{ "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.274, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.637, "chi2": -105.677, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.751, "C1C1_dist": 10.656, "N1N9_dist": 9.007, "C6C8_dist": 9.992, "CNNC_torsion": -12.368, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.14]", "interBase_angle": 15.256, "planarity": 0.216, "simple_Shear": 0.411, "simple_Stretch": 0.021, "simple_Buckle": -11.243, "simple_Propeller": -10.313, "bp_simpleParams": [ 0.411, 0.021, 0.211, -11.243, -10.313, 2.396 ], "bp_params": [ 0.412, 0.004, 0.211, -11.658, -9.841, 2.392 ], "frame": { "rmsd": null, "origin": [ 12.405, 56.842, 80.469 ], "x_axis": [ 0.135, 0.570, -0.811 ], "y_axis": [ 0.880, -0.446, -0.167 ], "z_axis": [ -0.456, -0.691, -0.561 ], "quaternion": [ 0.179, 0.732, 0.495, -0.433 ] } }, { "index": 2, "nt1": "///C/2", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.035, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.672, "chi2": -109.176, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.142, "C1C1_dist": 10.584, "N1N9_dist": 8.865, "C6C8_dist": 9.805, "CNNC_torsion": -12.416, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 10.365, "planarity": 0.140, "simple_Shear": 0.349, "simple_Stretch": -0.216, "simple_Buckle": -2.175, "simple_Propeller": -10.134, "bp_simpleParams": [ 0.349, -0.216, 0.031, -2.175, -10.134, 0.258 ], "bp_params": [ 0.342, -0.227, 0.031, -2.482, -10.063, 0.259 ], "frame": { "rmsd": null, "origin": [ 10.551, 55.020, 78.750 ], "x_axis": [ 0.625, 0.282, -0.728 ], "y_axis": [ 0.617, -0.749, 0.239 ], "z_axis": [ -0.479, -0.599, -0.642 ], "quaternion": [ 0.241, 0.868, 0.259, -0.348 ] } }, { "index": 3, "nt1": "///C/3", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -107.618, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.690, "chi2": -144.210, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.493, "C1C1_dist": 10.265, "N1N9_dist": 8.740, "C6C8_dist": 9.851, "CNNC_torsion": -11.221, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.40],N3-N1(imino)[2.80],N4(amino)-O6(carbonyl)[3.12]", "interBase_angle": 17.775, "planarity": 0.209, "simple_Shear": 0.026, "simple_Stretch": -0.102, "simple_Buckle": 11.635, "simple_Propeller": -13.439, "bp_simpleParams": [ 0.026, -0.102, -0.156, 11.635, -13.439, 8.379 ], "bp_params": [ 0.027, -0.102, -0.156, 11.741, -13.346, 8.392 ], "frame": { "rmsd": null, "origin": [ 9.866, 53.509, 76.296 ], "x_axis": [ 0.942, 0.000, -0.335 ], "y_axis": [ 0.173, -0.856, 0.487 ], "z_axis": [ -0.287, -0.517, -0.807 ], "quaternion": [ 0.264, 0.949, 0.046, -0.164 ] } }, { "index": 4, "nt1": "///C/4", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -107.000, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.437, "chi2": -170.899, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.171, "C1C1_dist": 10.751, "N1N9_dist": 9.009, "C6C8_dist": 9.918, "CNNC_torsion": -9.156, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.00],N3-N1(imino)[3.09],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 12.558, "planarity": 0.144, "simple_Shear": 0.870, "simple_Stretch": -0.052, "simple_Buckle": 8.284, "simple_Propeller": -9.438, "bp_simpleParams": [ 0.870, -0.052, -0.135, 8.284, -9.438, -0.328 ], "bp_params": [ 0.863, -0.121, -0.135, 7.505, -10.068, -0.329 ], "frame": { "rmsd": null, "origin": [ 8.369, 52.330, 73.327 ], "x_axis": [ 0.857, -0.484, 0.174 ], "y_axis": [ -0.477, -0.619, 0.624 ], "z_axis": [ -0.194, -0.618, -0.762 ], "quaternion": [ 0.345, 0.900, -0.267, -0.006 ] } }, { "index": 5, "nt1": "///C/5", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -107.212, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.433, "chi2": -94.668, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.080, "C1C1_dist": 10.447, "N1N9_dist": 8.767, "C6C8_dist": 9.735, "CNNC_torsion": -5.217, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.84]", "interBase_angle": 6.783, "planarity": 0.094, "simple_Shear": -0.199, "simple_Stretch": -0.217, "simple_Buckle": 2.303, "simple_Propeller": -6.380, "bp_simpleParams": [ -0.199, -0.217, -0.192, 2.303, -6.380, 0.896 ], "bp_params": [ -0.193, -0.222, -0.192, 2.461, -6.321, 0.897 ], "frame": { "rmsd": null, "origin": [ 7.887, 50.709, 70.295 ], "x_axis": [ 0.569, -0.694, 0.442 ], "y_axis": [ -0.807, -0.370, 0.460 ], "z_axis": [ -0.156, -0.618, -0.770 ], "quaternion": [ 0.328, 0.823, -0.456, 0.087 ] } }, { "index": 6, "nt1": "///C/6", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -117.967, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.271, "chi2": -130.425, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.899, "C1C1_dist": 10.662, "N1N9_dist": 8.924, "C6C8_dist": 9.884, "CNNC_torsion": -7.408, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.84]", "interBase_angle": 6.168, "planarity": 0.097, "simple_Shear": 0.545, "simple_Stretch": -0.057, "simple_Buckle": -2.700, "simple_Propeller": -5.546, "bp_simpleParams": [ 0.545, -0.057, 0.080, -2.700, -5.546, 0.394 ], "bp_params": [ 0.541, -0.090, 0.080, -3.028, -5.374, 0.395 ], "frame": { "rmsd": null, "origin": [ 7.511, 48.495, 67.622 ], "x_axis": [ -0.108, -0.721, 0.684 ], "y_axis": [ -0.970, 0.227, 0.086 ], "z_axis": [ -0.217, -0.655, -0.724 ], "quaternion": [ -0.314, -0.589, 0.717, -0.198 ] } }, { "index": 7, "nt1": "///C/7", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -103.822, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.972, "chi2": -159.642, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.153, "C1C1_dist": 10.789, "N1N9_dist": 9.138, "C6C8_dist": 10.126, "CNNC_torsion": -10.187, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.22],N1(imino)-N3[3.07],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 14.438, "planarity": 0.192, "simple_Shear": 0.072, "simple_Stretch": 0.091, "simple_Buckle": -0.249, "simple_Propeller": -14.435, "bp_simpleParams": [ 0.072, 0.091, 0.324, -0.249, -14.435, 1.993 ], "bp_params": [ 0.073, 0.090, 0.324, -0.424, -14.431, 2.009 ], "frame": { "rmsd": null, "origin": [ 7.314, 45.684, 65.908 ], "x_axis": [ -0.541, -0.392, 0.744 ], "y_axis": [ -0.780, 0.564, -0.271 ], "z_axis": [ -0.314, -0.727, -0.611 ], "quaternion": [ -0.321, -0.355, 0.824, -0.303 ] } }, { "index": 8, "nt1": "///C/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -99.113, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.743, "chi2": -83.578, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.057, "C1C1_dist": 10.675, "N1N9_dist": 8.975, "C6C8_dist": 9.872, "CNNC_torsion": 11.877, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 5.120, "planarity": 0.088, "simple_Shear": 0.115, "simple_Stretch": -0.151, "simple_Buckle": 5.052, "simple_Propeller": 0.836, "bp_simpleParams": [ 0.115, -0.151, -0.246, 5.052, 0.836, -2.274 ], "bp_params": [ 0.114, -0.152, -0.246, 5.058, 0.798, -2.271 ], "frame": { "rmsd": null, "origin": [ 6.370, 42.969, 64.417 ], "x_axis": [ -0.861, -0.085, 0.501 ], "y_axis": [ -0.436, 0.630, -0.643 ], "z_axis": [ -0.261, -0.772, -0.580 ], "quaternion": [ -0.217, -0.148, 0.876, -0.404 ] } }, { "index": 9, "nt1": "///C/9", "nt2": "///C/12", "bp": "T+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -123.949, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.810, "chi2": 76.101, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 51.944, "C1C1_dist": 8.131, "N1N9_dist": 6.589, "C6C8_dist": 6.146, "CNNC_torsion": -17.625, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.84],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 19.773, "planarity": 0.249, "simple_Shear": -2.973, "simple_Stretch": 1.785, "simple_Buckle": 19.405, "simple_Propeller": -3.799, "bp_simpleParams": [ -2.973, 1.785, -0.041, 19.405, -3.799, -64.602 ], "bp_params": [ -0.280, 3.456, -0.041, 8.244, -17.972, -65.110 ], "frame": { "rmsd": null, "origin": [ 3.935, 39.828, 64.369 ], "x_axis": [ -0.665, 0.652, -0.363 ], "y_axis": [ 0.649, 0.264, -0.714 ], "z_axis": [ -0.370, -0.710, -0.599 ], "quaternion": [ -0.002, 0.409, 0.795, -0.448 ] } }, { "index": 10, "nt1": "///D/1", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.871, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.875, "chi2": -105.618, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.519, "C1C1_dist": 10.676, "N1N9_dist": 8.944, "C6C8_dist": 9.839, "CNNC_torsion": -11.016, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 13.883, "planarity": 0.187, "simple_Shear": 0.233, "simple_Stretch": -0.139, "simple_Buckle": -11.917, "simple_Propeller": -7.122, "bp_simpleParams": [ 0.233, -0.139, 0.348, -11.917, -7.122, -1.839 ], "bp_params": [ 0.230, -0.144, 0.348, -12.079, -6.843, -1.832 ], "frame": { "rmsd": null, "origin": [ 15.895, 57.389, 33.524 ], "x_axis": [ -0.005, -0.594, 0.804 ], "y_axis": [ 0.859, 0.409, 0.307 ], "z_axis": [ -0.511, 0.693, 0.509 ], "quaternion": [ 0.692, -0.139, -0.476, -0.526 ] } }, { "index": 11, "nt1": "///D/2", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.280, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.090, "chi2": -107.876, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.482, "C1C1_dist": 10.611, "N1N9_dist": 8.807, "C6C8_dist": 9.623, "CNNC_torsion": -15.465, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.94],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 12.642, "planarity": 0.180, "simple_Shear": 0.690, "simple_Stretch": -0.366, "simple_Buckle": -7.097, "simple_Propeller": -10.462, "bp_simpleParams": [ 0.690, -0.366, 0.508, -7.097, -10.462, -5.692 ], "bp_params": [ 0.664, -0.412, 0.508, -7.787, -9.959, -5.700 ], "frame": { "rmsd": null, "origin": [ 13.679, 59.295, 35.081 ], "x_axis": [ 0.520, -0.263, 0.812 ], "y_axis": [ 0.675, 0.709, -0.203 ], "z_axis": [ -0.523, 0.654, 0.547 ], "quaternion": [ 0.833, -0.257, -0.401, -0.282 ] } }, { "index": 12, "nt1": "///D/3", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -111.197, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.435, "chi2": -143.514, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.114, "C1C1_dist": 10.386, "N1N9_dist": 8.810, "C6C8_dist": 9.880, "CNNC_torsion": -15.317, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.50],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 17.186, "planarity": 0.224, "simple_Shear": -0.099, "simple_Stretch": -0.110, "simple_Buckle": 7.839, "simple_Propeller": -15.294, "bp_simpleParams": [ -0.099, -0.110, 0.195, 7.839, -15.294, 5.536 ], "bp_params": [ -0.097, -0.112, 0.195, 8.104, -15.156, 5.571 ], "frame": { "rmsd": null, "origin": [ 12.532, 60.546, 37.472 ], "x_axis": [ 0.881, -0.035, 0.471 ], "y_axis": [ 0.284, 0.836, -0.470 ], "z_axis": [ -0.378, 0.548, 0.747 ], "quaternion": [ 0.931, -0.273, -0.228, -0.086 ] } }, { "index": 13, "nt1": "///D/4", "nt2": "///D/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -111.650, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.046, "chi2": -173.202, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.338, "C1C1_dist": 10.929, "N1N9_dist": 9.097, "C6C8_dist": 9.917, "CNNC_torsion": -10.256, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.08],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 14.638, "planarity": 0.180, "simple_Shear": 0.246, "simple_Stretch": -0.081, "simple_Buckle": 6.082, "simple_Propeller": -13.314, "bp_simpleParams": [ 0.246, -0.081, 0.078, 6.082, -13.314, -4.836 ], "bp_params": [ 0.244, -0.085, 0.078, 5.827, -13.428, -4.863 ], "frame": { "rmsd": null, "origin": [ 10.695, 61.758, 40.281 ], "x_axis": [ 0.888, 0.460, 0.002 ], "y_axis": [ -0.319, 0.620, -0.717 ], "z_axis": [ -0.331, 0.636, 0.697 ], "quaternion": [ 0.895, -0.378, -0.093, 0.218 ] } }, { "index": 14, "nt1": "///D/5", "nt2": "///D/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -109.323, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.713, "chi2": -97.380, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.161, "C1C1_dist": 10.391, "N1N9_dist": 8.722, "C6C8_dist": 9.715, "CNNC_torsion": -7.465, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.67],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 2.702, "planarity": 0.046, "simple_Shear": -0.709, "simple_Stretch": -0.215, "simple_Buckle": -2.607, "simple_Propeller": -0.713, "bp_simpleParams": [ -0.709, -0.215, 0.116, -2.607, -0.713, 1.738 ], "bp_params": [ -0.690, -0.268, 0.116, -2.545, -0.909, 1.738 ], "frame": { "rmsd": null, "origin": [ 9.988, 63.676, 43.271 ], "x_axis": [ 0.663, 0.681, -0.311 ], "y_axis": [ -0.681, 0.375, -0.629 ], "z_axis": [ -0.312, 0.629, 0.712 ], "quaternion": [ 0.829, -0.379, -0.000, 0.411 ] } }, { "index": 15, "nt1": "///D/6", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -108.961, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.974, "chi2": -127.573, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.058, "C1C1_dist": 10.745, "N1N9_dist": 9.037, "C6C8_dist": 10.000, "CNNC_torsion": -4.257, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.98]", "interBase_angle": 5.643, "planarity": 0.076, "simple_Shear": 0.142, "simple_Stretch": 0.042, "simple_Buckle": 1.173, "simple_Propeller": -5.520, "bp_simpleParams": [ 0.142, 0.042, -0.094, 1.173, -5.520, 0.399 ], "bp_params": [ 0.143, 0.040, -0.094, 1.066, -5.542, 0.400 ], "frame": { "rmsd": null, "origin": [ 9.293, 65.935, 45.431 ], "x_axis": [ 0.069, 0.721, -0.690 ], "y_axis": [ -0.959, -0.143, -0.245 ], "z_axis": [ -0.275, 0.678, 0.681 ], "quaternion": [ 0.634, -0.364, 0.164, 0.663 ] } }, { "index": 16, "nt1": "///D/7", "nt2": "///D/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -105.045, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.615, "chi2": -162.329, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.571, "C1C1_dist": 10.693, "N1N9_dist": 9.059, "C6C8_dist": 10.071, "CNNC_torsion": -9.182, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.17],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 12.086, "planarity": 0.160, "simple_Shear": -0.178, "simple_Stretch": 0.044, "simple_Buckle": 3.589, "simple_Propeller": -11.541, "bp_simpleParams": [ -0.178, 0.044, 0.252, 3.589, -11.541, 3.052 ], "bp_params": [ -0.179, 0.041, 0.252, 3.753, -11.489, 3.066 ], "frame": { "rmsd": null, "origin": [ 8.885, 68.558, 47.390 ], "x_axis": [ -0.397, 0.427, -0.813 ], "y_axis": [ -0.832, -0.540, 0.123 ], "z_axis": [ -0.387, 0.725, 0.570 ], "quaternion": [ 0.398, -0.379, 0.268, 0.792 ] } }, { "index": 17, "nt1": "///D/8", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -103.132, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.888, "chi2": -82.346, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.708, "C1C1_dist": 10.591, "N1N9_dist": 8.947, "C6C8_dist": 9.916, "CNNC_torsion": 10.748, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.309, "planarity": 0.077, "simple_Shear": 0.104, "simple_Stretch": -0.116, "simple_Buckle": 3.290, "simple_Propeller": 0.360, "bp_simpleParams": [ 0.104, -0.116, -0.263, 3.290, 0.360, 1.016 ], "bp_params": [ 0.104, -0.116, -0.263, 3.292, 0.340, 1.015 ], "frame": { "rmsd": null, "origin": [ 7.566, 71.266, 48.813 ], "x_axis": [ -0.790, 0.090, -0.606 ], "y_axis": [ -0.518, -0.627, 0.582 ], "z_axis": [ -0.328, 0.774, 0.542 ], "quaternion": [ 0.177, -0.271, 0.394, 0.860 ] } }, { "index": 18, "nt1": "///D/9", "nt2": "///D/12", "bp": "T+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -121.104, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.277, "chi2": 74.127, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 53.480, "C1C1_dist": 8.135, "N1N9_dist": 6.567, "C6C8_dist": 6.087, "CNNC_torsion": -16.991, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.80],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 19.201, "planarity": 0.239, "simple_Shear": -3.205, "simple_Stretch": 1.742, "simple_Buckle": 19.184, "simple_Propeller": -0.794, "bp_simpleParams": [ -3.205, 1.742, -0.006, 19.184, -0.794, -66.007 ], "bp_params": [ -0.592, 3.599, -0.006, 11.155, -15.628, -66.249 ], "frame": { "rmsd": null, "origin": [ 5.229, 74.497, 48.587 ], "x_axis": [ -0.718, -0.652, 0.244 ], "y_axis": [ 0.544, -0.307, 0.781 ], "z_axis": [ -0.435, 0.693, 0.575 ], "quaternion": [ -0.371, -0.059, 0.457, 0.806 ] } }, { "index": 19, "nt1": "///D/10", "nt2": "///D/13", "bp": "T-G", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW-m", "intra_chain": true, "chi1": -153.282, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.229, "chi2": -82.346, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 92.428, "C1C1_dist": 6.928, "N1N9_dist": 6.277, "C6C8_dist": 8.189, "CNNC_torsion": 106.865, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)*O4'[3.19],N3(imino)-N3[3.07],O4(carbonyl)-N2(amino)[3.06]", "interBase_angle": 84.828, "planarity": 1.093, "simple_Shear": -2.628, "simple_Stretch": 2.284, "simple_Buckle": 37.578, "simple_Propeller": 76.051, "bp_simpleParams": [ -2.628, 2.284, -2.887, 37.578, 76.051, 87.412 ], "bp_params": [ -3.381, 0.833, -2.887, -5.889, 84.623, 104.464 ], "frame": { "rmsd": null, "origin": [ 9.613, 72.195, 49.136 ], "x_axis": [ -0.434, -0.834, -0.340 ], "y_axis": [ 0.338, -0.501, 0.797 ], "z_axis": [ -0.835, 0.231, 0.500 ], "quaternion": [ -0.376, -0.377, 0.329, 0.780 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "CTG", "nts_long": "///D/8,///D/10,///D/13", "planarity": 1.058 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "CCCCTAGCT", "strand2": "GGGGATCGA", "bp_type": "||||||||.", "helix_form": ".B.xB.B.", "helical_rise": 3.334, "helical_rise_std": 0.427, "helical_radius": 9.147, "helical_radius_std": 0.989, "helical_axis": [ -0.289, -0.663, -0.691 ], "point1": [ 12.422, 58.577, 80.154 ], "point2": [ 4.649, 40.727, 61.559 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, 0.004, 0.211, -11.658, -9.841, 2.392 ], "step_params": [ -0.198, -0.421, 3.081, 4.452, 5.540, 32.930 ], "heli_params": [ -1.565, 1.016, 2.922, 9.633, -7.742, 33.667 ], "bp2_params": [ 0.342, -0.227, 0.031, -2.482, -10.063, 0.259 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.081, "simple_Twist": 33.599, "simple_hRise": 2.927, "simple_hTwist": 34.321 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.342, -0.227, 0.031, -2.482, -10.063, 0.259 ], "step_params": [ 0.559, -0.050, 2.909, 3.013, 14.966, 30.212 ], "heli_params": [ -2.265, -0.524, 2.637, 26.679, -5.372, 33.770 ], "bp2_params": [ 0.027, -0.102, -0.156, 11.741, -13.346, 8.392 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.909, "simple_Twist": 32.437, "simple_hRise": 2.672, "simple_hTwist": 35.763 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.102, -0.156, 11.741, -13.346, 8.392 ], "step_params": [ -0.822, -0.662, 3.365, -5.244, 6.410, 41.034 ], "heli_params": [ -1.619, 0.586, 3.306, 9.034, 7.391, 41.826 ], "bp2_params": [ 0.863, -0.121, -0.135, 7.505, -10.068, -0.329 ], "groove_widths": [ 13.828, null, 16.480, null ], "simple_Rise": 3.365, "simple_Twist": 36.340, "simple_hRise": 3.289, "simple_hTwist": 37.241 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.863, -0.121, -0.135, 7.505, -10.068, -0.329 ], "step_params": [ -0.343, -0.557, 3.410, 1.697, 1.460, 25.697 ], "heli_params": [ -1.669, 1.259, 3.344, 3.274, -3.807, 25.792 ], "bp2_params": [ -0.193, -0.222, -0.192, 2.461, -6.321, 0.897 ], "groove_widths": [ 13.447, 13.307, 14.906, 13.983 ], "simple_Rise": 3.410, "simple_Twist": 31.231, "simple_hRise": 3.358, "simple_hTwist": 31.309 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.222, -0.192, 2.461, -6.321, 0.897 ], "step_params": [ 0.023, -0.282, 3.480, -4.276, 2.302, 42.172 ], "heli_params": [ -0.637, -0.494, 3.442, 3.186, 5.919, 42.438 ], "bp2_params": [ 0.541, -0.090, 0.080, -3.028, -5.374, 0.395 ], "groove_widths": [ 14.695, 14.028, 16.582, 16.466 ], "simple_Rise": 3.480, "simple_Twist": 38.089, "simple_hRise": 3.435, "simple_hTwist": 38.386 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.541, -0.090, 0.080, -3.028, -5.374, 0.395 ], "step_params": [ 0.439, -0.877, 3.148, -2.715, 9.093, 30.502 ], "heli_params": [ -3.116, -1.252, 2.732, 16.780, 5.010, 31.911 ], "bp2_params": [ 0.073, 0.090, 0.324, -0.424, -14.431, 2.009 ], "groove_widths": [ 15.255, null, 19.147, null ], "simple_Rise": 3.148, "simple_Twist": 33.110, "simple_hRise": 2.774, "simple_hTwist": 34.406 }, { "index": 7, "nt1": "///C/7", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.073, 0.090, 0.324, -0.424, -14.431, 2.009 ], "step_params": [ 0.362, -0.377, 3.196, 4.332, -0.393, 29.305 ], "heli_params": [ -0.656, 0.194, 3.220, -0.771, -8.503, 29.619 ], "bp2_params": [ 0.114, -0.152, -0.246, 5.058, 0.798, -2.271 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.196, "simple_Twist": 28.914, "simple_hRise": 3.220, "simple_hTwist": 29.232 }, { "index": 8, "nt1": "///C/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.114, -0.152, -0.246, 5.058, 0.798, -2.271 ], "step_params": [ 1.217, -2.124, 3.130, -2.044, 6.933, 70.083 ], "heli_params": [ -2.068, -1.122, 2.905, 6.022, 1.775, 70.407 ], "bp2_params": [ -0.280, 3.456, -0.041, 8.244, -17.972, -65.110 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.130, "simple_Twist": 29.597, "simple_hRise": 2.492, "simple_hTwist": 30.448 }, { "index": 9, "nt1": "///C/9", "nt2": "///C/12", "bp": "T+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M" } ] }, { "index": 2, "num_stems": 2, "strand1": "CCCCTAGCT", "strand2": "GGGGATCGA", "bp_type": "||||||||.", "helix_form": "...xB.B.", "helical_rise": 3.331, "helical_rise_std": 0.418, "helical_radius": 9.163, "helical_radius_std": 1.044, "helical_axis": [ -0.386, 0.681, 0.623 ], "point1": [ 15.982, 55.519, 34.287 ], "point2": [ 5.602, 73.809, 51.016 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.230, -0.144, 0.348, -12.079, -6.843, -1.832 ], "step_params": [ -0.153, -0.608, 3.252, 1.703, 2.665, 36.081 ], "heli_params": [ -1.347, 0.482, 3.190, 4.293, -2.744, 36.215 ], "bp2_params": [ 0.664, -0.412, 0.508, -7.787, -9.959, -5.700 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.252, "simple_Twist": 33.688, "simple_hRise": 3.185, "simple_hTwist": 33.832 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.664, -0.412, 0.508, -7.787, -9.959, -5.700 ], "step_params": [ 0.537, -0.493, 2.839, 4.776, 14.695, 28.209 ], "heli_params": [ -3.135, -0.243, 2.360, 27.680, -8.995, 32.089 ], "bp2_params": [ -0.097, -0.112, 0.195, 8.104, -15.156, 5.571 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.839, "simple_Twist": 33.000, "simple_hRise": 2.460, "simple_hTwist": 36.347 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.112, 0.195, 8.104, -15.156, 5.571 ], "step_params": [ -0.687, -0.833, 3.402, -5.677, 2.945, 39.808 ], "heli_params": [ -1.558, 0.327, 3.396, 4.291, 8.273, 40.298 ], "bp2_params": [ 0.244, -0.085, 0.078, 5.827, -13.428, -4.863 ], "groove_widths": [ 13.692, null, 16.362, null ], "simple_Rise": 3.402, "simple_Twist": 37.912, "simple_hRise": 3.394, "simple_hTwist": 38.428 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, -0.085, 0.078, 5.827, -13.428, -4.863 ], "step_params": [ 0.077, -0.727, 3.548, 1.369, 0.481, 25.699 ], "heli_params": [ -1.779, 0.244, 3.533, 1.081, -3.075, 25.740 ], "bp2_params": [ -0.690, -0.268, 0.116, -2.545, -0.909, 1.738 ], "groove_widths": [ 13.793, 13.646, 15.022, 14.108 ], "simple_Rise": 3.548, "simple_Twist": 30.612, "simple_hRise": 3.536, "simple_hTwist": 30.645 }, { "index": 5, "nt1": "///D/5", "nt2": "///D/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.690, -0.268, 0.116, -2.545, -0.909, 1.738 ], "step_params": [ 0.259, -0.161, 3.187, 0.686, 3.893, 41.149 ], "heli_params": [ -0.634, -0.295, 3.164, 5.523, -0.973, 41.330 ], "bp2_params": [ 0.143, 0.040, -0.094, 1.066, -5.542, 0.400 ], "groove_widths": [ 15.203, 14.645, 16.574, 16.459 ], "simple_Rise": 3.187, "simple_Twist": 36.438, "simple_hRise": 3.158, "simple_hTwist": 36.644 }, { "index": 6, "nt1": "///D/6", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.143, 0.040, -0.094, 1.066, -5.542, 0.400 ], "step_params": [ 0.147, -0.739, 3.212, -5.420, 7.732, 31.920 ], "heli_params": [ -2.524, -1.121, 2.896, 13.690, 9.596, 33.253 ], "bp2_params": [ -0.179, 0.041, 0.252, 3.753, -11.489, 3.066 ], "groove_widths": [ 15.208, null, 19.250, null ], "simple_Rise": 3.212, "simple_Twist": 33.955, "simple_hRise": 2.922, "simple_hTwist": 35.206 }, { "index": 7, "nt1": "///D/7", "nt2": "///D/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.179, 0.041, 0.252, 3.753, -11.489, 3.066 ], "step_params": [ 0.453, -0.194, 3.295, 4.630, -0.165, 32.386 ], "heli_params": [ -0.316, 0.009, 3.327, -0.293, -8.248, 32.707 ], "bp2_params": [ 0.104, -0.116, -0.263, 3.292, 0.340, 1.015 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.295, "simple_Twist": 30.431, "simple_hRise": 3.327, "simple_hTwist": 30.773 }, { "index": 8, "nt1": "///D/8", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.104, -0.116, -0.263, 3.292, 0.340, 1.015 ], "step_params": [ 1.158, -2.177, 3.142, -4.064, 6.765, 68.607 ], "heli_params": [ -2.151, -1.160, 2.879, 5.982, 3.594, 69.004 ], "bp2_params": [ -0.592, 3.599, -0.006, 11.155, -15.628, -66.249 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.142, "simple_Twist": 30.069, "simple_hRise": 2.432, "simple_hTwist": 31.065 }, { "index": 9, "nt1": "///D/9", "nt2": "///D/12", "bp": "T+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CCCC", "strand2": "GGGG", "bp_type": "||||", "helix_form": ".B.", "helical_rise": 3.515, "helical_rise_std": 0.398, "helical_radius": 9.257, "helical_radius_std": 0.533, "helical_axis": [ -0.337, -0.637, -0.694 ], "point1": [ 13.034, 57.987, 80.509 ], "point2": [ 9.392, 51.110, 73.017 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, 0.004, 0.211, -11.658, -9.841, 2.392 ], "step_params": [ -0.198, -0.421, 3.081, 4.452, 5.540, 32.930 ], "heli_params": [ -1.565, 1.016, 2.922, 9.633, -7.742, 33.667 ], "bp2_params": [ 0.342, -0.227, 0.031, -2.482, -10.063, 0.259 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.081, "simple_Twist": 33.599, "simple_hRise": 2.927, "simple_hTwist": 34.321 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.342, -0.227, 0.031, -2.482, -10.063, 0.259 ], "step_params": [ 0.559, -0.050, 2.909, 3.013, 14.966, 30.212 ], "heli_params": [ -2.265, -0.524, 2.637, 26.679, -5.372, 33.770 ], "bp2_params": [ 0.027, -0.102, -0.156, 11.741, -13.346, 8.392 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.909, "simple_Twist": 32.437, "simple_hRise": 2.672, "simple_hTwist": 35.763 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.102, -0.156, 11.741, -13.346, 8.392 ], "step_params": [ -0.822, -0.662, 3.365, -5.244, 6.410, 41.034 ], "heli_params": [ -1.619, 0.586, 3.306, 9.034, 7.391, 41.826 ], "bp2_params": [ 0.863, -0.121, -0.135, 7.505, -10.068, -0.329 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.365, "simple_Twist": 36.340, "simple_hRise": 3.289, "simple_hTwist": 37.241 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "TAGC", "strand2": "ATCG", "bp_type": "||||", "helix_form": "B.B", "helical_rise": 2.830, "helical_rise_std": 0.299, "helical_radius": 9.907, "helical_radius_std": 0.823, "helical_axis": [ -0.487, -0.549, -0.679 ], "point1": [ 8.089, 48.333, 71.095 ], "point2": [ 4.045, 43.768, 65.450 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/5", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.222, -0.192, 2.461, -6.321, 0.897 ], "step_params": [ 0.023, -0.282, 3.480, -4.276, 2.302, 42.172 ], "heli_params": [ -0.637, -0.494, 3.442, 3.186, 5.919, 42.438 ], "bp2_params": [ 0.541, -0.090, 0.080, -3.028, -5.374, 0.395 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.480, "simple_Twist": 38.089, "simple_hRise": 3.435, "simple_hTwist": 38.386 }, { "index": 2, "nt1": "///C/6", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.541, -0.090, 0.080, -3.028, -5.374, 0.395 ], "step_params": [ 0.439, -0.877, 3.148, -2.715, 9.093, 30.502 ], "heli_params": [ -3.116, -1.252, 2.732, 16.780, 5.010, 31.911 ], "bp2_params": [ 0.073, 0.090, 0.324, -0.424, -14.431, 2.009 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.148, "simple_Twist": 33.110, "simple_hRise": 2.774, "simple_hTwist": 34.406 }, { "index": 3, "nt1": "///C/7", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.073, 0.090, 0.324, -0.424, -14.431, 2.009 ], "step_params": [ 0.362, -0.377, 3.196, 4.332, -0.393, 29.305 ], "heli_params": [ -0.656, 0.194, 3.220, -0.771, -8.503, 29.619 ], "bp2_params": [ 0.114, -0.152, -0.246, 5.058, 0.798, -2.271 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.196, "simple_Twist": 28.914, "simple_hRise": 3.220, "simple_hTwist": 29.232 }, { "index": 4, "nt1": "///C/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCCC", "strand2": "GGGG", "bp_type": "||||", "helix_form": "...", "helical_rise": 3.491, "helical_rise_std": 0.417, "helical_radius": 9.288, "helical_radius_std": 0.537, "helical_axis": [ -0.433, 0.654, 0.620 ], "point1": [ 16.503, 56.027, 33.987 ], "point2": [ 11.871, 63.025, 40.619 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.230, -0.144, 0.348, -12.079, -6.843, -1.832 ], "step_params": [ -0.153, -0.608, 3.252, 1.703, 2.665, 36.081 ], "heli_params": [ -1.347, 0.482, 3.190, 4.293, -2.744, 36.215 ], "bp2_params": [ 0.664, -0.412, 0.508, -7.787, -9.959, -5.700 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.252, "simple_Twist": 33.688, "simple_hRise": 3.185, "simple_hTwist": 33.832 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.664, -0.412, 0.508, -7.787, -9.959, -5.700 ], "step_params": [ 0.537, -0.493, 2.839, 4.776, 14.695, 28.209 ], "heli_params": [ -3.135, -0.243, 2.360, 27.680, -8.995, 32.089 ], "bp2_params": [ -0.097, -0.112, 0.195, 8.104, -15.156, 5.571 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.839, "simple_Twist": 33.000, "simple_hRise": 2.460, "simple_hTwist": 36.347 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.112, 0.195, 8.104, -15.156, 5.571 ], "step_params": [ -0.687, -0.833, 3.402, -5.677, 2.945, 39.808 ], "heli_params": [ -1.558, 0.327, 3.396, 4.291, 8.273, 40.298 ], "bp2_params": [ 0.244, -0.085, 0.078, 5.827, -13.428, -4.863 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.402, "simple_Twist": 37.912, "simple_hRise": 3.394, "simple_hTwist": 38.428 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "TAGC", "strand2": "ATCG", "bp_type": "||||", "helix_form": "B.B", "helical_rise": 2.944, "helical_rise_std": 0.312, "helical_radius": 9.823, "helical_radius_std": 0.478, "helical_axis": [ -0.545, 0.592, 0.594 ], "point1": [ 10.660, 65.682, 42.421 ], "point2": [ 5.923, 70.828, 47.589 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///D/5", "nt2": "///D/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.690, -0.268, 0.116, -2.545, -0.909, 1.738 ], "step_params": [ 0.259, -0.161, 3.187, 0.686, 3.893, 41.149 ], "heli_params": [ -0.634, -0.295, 3.164, 5.523, -0.973, 41.330 ], "bp2_params": [ 0.143, 0.040, -0.094, 1.066, -5.542, 0.400 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.187, "simple_Twist": 36.438, "simple_hRise": 3.158, "simple_hTwist": 36.644 }, { "index": 2, "nt1": "///D/6", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.143, 0.040, -0.094, 1.066, -5.542, 0.400 ], "step_params": [ 0.147, -0.739, 3.212, -5.420, 7.732, 31.920 ], "heli_params": [ -2.524, -1.121, 2.896, 13.690, 9.596, 33.253 ], "bp2_params": [ -0.179, 0.041, 0.252, 3.753, -11.489, 3.066 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 33.955, "simple_hRise": 2.922, "simple_hTwist": 35.206 }, { "index": 3, "nt1": "///D/7", "nt2": "///D/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.179, 0.041, 0.252, 3.753, -11.489, 3.066 ], "step_params": [ 0.453, -0.194, 3.295, 4.630, -0.165, 32.386 ], "heli_params": [ -0.316, 0.009, 3.327, -0.293, -8.248, 32.707 ], "bp2_params": [ 0.104, -0.116, -0.263, 3.292, 0.340, 1.015 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.295, "simple_Twist": 30.431, "simple_hRise": 3.327, "simple_hTwist": 30.773 }, { "index": 4, "nt1": "///D/8", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 4 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CT", "nts_long": "///C/4,///C/5" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/12,///C/13" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/16,///C/18" }, { "index": 4, "num_nts": 2, "nts_short": "CT", "nts_long": "///D/4,///D/5" }, { "index": 5, "num_nts": 2, "nts_short": "AG", "nts_long": "///D/12,///D/13" }, { "index": 6, "num_nts": 2, "nts_short": "AG", "nts_long": "///D/16,///D/18" }, { "index": 7, "num_nts": 3, "nts_short": "CTT", "nts_long": "///C/8,///C/9,///C/11" }, { "index": 8, "num_nts": 3, "nts_short": "CTT", "nts_long": "///D/8,///D/9,///D/11" }, { "index": 9, "num_nts": 3, "nts_short": "RTF", "nts_long": "///A/52,///D/17,///A/75" }, { "index": 10, "num_nts": 3, "nts_short": "RTF", "nts_long": "///B/52,///C/17,///B/75" } ], "nonStack": { "num_nts": 2, "nts_short": "AA", "nts_long": "///C/22,///D/22" }, "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 2 ], "summary": "[1] 4 [C.8 C.13] 4", "num_nts": 6, "nts_short": "CTTTAG", "nts_long": "///C/8,///C/9,///C/10,///C/11,///C/12,///C/13", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "TTTA", "nts_long": "///C/9,///C/10,///C/11,///C/12" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 4 ], "summary": "[1] 4 [D.8 D.13] 4", "num_nts": 6, "nts_short": "CTTTAG", "nts_long": "///D/8,///D/9,///D/10,///D/11,///D/12,///D/13", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "TTTA", "nts_long": "///D/9,///D/10,///D/11,///D/12" } ] } ], "num_bulges": 2, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 0 1 [C.4 C.18 C.5 C.16] 4 4", "num_nts": 5, "nts_short": "CTATG", "nts_long": "///C/4,///C/5,///C/16,///C/17,///C/18", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///C/17" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 3, 4 ], "summary": "[2] 0 1 [D.4 D.18 D.5 D.16] 4 4", "num_nts": 5, "nts_short": "CTATG", "nts_long": "///D/4,///D/5,///D/16,///D/17,///D/18", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///D/17" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///C/22" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///D/22" } ], "num_splayUnits": 5, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///C/10,///C/11" }, { "index": 2, "num_nts": 3, "nts_short": "ATG", "nts_long": "///C/16,///C/17,///C/18" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///C/21,///C/22" }, { "index": 4, "num_nts": 3, "nts_short": "ATG", "nts_long": "///D/16,///D/17,///D/18" }, { "index": 5, "num_nts": 2, "nts_short": "GA", "nts_long": "///D/21,///D/22" } ], "dbn": { "all_chains": { "num_nts": 44, "num_chars": 45, "bseq": "CCCCTAGCTTTAGCTATGGGGA&CCCCTAGCTTTAGCTATGGGGA", "sstr": "((((((((....)))).)))).&((((((((....)))).)))).", "form": "ABBBB..B....BAB..A.B.-&A.B.BBBB....BAB..A.B.-" }, "chain_C": { "num_nts": 22, "num_chars": 22, "bseq": "CCCCTAGCTTTAGCTATGGGGA", "sstr": "((((((((....)))).)))).", "form": "ABBBB..B....BAB..A.B.-" }, "chain_D": { "num_nts": 22, "num_chars": 22, "bseq": "CCCCTAGCTTTAGCTATGGGGA", "sstr": "((((((((....)))).)))).", "form": "A.B.BBBB....BAB..A.B.-" } }, "chains": { "chain_C": { "num_nts": 22, "bseq": "CCCCTAGCTTTAGCTATGGGGA", "sstr": "((((((((....)))).)))).", "form": "ABBBB..B....BAB..A.B.-", "helical_rise": 0.462, "helical_rise_std": 2.769, "helical_axis": [ -0.710, 0.679, 0.186 ], "point1": [ 12.839, 51.608, 73.011 ], "point2": [ 6.064, 58.081, 74.780 ], "num_chars": 64, "suite": "C1aC1bC!!C!!T!!A!!G!!C!!T2zT!!T!!A!!G!!C1bT!!A!!T!!G1aG1bG!!G4pA" }, "chain_D": { "num_nts": 22, "bseq": "CCCCTAGCTTTAGCTATGGGGA", "sstr": "((((((((....)))).)))).", "form": "A.B.BBBB....BAB..A.B.-", "helical_rise": 0.448, "helical_rise_std": 2.768, "helical_axis": [ -0.677, -0.689, -0.259 ], "point1": [ 15.609, 62.597, 41.016 ], "point2": [ 9.306, 56.185, 38.607 ], "num_chars": 64, "suite": "C1aC1bC!!C!!T!!A!!G!!C!!T2zT!!T!!A!!G!!C1bT!!A!!T!!G1aG1bG!!G4pA" } }, "num_nts": 44, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 58.364, "delta": 85.222, "epsilon": -132.992, "zeta": -93.001, "epsilon_zeta": -39.991, "bb_type": "BI", "chi": -168.274, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.707, 0.913 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.298, "Dp": 4.566, "splay_angle": 18.787, "splay_distance": 3.005, "splay_ratio": 0.163, "d22": 4.602, "d64": 4.053, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 1.867, "v1": -23.885, "v2": 35.536, "v3": -35.590, "v4": 21.282, "amplitude": 36.947, "phase_angle": 15.883, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 12.386, 56.885, 80.242 ], "x_axis": [ 0.118, 0.499, -0.859 ], "y_axis": [ 0.920, -0.381, -0.094 ], "z_axis": [ -0.374, -0.778, -0.504 ], "quaternion": [ 0.242, 0.708, 0.501, -0.436 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -50.810, "beta": 150.555, "gamma": 55.213, "delta": 87.018, "epsilon": -163.302, "zeta": -66.529, "epsilon_zeta": -96.773, "bb_type": "BI", "chi": -150.035, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.871, -0.256 ], "P_xyz": [ 1.059, 9.106, -0.496 ], "form": "B", "ssZp": 3.715, "Dp": 4.219, "splay_angle": 17.281, "splay_distance": 2.826, "splay_ratio": 0.151, "d22": 4.157, "d64": 3.319, "eta": 167.976, "theta": -140.470, "eta_prime": -173.190, "theta_prime": -137.834, "eta_base": -135.072, "theta_base": -106.053, "v0": -3.413, "v1": -18.770, "v2": 32.384, "v3": -35.421, "v4": 24.501, "amplitude": 35.474, "phase_angle": 24.092, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.451, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ 10.581, 55.144, 78.588 ], "x_axis": [ 0.582, 0.226, -0.781 ], "y_axis": [ 0.627, -0.737, 0.254 ], "z_axis": [ -0.518, -0.638, -0.570 ], "quaternion": [ 0.262, 0.850, 0.251, -0.382 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.487, "beta": -176.388, "gamma": 56.825, "delta": 142.524, "epsilon": 175.555, "zeta": -100.472, "epsilon_zeta": -83.974, "bb_type": "BI", "chi": -107.618, "glyco_bond": "anti", "C5prime_xyz": [ -2.017, 8.285, -1.739 ], "P_xyz": [ 0.488, 9.016, -1.520 ], "form": "B", "ssZp": 2.324, "Dp": 2.191, "splay_angle": 20.885, "splay_distance": 3.415, "splay_ratio": 0.181, "d22": 4.292, "d64": 3.528, "eta": 162.435, "theta": -136.709, "eta_prime": -156.711, "theta_prime": -153.510, "eta_base": -113.896, "theta_base": -117.615, "v0": -18.857, "v1": 31.288, "v2": -31.249, "v3": 20.950, "v4": -1.461, "amplitude": 32.522, "phase_angle": 163.913, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.770, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 9.892, 53.593, 76.330 ], "x_axis": [ 0.909, -0.121, -0.399 ], "y_axis": [ 0.071, -0.898, 0.434 ], "z_axis": [ -0.411, -0.423, -0.808 ], "quaternion": [ 0.226, 0.951, -0.013, -0.213 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -62.568, "beta": -160.081, "gamma": 40.221, "delta": 141.367, "epsilon": -179.844, "zeta": -103.920, "epsilon_zeta": -75.924, "bb_type": "BI", "chi": -107.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.722, 8.170, -1.822 ], "P_xyz": [ 0.508, 9.349, -1.152 ], "form": "B", "ssZp": 2.186, "Dp": 2.239, "splay_angle": 20.759, "splay_distance": 3.512, "splay_ratio": 0.180, "d22": 4.389, "d64": 4.003, "eta": 168.313, "theta": -144.137, "eta_prime": -173.585, "theta_prime": -152.542, "eta_base": -128.953, "theta_base": -127.902, "v0": -14.600, "v1": 27.308, "v2": -28.862, "v3": 20.996, "v4": -4.152, "amplitude": 29.371, "phase_angle": 169.315, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 8.781, 52.200, 73.416 ], "x_axis": [ 0.840, -0.533, 0.103 ], "y_axis": [ -0.488, -0.659, 0.573 ], "z_axis": [ -0.237, -0.531, -0.813 ], "quaternion": [ 0.303, 0.910, -0.281, -0.037 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -53.580, "beta": -178.231, "gamma": 43.691, "delta": 136.443, "epsilon": 176.300, "zeta": -112.501, "epsilon_zeta": -71.198, "bb_type": "BI", "chi": -107.212, "glyco_bond": "anti", "C5prime_xyz": [ -2.359, 8.298, -1.864 ], "P_xyz": [ -0.149, 9.663, -1.629 ], "form": "B", "ssZp": 2.284, "Dp": 2.218, "splay_angle": 22.361, "splay_distance": 3.641, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 166.315, "theta": -152.808, "eta_prime": -169.404, "theta_prime": -163.804, "eta_base": -137.815, "theta_base": -112.548, "v0": -23.603, "v1": 34.176, "v2": -31.355, "v3": 18.309, "v4": 3.208, "amplitude": 34.284, "phase_angle": 156.142, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 7.937, 50.877, 70.275 ], "x_axis": [ 0.554, -0.729, 0.402 ], "y_axis": [ -0.815, -0.377, 0.440 ], "z_axis": [ -0.170, -0.571, -0.803 ], "quaternion": [ 0.306, 0.827, -0.467, 0.070 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.062, "beta": 175.241, "gamma": 44.208, "delta": 137.831, "epsilon": 179.194, "zeta": -82.385, "epsilon_zeta": -98.420, "bb_type": "BI", "chi": -117.967, "glyco_bond": "anti", "C5prime_xyz": [ -1.692, 8.465, -1.469 ], "P_xyz": [ 0.642, 9.354, -0.684 ], "form": ".", "ssZp": 1.867, "Dp": 2.117, "splay_angle": 18.813, "splay_distance": 3.333, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 174.411, "theta": -122.383, "eta_prime": -161.782, "theta_prime": -137.752, "eta_base": -105.271, "theta_base": -104.049, "v0": -17.797, "v1": 29.853, "v2": -30.067, "v3": 20.331, "v4": -1.687, "amplitude": 31.199, "phase_angle": 164.518, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ 7.517, 48.263, 67.775 ], "x_axis": [ -0.122, -0.750, 0.650 ], "y_axis": [ -0.964, 0.246, 0.103 ], "z_axis": [ -0.237, -0.614, -0.753 ], "quaternion": [ -0.305, -0.588, 0.728, -0.175 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.689, "beta": -169.322, "gamma": 39.551, "delta": 137.546, "epsilon": -165.167, "zeta": -119.389, "epsilon_zeta": -45.778, "bb_type": "BI", "chi": -103.822, "glyco_bond": "anti", "C5prime_xyz": [ -2.801, 8.260, -1.920 ], "P_xyz": [ -0.927, 10.103, -1.795 ], "form": ".", "ssZp": 2.475, "Dp": 2.300, "splay_angle": 17.069, "splay_distance": 2.974, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 158.235, "theta": -148.800, "eta_prime": -174.573, "theta_prime": -154.133, "eta_base": -130.014, "theta_base": -121.689, "v0": -30.429, "v1": 39.537, "v2": -33.177, "v3": 16.426, "v4": 8.552, "amplitude": 38.829, "phase_angle": 148.696, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 7.208, 45.578, 65.824 ], "x_axis": [ -0.590, -0.470, 0.656 ], "y_axis": [ -0.769, 0.575, -0.280 ], "z_axis": [ -0.246, -0.670, -0.701 ], "quaternion": [ -0.267, -0.366, 0.846, -0.280 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -47.583, "beta": 159.501, "gamma": 40.871, "delta": 138.467, "epsilon": -171.052, "zeta": -152.352, "epsilon_zeta": -18.701, "bb_type": "--", "chi": -99.113, "glyco_bond": "anti", "C5prime_xyz": [ -3.440, 8.158, -1.726 ], "P_xyz": [ -1.451, 9.767, -2.237 ], "form": "B", "ssZp": 2.995, "Dp": 2.494, "splay_angle": 21.114, "splay_distance": 3.352, "splay_ratio": 0.183, "d22": 4.423, "d64": 3.730, "eta": 158.562, "theta": -171.778, "eta_prime": -175.494, "theta_prime": 179.460, "eta_base": -136.776, "theta_base": -133.348, "v0": -37.514, "v1": 45.492, "v2": -35.139, "v3": 14.695, "v4": 13.881, "amplitude": 44.136, "phase_angle": 142.765, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.017, "origin": [ 6.386, 43.011, 64.566 ], "x_axis": [ -0.851, -0.091, 0.518 ], "y_axis": [ -0.464, 0.594, -0.657 ], "z_axis": [ -0.248, -0.799, -0.547 ], "quaternion": [ -0.221, -0.160, 0.865, -0.421 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -39.637, "beta": 144.670, "gamma": 60.531, "delta": 140.595, "epsilon": -164.424, "zeta": -85.030, "epsilon_zeta": -79.394, "bb_type": "BI", "chi": -123.949, "glyco_bond": "anti", "C5prime_xyz": [ -2.220, 8.625, -1.156 ], "P_xyz": [ 0.346, 9.090, -0.964 ], "form": ".", "ssZp": 1.891, "Dp": 2.050, "splay_angle": 37.259, "splay_distance": 5.778, "splay_ratio": 0.322, "d22": 6.712, "d64": 7.606, "eta": 176.509, "theta": -96.673, "eta_prime": -156.678, "theta_prime": -166.419, "eta_base": -109.757, "theta_base": 116.259, "v0": -25.716, "v1": 37.550, "v2": -34.662, "v3": 20.647, "v4": 2.944, "amplitude": 37.691, "phase_angle": 156.873, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 5.157, 40.208, 63.198 ], "x_axis": [ -0.941, 0.336, 0.027 ], "y_axis": [ 0.140, 0.463, -0.876 ], "z_axis": [ -0.307, -0.820, -0.482 ], "quaternion": [ -0.098, 0.140, 0.849, -0.499 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -167.690, "beta": 155.062, "gamma": 58.015, "delta": 142.982, "epsilon": -169.970, "zeta": -84.574, "epsilon_zeta": -85.396, "bb_type": "BI", "chi": -146.776, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.634, 0.378 ], "P_xyz": [ 0.835, 8.519, 1.180 ], "form": ".", "ssZp": 2.251, "Dp": 2.147, "splay_angle": 85.608, "splay_distance": 12.697, "splay_ratio": 0.680, "d22": 7.951, "d64": 10.186, "eta": 44.172, "theta": -73.067, "eta_prime": 89.236, "theta_prime": -99.682, "eta_base": 45.501, "theta_base": -87.263, "v0": -16.535, "v1": 29.632, "v2": -30.796, "v3": 21.850, "v4": -3.468, "amplitude": 31.532, "phase_angle": 167.594, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.152, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 10.722, 40.976, 64.550 ], "x_axis": [ 0.455, 0.871, -0.185 ], "y_axis": [ 0.117, -0.264, -0.957 ], "z_axis": [ -0.882, 0.414, -0.223 ], "quaternion": [ -0.492, 0.697, 0.355, -0.383 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -155.294, "beta": -132.273, "gamma": 152.245, "delta": 99.553, "epsilon": -84.622, "zeta": 81.542, "epsilon_zeta": 193.835, "bb_type": "--", "chi": 174.219, "glyco_bond": "anti", "C5prime_xyz": [ -2.571, 8.635, 1.312 ], "P_xyz": [ -0.065, 9.400, 1.437 ], "form": ".", "ssZp": 2.196, "Dp": 2.624, "splay_angle": 55.778, "splay_distance": 8.404, "splay_ratio": 0.527, "d22": null, "d64": null, "eta": -133.635, "theta": 80.293, "eta_prime": -111.683, "theta_prime": 73.767, "eta_base": -81.285, "theta_base": 119.703, "v0": -17.827, "v1": 0.058, "v2": 16.270, "v3": -27.335, "v4": 28.483, "amplitude": 28.952, "phase_angle": 55.808, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ -0.069, 41.496, 57.878 ], "x_axis": [ 0.314, 0.218, -0.924 ], "y_axis": [ 0.812, -0.566, 0.142 ], "z_axis": [ -0.492, -0.795, -0.355 ], "quaternion": [ 0.313, 0.748, 0.344, -0.474 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 90.457, "beta": -164.679, "gamma": 179.648, "delta": 149.459, "epsilon": 178.566, "zeta": -76.950, "epsilon_zeta": -104.484, "bb_type": "BI", "chi": 76.101, "glyco_bond": "syn", "C5prime_xyz": [ -4.412, 3.450, 2.067 ], "P_xyz": [ -3.480, 2.067, 4.117 ], "form": ".", "ssZp": -1.420, "Dp": 1.855, "splay_angle": 31.636, "splay_distance": 5.193, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 157.374, "theta": -139.899, "eta_prime": -171.922, "theta_prime": -159.741, "eta_base": -132.309, "theta_base": 135.110, "v0": -4.231, "v1": 22.149, "v2": -30.629, "v3": 28.628, "v4": -15.521, "amplitude": 31.168, "phase_angle": 190.675, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 2.713, 39.449, 65.539 ], "x_axis": [ -0.144, 0.803, -0.579 ], "y_axis": [ 0.895, -0.144, -0.422 ], "z_axis": [ -0.422, -0.579, -0.698 ], "quaternion": [ 0.060, 0.651, 0.652, -0.384 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -78.167, "beta": -176.672, "gamma": 52.074, "delta": 142.680, "epsilon": -162.641, "zeta": -145.732, "epsilon_zeta": -16.909, "bb_type": "--", "chi": -83.578, "glyco_bond": "anti", "C5prime_xyz": [ -3.378, 7.518, -2.542 ], "P_xyz": [ -1.429, 9.001, -3.453 ], "form": "B", "ssZp": 2.149, "Dp": 2.104, "splay_angle": 21.027, "splay_distance": 3.509, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 155.872, "theta": -172.145, "eta_prime": -164.374, "theta_prime": 163.779, "eta_base": 154.910, "theta_base": -152.892, "v0": -30.328, "v1": 41.378, "v2": -36.279, "v3": 19.835, "v4": 6.231, "amplitude": 40.897, "phase_angle": 152.509, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 6.354, 42.927, 64.269 ], "x_axis": [ -0.871, -0.077, 0.484 ], "y_axis": [ 0.407, -0.665, 0.626 ], "z_axis": [ 0.274, 0.743, 0.611 ], "quaternion": [ -0.136, 0.214, 0.386, 0.887 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.311, "beta": 129.852, "gamma": 72.381, "delta": 82.101, "epsilon": -162.607, "zeta": -87.211, "epsilon_zeta": -75.396, "bb_type": "BI", "chi": -159.642, "glyco_bond": "anti", "C5prime_xyz": [ -2.149, 9.016, 0.255 ], "P_xyz": [ 0.111, 9.574, -0.980 ], "form": "A", "ssZp": 4.288, "Dp": 4.296, "splay_angle": 20.637, "splay_distance": 3.287, "splay_ratio": 0.179, "d22": 4.509, "d64": 4.013, "eta": 160.848, "theta": -159.745, "eta_prime": 163.744, "theta_prime": -162.054, "eta_base": -143.943, "theta_base": -143.643, "v0": -13.848, "v1": -13.812, "v2": 34.386, "v3": -42.944, "v4": 35.713, "amplitude": 42.851, "phase_angle": 36.634, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ 7.420, 45.791, 65.992 ], "x_axis": [ -0.484, -0.307, 0.819 ], "y_axis": [ 0.790, -0.556, 0.258 ], "z_axis": [ 0.376, 0.772, 0.512 ], "quaternion": [ -0.343, 0.374, 0.323, 0.799 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -56.332, "beta": 171.353, "gamma": 65.754, "delta": 144.283, "epsilon": 176.825, "zeta": -89.356, "epsilon_zeta": -93.819, "bb_type": "BI", "chi": -130.425, "glyco_bond": "anti", "C5prime_xyz": [ -1.835, 8.698, -0.752 ], "P_xyz": [ 0.690, 9.227, -0.224 ], "form": "B", "ssZp": 2.088, "Dp": 2.221, "splay_angle": 21.023, "splay_distance": 3.392, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 166.738, "theta": -117.249, "eta_prime": -154.502, "theta_prime": -138.963, "eta_base": -127.063, "theta_base": -98.186, "v0": -22.811, "v1": 35.742, "v2": -34.630, "v3": 22.120, "v4": 0.281, "amplitude": 36.627, "phase_angle": 160.993, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.666, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 7.505, 48.726, 67.470 ], "x_axis": [ -0.095, -0.690, 0.717 ], "y_axis": [ 0.976, -0.207, -0.070 ], "z_axis": [ 0.196, 0.693, 0.693 ], "quaternion": [ 0.590, -0.323, -0.221, -0.706 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -80.141, "beta": -150.755, "gamma": 48.692, "delta": 146.643, "epsilon": -119.065, "zeta": -67.543, "epsilon_zeta": -51.523, "bb_type": "--", "chi": -94.668, "glyco_bond": "anti", "C5prime_xyz": [ -2.164, 7.780, -2.407 ], "P_xyz": [ -0.054, 9.255, -1.903 ], "form": ".", "ssZp": 0.588, "Dp": 1.252, "splay_angle": 137.087, "splay_distance": 19.452, "splay_ratio": 0.931, "d22": null, "d64": null, "eta": -174.291, "theta": -30.517, "eta_prime": -153.571, "theta_prime": -75.702, "eta_base": -105.782, "theta_base": -84.217, "v0": -16.506, "v1": 31.971, "v2": -34.484, "v3": 25.759, "v4": -6.001, "amplitude": 34.909, "phase_angle": 171.049, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ 7.838, 50.542, 70.315 ], "x_axis": [ 0.584, -0.655, 0.479 ], "y_axis": [ 0.800, 0.361, -0.480 ], "z_axis": [ 0.142, 0.663, 0.735 ], "quaternion": [ 0.818, -0.349, -0.103, -0.444 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,bulge,splayed-apart", "alpha": 140.470, "beta": -155.769, "gamma": -42.277, "delta": 129.304, "epsilon": -162.107, "zeta": 66.426, "epsilon_zeta": 131.467, "bb_type": "--", "chi": -90.288, "glyco_bond": "anti", "C5prime_xyz": [ -2.077, 7.581, -2.526 ], "P_xyz": [ -1.440, 9.877, -3.633 ], "form": ".", "ssZp": 1.672, "Dp": 2.957, "splay_angle": 174.576, "splay_distance": 19.087, "splay_ratio": 0.999, "d22": null, "d64": null, "eta": -74.545, "theta": -20.347, "eta_prime": -27.590, "theta_prime": -25.398, "eta_base": -7.419, "theta_base": -53.733, "v0": -11.562, "v1": 17.517, "v2": -16.644, "v3": 10.105, "v4": 0.902, "amplitude": 17.853, "phase_angle": 158.795, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ 18.366, 65.785, 64.384 ], "x_axis": [ -0.622, 0.729, -0.287 ], "y_axis": [ -0.783, -0.569, 0.252 ], "z_axis": [ 0.020, 0.381, 0.924 ], "quaternion": [ 0.428, -0.076, 0.179, 0.882 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -71.349, "beta": -150.208, "gamma": 67.972, "delta": 90.806, "epsilon": -160.682, "zeta": -50.916, "epsilon_zeta": -109.766, "bb_type": "BI", "chi": -170.899, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.600, 1.104 ], "P_xyz": [ 1.012, 8.485, 2.206 ], "form": "A", "ssZp": 4.199, "Dp": 4.354, "splay_angle": 22.703, "splay_distance": 3.690, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -130.757, "theta": -121.513, "eta_prime": -86.026, "theta_prime": -120.631, "eta_base": -35.383, "theta_base": -81.280, "v0": 3.367, "v1": -23.747, "v2": 33.971, "v3": -32.973, "v4": 18.725, "amplitude": 34.897, "phase_angle": 13.232, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 7.957, 52.460, 73.239 ], "x_axis": [ 0.871, -0.428, 0.241 ], "y_axis": [ 0.468, 0.575, -0.671 ], "z_axis": [ 0.149, 0.697, 0.701 ], "quaternion": [ 0.887, -0.386, -0.026, -0.252 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.739, "beta": -170.645, "gamma": 56.817, "delta": 90.490, "epsilon": -175.816, "zeta": -63.827, "epsilon_zeta": -111.989, "bb_type": "BI", "chi": -144.210, "glyco_bond": "anti", "C5prime_xyz": [ -1.635, 8.820, -0.544 ], "P_xyz": [ 0.867, 9.517, -0.112 ], "form": ".", "ssZp": 3.472, "Dp": 3.989, "splay_angle": 18.918, "splay_distance": 3.107, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 166.766, "theta": -148.248, "eta_prime": -166.715, "theta_prime": -142.736, "eta_base": -107.794, "theta_base": -124.462, "v0": -2.872, "v1": -17.771, "v2": 30.302, "v3": -33.034, "v4": 22.612, "amplitude": 33.068, "phase_angle": 23.601, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.393, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 9.839, 53.424, 76.262 ], "x_axis": [ 0.951, 0.123, -0.283 ], "y_axis": [ -0.266, 0.792, -0.549 ], "z_axis": [ 0.157, 0.598, 0.786 ], "quaternion": [ 0.939, -0.305, 0.117, 0.104 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.254, "beta": -164.240, "gamma": 59.814, "delta": 145.701, "epsilon": -170.557, "zeta": -109.399, "epsilon_zeta": -61.158, "bb_type": "BI", "chi": -109.176, "glyco_bond": "anti", "C5prime_xyz": [ -2.062, 8.317, -1.759 ], "P_xyz": [ 0.340, 9.248, -1.281 ], "form": "B", "ssZp": 2.149, "Dp": 2.183, "splay_angle": 19.116, "splay_distance": 3.227, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 167.412, "theta": -131.792, "eta_prime": -160.327, "theta_prime": -146.279, "eta_base": -135.561, "theta_base": -108.886, "v0": -22.191, "v1": 35.107, "v2": -34.122, "v3": 21.917, "v4": 0.013, "amplitude": 36.008, "phase_angle": 161.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.352, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 10.522, 54.896, 78.912 ], "x_axis": [ 0.663, 0.334, -0.670 ], "y_axis": [ -0.609, 0.761, -0.223 ], "z_axis": [ 0.435, 0.556, 0.708 ], "quaternion": [ 0.885, -0.220, 0.312, 0.266 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -59.917, "beta": 172.898, "gamma": 49.031, "delta": 140.278, "epsilon": -136.841, "zeta": -156.446, "epsilon_zeta": 19.605, "bb_type": "--", "chi": -105.677, "glyco_bond": "anti", "C5prime_xyz": [ -2.664, 8.279, -1.923 ], "P_xyz": [ -0.434, 9.634, -1.892 ], "form": ".", "ssZp": 1.720, "Dp": 1.724, "splay_angle": 116.960, "splay_distance": 15.650, "splay_ratio": 0.854, "d22": null, "d64": null, "eta": 176.239, "theta": -157.092, "eta_prime": -161.170, "theta_prime": 173.461, "eta_base": -118.433, "theta_base": -146.008, "v0": -28.260, "v1": 39.080, "v2": -34.512, "v3": 19.106, "v4": 5.512, "amplitude": 38.679, "phase_angle": 153.161, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 12.424, 56.798, 80.695 ], "x_axis": [ 0.160, 0.635, -0.756 ], "y_axis": [ -0.833, 0.498, 0.242 ], "z_axis": [ 0.530, 0.591, 0.609 ], "quaternion": [ 0.753, -0.116, 0.427, 0.488 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/22", "linked_nts": [ "///C/21", null ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 34.380, "beta": -161.779, "gamma": 50.548, "delta": 156.062, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -59.949, "glyco_bond": "--", "C5prime_xyz": [ -2.962, 6.441, -3.155 ], "P_xyz": [ -0.675, 7.306, -4.091 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -12.726, "v1": 30.658, "v2": -35.849, "v3": 29.261, "v4": -10.524, "amplitude": 35.868, "phase_angle": 178.132, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.023, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 8.850, 60.066, 95.577 ], "x_axis": [ -0.863, 0.376, 0.338 ], "y_axis": [ -0.505, -0.618, -0.602 ], "z_axis": [ -0.017, -0.690, 0.723 ], "quaternion": [ 0.246, 0.090, -0.361, 0.895 ] } }, { "index": 23, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 50.223, "delta": 84.646, "epsilon": -140.225, "zeta": -88.890, "epsilon_zeta": -51.335, "bb_type": "BI", "chi": -167.871, "glyco_bond": "anti", "C5prime_xyz": [ -1.505, 8.749, 0.893 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.303, "Dp": 4.516, "splay_angle": 21.139, "splay_distance": 3.376, "splay_ratio": 0.183, "d22": 4.460, "d64": 4.239, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.559, "v1": -22.706, "v2": 34.890, "v3": -35.689, "v4": 22.166, "amplitude": 36.656, "phase_angle": 17.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 15.744, 57.412, 33.683 ], "x_axis": [ -0.047, -0.556, 0.830 ], "y_axis": [ 0.908, 0.323, 0.268 ], "z_axis": [ -0.417, 0.766, 0.489 ], "quaternion": [ 0.664, -0.187, -0.469, -0.551 ] } }, { "index": 24, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -47.139, "beta": 151.148, "gamma": 53.677, "delta": 85.505, "epsilon": -159.370, "zeta": -68.350, "epsilon_zeta": -91.019, "bb_type": "BI", "chi": -157.280, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.888, 0.207 ], "P_xyz": [ 1.085, 9.169, 0.141 ], "form": ".", "ssZp": 4.040, "Dp": 4.335, "splay_angle": 16.556, "splay_distance": 2.670, "splay_ratio": 0.144, "d22": 4.250, "d64": 3.545, "eta": 169.359, "theta": -140.558, "eta_prime": -171.323, "theta_prime": -137.270, "eta_base": -126.178, "theta_base": -108.720, "v0": -2.511, "v1": -19.918, "v2": 33.336, "v3": -35.816, "v4": 24.166, "amplitude": 36.093, "phase_angle": 22.537, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.507, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 13.580, 59.228, 35.532 ], "x_axis": [ 0.439, -0.236, 0.867 ], "y_axis": [ 0.733, 0.651, -0.194 ], "z_axis": [ -0.519, 0.721, 0.459 ], "quaternion": [ 0.798, -0.287, -0.434, -0.304 ] } }, { "index": 25, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.803, "beta": -176.316, "gamma": 56.488, "delta": 142.863, "epsilon": 175.213, "zeta": -103.671, "epsilon_zeta": -81.116, "bb_type": "BI", "chi": -111.197, "glyco_bond": "anti", "C5prime_xyz": [ -1.991, 8.389, -1.577 ], "P_xyz": [ 0.504, 9.148, -1.308 ], "form": "B", "ssZp": 2.453, "Dp": 2.263, "splay_angle": 21.149, "splay_distance": 3.469, "splay_ratio": 0.184, "d22": 4.322, "d64": 3.873, "eta": 162.211, "theta": -138.413, "eta_prime": -158.126, "theta_prime": -154.690, "eta_base": -117.282, "theta_base": -121.196, "v0": -20.364, "v1": 32.403, "v2": -31.581, "v3": 20.386, "v4": -0.141, "amplitude": 33.273, "phase_angle": 161.649, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.854, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 12.437, 60.554, 37.548 ], "x_axis": [ 0.834, 0.076, 0.547 ], "y_axis": [ 0.212, 0.870, -0.445 ], "z_axis": [ -0.510, 0.487, 0.709 ], "quaternion": [ 0.924, -0.252, -0.286, -0.037 ] } }, { "index": 26, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -63.129, "beta": -164.878, "gamma": 44.788, "delta": 140.028, "epsilon": 176.821, "zeta": -98.425, "epsilon_zeta": -84.754, "bb_type": "BI", "chi": -111.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.920, 8.383, -1.539 ], "P_xyz": [ 0.356, 9.508, -0.949 ], "form": ".", "ssZp": 2.542, "Dp": 2.318, "splay_angle": 21.677, "splay_distance": 3.684, "splay_ratio": 0.190, "d22": 4.226, "d64": 4.040, "eta": 166.771, "theta": -140.060, "eta_prime": -173.654, "theta_prime": -149.480, "eta_base": -129.886, "theta_base": -121.296, "v0": -19.279, "v1": 30.468, "v2": -29.465, "v3": 18.906, "v4": 0.130, "amplitude": 31.136, "phase_angle": 161.144, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 10.804, 61.812, 40.339 ], "x_axis": [ 0.858, 0.501, 0.115 ], "y_axis": [ -0.302, 0.672, -0.677 ], "z_axis": [ -0.416, 0.546, 0.727 ], "quaternion": [ 0.902, -0.339, -0.147, 0.223 ] } }, { "index": 27, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -50.530, "beta": -170.819, "gamma": 38.430, "delta": 138.119, "epsilon": -179.708, "zeta": -109.819, "epsilon_zeta": -69.890, "bb_type": "BI", "chi": -109.323, "glyco_bond": "anti", "C5prime_xyz": [ -2.312, 8.324, -1.795 ], "P_xyz": [ -0.311, 9.886, -1.189 ], "form": "B", "ssZp": 2.184, "Dp": 2.237, "splay_angle": 19.187, "splay_distance": 3.171, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 170.669, "theta": -149.568, "eta_prime": -166.931, "theta_prime": -157.270, "eta_base": -130.538, "theta_base": -106.641, "v0": -24.226, "v1": 34.274, "v2": -31.002, "v3": 17.632, "v4": 3.989, "amplitude": 34.258, "phase_angle": 154.821, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 9.832, 63.427, 43.504 ], "x_axis": [ 0.650, 0.692, -0.315 ], "y_axis": [ -0.683, 0.350, -0.640 ], "z_axis": [ -0.332, 0.632, 0.700 ], "quaternion": [ 0.822, -0.387, -0.005, 0.418 ] } }, { "index": 28, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.309, "beta": 175.866, "gamma": 42.138, "delta": 136.593, "epsilon": 173.174, "zeta": -94.771, "epsilon_zeta": -92.055, "bb_type": "BI", "chi": -108.961, "glyco_bond": "anti", "C5prime_xyz": [ -2.102, 8.305, -1.837 ], "P_xyz": [ 0.200, 9.478, -1.510 ], "form": "B", "ssZp": 2.124, "Dp": 2.179, "splay_angle": 20.537, "splay_distance": 3.465, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 168.245, "theta": -141.182, "eta_prime": -165.976, "theta_prime": -153.698, "eta_base": -109.022, "theta_base": -117.339, "v0": -21.041, "v1": 32.307, "v2": -30.810, "v3": 19.176, "v4": 1.040, "amplitude": 32.866, "phase_angle": 159.628, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 9.292, 65.952, 45.345 ], "x_axis": [ 0.052, 0.752, -0.657 ], "y_axis": [ -0.962, -0.140, -0.236 ], "z_axis": [ -0.269, 0.644, 0.716 ], "quaternion": [ 0.638, -0.345, 0.152, 0.671 ] } }, { "index": 29, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.627, "beta": -164.225, "gamma": 38.901, "delta": 140.720, "epsilon": -170.247, "zeta": -105.501, "epsilon_zeta": -64.745, "bb_type": "BI", "chi": -105.045, "glyco_bond": "anti", "C5prime_xyz": [ -2.294, 8.243, -1.830 ], "P_xyz": [ -0.244, 9.785, -1.294 ], "form": "B", "ssZp": 2.289, "Dp": 2.228, "splay_angle": 17.975, "splay_distance": 3.109, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 169.676, "theta": -138.396, "eta_prime": -170.819, "theta_prime": -146.159, "eta_base": -127.124, "theta_base": -108.496, "v0": -20.584, "v1": 32.587, "v2": -31.576, "v3": 20.353, "v4": -0.001, "amplitude": 33.328, "phase_angle": 161.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 8.855, 68.600, 47.537 ], "x_axis": [ -0.455, 0.484, -0.748 ], "y_axis": [ -0.832, -0.530, 0.163 ], "z_axis": [ -0.317, 0.696, 0.644 ], "quaternion": [ 0.406, -0.328, 0.265, 0.811 ] } }, { "index": 30, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop", "alpha": -55.065, "beta": 169.019, "gamma": 43.490, "delta": 136.851, "epsilon": -173.185, "zeta": -141.679, "epsilon_zeta": -31.506, "bb_type": "--", "chi": -103.132, "glyco_bond": "anti", "C5prime_xyz": [ -3.072, 8.291, -1.691 ], "P_xyz": [ -0.972, 9.815, -2.049 ], "form": "B", "ssZp": 2.952, "Dp": 2.453, "splay_angle": 20.920, "splay_distance": 3.393, "splay_ratio": 0.182, "d22": 4.369, "d64": 3.815, "eta": 158.041, "theta": -165.801, "eta_prime": -174.139, "theta_prime": -174.408, "eta_base": -128.158, "theta_base": -133.868, "v0": -33.664, "v1": 41.650, "v2": -33.009, "v3": 14.532, "v4": 11.670, "amplitude": 40.544, "phase_angle": 144.505, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.019, "origin": [ 7.598, 71.205, 48.677 ], "x_axis": [ -0.794, 0.082, -0.602 ], "y_axis": [ -0.520, -0.605, 0.603 ], "z_axis": [ -0.315, 0.792, 0.523 ], "quaternion": [ 0.176, -0.268, 0.408, 0.855 ] } }, { "index": 31, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -36.055, "beta": 149.581, "gamma": 55.083, "delta": 143.084, "epsilon": -165.940, "zeta": -86.565, "epsilon_zeta": -79.374, "bb_type": "BI", "chi": -121.104, "glyco_bond": "anti", "C5prime_xyz": [ -2.343, 8.595, -1.288 ], "P_xyz": [ 0.143, 9.345, -0.960 ], "form": ".", "ssZp": 1.848, "Dp": 2.055, "splay_angle": 35.277, "splay_distance": 5.412, "splay_ratio": 0.305, "d22": 6.697, "d64": 7.406, "eta": 174.624, "theta": -100.841, "eta_prime": -157.123, "theta_prime": -168.476, "eta_base": -115.064, "theta_base": 111.434, "v0": -27.685, "v1": 40.260, "v2": -37.053, "v3": 22.098, "v4": 3.233, "amplitude": 40.339, "phase_angle": 156.713, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 6.422, 74.137, 49.919 ], "x_axis": [ -0.923, -0.333, -0.191 ], "y_axis": [ -0.001, -0.496, 0.868 ], "z_axis": [ -0.384, 0.802, 0.458 ], "quaternion": [ -0.098, -0.169, 0.492, 0.848 ] } }, { "index": 32, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-canonical,multiplet,hairpin-loop,phosphate", "alpha": -165.231, "beta": 150.781, "gamma": 57.757, "delta": 144.087, "epsilon": -168.029, "zeta": -89.192, "epsilon_zeta": -78.837, "bb_type": "BI", "chi": -153.282, "glyco_bond": "anti", "C5prime_xyz": [ -1.609, 8.622, 0.741 ], "P_xyz": [ 0.872, 8.392, 1.552 ], "form": ".", "ssZp": 2.243, "Dp": 2.149, "splay_angle": 84.391, "splay_distance": 12.506, "splay_ratio": 0.672, "d22": 7.893, "d64": 10.206, "eta": 44.682, "theta": -69.685, "eta_prime": 89.516, "theta_prime": -98.900, "eta_base": 43.218, "theta_base": -88.214, "v0": -18.015, "v1": 31.697, "v2": -32.674, "v3": 22.775, "v4": -3.119, "amplitude": 33.578, "phase_angle": 166.675, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.103, "filter_rmsd": 0.106, "frame": { "rmsd": 0.013, "origin": [ 11.693, 73.063, 49.322 ], "x_axis": [ 0.448, -0.859, 0.247 ], "y_axis": [ 0.050, 0.299, 0.953 ], "z_axis": [ -0.893, -0.414, 0.177 ], "quaternion": [ 0.694, 0.493, -0.411, -0.328 ] } }, { "index": 33, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,non-pair-contact,hairpin-loop", "alpha": -163.069, "beta": -130.910, "gamma": 156.792, "delta": 96.776, "epsilon": -73.918, "zeta": 77.799, "epsilon_zeta": 208.283, "bb_type": "--", "chi": 166.049, "glyco_bond": "anti", "C5prime_xyz": [ -2.635, 8.471, 1.702 ], "P_xyz": [ -0.172, 9.334, 1.878 ], "form": ".", "ssZp": 2.335, "Dp": 2.736, "splay_angle": 55.823, "splay_distance": 8.325, "splay_ratio": 0.527, "d22": null, "d64": null, "eta": -135.046, "theta": 80.059, "eta_prime": -113.581, "theta_prime": 75.581, "eta_base": -81.701, "theta_base": 120.689, "v0": -16.805, "v1": -2.822, "v2": 19.778, "v3": -30.321, "v4": 29.723, "amplitude": 31.140, "phase_angle": 50.571, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ 0.263, 72.833, 54.394 ], "x_axis": [ 0.197, -0.256, 0.946 ], "y_axis": [ 0.859, 0.511, -0.040 ], "z_axis": [ -0.473, 0.821, 0.320 ], "quaternion": [ 0.712, -0.302, -0.498, -0.391 ] } }, { "index": 34, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 96.419, "beta": -169.840, "gamma": 175.757, "delta": 150.320, "epsilon": -178.770, "zeta": -81.625, "epsilon_zeta": -97.144, "bb_type": "BI", "chi": 74.127, "glyco_bond": "syn", "C5prime_xyz": [ -4.439, 3.395, 2.018 ], "P_xyz": [ -3.543, 1.967, 4.040 ], "form": ".", "ssZp": -1.344, "Dp": 1.776, "splay_angle": 32.140, "splay_distance": 5.251, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 163.316, "theta": -146.873, "eta_prime": -170.879, "theta_prime": -163.047, "eta_base": -132.457, "theta_base": 134.628, "v0": -5.174, "v1": 23.230, "v2": -31.380, "v3": 28.939, "v4": -15.130, "amplitude": 31.790, "phase_angle": 189.213, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.011, "origin": [ 4.036, 74.858, 47.255 ], "x_axis": [ -0.228, -0.819, 0.526 ], "y_axis": [ 0.851, 0.095, 0.516 ], "z_axis": [ -0.473, 0.565, 0.676 ], "quaternion": [ 0.621, -0.020, -0.402, -0.672 ] } }, { "index": 35, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,phosphate", "alpha": -75.481, "beta": -178.729, "gamma": 50.652, "delta": 141.836, "epsilon": -166.248, "zeta": -143.987, "epsilon_zeta": -22.261, "bb_type": "--", "chi": -82.346, "glyco_bond": "anti", "C5prime_xyz": [ -3.311, 7.468, -2.630 ], "P_xyz": [ -1.324, 8.881, -3.578 ], "form": "B", "ssZp": 2.069, "Dp": 2.095, "splay_angle": 21.489, "splay_distance": 3.567, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 155.299, "theta": -173.103, "eta_prime": -165.525, "theta_prime": 161.795, "eta_base": 155.933, "theta_base": -151.140, "v0": -27.589, "v1": 39.549, "v2": -35.972, "v3": 20.989, "v4": 3.859, "amplitude": 39.471, "phase_angle": 155.691, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 7.533, 71.327, 48.950 ], "x_axis": [ -0.787, 0.098, -0.609 ], "y_axis": [ 0.515, 0.648, -0.561 ], "z_axis": [ 0.340, -0.755, -0.560 ], "quaternion": [ 0.274, 0.177, 0.865, -0.380 ] } }, { "index": 36, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.229, "beta": 131.021, "gamma": 72.139, "delta": 82.046, "epsilon": -159.891, "zeta": -85.088, "epsilon_zeta": -74.803, "bb_type": "BI", "chi": -162.329, "glyco_bond": "anti", "C5prime_xyz": [ -1.922, 8.998, 0.412 ], "P_xyz": [ 0.438, 9.452, -0.669 ], "form": "A", "ssZp": 4.290, "Dp": 4.336, "splay_angle": 19.828, "splay_distance": 3.142, "splay_ratio": 0.172, "d22": 4.490, "d64": 3.976, "eta": 160.824, "theta": -155.680, "eta_prime": 162.875, "theta_prime": -157.014, "eta_base": -140.861, "theta_base": -135.618, "v0": -10.792, "v1": -15.586, "v2": 34.402, "v3": -41.220, "v4": 32.804, "amplitude": 41.103, "phase_angle": 33.179, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 8.915, 68.517, 47.243 ], "x_axis": [ -0.333, 0.368, -0.868 ], "y_axis": [ 0.828, 0.555, -0.083 ], "z_axis": [ 0.451, -0.746, -0.489 ], "quaternion": [ 0.428, 0.388, 0.771, -0.269 ] } }, { "index": 37, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.901, "beta": 169.576, "gamma": 64.889, "delta": 141.185, "epsilon": -177.291, "zeta": -91.153, "epsilon_zeta": -86.138, "bb_type": "BI", "chi": -127.573, "glyco_bond": "anti", "C5prime_xyz": [ -1.895, 8.639, -0.889 ], "P_xyz": [ 0.633, 9.133, -0.403 ], "form": "B", "ssZp": 2.077, "Dp": 2.154, "splay_angle": 20.227, "splay_distance": 3.293, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 171.567, "theta": -120.542, "eta_prime": -149.985, "theta_prime": -141.272, "eta_base": -119.921, "theta_base": -101.391, "v0": -20.252, "v1": 32.696, "v2": -32.128, "v3": 20.965, "v4": -0.624, "amplitude": 33.705, "phase_angle": 162.403, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.722, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 9.294, 65.919, 45.517 ], "x_axis": [ 0.085, 0.688, -0.721 ], "y_axis": [ 0.956, 0.147, 0.253 ], "z_axis": [ 0.280, -0.711, -0.645 ], "quaternion": [ 0.383, 0.629, 0.653, -0.175 ] } }, { "index": 38, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -71.880, "beta": -157.673, "gamma": 43.070, "delta": 142.892, "epsilon": -119.143, "zeta": -63.310, "epsilon_zeta": -55.833, "bb_type": "--", "chi": -97.380, "glyco_bond": "anti", "C5prime_xyz": [ -1.885, 7.841, -2.423 ], "P_xyz": [ 0.249, 9.282, -1.863 ], "form": ".", "ssZp": 0.327, "Dp": 1.399, "splay_angle": 135.489, "splay_distance": 19.622, "splay_ratio": 0.926, "d22": null, "d64": null, "eta": -174.101, "theta": -32.272, "eta_prime": -155.232, "theta_prime": -76.655, "eta_base": -109.559, "theta_base": -85.955, "v0": -13.853, "v1": 28.571, "v2": -31.732, "v3": 24.227, "v4": -6.712, "amplitude": 31.950, "phase_angle": 173.293, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.016, "origin": [ 10.143, 63.925, 43.038 ], "x_axis": [ 0.675, 0.670, -0.307 ], "y_axis": [ 0.677, -0.399, 0.618 ], "z_axis": [ 0.292, -0.626, -0.723 ], "quaternion": [ 0.372, 0.836, 0.403, -0.005 ] } }, { "index": 39, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,bulge,splayed-apart", "alpha": 143.910, "beta": -161.524, "gamma": -42.114, "delta": 128.742, "epsilon": -163.296, "zeta": 67.824, "epsilon_zeta": 128.880, "bb_type": "--", "chi": -96.397, "glyco_bond": "anti", "C5prime_xyz": [ -2.083, 7.872, -2.206 ], "P_xyz": [ -1.342, 10.265, -2.985 ], "form": ".", "ssZp": 2.228, "Dp": 3.073, "splay_angle": 176.147, "splay_distance": 18.990, "splay_ratio": 0.999, "d22": null, "d64": null, "eta": -76.558, "theta": -17.711, "eta_prime": -28.857, "theta_prime": -21.997, "eta_base": -9.002, "theta_base": -77.958, "v0": -15.837, "v1": 20.253, "v2": -16.932, "v3": 7.929, "v4": 4.964, "amplitude": 20.063, "phase_angle": 147.558, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.015, "origin": [ 19.388, 48.193, 50.253 ], "x_axis": [ -0.674, -0.708, 0.209 ], "y_axis": [ -0.736, 0.620, -0.274 ], "z_axis": [ 0.064, -0.338, -0.939 ], "quaternion": [ -0.040, -0.401, 0.899, -0.170 ] } }, { "index": 40, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -77.471, "beta": -150.154, "gamma": 68.949, "delta": 91.032, "epsilon": -155.880, "zeta": -56.822, "epsilon_zeta": -99.058, "bb_type": "BI", "chi": -173.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.424, 8.570, 1.252 ], "P_xyz": [ 0.974, 8.481, 2.357 ], "form": "A", "ssZp": 4.266, "Dp": 4.378, "splay_angle": 22.879, "splay_distance": 3.678, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -133.279, "theta": -124.114, "eta_prime": -90.694, "theta_prime": -122.765, "eta_base": -11.974, "theta_base": -85.683, "v0": 2.638, "v1": -23.242, "v2": 33.772, "v3": -33.261, "v4": 19.328, "amplitude": 34.870, "phase_angle": 14.411, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 10.585, 61.703, 40.223 ], "x_axis": [ 0.908, 0.405, -0.109 ], "y_axis": [ 0.343, -0.569, 0.748 ], "z_axis": [ 0.241, -0.716, -0.655 ], "quaternion": [ 0.414, 0.885, 0.211, 0.037 ] } }, { "index": 41, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.890, "beta": -173.315, "gamma": 59.383, "delta": 91.404, "epsilon": 179.228, "zeta": -54.554, "epsilon_zeta": -126.218, "bb_type": "BI", "chi": -143.514, "glyco_bond": "anti", "C5prime_xyz": [ -1.564, 8.772, -0.616 ], "P_xyz": [ 0.978, 9.389, -0.392 ], "form": ".", "ssZp": 3.420, "Dp": 3.974, "splay_angle": 19.257, "splay_distance": 3.216, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 167.396, "theta": -142.105, "eta_prime": -166.360, "theta_prime": -138.909, "eta_base": -111.083, "theta_base": -127.796, "v0": -1.395, "v1": -18.712, "v2": 30.211, "v3": -32.162, "v4": 21.209, "amplitude": 32.403, "phase_angle": 21.194, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.445, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 12.628, 60.537, 37.395 ], "x_axis": [ 0.906, -0.149, 0.396 ], "y_axis": [ -0.350, -0.789, 0.505 ], "z_axis": [ 0.237, -0.596, -0.767 ], "quaternion": [ 0.296, 0.930, -0.134, 0.170 ] } }, { "index": 42, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.009, "beta": -161.375, "gamma": 58.925, "delta": 146.366, "epsilon": -167.359, "zeta": -114.806, "epsilon_zeta": -52.553, "bb_type": "BI", "chi": -107.876, "glyco_bond": "anti", "C5prime_xyz": [ -2.418, 8.322, -1.773 ], "P_xyz": [ -0.194, 9.609, -1.304 ], "form": "B", "ssZp": 2.132, "Dp": 2.108, "splay_angle": 19.393, "splay_distance": 3.276, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 165.766, "theta": -136.417, "eta_prime": -159.765, "theta_prime": -149.992, "eta_base": -140.472, "theta_base": -106.280, "v0": -25.524, "v1": 38.478, "v2": -36.266, "v3": 22.404, "v4": 1.741, "amplitude": 38.904, "phase_angle": 158.779, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.160, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 13.778, 59.362, 34.631 ], "x_axis": [ 0.597, -0.279, 0.752 ], "y_axis": [ -0.611, -0.766, 0.201 ], "z_axis": [ 0.520, -0.579, -0.628 ], "quaternion": [ 0.226, 0.865, -0.257, 0.368 ] } }, { "index": 43, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -58.849, "beta": 172.759, "gamma": 44.942, "delta": 141.244, "epsilon": -142.370, "zeta": -160.930, "epsilon_zeta": 18.561, "bb_type": "--", "chi": -105.618, "glyco_bond": "anti", "C5prime_xyz": [ -2.595, 8.289, -1.933 ], "P_xyz": [ -0.385, 9.675, -1.881 ], "form": ".", "ssZp": 1.858, "Dp": 1.861, "splay_angle": 114.849, "splay_distance": 15.593, "splay_ratio": 0.843, "d22": null, "d64": null, "eta": 173.418, "theta": -160.400, "eta_prime": -165.597, "theta_prime": 171.067, "eta_base": -116.486, "theta_base": -149.933, "v0": -28.053, "v1": 39.153, "v2": -34.829, "v3": 19.503, "v4": 5.129, "amplitude": 38.830, "phase_angle": 153.763, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 16.046, 57.366, 33.365 ], "x_axis": [ 0.041, -0.625, 0.779 ], "y_axis": [ -0.800, -0.488, -0.349 ], "z_axis": [ 0.598, -0.609, -0.521 ], "quaternion": [ 0.091, 0.716, -0.498, 0.481 ] } }, { "index": 44, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/22", "linked_nts": [ "///D/21", null ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 42.828, "beta": -167.078, "gamma": 48.068, "delta": 149.824, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -61.893, "glyco_bond": "--", "C5prime_xyz": [ -3.073, 6.528, -3.165 ], "P_xyz": [ -0.888, 7.435, -4.282 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -15.693, "v1": 31.411, "v2": -34.269, "v3": 25.913, "v4": -6.556, "amplitude": 34.597, "phase_angle": 172.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.049, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 15.082, 54.009, 18.169 ], "x_axis": [ -0.766, -0.399, -0.504 ], "y_axis": [ -0.634, 0.600, 0.488 ], "z_axis": [ 0.108, 0.694, -0.712 ], "quaternion": [ 0.174, -0.294, 0.877, 0.337 ] } } ], "num_hbonds": 398, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/1/O2", "atom2_id": "///C/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 422, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/1/N3", "atom2_id": "///C/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 14, "atom2_serNum": 421, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/1/N4", "atom2_id": "///C/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 19, "atom2_serNum": 2219, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///C/2/OP2", "atom2_id": "///B/12/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 5, "atom1_serNum": 30, "atom2_serNum": 402, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///C/2/O2", "atom2_id": "///C/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 31, "atom2_serNum": 400, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/2/N3", "atom2_id": "///C/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 33, "atom2_serNum": 377, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///C/2/N4", "atom2_id": "///C/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 33, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/2/N4", "atom2_id": "///C/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 49, "atom2_serNum": 380, "donAcc_type": "standard", "distance": 2.399, "atom1_id": "///C/3/O2", "atom2_id": "///C/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 50, "atom2_serNum": 378, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///C/3/N3", "atom2_id": "///C/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 52, "atom2_serNum": 377, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/3/N4", "atom2_id": "///C/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 68, "atom2_serNum": 358, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/4/O2", "atom2_id": "///C/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 69, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/4/N3", "atom2_id": "///C/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 71, "atom2_serNum": 355, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/4/N4", "atom2_id": "///C/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 88, "atom2_serNum": 315, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///C/5/N3", "atom2_id": "///C/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 90, "atom2_serNum": 314, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/5/O4", "atom2_id": "///C/16/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 110, "atom2_serNum": 294, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/6/N6", "atom2_id": "///C/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 111, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/6/N1", "atom2_id": "///C/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 131, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///C/7/O6", "atom2_id": "///C/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 132, "atom2_serNum": 273, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/7/N1", "atom2_id": "///C/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 134, "atom2_serNum": 272, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/7/N2", "atom2_id": "///C/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 150, "atom2_serNum": 256, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/8/O2", "atom2_id": "///C/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 150, "atom2_serNum": 1550, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///C/8/O2", "atom2_id": "///A/82/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 24, "atom1_serNum": 151, "atom2_serNum": 254, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/8/N3", "atom2_id": "///C/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 153, "atom2_serNum": 253, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///C/8/N4", "atom2_id": "///C/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 170, "atom2_serNum": 229, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/9/N3", "atom2_id": "///C/12/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 172, "atom2_serNum": 232, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/9/O4", "atom2_id": "///C/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 177, "atom2_serNum": 1583, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///C/10/OP1", "atom2_id": "///A/87/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 29, "atom1_serNum": 177, "atom2_serNum": 1586, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/10/OP1", "atom2_id": "///A/87/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 30, "atom1_serNum": 189, "atom2_serNum": 243, "donAcc_type": "questionable", "distance": 3.149, "atom1_id": "///C/10/O2", "atom2_id": "///C/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 190, "atom2_serNum": 257, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///C/10/N3", "atom2_id": "///C/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 192, "atom2_serNum": 256, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/10/O4", "atom2_id": "///C/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 197, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///C/11/OP1", "atom2_id": "///A/90/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 34, "atom1_serNum": 238, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///C/13/OP1", "atom2_id": "///A/93/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 35, "atom1_serNum": 239, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/13/OP2", "atom2_id": "///A/93/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 36, "atom1_serNum": 260, "atom2_serNum": 1598, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///C/14/OP1", "atom2_id": "///A/89/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 37, "atom1_serNum": 260, "atom2_serNum": 1739, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///C/14/OP1", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 38, "atom1_serNum": 260, "atom2_serNum": 1747, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///C/14/OP1", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 39, "atom1_serNum": 279, "atom2_serNum": 1571, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///C/15/OP1", "atom2_id": "///A/85/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 40, "atom1_serNum": 300, "atom2_serNum": 2733, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///C/16/OP2", "atom2_id": "///B/74/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 41, "atom1_serNum": 333, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/17/N3", "atom2_id": "///B/51/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 340, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/18/OP1", "atom2_id": "///B/10/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 341, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/18/OP2", "atom2_id": "///B/10/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 352, "atom2_serNum": 2211, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///C/18/N7", "atom2_id": "///B/11/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 45, "atom1_serNum": 459, "atom2_serNum": 872, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///D/1/O2", "atom2_id": "///D/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 460, "atom2_serNum": 870, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/1/N3", "atom2_id": "///D/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 462, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/1/N4", "atom2_id": "///D/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 466, "atom2_serNum": 2043, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///D/2/OP1", "atom2_id": "///A/143/NE1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 467, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///D/2/OP2", "atom2_id": "///A/12/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 50, "atom1_serNum": 478, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/2/O2", "atom2_id": "///D/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 479, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/2/N3", "atom2_id": "///D/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 481, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///D/2/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 481, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///D/2/N4", "atom2_id": "///D/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 497, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///D/3/O2", "atom2_id": "///D/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 498, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/3/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 500, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///D/3/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 516, "atom2_serNum": 806, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/4/O2", "atom2_id": "///D/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 517, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///D/4/N3", "atom2_id": "///D/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 519, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/4/N4", "atom2_id": "///D/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 536, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///D/5/N3", "atom2_id": "///D/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 538, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/5/O4", "atom2_id": "///D/16/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 558, "atom2_serNum": 742, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///D/6/N6", "atom2_id": "///D/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 559, "atom2_serNum": 740, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/6/N1", "atom2_id": "///D/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 579, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///D/7/O6", "atom2_id": "///D/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 580, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///D/7/N1", "atom2_id": "///D/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 582, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/7/N2", "atom2_id": "///D/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 598, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///D/8/O2", "atom2_id": "///D/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 598, "atom2_serNum": 2800, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///D/8/O2", "atom2_id": "///B/82/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 599, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/8/N3", "atom2_id": "///D/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 601, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/8/N4", "atom2_id": "///D/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 618, "atom2_serNum": 677, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///D/9/N3", "atom2_id": "///D/12/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 620, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/9/O4", "atom2_id": "///D/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 625, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///D/10/OP1", "atom2_id": "///B/87/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 74, "atom1_serNum": 625, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///D/10/OP1", "atom2_id": "///B/87/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 75, "atom1_serNum": 626, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/10/OP2", "atom2_id": "///B/87/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 76, "atom1_serNum": 632, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///D/10/O3'", "atom2_id": "///B/90/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 77, "atom1_serNum": 637, "atom2_serNum": 691, "donAcc_type": "questionable", "distance": 3.189, "atom1_id": "///D/10/O2", "atom2_id": "///D/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 638, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///D/10/N3", "atom2_id": "///D/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 640, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///D/10/O4", "atom2_id": "///D/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 686, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///D/13/OP1", "atom2_id": "///B/93/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 81, "atom1_serNum": 687, "atom2_serNum": 2886, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/13/OP2", "atom2_id": "///B/93/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 82, "atom1_serNum": 708, "atom2_serNum": 2848, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///D/14/OP1", "atom2_id": "///B/89/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 708, "atom2_serNum": 2989, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///D/14/OP1", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 84, "atom1_serNum": 708, "atom2_serNum": 2997, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/14/OP1", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 85, "atom1_serNum": 727, "atom2_serNum": 2821, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///D/15/OP1", "atom2_id": "///B/85/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 86, "atom1_serNum": 748, "atom2_serNum": 1483, "donAcc_type": "acceptable", "distance": 2.867, "atom1_id": "///D/16/OP2", "atom2_id": "///A/74/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 775, "atom2_serNum": 951, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///D/17/O3'", "atom2_id": "///A/10/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 88, "atom1_serNum": 781, "atom2_serNum": 1292, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///D/17/N3", "atom2_id": "///A/51/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 89, "atom1_serNum": 788, "atom2_serNum": 951, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///D/18/OP1", "atom2_id": "///A/10/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 90, "atom1_serNum": 788, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 3.947, "atom1_id": "///D/18/OP1", "atom2_id": "///A/52/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 91, "atom1_serNum": 789, "atom2_serNum": 951, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///D/18/OP2", "atom2_id": "///A/10/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 800, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/18/N7", "atom2_id": "///A/11/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 803, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///D/18/O6", "atom2_id": "///A/11/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 897, "atom2_serNum": 2114, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///A/4/N", "atom2_id": "///A/151/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 905, "atom2_serNum": 1001, "donAcc_type": "acceptable", "distance": 2.774, "atom1_id": "///A/5/O", "atom2_id": "///A/16/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 912, "atom2_serNum": 2107, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/6/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 917, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/7/N", "atom2_id": "///A/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 920, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/7/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 928, "atom2_serNum": 1322, "donAcc_type": "acceptable", "distance": 3.441, "atom1_id": "///A/7/OH", "atom2_id": "///A/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 929, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/8/N", "atom2_id": "///A/151/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 937, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/8/NZ", "atom2_id": "///A/9/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 937, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/8/NZ", "atom2_id": "///A/11/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 938, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/9/N", "atom2_id": "///A/13/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 943, "atom2_serNum": 952, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///A/9/OG", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 965, "atom2_serNum": 3031, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///A/12/O", "atom2_id": "///B/110/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 969, "atom2_serNum": 3025, "donAcc_type": "questionable", "distance": 3.000, "atom1_id": "///A/12/ND2", "atom2_id": "///B/109/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 977, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/14/N", "atom2_id": "///B/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 980, "atom2_serNum": 3049, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/14/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 995, "atom2_serNum": 2131, "donAcc_type": "acceptable", "distance": 3.980, "atom1_id": "///A/15/OH", "atom2_id": "///A/153/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 996, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/16/N", "atom2_id": "///B/113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 999, "atom2_serNum": 3063, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/16/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1002, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/17/N", "atom2_id": "///A/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1005, "atom2_serNum": 1455, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/17/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1008, "atom2_serNum": 3068, "donAcc_type": "acceptable", "distance": 2.753, "atom1_id": "///A/18/N", "atom2_id": "///B/115/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1011, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/18/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1017, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/19/N", "atom2_id": "///A/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1020, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/19/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1028, "atom2_serNum": 2278, "donAcc_type": "acceptable", "distance": 2.389, "atom1_id": "///A/19/OH", "atom2_id": "///B/19/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1029, "atom2_serNum": 1810, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/20/N", "atom2_id": "///A/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1032, "atom2_serNum": 1807, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/20/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1039, "atom2_serNum": 1429, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/21/N", "atom2_id": "///A/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1042, "atom2_serNum": 1426, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/21/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1047, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/22/N", "atom2_id": "///A/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1050, "atom2_serNum": 1788, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/22/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1054, "atom2_serNum": 1411, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///A/23/N", "atom2_id": "///A/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1057, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/23/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1077, "atom2_serNum": 1102, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/25/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1081, "atom2_serNum": 1742, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/26/N", "atom2_id": "///A/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1084, "atom2_serNum": 1113, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/26/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1101, "atom2_serNum": 3221, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///A/27/OH", "atom2_id": "///B/135/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1111, "atom2_serNum": 3160, "donAcc_type": "standard", "distance": 3.564, "atom1_id": "///A/28/NH1", "atom2_id": "///B/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1111, "atom2_serNum": 3168, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/28/NH1", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1116, "atom2_serNum": 1133, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/29/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1136, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/31/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1140, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/32/N", "atom2_id": "///A/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1143, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/32/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1151, "atom2_serNum": 1164, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/33/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1151, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1158, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1162, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1167, "atom2_serNum": 1199, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1174, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1179, "atom2_serNum": 1371, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///A/37/OE2", "atom2_id": "///A/60/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1183, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1191, "atom2_serNum": 1225, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1195, "atom2_serNum": 1654, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/39/NE", "atom2_id": "///A/95/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1197, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///A/39/NH1", "atom2_id": "///A/42/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1198, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/39/NH2", "atom2_id": "///A/95/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1202, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1210, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1219, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1228, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1236, "atom2_serNum": 1266, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1244, "atom2_serNum": 1271, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1253, "atom2_serNum": 1280, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1262, "atom2_serNum": 1289, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1269, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1269, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///A/48/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1274, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/49/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1288, "atom2_serNum": 1586, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/50/OE2", "atom2_id": "///A/87/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1300, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///A/52/O", "atom2_id": "///A/153/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1315, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/54/N", "atom2_id": "///A/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1318, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/54/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1318, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/54/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1332, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/56/N", "atom2_id": "///A/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1340, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/57/N", "atom2_id": "///A/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1343, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/57/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1357, "atom2_serNum": 1419, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/59/N", "atom2_id": "///A/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1360, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/59/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1373, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/61/N", "atom2_id": "///A/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1376, "atom2_serNum": 1390, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/61/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1379, "atom2_serNum": 1389, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/61/OD1", "atom2_id": "///A/62/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1397, "atom2_serNum": 1404, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///A/63/OD2", "atom2_id": "///A/64/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1454, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///A/70/OD2", "atom2_id": "///A/153/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1466, "atom2_serNum": 1484, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/72/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1466, "atom2_serNum": 1495, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1469, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/72/OD1", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1487, "atom2_serNum": 1522, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/75/O", "atom2_id": "///A/79/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1498, "atom2_serNum": 1514, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/76/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1502, "atom2_serNum": 1534, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1509, "atom2_serNum": 1542, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1517, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1517, "atom2_serNum": 1556, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///A/79/O", "atom2_id": "///A/83/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1526, "atom2_serNum": 1558, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1537, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1545, "atom2_serNum": 1572, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1554, "atom2_serNum": 1576, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1561, "atom2_serNum": 1587, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1561, "atom2_serNum": 1592, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///A/84/O", "atom2_id": "///A/88/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1566, "atom2_serNum": 1592, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///A/85/O", "atom2_id": "///A/88/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1566, "atom2_serNum": 1593, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1566, "atom2_serNum": 1755, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/85/O", "atom2_id": "///A/107/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1571, "atom2_serNum": 1764, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/85/NZ", "atom2_id": "///A/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1571, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/85/NZ", "atom2_id": "///A/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1575, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1579, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/87/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1579, "atom2_serNum": 1610, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1590, "atom2_serNum": 1618, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1592, "atom2_serNum": 1755, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///A/88/OG", "atom2_id": "///A/107/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1596, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1602, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1613, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/91/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1613, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1621, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1635, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/93/NH1", "atom2_id": "///A/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1635, "atom2_serNum": 1695, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///A/93/NH1", "atom2_id": "///A/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1635, "atom2_serNum": 1720, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/93/NH1", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1658, "atom2_serNum": 1684, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/96/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1669, "atom2_serNum": 1692, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/97/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1669, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1674, "atom2_serNum": 1680, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///A/98/N", "atom2_id": "///A/98/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1677, "atom2_serNum": 1708, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1737, "atom2_serNum": 1750, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/105/OG1", "atom2_id": "///A/107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1766, "atom2_serNum": 1776, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///A/108/OG1", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1774, "atom2_serNum": 2219, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/109/OD1", "atom2_id": "///B/12/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1781, "atom2_serNum": 2215, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///A/110/OG", "atom2_id": "///B/12/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1781, "atom2_serNum": 3156, "donAcc_type": "acceptable", "distance": 2.405, "atom1_id": "///A/110/OG", "atom2_id": "///B/127/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1782, "atom2_serNum": 3156, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///A/111/N", "atom2_id": "///B/127/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1785, "atom2_serNum": 2227, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/111/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1799, "atom2_serNum": 2230, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/113/N", "atom2_id": "///B/14/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1802, "atom2_serNum": 2246, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/113/O", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1810, "atom2_serNum": 1812, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///A/114/O", "atom2_id": "///A/114/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1813, "atom2_serNum": 2249, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/115/N", "atom2_id": "///B/16/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1816, "atom2_serNum": 1818, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///A/115/O", "atom2_id": "///A/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1818, "atom2_serNum": 2258, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///A/115/OG1", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1818, "atom2_serNum": 3073, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///A/115/OG1", "atom2_id": "///B/116/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1827, "atom2_serNum": 3080, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/117/N", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1830, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/117/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1843, "atom2_serNum": 1855, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///A/120/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1843, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1850, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1858, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1866, "atom2_serNum": 1895, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1873, "atom2_serNum": 1907, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1880, "atom2_serNum": 1915, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1889, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1889, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/126/O", "atom2_id": "///A/130/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1898, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/127/O", "atom2_id": "///A/131/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1906, "atom2_serNum": 3031, "donAcc_type": "acceptable", "distance": 2.514, "atom1_id": "///A/127/OH", "atom2_id": "///B/110/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1910, "atom2_serNum": 1932, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/128/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1910, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///A/128/O", "atom2_id": "///B/28/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1918, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/129/O", "atom2_id": "///A/142/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1918, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/129/O", "atom2_id": "///B/28/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1935, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 3.639, "atom1_id": "///A/131/O", "atom2_id": "///A/139/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1935, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/131/O", "atom2_id": "///A/142/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1949, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/132/NE2", "atom2_id": "///A/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1963, "atom2_serNum": 1972, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///A/134/OG", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1971, "atom2_serNum": 2351, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///A/135/ND2", "atom2_id": "///B/27/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1975, "atom2_serNum": 2008, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1986, "atom2_serNum": 2017, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1993, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2002, "atom2_serNum": 2035, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2011, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2020, "atom2_serNum": 2058, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2029, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/142/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2038, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2052, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2067, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/146/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2079, "atom2_serNum": 2099, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/147/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2094, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/149/O", "atom2_id": "///A/149/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2150, "atom2_serNum": 2159, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/4/O", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2155, "atom2_serNum": 2251, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///B/5/O", "atom2_id": "///B/16/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2162, "atom2_serNum": 3357, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///B/6/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2167, "atom2_serNum": 2237, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/7/N", "atom2_id": "///B/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2170, "atom2_serNum": 2234, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/7/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2178, "atom2_serNum": 2572, "donAcc_type": "acceptable", "distance": 3.726, "atom1_id": "///B/7/OH", "atom2_id": "///B/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2179, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/8/N", "atom2_id": "///B/151/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2187, "atom2_serNum": 2191, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/8/NZ", "atom2_id": "///B/9/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2187, "atom2_serNum": 2205, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/8/NZ", "atom2_id": "///B/11/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2188, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/9/N", "atom2_id": "///B/13/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2252, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///B/17/N", "atom2_id": "///B/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2255, "atom2_serNum": 2705, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///B/17/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2261, "atom2_serNum": 3070, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/18/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2267, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///B/19/N", "atom2_id": "///B/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2270, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/19/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2279, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/20/N", "atom2_id": "///B/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2282, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/20/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2289, "atom2_serNum": 2679, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/21/N", "atom2_id": "///B/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2292, "atom2_serNum": 2676, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/21/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2297, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/22/N", "atom2_id": "///B/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2300, "atom2_serNum": 3038, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///B/22/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2304, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///B/23/N", "atom2_id": "///B/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2307, "atom2_serNum": 2658, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///B/23/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2321, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 3.967, "atom1_id": "///B/24/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2327, "atom2_serNum": 2352, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/25/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2331, "atom2_serNum": 2992, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/26/N", "atom2_id": "///B/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2334, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/26/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2366, "atom2_serNum": 2383, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/29/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2386, "atom2_serNum": 2398, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/31/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2390, "atom2_serNum": 2634, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/32/N", "atom2_id": "///B/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2393, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///B/32/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2401, "atom2_serNum": 2414, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///B/33/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2401, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2408, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/34/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2408, "atom2_serNum": 2430, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2412, "atom2_serNum": 2438, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2417, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2424, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2429, "atom2_serNum": 2621, "donAcc_type": "acceptable", "distance": 2.527, "atom1_id": "///B/37/OE2", "atom2_id": "///B/60/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2433, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2441, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2445, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/39/NE", "atom2_id": "///B/95/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2447, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/39/NH1", "atom2_id": "///B/42/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2448, "atom2_serNum": 2903, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/39/NH2", "atom2_id": "///B/95/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2452, "atom2_serNum": 2483, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2460, "atom2_serNum": 2491, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2469, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2478, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/43/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2486, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/44/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2494, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2503, "atom2_serNum": 2530, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/46/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2512, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/47/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2519, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/48/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2519, "atom2_serNum": 2558, "donAcc_type": "standard", "distance": 2.508, "atom1_id": "///B/48/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2524, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///B/49/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2538, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///B/50/OE2", "atom2_id": "///B/87/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2565, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/54/N", "atom2_id": "///B/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2568, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/54/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2568, "atom2_serNum": 2697, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/54/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2582, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/56/N", "atom2_id": "///B/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2590, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/57/N", "atom2_id": "///B/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2593, "atom2_serNum": 2684, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///B/57/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2607, "atom2_serNum": 2669, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/59/N", "atom2_id": "///B/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2610, "atom2_serNum": 2666, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/59/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2623, "atom2_serNum": 2651, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/61/N", "atom2_id": "///B/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2626, "atom2_serNum": 2640, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/61/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2629, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.937, "atom1_id": "///B/61/OD1", "atom2_id": "///B/62/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2640, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/63/N", "atom2_id": "///B/63/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2647, "atom2_serNum": 2654, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///B/63/OD2", "atom2_id": "///B/64/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2716, "atom2_serNum": 2734, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/72/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2716, "atom2_serNum": 2745, "donAcc_type": "standard", "distance": 3.605, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2719, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/72/OD1", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2737, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/75/O", "atom2_id": "///B/79/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2748, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/76/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2752, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/77/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2752, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2759, "atom2_serNum": 2792, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2767, "atom2_serNum": 2801, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2767, "atom2_serNum": 2806, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///B/79/O", "atom2_id": "///B/83/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2776, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2787, "atom2_serNum": 2813, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2795, "atom2_serNum": 2822, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2804, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2811, "atom2_serNum": 2837, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2811, "atom2_serNum": 2842, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///B/84/O", "atom2_id": "///B/88/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2816, "atom2_serNum": 2842, "donAcc_type": "acceptable", "distance": 3.212, "atom1_id": "///B/85/O", "atom2_id": "///B/88/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2816, "atom2_serNum": 2843, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2816, "atom2_serNum": 3005, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/85/O", "atom2_id": "///B/107/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2821, "atom2_serNum": 3014, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/85/NZ", "atom2_id": "///B/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2821, "atom2_serNum": 3029, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/85/NZ", "atom2_id": "///B/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2825, "atom2_serNum": 2849, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2829, "atom2_serNum": 2860, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2840, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2842, "atom2_serNum": 3005, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///B/88/OG", "atom2_id": "///B/107/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2846, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/89/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2848, "atom2_serNum": 2989, "donAcc_type": "acceptable", "distance": 3.855, "atom1_id": "///B/89/OG", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2852, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2863, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2863, "atom2_serNum": 2896, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2871, "atom2_serNum": 2905, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2885, "atom2_serNum": 2937, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/93/NH1", "atom2_id": "///B/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2885, "atom2_serNum": 2970, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/93/NH1", "atom2_id": "///B/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2908, "atom2_serNum": 2934, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///B/96/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2919, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/97/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2919, "atom2_serNum": 2951, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2987, "atom2_serNum": 3000, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///B/105/OG1", "atom2_id": "///B/107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3016, "atom2_serNum": 3026, "donAcc_type": "acceptable", "distance": 3.260, "atom1_id": "///B/108/OG1", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3060, "atom2_serNum": 3062, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///B/114/O", "atom2_id": "///B/114/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3093, "atom2_serNum": 3105, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/120/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3093, "atom2_serNum": 3113, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/120/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3100, "atom2_serNum": 3127, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///B/121/O", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3108, "atom2_serNum": 3136, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/122/O", "atom2_id": "///B/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3116, "atom2_serNum": 3145, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/123/O", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3123, "atom2_serNum": 3157, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/124/O", "atom2_id": "///B/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3130, "atom2_serNum": 3165, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/125/O", "atom2_id": "///B/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3139, "atom2_serNum": 3174, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/126/O", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3139, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/126/O", "atom2_id": "///B/130/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3148, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/127/O", "atom2_id": "///B/131/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3160, "atom2_serNum": 3182, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/128/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3168, "atom2_serNum": 3284, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///B/129/O", "atom2_id": "///B/142/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3185, "atom2_serNum": 3257, "donAcc_type": "standard", "distance": 3.790, "atom1_id": "///B/131/O", "atom2_id": "///B/139/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3199, "atom2_serNum": 3211, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/132/NE2", "atom2_id": "///B/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3207, "atom2_serNum": 3213, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///B/133/ND2", "atom2_id": "///B/134/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3213, "atom2_serNum": 3222, "donAcc_type": "acceptable", "distance": 3.467, "atom1_id": "///B/134/OG", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3225, "atom2_serNum": 3249, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/136/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3225, "atom2_serNum": 3258, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/136/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3236, "atom2_serNum": 3267, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/137/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3243, "atom2_serNum": 3276, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/138/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3252, "atom2_serNum": 3285, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/139/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3257, "atom2_serNum": 3284, "donAcc_type": "questionable", "distance": 3.380, "atom1_id": "///B/139/NE2", "atom2_id": "///B/142/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3261, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/140/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3270, "atom2_serNum": 3308, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3279, "atom2_serNum": 3314, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/142/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3288, "atom2_serNum": 3326, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3302, "atom2_serNum": 3333, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/144/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3311, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3317, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/146/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3344, "atom2_serNum": 3348, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///B/149/O", "atom2_id": "///B/149/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2a6o", "num_aaChains": 2, "aaChains": "A=152,B=152", "num_naChains": 2, "naChains": "C=22,D=22", "num_atoms": 3515, "num_waters": 123, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 14, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }