ -4.270, 0.184, 2.789, 20.454, 7.819, 38.137 ], "bp2_params": [ 0.429, -0.123, -0.312, -2.316, -14.418, 1.303 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.517, "simple_Twist": 29.654, "simple_hRise": 2.607, "simple_hTwist": 32.724 }, { "index": 2, "nt1": "///A/264", "nt2": "///A/293", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.429, -0.123, -0.312, -2.316, -14.418, 1.303 ], "step_params": [ -0.402, -2.162, 3.588, 2.394, -5.099, 37.240 ], "heli_params": [ -2.597, 0.976, 3.809, -7.929, -3.723, 37.648 ], "bp2_params": [ 0.127, -0.149, -0.348, -2.222, 12.643, -2.867 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 38.763, "simple_hRise": 3.801, "simple_hTwist": 39.154 }, { "index": 3, "nt1": "///A/265", "nt2": "///A/292", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "GAC", "strand2": "CUG", "bp_type": "|||", "helix_form": "..", "helical_rise": 2.451, "helical_rise_std": 0.572, "helical_radius": 10.249, "helical_radius_std": 1.390, "helical_axis": [ -0.147, -0.406, 0.902 ], "point1": [ -62.098, 12.534, -26.153 ], "point2": [ -62.808, 10.570, -21.787 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/268", "nt2": "///A/288", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.415, -0.189, 0.209, 12.201, -11.339, -1.315 ], "step_params": [ 0.669, -0.664, 3.195, 5.133, 26.981, 32.628 ], "heli_params": [ -3.491, -0.435, 2.149, 40.299, -7.667, 42.407 ], "bp2_params": [ 0.597, -0.261, -0.209, 13.616, -31.168, 2.361 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.195, "simple_Twist": 27.596, "simple_hRise": 1.931, "simple_hTwist": 38.745 }, { "index": 2, "nt1": "///A/269", "nt2": "///A/287", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.597, -0.261, -0.209, 13.616, -31.168, 2.361 ], "step_params": [ -0.112, -1.646, 4.018, -7.969, 4.568, 33.747 ], "heli_params": [ -3.570, -1.261, 3.700, 7.693, 13.421, 34.939 ], "bp2_params": [ 0.313, -0.173, 0.381, -2.410, -7.513, -2.578 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.018, "simple_Twist": 34.254, "simple_hRise": 3.707, "simple_hTwist": 35.429 }, { "index": 3, "nt1": "///A/270", "nt2": "///A/286", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/265,///A/266" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/285,///A/286" }, { "index": 3, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/288,///A/289" }, { "index": 4, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/294,///A/295" }, { "index": 5, "num_nts": 3, "nts_short": "CUC", "nts_long": "///A/270,///A/271,///A/284" } ], "nonStack": { "num_nts": 5, "nts_short": "CCUCU", "nts_long": "///A/262,///A/267,///A/272,///A/290,///A/291" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/284/OP2", "nt": "///A/284", "vert_dist": 2.852 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 3 ], "summary": "[1] 4 [A.270 A.286] 3", "num_nts": 6, "nts_short": "CUUCGG", "nts_long": "///A/270,///A/271,///A/272,///A/284,///A/285,///A/286", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UUCG", "nts_long": "///A/271,///A/272,///A/284,///A/285" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 0 [A.261 A.295 A.263 A.294] 5 3", "num_nts": 5, "nts_short": "UCGCA", "nts_long": "///A/261,///A/262,///A/263,///A/294,///A/295", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///A/262" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 2, 3 ], "stem_indices": [ 2, 3 ], "summary": "[2] 2 3 [A.265 A.292 A.268 A.288] 3 3", "num_nts": 9, "nts_short": "CCCGCACUG", "nts_long": "///A/265,///A/266,///A/267,///A/268,///A/288,///A/289,///A/290,///A/291,///A/292", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/266,///A/267" }, { "index": 2, "num_nts": 3, "nts_short": "ACU", "nts_long": "///A/289,///A/290,///A/291" } ] } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "UUC", "nts_long": "///A/271,///A/272,///A/284" } ], "dbn": { "all_chains": { "num_nts": 32, "num_chars": 32, "bseq": "GAGGUCGGCCCGACUUCGGUCACUGCCACCUC", "sstr": "(((((.(((..(((....)))...))))))))", "form": "......A...........A.....A....A.-" }, "m1_chain_A": { "num_nts": 32, "num_chars": 32, "bseq": "GAGGUCGGCCCGACUUCGGUCACUGCCACCUC", "sstr": "(((((.(((..(((....)))...))))))))", "form": "......A...........A.....A....A.-" } }, "chains": { "m1_chain_A": { "num_nts": 32, "bseq": "GAGGUCGGCCCGACUUCGGUCACUGCCACCUC", "sstr": "(((((.(((..(((....)))...))))))))", "form": "......A...........A.....A....A.-", "helical_rise": 0.048, "helical_rise_std": 2.801, "helical_axis": [ -0.509, -0.376, -0.775 ], "point1": [ -57.670, 18.157, -34.784 ], "point2": [ -58.463, 17.570, -35.992 ], "num_chars": 94, "suite": "G!!A!!G!!G!!U!!C!!G!!G!!C1cC!!C!!G!!A!!C1cU!!U2[C!!G!!G1aU1fC!!A&aC!!U!!G!!C!!C!!A&aC!!C1cU!!C" } }, "num_nts": 32, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 257, "nt_name": "G", "nt_code": "G", "nt_id": "///A/257", "linked_nts": [ null, "///A/258" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -176.688, "gamma": -170.117, "delta": 104.994, "epsilon": -179.770, "zeta": -53.775, "epsilon_zeta": -125.994, "bb_type": "BI", "chi": -151.458, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.703, 0.260 ], "P_xyz": [ -0.062, 10.486, -1.241 ], "form": ".", "ssZp": 3.893, "Dp": 3.879, "splay_angle": 20.989, "splay_distance": 3.904, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": null, "theta": -141.557, "eta_prime": null, "theta_prime": -147.055, "eta_base": null, "theta_base": -109.579, "v0": -0.344, "v1": -11.913, "v2": 18.906, "v3": -19.545, "v4": 12.563, "amplitude": 20.049, "phase_angle": 19.442, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -47.256, 25.808, -48.391 ], "x_axis": [ -0.765, -0.560, -0.318 ], "y_axis": [ 0.567, -0.820, 0.081 ], "z_axis": [ -0.306, -0.118, 0.945 ], "quaternion": [ -0.300, -0.166, -0.010, 0.939 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 258, "nt_name": "A", "nt_code": "A", "nt_id": "///A/258", "linked_nts": [ "///A/257", "///A/259" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 127.188, "beta": 168.671, "gamma": -152.045, "delta": 105.596, "epsilon": -177.634, "zeta": -53.324, "epsilon_zeta": -124.310, "bb_type": "BI", "chi": -134.622, "glyco_bond": "anti", "C5prime_xyz": [ -1.240, 8.471, -0.712 ], "P_xyz": [ -0.521, 10.427, -2.335 ], "form": ".", "ssZp": 3.543, "Dp": 3.996, "splay_angle": 21.054, "splay_distance": 4.031, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 172.387, "theta": -147.697, "eta_prime": -167.812, "theta_prime": -153.612, "eta_base": -115.753, "theta_base": -134.160, "v0": 4.757, "v1": -16.184, "v2": 20.653, "v3": -18.422, "v4": 8.646, "amplitude": 20.748, "phase_angle": 5.505, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ -50.622, 24.971, -46.600 ], "x_axis": [ -0.377, -0.926, -0.029 ], "y_axis": [ 0.769, -0.330, 0.547 ], "z_axis": [ -0.516, 0.184, 0.837 ], "quaternion": [ 0.531, 0.171, -0.229, -0.798 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 259, "nt_name": "G", "nt_code": "G", "nt_id": "///A/259", "linked_nts": [ "///A/258", "///A/260" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 131.242, "beta": 168.048, "gamma": -170.805, "delta": 101.487, "epsilon": -176.244, "zeta": -78.306, "epsilon_zeta": -97.938, "bb_type": "BI", "chi": -165.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.676, 1.070 ], "P_xyz": [ -0.631, 10.995, 0.259 ], "form": ".", "ssZp": 4.043, "Dp": 3.926, "splay_angle": 24.936, "splay_distance": 3.816, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 155.502, "theta": 166.485, "eta_prime": 173.234, "theta_prime": -177.275, "eta_base": -152.635, "theta_base": -137.863, "v0": -4.699, "v1": -9.498, "v2": 19.063, "v3": -22.447, "v4": 17.202, "amplitude": 22.172, "phase_angle": 30.711, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -54.186, 24.446, -44.792 ], "x_axis": [ 0.268, -0.916, -0.300 ], "y_axis": [ 0.869, 0.096, 0.485 ], "z_axis": [ -0.415, -0.390, 0.822 ], "quaternion": [ 0.739, 0.296, -0.039, -0.604 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 260, "nt_name": "G", "nt_code": "G", "nt_id": "///A/260", "linked_nts": [ "///A/259", "///A/261" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -98.559, "beta": -160.774, "gamma": 73.731, "delta": 105.064, "epsilon": -174.615, "zeta": -57.946, "epsilon_zeta": -116.669, "bb_type": "BI", "chi": -145.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.172, 8.646, -0.081 ], "P_xyz": [ 1.454, 8.565, 0.155 ], "form": ".", "ssZp": 3.875, "Dp": 4.013, "splay_angle": 17.163, "splay_distance": 3.454, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 173.528, "theta": -95.473, "eta_prime": -171.648, "theta_prime": -114.895, "eta_base": -131.677, "theta_base": -90.955, "v0": 3.190, "v1": -14.829, "v2": 19.959, "v3": -18.625, "v4": 9.784, "amplitude": 20.243, "phase_angle": 9.600, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -56.662, 23.187, -42.175 ], "x_axis": [ 0.691, -0.701, 0.177 ], "y_axis": [ 0.510, 0.646, 0.568 ], "z_axis": [ -0.512, -0.303, 0.804 ], "quaternion": [ 0.886, 0.246, -0.194, -0.342 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 261, "nt_name": "U", "nt_code": "U", "nt_id": "///A/261", "linked_nts": [ "///A/260", "///A/262" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 120.084, "beta": -172.760, "gamma": -161.577, "delta": 93.824, "epsilon": -159.906, "zeta": 24.044, "epsilon_zeta": 176.050, "bb_type": "--", "chi": -160.161, "glyco_bond": "anti", "C5prime_xyz": [ -1.661, 8.794, 0.697 ], "P_xyz": [ -0.869, 11.004, -0.505 ], "form": ".", "ssZp": 4.280, "Dp": 4.178, "splay_angle": 44.814, "splay_distance": 7.348, "splay_ratio": 0.383, "d22": 4.090, "d64": 4.669, "eta": 161.563, "theta": -111.453, "eta_prime": -178.095, "theta_prime": -133.059, "eta_base": -127.421, "theta_base": -104.543, "v0": -8.571, "v1": -9.584, "v2": 23.734, "v3": -29.273, "v4": 23.690, "amplitude": 29.125, "phase_angle": 35.420, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -56.819, 20.018, -40.811 ], "x_axis": [ 0.920, -0.239, 0.311 ], "y_axis": [ 0.024, 0.826, 0.564 ], "z_axis": [ -0.391, -0.511, 0.766 ], "quaternion": [ 0.937, 0.287, -0.187, -0.070 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 262, "nt_name": "C", "nt_code": "C", "nt_id": "///A/262", "linked_nts": [ "///A/261", "///A/263" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,phosphate", "alpha": -169.113, "beta": 46.356, "gamma": -173.605, "delta": 146.921, "epsilon": 69.161, "zeta": -117.296, "epsilon_zeta": -173.543, "bb_type": "--", "chi": 165.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 7.141, 2.755 ], "P_xyz": [ -1.321, 9.662, 2.253 ], "form": ".", "ssZp": -0.388, "Dp": 0.805, "splay_angle": 49.090, "splay_distance": 6.863, "splay_ratio": 0.417, "d22": null, "d64": null, "eta": -123.421, "theta": 25.918, "eta_prime": -135.925, "theta_prime": 78.257, "eta_base": -102.809, "theta_base": 97.146, "v0": -0.163, "v1": 13.918, "v2": -22.030, "v3": 22.617, "v4": -14.349, "amplitude": 23.251, "phase_angle": 198.651, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -55.359, 16.934, -34.303 ], "x_axis": [ 0.765, 0.439, -0.471 ], "y_axis": [ -0.605, 0.741, -0.291 ], "z_axis": [ 0.221, 0.508, 0.832 ], "quaternion": [ 0.914, -0.219, 0.190, 0.286 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 263, "nt_name": "G", "nt_code": "G", "nt_id": "///A/263", "linked_nts": [ "///A/262", "///A/264" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate", "alpha": 85.911, "beta": 110.088, "gamma": -20.426, "delta": 106.201, "epsilon": -101.754, "zeta": -109.536, "epsilon_zeta": 7.782, "bb_type": "--", "chi": 175.515, "glyco_bond": "--", "C5prime_xyz": [ -1.395, 8.012, 2.096 ], "P_xyz": [ -0.273, 6.769, 4.145 ], "form": "A", "ssZp": 4.441, "Dp": 4.284, "splay_angle": 21.592, "splay_distance": 3.765, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": -161.780, "theta": -77.470, "eta_prime": 169.982, "theta_prime": -87.368, "eta_base": 160.268, "theta_base": -66.827, "v0": 5.455, "v1": -16.338, "v2": 19.977, "v3": -17.272, "v4": 7.509, "amplitude": 20.000, "phase_angle": 2.783, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -59.073, 16.666, -40.068 ], "x_axis": [ 0.846, 0.198, 0.495 ], "y_axis": [ -0.445, 0.774, 0.450 ], "z_axis": [ -0.294, -0.601, 0.743 ], "quaternion": [ 0.917, 0.287, -0.215, 0.175 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 264, "nt_name": "G", "nt_code": "G", "nt_id": "///A/264", "linked_nts": [ "///A/263", "///A/265" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 105.774, "beta": -131.585, "gamma": -169.379, "delta": 98.703, "epsilon": -161.881, "zeta": -55.171, "epsilon_zeta": -106.710, "bb_type": "BI", "chi": -178.320, "glyco_bond": "anti", "C5prime_xyz": [ -1.802, 8.555, 1.665 ], "P_xyz": [ -0.140, 10.213, 0.460 ], "form": ".", "ssZp": 4.141, "Dp": 4.058, "splay_angle": 24.456, "splay_distance": 4.167, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 142.716, "theta": -153.731, "eta_prime": 173.659, "theta_prime": -153.245, "eta_base": -138.033, "theta_base": -133.392, "v0": -8.814, "v1": -7.423, "v2": 19.393, "v3": -24.981, "v4": 21.281, "amplitude": 24.816, "phase_angle": 38.605, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -58.190, 14.029, -37.530 ], "x_axis": [ 0.483, 0.765, 0.427 ], "y_axis": [ -0.870, 0.473, 0.137 ], "z_axis": [ -0.097, -0.438, 0.894 ], "quaternion": [ 0.844, 0.170, -0.155, 0.484 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 265, "nt_name": "C", "nt_code": "C", "nt_id": "///A/265", "linked_nts": [ "///A/264", "///A/266" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -80.288, "beta": -137.121, "gamma": 20.699, "delta": 98.944, "epsilon": -175.577, "zeta": -96.159, "epsilon_zeta": -79.418, "bb_type": "BI", "chi": -128.919, "glyco_bond": "anti", "C5prime_xyz": [ -1.411, 8.581, -1.090 ], "P_xyz": [ 0.535, 10.027, -0.046 ], "form": ".", "ssZp": 3.390, "Dp": 4.115, "splay_angle": 8.061, "splay_distance": 1.364, "splay_ratio": 0.072, "d22": 4.004, "d64": 3.224, "eta": 160.622, "theta": -148.520, "eta_prime": 173.891, "theta_prime": -150.072, "eta_base": -155.489, "theta_base": -112.087, "v0": 0.141, "v1": -15.636, "v2": 23.839, "v3": -24.410, "v4": 15.340, "amplitude": 25.080, "phase_angle": 18.095, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -56.268, 11.804, -34.578 ], "x_axis": [ -0.101, 0.937, 0.334 ], "y_axis": [ -0.995, -0.086, -0.059 ], "z_axis": [ -0.027, -0.338, 0.941 ], "quaternion": [ 0.662, 0.105, -0.136, 0.729 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 266, "nt_name": "C", "nt_code": "C", "nt_id": "///A/266", "linked_nts": [ "///A/265", "///A/267" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop", "alpha": 142.380, "beta": -143.342, "gamma": 170.028, "delta": 99.677, "epsilon": 176.050, "zeta": 37.290, "epsilon_zeta": 138.760, "bb_type": "--", "chi": -134.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.664, -0.768 ], "P_xyz": [ -0.027, 8.879, -3.046 ], "form": ".", "ssZp": 3.649, "Dp": 4.025, "splay_angle": 68.136, "splay_distance": 10.893, "splay_ratio": 0.561, "d22": 4.471, "d64": 5.568, "eta": 153.975, "theta": -65.144, "eta_prime": -179.797, "theta_prime": -83.791, "eta_base": -129.681, "theta_base": -61.613, "v0": -0.087, "v1": -15.786, "v2": 24.398, "v3": -25.005, "v4": 15.810, "amplitude": 25.727, "phase_angle": 18.494, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.036, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -56.399, 11.810, -33.221 ], "x_axis": [ -0.434, 0.828, 0.354 ], "y_axis": [ -0.763, -0.547, 0.343 ], "z_axis": [ 0.478, -0.121, 0.870 ], "quaternion": [ 0.471, 0.247, 0.066, 0.844 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 267, "nt_name": "C", "nt_code": "C", "nt_id": "///A/267", "linked_nts": [ "///A/266", "///A/268" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate", "alpha": -106.714, "beta": -132.490, "gamma": -0.639, "delta": 111.283, "epsilon": -42.215, "zeta": 85.518, "epsilon_zeta": 232.267, "bb_type": "--", "chi": -133.531, "glyco_bond": "anti", "C5prime_xyz": [ -0.876, 8.354, -0.742 ], "P_xyz": [ 0.715, 9.974, 0.605 ], "form": ".", "ssZp": 1.359, "Dp": 3.472, "splay_angle": 44.878, "splay_distance": 7.579, "splay_ratio": 0.388, "d22": null, "d64": null, "eta": -179.092, "theta": 132.594, "eta_prime": -140.628, "theta_prime": 131.317, "eta_base": -102.719, "theta_base": 124.751, "v0": 8.900, "v1": -16.656, "v2": 17.518, "v3": -12.729, "v4": 2.482, "amplitude": 17.838, "phase_angle": 349.137, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -64.673, 12.696, -26.192 ], "x_axis": [ -0.589, -0.253, -0.768 ], "y_axis": [ 0.593, -0.780, -0.198 ], "z_axis": [ -0.549, -0.572, 0.609 ], "quaternion": [ -0.245, -0.381, -0.223, 0.863 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 268, "nt_name": "G", "nt_code": "G", "nt_id": "///A/268", "linked_nts": [ "///A/267", "///A/269" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop", "alpha": 159.389, "beta": -159.391, "gamma": 64.733, "delta": 98.480, "epsilon": 170.678, "zeta": -26.387, "epsilon_zeta": -162.934, "bb_type": "BI", "chi": -125.798, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.527, -1.274 ], "P_xyz": [ 1.134, 8.793, -1.513 ], "form": ".", "ssZp": 3.256, "Dp": 3.948, "splay_angle": 19.042, "splay_distance": 3.270, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 123.651, "theta": -116.565, "eta_prime": 129.103, "theta_prime": -126.797, "eta_base": 141.058, "theta_base": -95.573, "v0": 1.305, "v1": -16.563, "v2": 24.857, "v3": -24.741, "v4": 14.781, "amplitude": 25.834, "phase_angle": 15.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -57.313, 13.990, -24.931 ], "x_axis": [ -0.996, -0.090, 0.027 ], "y_axis": [ 0.094, -0.980, 0.176 ], "z_axis": [ 0.011, 0.177, 0.984 ], "quaternion": [ -0.046, 0.010, 0.089, 0.995 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 269, "nt_name": "A", "nt_code": "A", "nt_id": "///A/269", "linked_nts": [ "///A/268", "///A/270" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -168.521, "beta": 134.544, "gamma": 163.217, "delta": 141.277, "epsilon": -157.011, "zeta": -79.582, "epsilon_zeta": -77.430, "bb_type": "BI", "chi": -135.367, "glyco_bond": "anti", "C5prime_xyz": [ -1.407, 8.466, -0.178 ], "P_xyz": [ -0.049, 9.805, -2.010 ], "form": ".", "ssZp": 2.555, "Dp": 2.569, "splay_angle": 24.489, "splay_distance": 4.558, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -166.665, "theta": -127.644, "eta_prime": -148.324, "theta_prime": -144.440, "eta_base": -105.878, "theta_base": -115.103, "v0": -5.577, "v1": 16.186, "v2": -19.759, "v3": 17.127, "v4": -7.464, "amplitude": 19.780, "phase_angle": 182.662, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -59.523, 14.159, -22.526 ], "x_axis": [ -0.760, -0.626, -0.175 ], "y_axis": [ 0.522, -0.748, 0.410 ], "z_axis": [ -0.387, 0.221, 0.895 ], "quaternion": [ -0.311, -0.152, 0.171, 0.922 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 