**************************************************************************** File name: 2a6o.pdb no. of DNA/RNA chains: 2 [C=22,D=22] no. of nucleotides: 44 no. of atoms: 3515 no. of waters: 123 no. of metals: 0 **************************************************************************** List of 19 base pairs nt1 nt2 bp name Saenger LW DSSR 1 C.DC1 C.DG21 C-G WC 19-XIX cWW cW-W 2 C.DC2 C.DG20 C-G WC 19-XIX cWW cW-W 3 C.DC3 C.DG19 C-G WC 19-XIX cWW cW-W 4 C.DC4 C.DG18 C-G WC 19-XIX cWW cW-W 5 C.DT5 C.DA16 T-A WC 20-XX cWW cW-W 6 C.DA6 C.DT15 A-T WC 20-XX cWW cW-W 7 C.DG7 C.DC14 G-C WC 19-XIX cWW cW-W 8 C.DC8 C.DG13 C-G WC 19-XIX cWW cW-W 9 C.DT9 C.DA12 T+A Hoogsteen 23-XXIII cWH cW+M 10 D.DC1 D.DG21 C-G WC 19-XIX cWW cW-W 11 D.DC2 D.DG20 C-G WC 19-XIX cWW cW-W 12 D.DC3 D.DG19 C-G WC 19-XIX cWW cW-W 13 D.DC4 D.DG18 C-G WC 19-XIX cWW cW-W 14 D.DT5 D.DA16 T-A WC 20-XX cWW cW-W 15 D.DA6 D.DT15 A-T WC 20-XX cWW cW-W 16 D.DG7 D.DC14 G-C WC 19-XIX cWW cW-W 17 D.DC8 D.DG13 C-G WC 19-XIX cWW cW-W 18 D.DT9 D.DA12 T+A Hoogsteen 23-XXIII cWH cW+M 19 D.DT10 D.DG13 T-G -- -- tWS tW-m **************************************************************************** List of 1 multiplet 1 nts=3 CTG D.DC8,D.DT10,D.DG13 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=9 strand-1 5'-CCCCTAGCT-3' bp-type ||||||||. strand-2 3'-GGGGATCGA-5' helix-form .B.xB.B. 1 C.DC1 C.DG21 C-G WC 19-XIX cWW cW-W 2 C.DC2 C.DG20 C-G WC 19-XIX cWW cW-W 3 C.DC3 C.DG19 C-G WC 19-XIX cWW cW-W 4 C.DC4 C.DG18 C-G WC 19-XIX cWW cW-W 5 C.DT5 C.DA16 T-A WC 20-XX cWW cW-W 6 C.DA6 C.DT15 A-T WC 20-XX cWW cW-W 7 C.DG7 C.DC14 G-C WC 19-XIX cWW cW-W 8 C.DC8 C.DG13 C-G WC 19-XIX cWW cW-W 9 C.DT9 C.DA12 T+A Hoogsteen 23-XXIII cWH cW+M -------------------------------------------------------------------------- helix#2[2] bps=9 strand-1 5'-CCCCTAGCT-3' bp-type ||||||||. strand-2 3'-GGGGATCGA-5' helix-form ...xB.B. 1 D.DC1 D.DG21 C-G WC 19-XIX cWW cW-W 2 D.DC2 D.DG20 C-G WC 19-XIX cWW cW-W 3 D.DC3 D.DG19 C-G WC 19-XIX cWW cW-W 4 D.DC4 D.DG18 C-G WC 19-XIX cWW cW-W 5 D.DT5 D.DA16 T-A WC 20-XX cWW cW-W 6 D.DA6 D.DT15 A-T WC 20-XX cWW cW-W 7 D.DG7 D.DC14 G-C WC 19-XIX cWW cW-W 8 D.DC8 D.DG13 C-G WC 19-XIX cWW cW-W 9 D.DT9 D.DA12 T+A Hoogsteen 23-XXIII cWH cW+M **************************************************************************** List of 4 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=4 strand-1 5'-CCCC-3' bp-type |||| strand-2 3'-GGGG-5' helix-form .B. 1 C.DC1 C.DG21 C-G WC 19-XIX cWW cW-W 2 C.DC2 C.DG20 C-G WC 19-XIX cWW cW-W 3 C.DC3 C.DG19 C-G WC 19-XIX cWW cW-W 4 C.DC4 C.DG18 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=4 strand-1 5'-TAGC-3' bp-type |||| strand-2 3'-ATCG-5' helix-form B.B 1 C.DT5 C.DA16 T-A WC 20-XX cWW cW-W 2 C.DA6 C.DT15 A-T WC 20-XX cWW cW-W 3 C.DG7 C.DC14 G-C WC 19-XIX cWW cW-W 4 C.DC8 C.DG13 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=4 strand-1 5'-CCCC-3' bp-type |||| strand-2 3'-GGGG-5' helix-form ... 1 D.DC1 D.DG21 C-G WC 19-XIX cWW cW-W 2 D.DC2 D.DG20 C-G WC 19-XIX cWW cW-W 3 D.DC3 D.DG19 C-G WC 19-XIX cWW cW-W 4 D.DC4 D.DG18 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=4 strand-1 5'-TAGC-3' bp-type |||| strand-2 3'-ATCG-5' helix-form B.B 1 D.DT5 D.DA16 T-A WC 20-XX cWW cW-W 2 D.DA6 D.DT15 A-T WC 20-XX cWW cW-W 3 D.DG7 D.DC14 G-C WC 19-XIX cWW cW-W 4 D.DC8 D.DG13 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#2] 2 Helix#2 contains 2 stems: [#3,#4] **************************************************************************** List of 10 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CT C.DC4,C.DT5 2 nts=2 AG C.DA12,C.DG13 3 nts=2 AG C.DA16,C.DG18 4 nts=2 CT D.DC4,D.DT5 5 nts=2 AG D.DA12,D.DG13 6 nts=2 AG D.DA16,D.DG18 7 nts=3 CTT C.DC8,C.DT9,C.DT11 8 nts=3 CTT D.DC8,D.DT9,D.DT11 9 nts=3 RTF A.ARG52,D.DT17,A.PHE75 10 nts=3 RTF B.ARG52,C.DT17,B.PHE75 **************************************************************************** Nucleotides not involved in stacking interactions nts=2 AA C.DA22,D.DA22 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 2 hairpin loops 1 hairpin loop: nts=6; [4]; linked by [#2] summary: [1] 4 [C.8 C.13] 4 nts=6 CTTTAG C.DC8,C.DT9,C.DT10,C.DT11,C.DA12,C.DG13 nts=4 TTTA C.DT9,C.DT10,C.DT11,C.DA12 2 hairpin loop: nts=6; [4]; linked by [#4] summary: [1] 4 [D.8 D.13] 4 nts=6 CTTTAG D.DC8,D.DT9,D.DT10,D.DT11,D.DA12,D.DG13 nts=4 TTTA D.DT9,D.DT10,D.DT11,D.DA12 **************************************************************************** List of 2 bulges 1 bulge: nts=5; [0,1]; linked by [#1,#2] summary: [2] 0 1 [C.4 C.18 C.5 C.16] 4 4 nts=5 CTATG C.DC4,C.DT5,C.DA16,C.DT17,C.DG18 nts=0 nts=1 T C.DT17 2 bulge: nts=5; [0,1]; linked by [#3,#4] summary: [2] 0 1 [D.4 D.18 D.5 D.16] 4 4 nts=5 CTATG D.DC4,D.DT5,D.DA16,D.DT17,D.DG18 nts=0 nts=1 T D.DT17 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=1 A C.DA22 2 nts=1 A D.DA22 **************************************************************************** List of 7 splayed-apart dinucleotides 1 C.DT10 C.DT11 angle=86 distance=12.7 ratio=0.68 2 C.DA16 C.DT17 angle=137 distance=19.5 ratio=0.93 3 C.DT17 C.DG18 angle=175 distance=19.1 ratio=1.00 4 C.DG21 C.DA22 angle=117 distance=15.7 ratio=0.85 5 D.DA16 D.DT17 angle=135 distance=19.6 ratio=0.93 6 D.DT17 D.DG18 angle=176 distance=19.0 ratio=1.00 7 D.DG21 D.DA22 angle=115 distance=15.6 ratio=0.84 ---------------------------------------------------------------- Summary of 5 splayed-apart units 1 nts=2 TT C.DT10,C.DT11 2 nts=3 ATG C.DA16,C.DT17,C.DG18 3 nts=2 GA C.DG21,C.DA22 4 nts=3 ATG D.DA16,D.DT17,D.DG18 5 nts=2 GA D.DG21,D.DA22 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >2a6o nts=44 [whole] CCCCTAGCTTTAGCTATGGGGA&CCCCTAGCTTTAGCTATGGGGA ((((((((....)))).)))).&((((((((....)))).)))). >2a6o-C #1 nts=22 0.46(2.77) [chain] DNA CCCCTAGCTTTAGCTATGGGGA ((((((((....)))).)))). >2a6o-D #2 nts=22 0.45(2.77) [chain] DNA CCCCTAGCTTTAGCTATGGGGA ((((((((....)))).)))). **************************************************************************** Summary of structural features of 44 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( C.DC1 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 C ( C.DC2 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 3 C ( C.DC3 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 C ( C.DC4 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 5 T ( C.DT5 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 6 A ( C.DA6 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 G ( C.DG7 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 8 C ( C.DC8 0.017 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 9 T . C.DT9 0.003 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 10 T . C.DT10 0.011 turn,anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 11 T . C.DT11 0.010 turn,anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart 12 A . C.DA12 0.010 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 13 G ) C.DG13 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 14 C ) C.DC14 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 15 T ) C.DT15 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 16 A ) C.DA16 0.013 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 17 T . C.DT17 0.011 turn,anti,bulge,splayed-apart 18 G ) C.DG18 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 19 G ) C.DG19 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 20 G ) C.DG20 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 21 G ) C.DG21 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 22 A . C.DA22 0.004 ~C2'-endo,non-stack,ss-non-loop,splayed-apart 23 C ( D.DC1 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 24 C ( D.DC2 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 25 C ( D.DC3 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 26 C ( D.DC4 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 27 T ( D.DT5 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 28 A ( D.DA6 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 G ( D.DG7 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 30 C ( D.DC8 0.019 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop 31 T . D.DT9 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 32 T . D.DT10 0.013 turn,anti,~C2'-endo,BI,non-canonical,multiplet,hairpin-loop,phosphate 33 T . D.DT11 0.010 turn,anti,non-pair-contact,hairpin-loop 34 A . D.DA12 0.011 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 35 G ) D.DG13 0.007 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,phosphate 36 C ) D.DC14 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 37 T ) D.DT15 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 38 A ) D.DA16 0.016 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 39 T . D.DT17 0.015 turn,anti,bulge,splayed-apart 40 G ) D.DG18 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 41 G ) D.DG19 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 G ) D.DG20 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 43 G ) D.DG21 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 44 A . D.DA22 0.006 ~C2'-endo,non-stack,ss-non-loop,splayed-apart **************************************************************************** List of 16 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-stacks.pdb -- an ensemble of base stacks 13 dssr-rotmat.txt -- position vector and rotation matrix 14 dssr-viewV.pdb -- vertical view of the principal moment of inertia 15 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 16 dssr-viewT.pdb -- top view of the principal moment of inertia