270, "nt_name": "C", "nt_code": "C", "nt_id": "///A/270", "linked_nts": [ "///A/269", "///A/271" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 100.341, "beta": 178.324, "gamma": -167.541, "delta": 91.848, "epsilon": -178.351, "zeta": -46.907, "epsilon_zeta": -131.444, "bb_type": "BI", "chi": -152.600, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.803, 0.287 ], "P_xyz": [ -0.735, 10.897, -1.161 ], "form": ".", "ssZp": 4.173, "Dp": 4.138, "splay_angle": 20.223, "splay_distance": 4.151, "splay_ratio": 0.205, "d22": 3.981, "d64": 4.953, "eta": 126.820, "theta": -148.919, "eta_prime": 151.298, "theta_prime": -150.510, "eta_base": -160.709, "theta_base": -125.731, "v0": -3.708, "v1": -15.094, "v2": 28.901, "v3": -31.869, "v4": 22.241, "amplitude": 32.062, "phase_angle": 25.657, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -62.642, 14.626, -19.235 ], "x_axis": [ -0.219, -0.947, -0.235 ], "y_axis": [ 0.883, -0.295, 0.366 ], "z_axis": [ -0.416, -0.127, 0.900 ], "quaternion": [ 0.589, 0.210, -0.077, -0.777 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 271, "nt_name": "U", "nt_code": "U", "nt_id": "///A/271", "linked_nts": [ "///A/270", "///A/272" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": 135.623, "beta": 173.546, "gamma": -160.804, "delta": 99.887, "epsilon": -166.188, "zeta": -58.919, "epsilon_zeta": -107.268, "bb_type": "BI", "chi": -158.326, "glyco_bond": "anti", "C5prime_xyz": [ -1.859, 8.819, 0.560 ], "P_xyz": [ -1.194, 11.150, -0.470 ], "form": ".", "ssZp": 3.925, "Dp": 3.893, "splay_angle": 93.357, "splay_distance": 12.796, "splay_ratio": 0.728, "d22": 8.225, "d64": 11.172, "eta": 173.233, "theta": -152.483, "eta_prime": -169.560, "theta_prime": 167.400, "eta_base": -132.708, "theta_base": 120.401, "v0": -11.582, "v1": -3.628, "v2": 16.230, "v3": -23.592, "v4": 22.267, "amplitude": 23.857, "phase_angle": 47.131, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.058, "filter_rmsd": 0.099, "frame": { "rmsd": 0.017, "origin": [ -66.133, 12.561, -18.352 ], "x_axis": [ 0.297, -0.917, -0.265 ], "y_axis": [ 0.815, 0.099, 0.572 ], "z_axis": [ -0.498, -0.386, 0.776 ], "quaternion": [ 0.737, 0.325, -0.079, -0.587 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 272, "nt_name": "U", "nt_code": "U", "nt_id": "///A/272", "linked_nts": [ "///A/271", "///A/284" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 146.982, "beta": 136.308, "gamma": 76.196, "delta": 134.377, "epsilon": -96.538, "zeta": -79.904, "epsilon_zeta": -16.634, "bb_type": "--", "chi": -119.775, "glyco_bond": "anti", "C5prime_xyz": [ -1.792, 8.475, -1.198 ], "P_xyz": [ 0.700, 8.048, -1.947 ], "form": ".", "ssZp": 1.261, "Dp": 2.062, "splay_angle": 138.195, "splay_distance": 15.893, "splay_ratio": 0.938, "d22": 7.479, "d64": 9.549, "eta": 38.584, "theta": -71.847, "eta_prime": 74.153, "theta_prime": -81.550, "eta_base": 44.384, "theta_base": -14.940, "v0": -13.011, "v1": 18.074, "v2": -16.174, "v3": 8.956, "v4": 2.512, "amplitude": 18.047, "phase_angle": 153.662, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ -67.423, 23.128, -11.252 ], "x_axis": [ 0.923, 0.364, -0.127 ], "y_axis": [ 0.356, -0.931, -0.081 ], "z_axis": [ -0.148, 0.029, -0.989 ], "quaternion": [ -0.028, 0.980, 0.183, -0.070 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 284, "nt_name": "C", "nt_code": "C", "nt_id": "///A/284", "linked_nts": [ "///A/272", "///A/285" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,phosphate,splayed-apart", "alpha": -44.355, "beta": -174.204, "gamma": 73.225, "delta": 163.639, "epsilon": -76.509, "zeta": 92.082, "epsilon_zeta": 191.409, "bb_type": "--", "chi": 175.704, "glyco_bond": "--", "C5prime_xyz": [ -1.585, 7.144, 2.410 ], "P_xyz": [ 0.097, 5.383, 3.441 ], "form": ".", "ssZp": 1.302, "Dp": 1.379, "splay_angle": 62.749, "splay_distance": 9.079, "splay_ratio": 0.566, "d22": null, "d64": null, "eta": -148.019, "theta": 130.552, "eta_prime": -87.402, "theta_prime": 60.568, "eta_base": -114.819, "theta_base": 60.541, "v0": 6.377, "v1": 16.935, "v2": -30.803, "v3": 34.817, "v4": -26.089, "amplitude": 34.878, "phase_angle": 207.972, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.069, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -65.738, 7.386, -12.648 ], "x_axis": [ 0.580, 0.372, 0.725 ], "y_axis": [ -0.126, 0.920, -0.371 ], "z_axis": [ -0.805, 0.124, 0.581 ], "quaternion": [ 0.878, -0.141, -0.436, 0.142 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 285, "nt_name": "G", "nt_code": "G", "nt_id": "///A/285", "linked_nts": [ "///A/284", "///A/286" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 141.767, "beta": 92.700, "gamma": 114.446, "delta": 106.839, "epsilon": 154.333, "zeta": 123.313, "epsilon_zeta": 31.020, "bb_type": "--", "chi": 49.111, "glyco_bond": "syn", "C5prime_xyz": [ -4.827, 2.971, 0.806 ], "P_xyz": [ -3.991, 2.897, 3.300 ], "form": ".", "ssZp": -3.415, "Dp": 3.573, "splay_angle": 29.992, "splay_distance": 5.043, "splay_ratio": 0.273, "d22": null, "d64": null, "eta": 67.600, "theta": -22.129, "eta_prime": 114.964, "theta_prime": -85.062, "eta_base": 171.259, "theta_base": -114.857, "v0": 12.422, "v1": -21.137, "v2": 20.922, "v3": -14.249, "v4": 1.239, "amplitude": 21.730, "phase_angle": 344.324, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -66.475, 15.483, -16.687 ], "x_axis": [ 0.178, 0.335, 0.925 ], "y_axis": [ -0.876, 0.481, -0.006 ], "z_axis": [ -0.448, -0.810, 0.379 ], "quaternion": [ 0.714, 0.282, -0.481, 0.424 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 286, "nt_name": "G", "nt_code": "G", "nt_id": "///A/286", "linked_nts": [ "///A/285", "///A/287" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -69.994, "beta": -44.035, "gamma": -152.564, "delta": 98.179, "epsilon": -138.341, "zeta": -85.386, "epsilon_zeta": -52.955, "bb_type": "BI", "chi": 178.605, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.196, 1.912 ], "P_xyz": [ -1.731, 9.914, -0.051 ], "form": "A", "ssZp": 4.696, "Dp": 4.513, "splay_angle": 25.730, "splay_distance": 4.147, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 157.345, "theta": 155.173, "eta_prime": -172.138, "theta_prime": -177.249, "eta_base": -144.001, "theta_base": -144.400, "v0": 4.409, "v1": -19.849, "v2": 27.153, "v3": -25.213, "v4": 13.113, "amplitude": 27.535, "phase_angle": 9.555, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -62.266, 14.944, -19.412 ], "x_axis": [ -0.121, -0.935, -0.332 ], "y_axis": [ -0.871, 0.260, -0.416 ], "z_axis": [ 0.475, 0.239, -0.847 ], "quaternion": [ 0.271, -0.605, 0.746, -0.059 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 287, "nt_name": "U", "nt_code": "U", "nt_id": "///A/287", "linked_nts": [ "///A/286", "///A/288" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -37.254, "beta": 162.488, "gamma": 43.014, "delta": 98.649, "epsilon": -155.957, "zeta": -61.872, "epsilon_zeta": -94.086, "bb_type": "BI", "chi": -150.633, "glyco_bond": "anti", "C5prime_xyz": [ -1.791, 8.862, 0.090 ], "P_xyz": [ 0.725, 9.506, 0.517 ], "form": ".", "ssZp": 3.915, "Dp": 4.033, "splay_angle": 20.104, "splay_distance": 3.489, "splay_ratio": 0.177, "d22": 3.960, "d64": 3.443, "eta": 179.898, "theta": -104.257, "eta_prime": -157.928, "theta_prime": -124.691, "eta_base": -119.482, "theta_base": -101.274, "v0": -11.897, "v1": -4.813, "v2": 18.166, "v3": -25.339, "v4": 23.292, "amplitude": 25.646, "phase_angle": 44.901, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.034, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -59.099, 14.328, -22.017 ], "x_axis": [ -0.506, -0.572, -0.645 ], "y_axis": [ -0.617, 0.763, -0.193 ], "z_axis": [ 0.603, 0.300, -0.739 ], "quaternion": [ 0.360, -0.343, 0.867, 0.031 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 288, "nt_name": "C", "nt_code": "C", "nt_id": "///A/288", "linked_nts": [ "///A/287", "///A/289" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop", "alpha": 160.153, "beta": 157.295, "gamma": 156.779, "delta": 103.771, "epsilon": -124.414, "zeta": -103.044, "epsilon_zeta": -21.370, "bb_type": "--", "chi": -157.081, "glyco_bond": "anti", "C5prime_xyz": [ -1.083, 8.544, 0.571 ], "P_xyz": [ 0.382, 10.096, -0.983 ], "form": ".", "ssZp": 4.117, "Dp": 4.431, "splay_angle": 22.972, "splay_distance": 3.768, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 141.820, "theta": -179.535, "eta_prime": 160.787, "theta_prime": -170.168, "eta_base": -157.148, "theta_base": -138.996, "v0": 5.479, "v1": -18.351, "v2": 23.196, "v3": -20.549, "v4": 9.562, "amplitude": 23.286, "phase_angle": 5.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.021, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -57.688, 13.743, -25.154 ], "x_axis": [ -0.978, -0.125, -0.167 ], "y_axis": [ -0.133, 0.991, 0.034 ], "z_axis": [ 0.161, 0.055, -0.985 ], "quaternion": [ 0.083, -0.065, 0.994, 0.023 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 289, "nt_name": "A", "nt_code": "A", "nt_id": "///A/289", "linked_nts": [ "///A/288", "///A/290" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -65.300, "beta": 114.297, "gamma": 88.836, "delta": 97.777, "epsilon": 171.414, "zeta": -94.008, "epsilon_zeta": -94.577, "bb_type": "BI", "chi": -157.668, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.734, 0.537 ], "P_xyz": [ 0.330, 8.790, -1.253 ], "form": ".", "ssZp": 4.044, "Dp": 3.882, "splay_angle": 37.574, "splay_distance": 5.984, "splay_ratio": 0.324, "d22": null, "d64": null, "eta": 157.089, "theta": -168.893, "eta_prime": -160.707, "theta_prime": 160.873, "eta_base": -116.663, "theta_base": 155.010, "v0": -5.120, "v1": -11.569, "v2": 23.383, "v3": -26.886, "v4": 20.145, "amplitude": 26.845, "phase_angle": 29.418, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ -57.152, 13.820, -28.883 ], "x_axis": [ -0.821, 0.280, -0.497 ], "y_axis": [ 0.348, 0.936, -0.049 ], "z_axis": [ 0.452, -0.213, -0.866 ], "quaternion": [ 0.249, 0.165, 0.952, -0.069 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 290, "nt_name": "C", "nt_code": "C", "nt_id": "///A/290", "linked_nts": [ "///A/289", "///A/291" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,internal-loop", "alpha": -54.096, "beta": 164.104, "gamma": 65.942, "delta": 95.447, "epsilon": 178.757, "zeta": 36.280, "epsilon_zeta": 142.477, "bb_type": "--", "chi": -173.104, "glyco_bond": "anti", "C5prime_xyz": [ -2.047, 8.698, 1.359 ], "P_xyz": [ 0.422, 9.387, 1.947 ], "form": ".", "ssZp": 3.872, "Dp": 3.851, "splay_angle": 35.587, "splay_distance": 5.634, "splay_ratio": 0.308, "d22": 5.003, "d64": 6.171, "eta": -174.651, "theta": -31.831, "eta_prime": -168.131, "theta_prime": -89.050, "eta_base": -163.485, "theta_base": -134.064, "v0": -13.112, "v1": -4.676, "v2": 19.429, "v3": -27.976, "v4": 26.078, "amplitude": 28.102, "phase_angle": 46.262, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.143, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -53.043, 9.525, -28.183 ], "x_axis": [ -0.731, 0.145, -0.667 ], "y_axis": [ 0.266, 0.960, -0.084 ], "z_axis": [ 0.628, -0.239, -0.741 ], "quaternion": [ 0.349, 0.111, 0.926, -0.087 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 291, "nt_name": "U", "nt_code": "U", "nt_id": "///A/291", "linked_nts": [ "///A/290", "///A/292" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BI,non-stack,non-pair-contact,internal-loop,phosphate", "alpha": 129.269, "beta": 136.188, "gamma": 87.006, "delta": 107.197, "epsilon": -162.551, "zeta": -34.758, "epsilon_zeta": -127.793, "bb_type": "BI", "chi": -120.875, "glyco_bond": "anti", "C5prime_xyz": [ -2.806, 8.599, -1.508 ], "P_xyz": [ -0.901, 8.893, -3.313 ], "form": ".", "ssZp": 2.841, "Dp": 3.147, "splay_angle": 57.550, "splay_distance": 9.774, "splay_ratio": 0.482, "d22": null, "d64": null, "eta": 33.960, "theta": -117.574, "eta_prime": 101.689, "theta_prime": -136.876, "eta_base": 103.684, "theta_base": -110.164, "v0": -29.738, "v1": 17.915, "v2": -0.948, "v3": -16.257, "v4": 28.769, "amplitude": 30.128, "phase_angle": 91.802, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ -49.759, 5.519, -30.399 ], "x_axis": [ -0.788, 0.156, 0.595 ], "y_axis": [ 0.197, 0.980, 0.003 ], "z_axis": [ -0.583, 0.119, -0.804 ], "quaternion": [ -0.312, 0.093, 0.945, 0.032 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 292, "nt_name": "G", "nt_code": "G", "nt_id": "///A/292", "linked_nts": [ "///A/291", "///A/293" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -140.176, "beta": 100.041, "gamma": 170.866, "delta": 112.308, "epsilon": -175.590, "zeta": -48.179, "epsilon_zeta": -127.410, "bb_type": "BI", "chi": 177.245, "glyco_bond": "anti", "C5prime_xyz": [ -1.041, 7.739, 2.009 ], "P_xyz": [ -0.373, 10.231, 1.438 ], "form": "A", "ssZp": 3.979, "Dp": 4.081, "splay_angle": 27.239, "splay_distance": 4.253, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": -155.343, "theta": 179.809, "eta_prime": -145.035, "theta_prime": -159.304, "eta_base": -97.509, "theta_base": -123.271, "v0": 16.151, "v1": -23.011, "v2": 20.584, "v3": -11.655, "v4": -2.715, "amplitude": 22.807, "phase_angle": 334.497, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -56.397, 11.521, -34.328 ], "x_axis": [ -0.149, 0.835, 0.529 ], "y_axis": [ 0.988, 0.147, 0.046 ], "z_axis": [ -0.039, 0.530, -0.847 ], "quaternion": [ -0.194, 0.623, 0.732, 0.197 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 293, "nt_name": "C", "nt_code": "C", "nt_id": "///A/293", "linked_nts": [ "///A/292", "///A/294" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -102.494, "beta": -155.124, "gamma": 67.633, "delta": 103.105, "epsilon": -173.005, "zeta": -55.539, "epsilon_zeta": -117.466, "bb_type": "BI", "chi": -154.153, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.815, 0.385 ], "P_xyz": [ 0.924, 9.151, 1.239 ], "form": ".", "ssZp": 3.872, "Dp": 3.786, "splay_angle": 22.173, "splay_distance": 4.197, "splay_ratio": 0.208, "d22": 4.455, "d64": 4.769, "eta": 171.520, "theta": -96.954, "eta_prime": -160.367, "theta_prime": -115.891, "eta_base": -115.314, "theta_base": -90.235, "v0": -8.993, "v1": -4.845, "v2": 16.014, "v3": -21.640, "v4": 19.221, "amplitude": 21.687, "phase_angle": 42.403, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -58.517, 13.632, -37.351 ], "x_axis": [ 0.507, 0.841, 0.188 ], "y_axis": [ 0.860, -0.477, -0.182 ], "z_axis": [ -0.063, 0.254, -0.965 ], "quaternion": [ -0.127, 0.859, 0.495, 0.036 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 294, "nt_name": "C", "nt_code": "C", "nt_id": "///A/294", "linked_nts": [ "///A/293", "///A/295" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 122.371, "beta": 161.164, "gamma": -157.294, "delta": 100.810, "epsilon": -162.984, "zeta": -61.716, "epsilon_zeta": -101.268, "bb_type": "BI", "chi": -142.832, "glyco_bond": "anti", "C5prime_xyz": [ -1.142, 8.608, -0.167 ], "P_xyz": [ -0.447, 10.807, -1.442 ], "form": ".", "ssZp": 3.978, "Dp": 4.303, "splay_angle": 19.458, "splay_distance": 3.804, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 152.018, "theta": -144.119, "eta_prime": 171.167, "theta_prime": -144.818, "eta_base": -140.609, "theta_base": -111.977, "v0": 5.517, "v1": -19.308, "v2": 24.709, "v3": -22.360, "v4": 10.737, "amplitude": 24.854, "phase_angle": 6.209, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -58.647, 17.090, -39.726 ], "x_axis": [ 0.913, 0.381, 0.148 ], "y_axis": [ 0.406, -0.804, -0.435 ], "z_axis": [ -0.047, 0.457, -0.888 ], "quaternion": [ -0.235, 0.949, 0.207, 0.026 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 295, "nt_name": "A", "nt_code": "A", "nt_id": "///A/295", "linked_nts": [ "///A/294", "///A/296" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 113.937, "beta": -172.340, "gamma": -150.601, "delta": 97.022, "epsilon": -164.439, "zeta": -89.092, "epsilon_zeta": -75.347, "bb_type": "BI", "chi": -158.041, "glyco_bond": "anti", "C5prime_xyz": [ -1.570, 8.708, 0.542 ], "P_xyz": [ -0.832, 10.986, -0.582 ], "form": ".", "ssZp": 4.220, "Dp": 4.229, "splay_angle": 24.323, "splay_distance": 3.875, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 162.312, "theta": 157.518, "eta_prime": -177.005, "theta_prime": 169.488, "eta_base": -129.387, "theta_base": -174.403, "v0": -3.720, "v1": -13.709, "v2": 24.411, "v3": -27.089, "v4": 19.390, "amplitude": 27.138, "phase_angle": 25.905, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ -56.627, 20.159, -40.715 ], "x_axis": [ 0.947, -0.233, 0.220 ], "y_axis": [ -0.052, -0.789, -0.612 ], "z_axis": [ 0.316, 0.569, -0.759 ], "quaternion": [ -0.316, 0.935, -0.076, 0.143 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 296, "nt_name": "C", "nt_code": "C", "nt_id": "///A/296", "linked_nts": [ "///A/295", "///A/297" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.904, "beta": -176.314, "gamma": 41.444, "delta": 96.762, "epsilon": -164.587, "zeta": -68.055, "epsilon_zeta": -96.532, "bb_type": "BI", "chi": -146.935, "glyco_bond": "anti", "C5prime_xyz": [ -1.240, 8.724, -0.077 ], "P_xyz": [ 1.304, 9.183, 0.436 ], "form": ".", "ssZp": 4.090, "Dp": 4.345, "splay_angle": 23.462, "splay_distance": 3.746, "splay_ratio": 0.204, "d22": 4.259, "d64": 3.684, "eta": 171.850, "theta": -136.059, "eta_prime": 177.191, "theta_prime": -134.910, "eta_base": -167.251, "theta_base": -98.253, "v0": 1.595, "v1": -19.180, "v2": 27.372, "v3": -27.056, "v4": 16.087, "amplitude": 28.320, "phase_angle": 14.870, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.211, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -56.992, 23.696, -42.256 ], "x_axis": [ 0.833, -0.553, 0.006 ], "y_axis": [ -0.384, -0.587, -0.713 ], "z_axis": [ 0.397, 0.592, -0.701 ], "quaternion": [ -0.369, 0.883, -0.265, 0.114 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 297, "nt_name": "C", "nt_code": "C", "nt_id": "///A/297", "linked_nts": [ "///A/296", "///A/298" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -120.623, "beta": -177.808, "gamma": 94.543, "delta": 97.366, "epsilon": -153.641, "zeta": -85.850, "epsilon_zeta": -67.791, "bb_type": "BI", "chi": -151.041, "glyco_bond": "anti", "C5prime_xyz": [ -1.302, 8.731, 0.177 ], "P_xyz": [ 1.222, 8.991, -0.530 ], "form": "A", "ssZp": 4.207, "Dp": 4.429, "splay_angle": 22.471, "splay_distance": 3.964, "splay_ratio": 0.202, "d22": 4.178, "d64": 4.349, "eta": 160.036, "theta": -117.158, "eta_prime": -178.756, "theta_prime": -134.712, "eta_base": -127.349, "theta_base": -125.517, "v0": 0.311, "v1": -17.699, "v2": 26.120, "v3": -26.494, "v4": 16.563, "amplitude": 27.358, "phase_angle": 17.306, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -54.262, 24.670, -44.629 ], "x_axis": [ 0.298, -0.905, -0.305 ], "y_axis": [ -0.739, -0.016, -0.674 ], "z_axis": [ 0.605, 0.426, -0.673 ], "quaternion": [ -0.390, 0.705, -0.583, 0.106 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 298, "nt_name": "U", "nt_code": "U", "nt_id": "///A/298", "linked_nts": [ "///A/297", "///A/299" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 145.361, "beta": -172.565, "gamma": -178.340, "delta": 104.696, "epsilon": -136.292, "zeta": -109.205, "epsilon_zeta": -27.087, "bb_type": "--", "chi": -164.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.534, 1.040 ], "P_xyz": [ 0.176, 10.348, -0.047 ], "form": ".", "ssZp": 4.217, "Dp": 4.224, "splay_angle": 25.375, "splay_distance": 4.055, "splay_ratio": 0.221, "d22": 5.468, "d64": 4.891, "eta": 162.577, "theta": 177.361, "eta_prime": 176.783, "theta_prime": -171.358, "eta_base": -154.419, "theta_base": -146.273, "v0": -0.686, "v1": -11.966, "v2": 19.095, "v3": -19.984, "v4": 13.068, "amplitude": 20.364, "phase_angle": 20.329, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.032, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -50.615, 25.091, -46.124 ], "x_axis": [ -0.322, -0.913, -0.249 ], "y_axis": [ -0.738, 0.407, -0.539 ], "z_axis": [ 0.593, 0.010, -0.805 ], "quaternion": [ 0.264, -0.519, 0.796, -0.166 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 299, "nt_name": "C", "nt_code": "C", "nt_id": "///A/299", "linked_nts": [ "///A/298", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -45.157, "beta": 162.096, "gamma": 38.231, "delta": 102.211, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -138.405, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.647, -0.496 ], "P_xyz": [ 1.381, 8.779, -0.246 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.567, "v1": -12.857, "v2": 19.171, "v3": -19.397, "v4": 11.997, "amplitude": 20.041, "phase_angle": 16.938, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -47.386, 25.538, -48.536 ], "x_axis": [ -0.653, -0.585, -0.481 ], "y_axis": [ -0.433, 0.810, -0.396 ], "z_axis": [ 0.621, -0.050, -0.782 ], "quaternion": [ 0.306, -0.283, 0.901, -0.124 ] } } ], "num_hbonds": 64, "hbonds": [ { "index": 1, "atom1_serNum": 19, "atom2_serNum": 1010, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/257/O6", "atom2_id": "///A/299/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 20, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/257/N1", "atom2_id": "///A/299/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 22, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/257/N2", "atom2_id": "///A/299/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 54, "atom2_serNum": 980, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/258/N6", "atom2_id": "///A/298/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 55, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/258/N1", "atom2_id": "///A/298/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 80, "atom2_serNum": 107, "donAcc_type": "acceptable", "distance": 2.272, "atom1_id": "///A/259/O2'", "atom2_id": "///A/260/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 80, "atom2_serNum": 110, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/259/O2'", "atom2_id": "///A/260/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 87, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/259/O6", "atom2_id": "///A/297/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 88, "atom2_serNum": 947, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/259/N1", "atom2_id": "///A/297/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 90, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/259/N2", "atom2_id": "///A/297/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 121, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/260/O6", "atom2_id": "///A/296/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 122, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/260/N1", "atom2_id": "///A/296/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 124, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/260/N2", "atom2_id": "///A/296/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 148, "atom2_serNum": 169, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///A/261/O2'", "atom2_id": "///A/262/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 153, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/261/N3", "atom2_id": "///A/295/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 155, "atom2_serNum": 885, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/261/O4", "atom2_id": "///A/295/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 178, "atom2_serNum": 182, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///A/262/O2'", "atom2_id": "///A/262/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 178, "atom2_serNum": 201, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///A/262/O2'", "atom2_id": "///A/263/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 201, "atom2_serNum": 247, "donAcc_type": "questionable", "distance": 3.387, "atom1_id": "///A/263/OP2", "atom2_id": "///A/264/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 202, "atom2_serNum": 235, "donAcc_type": "questionable", "distance": 2.244, "atom1_id": "///A/263/O5'", "atom2_id": "///A/264/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 216, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/263/O6", "atom2_id": "///A/294/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 217, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/263/N1", "atom2_id": "///A/294/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 219, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/263/N2", "atom2_id": "///A/294/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 250, "atom2_serNum": 823, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/264/O6", "atom2_id": "///A/293/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 251, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/264/N1", "atom2_id": "///A/293/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 253, "atom2_serNum": 820, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/264/N2", "atom2_id": "///A/293/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 277, "atom2_serNum": 301, "donAcc_type": "acceptable", "distance": 2.584, "atom1_id": "///A/265/O2'", "atom2_id": "///A/266/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 277, "atom2_serNum": 304, "donAcc_type": "acceptable", "distance": 2.275, "atom1_id": "///A/265/O2'", "atom2_id": "///A/266/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 281, "atom2_serNum": 792, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/265/O2", "atom2_id": "///A/292/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 282, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/265/N3", "atom2_id": "///A/292/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 284, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/265/N4", "atom2_id": "///A/292/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 308, "atom2_serNum": 330, "donAcc_type": "acceptable", "distance": 2.332, "atom1_id": "///A/266/O2'", "atom2_id": "///A/267/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 312, "atom2_serNum": 792, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/266/O2", "atom2_id": "///A/292/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 313, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/266/N3", "atom2_id": "///A/292/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 339, "atom2_serNum": 374, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///A/267/O2'", "atom2_id": "///A/268/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 339, "atom2_serNum": 408, "donAcc_type": "acceptable", "distance": 3.779, "atom1_id": "///A/267/O2'", "atom2_id": "///A/269/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 343, "atom2_serNum": 377, "donAcc_type": "questionable", "distance": 3.214, "atom1_id": "///A/267/O2", "atom2_id": "///A/268/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 343, "atom2_serNum": 411, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/267/O2", "atom2_id": "///A/269/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 370, "atom2_serNum": 400, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///A/268/O2'", "atom2_id": "///A/269/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 377, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/268/O6", "atom2_id": "///A/288/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 378, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/268/N1", "atom2_id": "///A/288/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 380, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/268/N2", "atom2_id": "///A/288/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 404, "atom2_serNum": 430, "donAcc_type": "acceptable", "distance": 2.286, "atom1_id": "///A/269/O2'", "atom2_id": "///A/270/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 404, "atom2_serNum": 433, "donAcc_type": "acceptable", "distance": 2.473, "atom1_id": "///A/269/O2'", "atom2_id": "///A/270/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 411, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/269/N6", "atom2_id": "///A/287/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 412, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/269/N1", "atom2_id": "///A/287/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 441, "atom2_serNum": 603, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/270/O2", "atom2_id": "///A/286/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 442, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/270/N3", "atom2_id": "///A/286/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 444, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/270/N4", "atom2_id": "///A/286/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 468, "atom2_serNum": 491, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///A/271/O2'", "atom2_id": "///A/272/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 472, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/271/O2", "atom2_id": "///A/285/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 498, "atom2_serNum": 563, "donAcc_type": "acceptable", "distance": 2.800, "atom1_id": "///A/272/O2'", "atom2_id": "///A/285/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 498, "atom2_serNum": 566, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/272/O2'", "atom2_id": "///A/285/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 528, "atom2_serNum": 532, "donAcc_type": "acceptable", "distance": 2.538, "atom1_id": "///A/284/O2'", "atom2_id": "///A/284/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 559, "atom2_serNum": 584, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///A/285/O2'", "atom2_id": "///A/286/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 559, "atom2_serNum": 585, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///A/285/O2'", "atom2_id": "///A/286/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 657, "atom2_serNum": 684, "donAcc_type": "acceptable", "distance": 2.099, "atom1_id": "///A/288/O2'", "atom2_id": "///A/289/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 688, "atom2_serNum": 714, "donAcc_type": "acceptable", "distance": 2.222, "atom1_id": "///A/289/O2'", "atom2_id": "///A/290/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 688, "atom2_serNum": 717, "donAcc_type": "acceptable", "distance": 2.247, "atom1_id": "///A/289/O2'", "atom2_id": "///A/290/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 721, "atom2_serNum": 743, "donAcc_type": "acceptable", "distance": 2.337, "atom1_id": "///A/290/O2'", "atom2_id": "///A/291/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 752, "atom2_serNum": 778, "donAcc_type": "acceptable", "distance": 2.289, "atom1_id": "///A/291/O2'", "atom2_id": "///A/292/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 878, "atom2_serNum": 904, "donAcc_type": "acceptable", "distance": 2.801, "atom1_id": "///A/295/O2'", "atom2_id": "///A/296/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 878, "atom2_serNum": 907, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///A/295/O2'", "atom2_id": "///A/296/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 973, "atom2_serNum": 999, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///A/298/O2'", "atom2_id": "///A/299/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1z31", "num_naChains": 1, "naChains": "A=32", "num_atoms": 1024, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 9, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 10, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 11, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 12, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }