{ "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.554, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.567, "chi2": -149.730, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.978, "C1C1_dist": 10.563, "N1N9_dist": 8.903, "C6C8_dist": 9.843, "CNNC_torsion": 4.049, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 10.932, "planarity": 0.153, "simple_Shear": 0.401, "simple_Stretch": -0.129, "simple_Buckle": -10.884, "simple_Propeller": 1.028, "bp_simpleParams": [ 0.401, -0.129, -0.070, -10.884, 1.028, 0.504 ], "bp_params": [ 0.395, -0.147, -0.070, -10.828, 1.503, 0.502 ], "frame": { "rmsd": null, "origin": [ -7.759, 7.914, -40.032 ], "x_axis": [ -0.125, -0.591, 0.797 ], "y_axis": [ 0.838, -0.493, -0.234 ], "z_axis": [ 0.532, 0.638, 0.557 ], "quaternion": [ -0.484, 0.450, 0.137, 0.737 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.894, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.455, "chi2": -149.152, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.328, "C1C1_dist": 10.483, "N1N9_dist": 8.872, "C6C8_dist": 9.883, "CNNC_torsion": -7.601, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.59]", "interBase_angle": 10.554, "planarity": 0.126, "simple_Shear": 0.354, "simple_Stretch": -0.119, "simple_Buckle": -5.288, "simple_Propeller": -9.134, "bp_simpleParams": [ 0.354, -0.119, -0.274, -5.288, -9.134, 4.093 ], "bp_params": [ 0.348, -0.134, -0.274, -5.660, -8.908, 4.101 ], "frame": { "rmsd": null, "origin": [ -6.520, 10.275, -38.052 ], "x_axis": [ 0.306, -0.848, 0.433 ], "y_axis": [ 0.790, -0.027, -0.612 ], "z_axis": [ 0.531, 0.530, 0.662 ], "quaternion": [ 0.697, -0.410, 0.035, -0.588 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/46", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.752, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.038, "chi2": -155.140, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.106, "C1C1_dist": 10.606, "N1N9_dist": 8.839, "C6C8_dist": 9.644, "CNNC_torsion": -10.745, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.78],N1(imino)-O2(carbonyl)[2.87],N2(amino)-O2(carbonyl)[3.36]", "interBase_angle": 9.693, "planarity": 0.121, "simple_Shear": -1.833, "simple_Stretch": -0.203, "simple_Buckle": -3.725, "simple_Propeller": -8.949, "bp_simpleParams": [ -1.833, -0.203, -0.182, -3.725, -8.949, -4.878 ], "bp_params": [ -1.768, -0.525, -0.182, -2.073, -9.469, -4.894 ], "frame": { "rmsd": null, "origin": [ -5.699, 11.654, -35.216 ], "x_axis": [ 0.520, -0.854, -0.031 ], "y_axis": [ 0.562, 0.370, -0.740 ], "z_axis": [ 0.643, 0.367, 0.672 ], "quaternion": [ 0.800, -0.346, 0.211, -0.442 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.910, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.563, "chi2": -150.702, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.338, "C1C1_dist": 10.330, "N1N9_dist": 8.830, "C6C8_dist": 9.914, "CNNC_torsion": 5.420, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.12],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.49]", "interBase_angle": 7.767, "planarity": 0.111, "simple_Shear": 0.316, "simple_Stretch": -0.083, "simple_Buckle": -6.032, "simple_Propeller": -4.893, "bp_simpleParams": [ 0.316, -0.083, -0.457, -6.032, -4.893, 7.170 ], "bp_params": [ 0.313, -0.095, -0.457, -6.213, -4.661, 7.166 ], "frame": { "rmsd": null, "origin": [ -3.148, 11.585, -32.667 ], "x_axis": [ 0.605, -0.445, -0.660 ], "y_axis": [ 0.090, 0.862, -0.499 ], "z_axis": [ 0.791, 0.243, 0.561 ], "quaternion": [ 0.870, -0.213, 0.417, -0.154 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/44", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.356, "chi2": -174.097, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.721, "C1C1_dist": 10.519, "N1N9_dist": 8.819, "C6C8_dist": 9.672, "CNNC_torsion": -2.682, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.82],N3(imino)-O6(carbonyl)[2.80]", "interBase_angle": 6.021, "planarity": 0.071, "simple_Shear": 1.959, "simple_Stretch": -0.147, "simple_Buckle": 5.313, "simple_Propeller": -2.834, "bp_simpleParams": [ 1.959, -0.147, -0.117, 5.313, -2.834, -2.888 ], "bp_params": [ 1.896, -0.517, -0.117, 4.679, -3.791, -2.887 ], "frame": { "rmsd": null, "origin": [ -0.992, 11.246, -30.032 ], "x_axis": [ 0.524, 0.185, -0.831 ], "y_axis": [ -0.315, 0.949, 0.013 ], "z_axis": [ 0.791, 0.255, 0.555 ], "quaternion": [ 0.870, -0.070, 0.466, 0.144 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.906, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.469, "chi2": -167.342, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.330, "C1C1_dist": 10.407, "N1N9_dist": 8.844, "C6C8_dist": 9.892, "CNNC_torsion": 0.043, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 5.025, "planarity": 0.066, "simple_Shear": -0.842, "simple_Stretch": -0.031, "simple_Buckle": 0.363, "simple_Propeller": -5.012, "bp_simpleParams": [ -0.842, -0.031, -0.176, 0.363, -5.012, 3.938 ], "bp_params": [ -0.835, -0.107, -0.176, 0.815, -4.958, 3.941 ], "frame": { "rmsd": null, "origin": [ 2.550, 10.977, -29.543 ], "x_axis": [ 0.188, 0.606, -0.773 ], "y_axis": [ -0.421, 0.761, 0.494 ], "z_axis": [ 0.887, 0.232, 0.398 ], "quaternion": [ 0.766, 0.085, 0.542, 0.335 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.927, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.484, "chi2": -151.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.625, "C1C1_dist": 10.582, "N1N9_dist": 8.914, "C6C8_dist": 9.839, "CNNC_torsion": 2.011, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.81],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 8.203, "planarity": 0.091, "simple_Shear": 0.366, "simple_Stretch": -0.166, "simple_Buckle": -6.750, "simple_Propeller": -4.661, "bp_simpleParams": [ 0.366, -0.166, -0.312, -6.750, -4.661, -0.136 ], "bp_params": [ 0.359, -0.181, -0.312, -6.942, -4.370, -0.135 ], "frame": { "rmsd": null, "origin": [ 5.937, 11.905, -29.068 ], "x_axis": [ -0.406, 0.726, -0.556 ], "y_axis": [ -0.380, 0.419, 0.825 ], "z_axis": [ 0.831, 0.546, 0.106 ], "quaternion": [ 0.529, 0.132, 0.656, 0.523 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/41", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.121, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.002, "chi2": -162.134, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.594, "C1C1_dist": 10.553, "N1N9_dist": 8.876, "C6C8_dist": 9.732, "CNNC_torsion": -5.674, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.81],N1(imino)-O2(carbonyl)[2.81]", "interBase_angle": 6.223, "planarity": 0.079, "simple_Shear": -2.288, "simple_Stretch": -0.027, "simple_Buckle": -1.849, "simple_Propeller": -5.942, "bp_simpleParams": [ -2.288, -0.027, 0.066, -1.849, -5.942, -2.452 ], "bp_params": [ -2.224, -0.537, 0.066, -0.474, -6.205, -2.456 ], "frame": { "rmsd": null, "origin": [ 8.849, 12.968, -29.862 ], "x_axis": [ -0.616, 0.784, -0.072 ], "y_axis": [ -0.200, -0.067, 0.978 ], "z_axis": [ 0.762, 0.617, 0.198 ], "quaternion": [ 0.359, 0.251, 0.581, 0.686 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.586, "chi2": -148.245, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.091, "C1C1_dist": 9.694, "N1N9_dist": 8.425, "C6C8_dist": 9.752, "CNNC_torsion": -12.429, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[2.81]", "interBase_angle": 13.051, "planarity": 0.168, "simple_Shear": 0.941, "simple_Stretch": -0.023, "simple_Buckle": 6.689, "simple_Propeller": -11.207, "bp_simpleParams": [ 0.941, -0.023, 0.020, 6.689, -11.207, 18.202 ], "bp_params": [ 0.936, -0.102, 0.020, 5.703, -11.739, 18.274 ], "frame": { "rmsd": null, "origin": [ 10.606, 15.466, -29.347 ], "x_axis": [ -0.701, 0.458, 0.547 ], "y_axis": [ 0.280, -0.529, 0.801 ], "z_axis": [ 0.656, 0.715, 0.242 ], "quaternion": [ 0.056, 0.383, 0.482, 0.786 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.812, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.982, "chi2": -154.660, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.528, "C1C1_dist": 10.792, "N1N9_dist": 8.986, "C6C8_dist": 9.790, "CNNC_torsion": -4.899, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.65],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 12.116, "planarity": 0.132, "simple_Shear": 0.388, "simple_Stretch": -0.181, "simple_Buckle": -9.261, "simple_Propeller": -7.811, "bp_simpleParams": [ 0.388, -0.181, -0.213, -9.261, -7.811, -4.932 ], "bp_params": [ 0.380, -0.199, -0.213, -9.611, -7.377, -4.925 ], "frame": { "rmsd": null, "origin": [ 14.055, 19.323, -26.725 ], "x_axis": [ -0.533, -0.467, 0.705 ], "y_axis": [ 0.619, -0.783, -0.051 ], "z_axis": [ 0.576, 0.410, 0.707 ], "quaternion": [ -0.312, 0.369, 0.103, 0.869 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.427, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.747, "chi2": -158.363, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.297, "C1C1_dist": 10.678, "N1N9_dist": 8.947, "C6C8_dist": 9.836, "CNNC_torsion": -5.689, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.80]", "interBase_angle": 4.000, "planarity": 0.053, "simple_Shear": -0.750, "simple_Stretch": -0.094, "simple_Buckle": -0.153, "simple_Propeller": -3.997, "bp_simpleParams": [ -0.750, -0.094, 0.038, -0.153, -3.997, -3.137 ], "bp_params": [ -0.740, -0.154, 0.038, 0.168, -3.996, -3.138 ], "frame": { "rmsd": null, "origin": [ 15.211, 21.306, -24.578 ], "x_axis": [ -0.127, -0.857, 0.499 ], "y_axis": [ 0.785, -0.395, -0.478 ], "z_axis": [ 0.607, 0.330, 0.723 ], "quaternion": [ 0.548, -0.369, 0.049, -0.749 ] } }, { "index": 12, "nt1": "///A/12", "nt2": "///A/36", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.338, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.318, "chi2": 164.260, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 27.104, "C1C1_dist": 12.138, "N1N9_dist": 10.148, "C6C8_dist": 10.565, "CNNC_torsion": 7.640, "hbonds_num": 1, "hbonds_desc": "N1*O4(carbonyl)[2.63]", "interBase_angle": 8.613, "planarity": 0.109, "simple_Shear": 3.302, "simple_Stretch": 1.393, "simple_Buckle": -7.631, "simple_Propeller": -3.994, "bp_simpleParams": [ 3.302, 1.393, -0.305, -7.631, -3.994, -22.662 ], "bp_params": [ 3.579, 0.185, -0.305, -8.536, -1.152, -22.602 ], "frame": { "rmsd": null, "origin": [ 16.015, 22.289, -21.195 ], "x_axis": [ 0.535, -0.841, -0.079 ], "y_axis": [ 0.663, 0.476, -0.577 ], "z_axis": [ 0.523, 0.257, 0.813 ], "quaternion": [ 0.840, -0.248, 0.179, -0.448 ] } }, { "index": 13, "nt1": "///A/13", "nt2": "///A/34", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.931, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.604, "chi2": -148.734, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.261, "C1C1_dist": 10.198, "N1N9_dist": 8.742, "C6C8_dist": 9.903, "CNNC_torsion": -10.318, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.29]", "interBase_angle": 10.002, "planarity": 0.140, "simple_Shear": -0.209, "simple_Stretch": -0.004, "simple_Buckle": 6.908, "simple_Propeller": -7.233, "bp_simpleParams": [ -0.209, -0.004, 0.065, 6.908, -7.233, 9.277 ], "bp_params": [ -0.209, -0.010, 0.065, 7.120, -7.024, 9.277 ], "frame": { "rmsd": null, "origin": [ 18.554, 19.893, -18.755 ], "x_axis": [ 0.721, -0.550, -0.421 ], "y_axis": [ 0.323, 0.805, -0.498 ], "z_axis": [ 0.612, 0.223, 0.759 ], "quaternion": [ 0.906, -0.199, 0.285, -0.241 ] } }, { "index": 14, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.040, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.318, "chi2": -158.992, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.245, "C1C1_dist": 10.118, "N1N9_dist": 8.655, "C6C8_dist": 9.815, "CNNC_torsion": -4.710, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[3.26]", "interBase_angle": 5.261, "planarity": 0.065, "simple_Shear": 0.419, "simple_Stretch": -0.100, "simple_Buckle": 0.968, "simple_Propeller": -5.171, "bp_simpleParams": [ 0.419, -0.100, -0.048, 0.968, -5.171, 9.508 ], "bp_params": [ 0.415, -0.115, -0.048, 0.785, -5.202, 9.517 ], "frame": { "rmsd": null, "origin": [ 20.695, 20.020, -15.284 ], "x_axis": [ 0.735, 0.061, -0.675 ], "y_axis": [ -0.186, 0.976, -0.114 ], "z_axis": [ 0.652, 0.210, 0.729 ], "quaternion": [ 0.927, -0.087, 0.358, 0.067 ] } }, { "index": 15, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.209, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.967, "chi2": -156.879, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.940, "C1C1_dist": 10.355, "N1N9_dist": 8.787, "C6C8_dist": 9.844, "CNNC_torsion": -0.530, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 3.344, "planarity": 0.042, "simple_Shear": 0.058, "simple_Stretch": -0.109, "simple_Buckle": 1.123, "simple_Propeller": -3.150, "bp_simpleParams": [ 0.058, -0.109, -0.124, 1.123, -3.150, 4.517 ], "bp_params": [ 0.058, -0.109, -0.124, 1.124, -3.150, 4.518 ], "frame": { "rmsd": null, "origin": [ 23.302, 19.979, -12.579 ], "x_axis": [ 0.523, 0.564, -0.640 ], "y_axis": [ -0.549, 0.796, 0.253 ], "z_axis": [ 0.652, 0.219, 0.726 ], "quaternion": [ 0.872, 0.010, 0.370, 0.319 ] } }, { "index": 16, "nt1": "///A/16", "nt2": "///A/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.789, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.156, "chi2": -150.680, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.936, "C1C1_dist": 9.943, "N1N9_dist": 8.604, "C6C8_dist": 9.874, "CNNC_torsion": 2.120, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.46]", "interBase_angle": 1.793, "planarity": 0.051, "simple_Shear": 0.251, "simple_Stretch": -0.006, "simple_Buckle": 0.938, "simple_Propeller": -1.528, "bp_simpleParams": [ 0.251, -0.006, -0.238, 0.938, -1.528, 14.504 ], "bp_params": [ 0.251, -0.011, -0.238, 0.911, -1.544, 14.504 ], "frame": { "rmsd": null, "origin": [ 26.385, 20.833, -10.824 ], "x_axis": [ 0.023, 0.878, -0.478 ], "y_axis": [ -0.717, 0.348, 0.605 ], "z_axis": [ 0.697, 0.329, 0.637 ], "quaternion": [ 0.708, 0.097, 0.415, 0.563 ] } }, { "index": 17, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.604, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.174, "chi2": -150.568, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.486, "C1C1_dist": 9.764, "N1N9_dist": 8.510, "C6C8_dist": 9.841, "CNNC_torsion": 2.471, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.78],O4(carbonyl)-N6(amino)[3.56]", "interBase_angle": 6.864, "planarity": 0.076, "simple_Shear": 0.311, "simple_Stretch": 0.019, "simple_Buckle": 6.786, "simple_Propeller": -1.035, "bp_simpleParams": [ 0.311, 0.019, -0.131, 6.786, -1.035, 17.417 ], "bp_params": [ 0.311, 0.012, -0.131, 6.760, -1.191, 17.388 ], "frame": { "rmsd": null, "origin": [ 29.263, 21.901, -9.551 ], "x_axis": [ -0.440, 0.880, -0.180 ], "y_axis": [ -0.614, -0.149, 0.776 ], "z_axis": [ 0.655, 0.452, 0.605 ], "quaternion": [ 0.504, 0.161, 0.414, 0.741 ] } }, { "index": 18, "nt1": "///A/18", "nt2": "///A/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.434, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.918, "chi2": -170.321, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.139, "C1C1_dist": 10.492, "N1N9_dist": 8.840, "C6C8_dist": 9.808, "CNNC_torsion": -6.562, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.81]", "interBase_angle": 9.915, "planarity": 0.118, "simple_Shear": -0.075, "simple_Stretch": -0.154, "simple_Buckle": -2.771, "simple_Propeller": -9.520, "bp_simpleParams": [ -0.075, -0.154, -0.209, -2.771, -9.520, 0.751 ], "bp_params": [ -0.075, -0.154, -0.209, -2.754, -9.525, 0.753 ], "frame": { "rmsd": null, "origin": [ 32.755, 23.495, -9.155 ], "x_axis": [ -0.790, 0.592, 0.157 ], "y_axis": [ -0.238, -0.532, 0.812 ], "z_axis": [ 0.565, 0.605, 0.562 ], "quaternion": [ 0.244, 0.212, 0.417, 0.849 ] } }, { "index": 19, "nt1": "///A/19", "nt2": "///A/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.282, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.306, "chi2": -165.144, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.727, "C1C1_dist": 10.753, "N1N9_dist": 8.982, "C6C8_dist": 9.817, "CNNC_torsion": 5.099, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.71],N1-N3(imino)[2.82]", "interBase_angle": 1.789, "planarity": 0.039, "simple_Shear": 0.766, "simple_Stretch": -0.103, "simple_Buckle": -1.544, "simple_Propeller": -0.904, "bp_simpleParams": [ 0.766, -0.103, -0.160, -1.544, -0.904, -5.391 ], "bp_params": [ 0.756, -0.165, -0.160, -1.613, -0.775, -5.390 ], "frame": { "rmsd": null, "origin": [ 35.445, 26.098, -8.872 ], "x_axis": [ -0.816, 0.174, 0.551 ], "y_axis": [ 0.229, -0.778, 0.585 ], "z_axis": [ 0.531, 0.603, 0.595 ], "quaternion": [ -0.015, 0.303, 0.333, 0.893 ] } }, { "index": 20, "nt1": "///A/21", "nt2": "///A/26", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -146.092, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.550, "chi2": -146.005, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.706, "C1C1_dist": 6.978, "N1N9_dist": 6.648, "C6C8_dist": 8.661, "CNNC_torsion": -11.540, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2(carbonyl)[3.33],O2(carbonyl)-N3(imino)[2.82]", "interBase_angle": 18.089, "planarity": 0.324, "simple_Shear": 2.317, "simple_Stretch": 0.069, "simple_Buckle": 14.210, "simple_Propeller": -11.194, "bp_simpleParams": [ 2.317, 0.069, -0.686, 14.210, -11.194, 57.872 ], "bp_params": [ 2.257, -0.530, -0.686, 10.864, -14.463, 58.043 ], "frame": { "rmsd": null, "origin": [ 37.806, 28.983, -2.432 ], "x_axis": [ -0.162, -0.766, 0.622 ], "y_axis": [ 0.886, -0.390, -0.249 ], "z_axis": [ 0.434, 0.511, 0.742 ], "quaternion": [ 0.545, -0.348, -0.086, -0.757 ] } }, { "index": 21, "nt1": "///A/21", "nt2": "///A/27", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -146.092, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 122.573, "chi2": -124.714, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.955, "C1C1_dist": 6.930, "N1N9_dist": 6.980, "C6C8_dist": 9.069, "CNNC_torsion": 21.006, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)*N3[3.14]", "interBase_angle": 14.521, "planarity": 0.257, "simple_Shear": 3.214, "simple_Stretch": 1.817, "simple_Buckle": -12.054, "simple_Propeller": 8.098, "bp_simpleParams": [ 3.214, 1.817, 0.201, -12.054, 8.098, 76.619 ], "bp_params": [ 3.674, 0.369, 0.201, -7.782, 12.260, 76.810 ], "frame": { "rmsd": null, "origin": [ 37.449, 29.068, -3.446 ], "x_axis": [ -0.224, -0.556, 0.800 ], "y_axis": [ 0.917, -0.398, -0.020 ], "z_axis": [ 0.329, 0.730, 0.599 ], "quaternion": [ -0.494, 0.379, 0.238, 0.745 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GGGGUUGGUGUAUUUUUAA", "strand2": "CCUCGACUACAUAAAAAUU", "bp_type": "|||||||||||.|||||||", "helix_form": "........xA.x.....A", "helical_rise": 3.177, "helical_rise_std": 0.894, "helical_radius": 9.089, "helical_radius_std": 1.661, "helical_axis": [ 0.745, 0.375, 0.552 ], "point1": [ -8.485, 6.433, -39.516 ], "point2": [ 34.320, 27.955, -7.838 ], "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.395, -0.147, -0.070, -10.828, 1.503, 0.502 ], "step_params": [ -0.396, -0.542, 3.253, 1.022, 8.619, 35.123 ], "heli_params": [ -2.058, 0.779, 3.028, 14.019, -1.662, 36.146 ], "bp2_params": [ 0.348, -0.134, -0.274, -5.660, -8.908, 4.101 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.253, "simple_Twist": 35.158, "simple_hRise": 3.028, "simple_hTwist": 36.180 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.348, -0.134, -0.274, -5.660, -8.908, 4.101 ], "step_params": [ -0.260, -1.231, 3.005, -2.464, 11.078, 27.510 ], "heli_params": [ -4.384, 0.065, 2.358, 22.139, 4.925, 29.717 ], "bp2_params": [ -1.768, -0.525, -0.182, -2.073, -9.469, -4.894 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.005, "simple_Twist": 38.956, "simple_hRise": 2.586, "simple_hTwist": 40.514 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/46", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.768, -0.525, -0.182, -2.073, -9.469, -4.894 ], "step_params": [ 0.674, -0.993, 3.402, -2.481, 12.558, 42.607 ], "heli_params": [ -2.472, -1.121, 2.967, 16.833, 3.326, 44.403 ], "bp2_params": [ 0.313, -0.095, -0.457, -6.213, -4.661, 7.166 ], "groove_widths": [ 17.184, null, 13.581, null ], "simple_Rise": 3.402, "simple_Twist": 31.404, "simple_hRise": 2.755, "simple_hTwist": 33.852 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.313, -0.095, -0.457, -6.213, -4.661, 7.166 ], "step_params": [ -0.739, -1.263, 3.093, -0.769, 0.173, 38.448 ], "heli_params": [ -1.938, 1.031, 3.102, 0.263, 1.167, 38.455 ], "bp2_params": [ 1.896, -0.517, -0.117, 4.679, -3.791, -2.887 ], "groove_widths": [ 16.880, 15.196, 14.626, 12.128 ], "simple_Rise": 3.093, "simple_Twist": 29.717, "simple_hRise": 3.104, "simple_hTwist": 29.727 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/44", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.896, -0.517, -0.117, 4.679, -3.791, -2.887 ], "step_params": [ 0.753, -1.530, 3.154, 5.643, 9.027, 30.158 ], "heli_params": [ -4.287, -0.426, 2.690, 16.709, -10.445, 31.940 ], "bp2_params": [ -0.835, -0.107, -0.176, 0.815, -4.958, 3.941 ], "groove_widths": [ 17.405, 15.820, 14.807, 11.434 ], "simple_Rise": 3.154, "simple_Twist": 44.949, "simple_hRise": 2.881, "simple_hTwist": 46.129 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.835, -0.107, -0.176, 0.815, -4.958, 3.941 ], "step_params": [ -0.063, -0.700, 3.473, -0.877, 24.946, 28.280 ], "heli_params": [ -4.338, -0.017, 2.182, 42.153, 1.481, 37.551 ], "bp2_params": [ 0.359, -0.181, -0.312, -6.942, -4.370, -0.135 ], "groove_widths": [ 18.007, 16.361, 14.975, 12.720 ], "simple_Rise": 3.473, "simple_Twist": 22.101, "simple_hRise": 1.811, "simple_hTwist": 33.223 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.359, -0.181, -0.312, -6.942, -4.370, -0.135 ], "step_params": [ -0.408, -1.450, 2.823, -6.903, 3.599, 30.637 ], "heli_params": [ -3.232, -0.342, 2.666, 6.676, 12.806, 31.587 ], "bp2_params": [ -2.224, -0.537, 0.066, -0.474, -6.205, -2.456 ], "groove_widths": [ 17.444, 15.671, 15.254, 12.059 ], "simple_Rise": 2.823, "simple_Twist": 44.525, "simple_hRise": 2.735, "simple_hTwist": 45.166 }, { "index": 8, "nt1": "///A/8", "nt2": "///A/41", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.224, -0.537, 0.066, -0.474, -6.205, -2.456 ], "step_params": [ 0.556, -0.314, 3.030, -0.364, 8.627, 40.401 ], "heli_params": [ -1.297, -0.824, 2.901, 12.322, 0.520, 41.276 ], "bp2_params": [ 0.936, -0.102, 0.020, 5.703, -11.739, 18.274 ], "groove_widths": [ 17.816, 15.271, 11.711, 11.234 ], "simple_Rise": 3.030, "simple_Twist": 22.882, "simple_hRise": 2.722, "simple_hTwist": 24.436 }, { "index": 9, "nt1": "///A/9", "nt2": "///A/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.936, -0.102, 0.020, 5.703, -11.739, 18.274 ], "step_params": [ 0.000, -0.588, 5.771, -22.951, 23.163, 53.629 ], "heli_params": [ -2.462, -1.875, 4.842, 23.412, 23.199, 62.130 ], "bp2_params": [ 0.380, -0.199, -0.213, -9.611, -7.377, -4.925 ], "groove_widths": [ 19.526, 16.336, 9.950, 6.488 ], "simple_Rise": 5.771, "simple_Twist": 56.969, "simple_hRise": 4.934, "simple_hTwist": 64.955 }, { "index": 10, "nt1": "///A/10", "nt2": "///A/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.380, -0.199, -0.213, -9.611, -7.377, -4.925 ], "step_params": [ -0.392, -0.994, 2.955, -3.827, 3.147, 34.770 ], "heli_params": [ -2.070, 0.136, 2.882, 5.233, 6.364, 35.110 ], "bp2_params": [ -0.740, -0.154, 0.038, 0.168, -3.996, -3.138 ], "groove_widths": [ 20.280, 16.688, 7.952, 4.506 ], "simple_Rise": 2.955, "simple_Twist": 40.703, "simple_hRise": 2.897, "simple_hTwist": 40.991 }, { "index": 11, "nt1": "///A/11", "nt2": "///A/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.740, -0.154, 0.038, 0.168, -3.996, -3.138 ], "step_params": [ -0.056, -1.356, 3.349, 7.074, 4.127, 52.096 ], "heli_params": [ -1.799, 0.527, 3.208, 4.667, -7.998, 52.691 ], "bp2_params": [ 3.579, 0.185, -0.305, -8.536, -1.152, -22.602 ], "groove_widths": [ 18.059, 15.486, 12.005, 11.549 ], "simple_Rise": 3.349, "simple_Twist": 31.201, "simple_hRise": 3.063, "simple_hTwist": 32.232 }, { "index": 12, "nt1": "///A/12", "nt2": "///A/36", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.579, 0.185, -0.305, -8.536, -1.152, -22.602 ], "step_params": [ 2.750, -1.673, 2.788, -3.046, 5.480, 27.614 ], "heli_params": [ -4.383, -6.160, 2.114, 11.296, 6.280, 28.304 ], "bp2_params": [ -0.209, -0.010, 0.065, 7.120, -7.024, 9.277 ], "groove_widths": [ 16.136, 14.783, 14.691, 13.863 ], "simple_Rise": 2.788, "simple_Twist": 45.875, "simple_hRise": 2.406, "simple_hTwist": 46.278 }, { "index": 13, "nt1": "///A/13", "nt2": "///A/34", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.209, -0.010, 0.065, 7.120, -7.024, 9.277 ], "step_params": [ -0.394, -0.885, 3.963, 0.005, 2.924, 38.567 ], "heli_params": [ -1.769, 0.596, 3.888, 4.420, -0.008, 38.673 ], "bp2_params": [ 0.415, -0.115, -0.048, 0.785, -5.202, 9.517 ], "groove_widths": [ 17.888, 15.630, 16.165, 15.722 ], "simple_Rise": 3.963, "simple_Twist": 34.891, "simple_hRise": 3.878, "simple_hTwist": 35.010 }, { "index": 14, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.415, -0.115, -0.048, 0.785, -5.202, 9.517 ], "step_params": [ -0.154, -0.842, 3.658, -0.462, 0.315, 31.735 ], "heli_params": [ -1.604, 0.186, 3.652, 0.576, 0.846, 31.740 ], "bp2_params": [ 0.058, -0.109, -0.124, 1.124, -3.150, 4.518 ], "groove_widths": [ 17.978, 15.545, 16.710, 16.141 ], "simple_Rise": 3.658, "simple_Twist": 33.752, "simple_hRise": 3.652, "simple_hTwist": 33.756 }, { "index": 15, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.109, -0.124, 1.124, -3.150, 4.518 ], "step_params": [ 0.498, -0.825, 3.520, 0.220, 8.502, 34.637 ], "heli_params": [ -2.642, -0.780, 3.236, 14.020, -0.363, 35.634 ], "bp2_params": [ 0.251, -0.011, -0.238, 0.911, -1.544, 14.504 ], "groove_widths": [ 16.919, 15.289, 17.514, 15.010 ], "simple_Rise": 3.520, "simple_Twist": 33.518, "simple_hRise": 3.223, "simple_hTwist": 34.550 }, { "index": 16, "nt1": "///A/16", "nt2": "///A/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.251, -0.011, -0.238, 0.911, -1.544, 14.504 ], "step_params": [ -0.077, -1.022, 3.161, -1.076, 7.581, 31.104 ], "heli_params": [ -3.127, -0.041, 2.840, 13.875, 1.969, 32.010 ], "bp2_params": [ 0.311, 0.012, -0.131, 6.760, -1.191, 17.388 ], "groove_widths": [ 16.765, null, 16.547, null ], "simple_Rise": 3.161, "simple_Twist": 30.713, "simple_hRise": 2.835, "simple_hTwist": 31.630 }, { "index": 17, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.311, 0.012, -0.131, 6.760, -1.191, 17.388 ], "step_params": [ -1.042, -1.860, 3.217, 2.861, 10.107, 31.211 ], "heli_params": [ -4.813, 2.273, 2.411, 18.152, -5.139, 32.889 ], "bp2_params": [ -0.075, -0.154, -0.209, -2.754, -9.525, 0.753 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.217, "simple_Twist": 33.519, "simple_hRise": 2.475, "simple_hTwist": 35.081 }, { "index": 18, "nt1": "///A/18", "nt2": "///A/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.154, -0.209, -2.754, -9.525, 0.753 ], "step_params": [ -1.097, -1.607, 3.210, -1.450, 2.305, 33.357 ], "heli_params": [ -3.160, 1.673, 3.139, 4.007, 2.521, 33.465 ], "bp2_params": [ 0.756, -0.165, -0.160, -1.613, -0.775, -5.390 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.210, "simple_Twist": 29.065, "simple_hRise": 3.126, "simple_hTwist": 29.190 }, { "index": 19, "nt1": "///A/19", "nt2": "///A/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGGGUUGGU", "strand2": "CCUCGACUA", "bp_type": "|||||||||", "helix_form": "........", "helical_rise": 2.879, "helical_rise_std": 0.335, "helical_radius": 8.958, "helical_radius_std": 0.480, "helical_axis": [ 0.759, 0.488, 0.431 ], "point1": [ -8.189, 5.880, -37.902 ], "point2": [ 9.373, 17.159, -27.946 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.395, -0.147, -0.070, -10.828, 1.503, 0.502 ], "step_params": [ -0.396, -0.542, 3.253, 1.022, 8.619, 35.123 ], "heli_params": [ -2.058, 0.779, 3.028, 14.019, -1.662, 36.146 ], "bp2_params": [ 0.348, -0.134, -0.274, -5.660, -8.908, 4.101 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.253, "simple_Twist": 35.158, "simple_hRise": 3.028, "simple_hTwist": 36.180 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.348, -0.134, -0.274, -5.660, -8.908, 4.101 ], "step_params": [ -0.260, -1.231, 3.005, -2.464, 11.078, 27.510 ], "heli_params": [ -4.384, 0.065, 2.358, 22.139, 4.925, 29.717 ], "bp2_params": [ -1.768, -0.525, -0.182, -2.073, -9.469, -4.894 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.005, "simple_Twist": 38.956, "simple_hRise": 2.586, "simple_hTwist": 40.514 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/46", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.768, -0.525, -0.182, -2.073, -9.469, -4.894 ], "step_params": [ 0.674, -0.993, 3.402, -2.481, 12.558, 42.607 ], "heli_params": [ -2.472, -1.121, 2.967, 16.833, 3.326, 44.403 ], "bp2_params": [ 0.313, -0.095, -0.457, -6.213, -4.661, 7.166 ], "groove_widths": [ 17.184, null, 13.581, null ], "simple_Rise": 3.402, "simple_Twist": 31.404, "simple_hRise": 2.755, "simple_hTwist": 33.852 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.313, -0.095, -0.457, -6.213, -4.661, 7.166 ], "step_params": [ -0.739, -1.263, 3.093, -0.769, 0.173, 38.448 ], "heli_params": [ -1.938, 1.031, 3.102, 0.263, 1.167, 38.455 ], "bp2_params": [ 1.896, -0.517, -0.117, 4.679, -3.791, -2.887 ], "groove_widths": [ 16.880, 15.196, 14.626, 12.128 ], "simple_Rise": 3.093, "simple_Twist": 29.717, "simple_hRise": 3.104, "simple_hTwist": 29.727 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/44", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.896, -0.517, -0.117, 4.679, -3.791, -2.887 ], "step_params": [ 0.753, -1.530, 3.154, 5.643, 9.027, 30.158 ], "heli_params": [ -4.287, -0.426, 2.690, 16.709, -10.445, 31.940 ], "bp2_params": [ -0.835, -0.107, -0.176, 0.815, -4.958, 3.941 ], "groove_widths": [ 17.405, 15.820, 14.807, 11.434 ], "simple_Rise": 3.154, "simple_Twist": 44.949, "simple_hRise": 2.881, "simple_hTwist": 46.129 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.835, -0.107, -0.176, 0.815, -4.958, 3.941 ], "step_params": [ -0.063, -0.700, 3.473, -0.877, 24.946, 28.280 ], "heli_params": [ -4.338, -0.017, 2.182, 42.153, 1.481, 37.551 ], "bp2_params": [ 0.359, -0.181, -0.312, -6.942, -4.370, -0.135 ], "groove_widths": [ 18.007, null, 14.975, null ], "simple_Rise": 3.473, "simple_Twist": 22.101, "simple_hRise": 1.811, "simple_hTwist": 33.223 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.359, -0.181, -0.312, -6.942, -4.370, -0.135 ], "step_params": [ -0.408, -1.450, 2.823, -6.903, 3.599, 30.637 ], "heli_params": [ -3.232, -0.342, 2.666, 6.676, 12.806, 31.587 ], "bp2_params": [ -2.224, -0.537, 0.066, -0.474, -6.205, -2.456 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.823, "simple_Twist": 44.525, "simple_hRise": 2.735, "simple_hTwist": 45.166 }, { "index": 8, "nt1": "///A/8", "nt2": "///A/41", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.224, -0.537, 0.066, -0.474, -6.205, -2.456 ], "step_params": [ 0.556, -0.314, 3.030, -0.364, 8.627, 40.401 ], "heli_params": [ -1.297, -0.824, 2.901, 12.322, 0.520, 41.276 ], "bp2_params": [ 0.936, -0.102, 0.020, 5.703, -11.739, 18.274 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.030, "simple_Twist": 22.882, "simple_hRise": 2.722, "simple_hTwist": 24.436 }, { "index": 9, "nt1": "///A/9", "nt2": "///A/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GU", "strand2": "CA", "bp_type": "||", "helix_form": "A", "helical_rise": 2.923, "helical_rise_std": 0.009, "helical_radius": 8.384, "helical_radius_std": 0.361, "helical_axis": [ 0.765, 0.241, 0.598 ], "point1": [ 12.633, 18.841, -25.109 ], "point2": [ 14.868, 19.544, -23.362 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/10", "nt2": "///A/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.380, -0.199, -0.213, -9.611, -7.377, -4.925 ], "step_params": [ -0.392, -0.994, 2.955, -3.827, 3.147, 34.770 ], "heli_params": [ -2.070, 0.136, 2.882, 5.233, 6.364, 35.110 ], "bp2_params": [ -0.740, -0.154, 0.038, 0.168, -3.996, -3.138 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.955, "simple_Twist": 40.703, "simple_hRise": 2.897, "simple_hTwist": 40.991 }, { "index": 2, "nt1": "///A/11", "nt2": "///A/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "UUUUUAA", "strand2": "AAAAAUU", "bp_type": "|||||||", "helix_form": ".....A", "helical_rise": 3.010, "helical_rise_std": 0.317, "helical_radius": 9.766, "helical_radius_std": 0.827, "helical_axis": [ 0.537, 0.478, 0.695 ], "point1": [ 21.808, 18.974, -19.381 ], "point2": [ 31.391, 27.513, -6.971 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/13", "nt2": "///A/34", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.209, -0.010, 0.065, 7.120, -7.024, 9.277 ], "step_params": [ -0.394, -0.885, 3.963, 0.005, 2.924, 38.567 ], "heli_params": [ -1.769, 0.596, 3.888, 4.420, -0.008, 38.673 ], "bp2_params": [ 0.415, -0.115, -0.048, 0.785, -5.202, 9.517 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.963, "simple_Twist": 34.891, "simple_hRise": 3.878, "simple_hTwist": 35.010 }, { "index": 2, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.415, -0.115, -0.048, 0.785, -5.202, 9.517 ], "step_params": [ -0.154, -0.842, 3.658, -0.462, 0.315, 31.735 ], "heli_params": [ -1.604, 0.186, 3.652, 0.576, 0.846, 31.740 ], "bp2_params": [ 0.058, -0.109, -0.124, 1.124, -3.150, 4.518 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.658, "simple_Twist": 33.752, "simple_hRise": 3.652, "simple_hTwist": 33.756 }, { "index": 3, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.109, -0.124, 1.124, -3.150, 4.518 ], "step_params": [ 0.498, -0.825, 3.520, 0.220, 8.502, 34.637 ], "heli_params": [ -2.642, -0.780, 3.236, 14.020, -0.363, 35.634 ], "bp2_params": [ 0.251, -0.011, -0.238, 0.911, -1.544, 14.504 ], "groove_widths": [ 16.919, null, 17.514, null ], "simple_Rise": 3.520, "simple_Twist": 33.518, "simple_hRise": 3.223, "simple_hTwist": 34.550 }, { "index": 4, "nt1": "///A/16", "nt2": "///A/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.251, -0.011, -0.238, 0.911, -1.544, 14.504 ], "step_params": [ -0.077, -1.022, 3.161, -1.076, 7.581, 31.104 ], "heli_params": [ -3.127, -0.041, 2.840, 13.875, 1.969, 32.010 ], "bp2_params": [ 0.311, 0.012, -0.131, 6.760, -1.191, 17.388 ], "groove_widths": [ 16.765, null, 16.547, null ], "simple_Rise": 3.161, "simple_Twist": 30.713, "simple_hRise": 2.835, "simple_hTwist": 31.630 }, { "index": 5, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.311, 0.012, -0.131, 6.760, -1.191, 17.388 ], "step_params": [ -1.042, -1.860, 3.217, 2.861, 10.107, 31.211 ], "heli_params": [ -4.813, 2.273, 2.411, 18.152, -5.139, 32.889 ], "bp2_params": [ -0.075, -0.154, -0.209, -2.754, -9.525, 0.753 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.217, "simple_Twist": 33.519, "simple_hRise": 2.475, "simple_hTwist": 35.081 }, { "index": 6, "nt1": "///A/18", "nt2": "///A/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.154, -0.209, -2.754, -9.525, 0.753 ], "step_params": [ -1.097, -1.607, 3.210, -1.450, 2.305, 33.357 ], "heli_params": [ -3.160, 1.673, 3.139, 4.007, 2.521, 33.465 ], "bp2_params": [ 0.756, -0.165, -0.160, -1.613, -0.775, -5.390 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.210, "simple_Twist": 29.065, "simple_hRise": 3.126, "simple_hTwist": 29.190 }, { "index": 7, "nt1": "///A/19", "nt2": "///A/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/23,///A/24" }, { "index": 2, "num_nts": 2, "nts_short": "AC", "nts_long": "///A/34,///A/35" }, { "index": 3, "num_nts": 3, "nts_short": "UAU", "nts_long": "///A/11,///A/12,///A/13" }, { "index": 4, "num_nts": 3, "nts_short": "AAU", "nts_long": "///A/19,///A/20,///A/21" }, { "index": 5, "num_nts": 3, "nts_short": "UUC", "nts_long": "///A/22,///A/26,///A/27" }, { "index": 6, "num_nts": 3, "nts_short": "CAA", "nts_long": "///A/38,///A/39,///A/40" } ], "nonStack": { "num_nts": 2, "nts_short": "UU", "nts_long": "///A/25,///A/36" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/24/OP2", "nt": "///A/22", "vert_dist": 2.733 }, { "index": 2, "type": "sugar", "atom": "///A/26/O4'", "nt": "///A/24", "vert_dist": 3.029 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 8 ], "stem_indices": [ 3 ], "summary": "[1] 8 [A.19 A.28] 7", "num_nts": 10, "nts_short": "AAUUAAUUCU", "nts_long": "///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27,///A/28", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 8, "nts_short": "AUUAAUUC", "nts_long": "///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 0 1 [A.9 A.40 A.10 A.38] 9 2", "num_nts": 5, "nts_short": "UGCAA", "nts_long": "///A/9,///A/10,///A/38,///A/39,///A/40", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///A/39" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ 2, 3 ], "summary": "[2] 1 2 [A.11 A.37 A.13 A.34] 2 7", "num_nts": 7, "nts_short": "UAUACUA", "nts_long": "///A/11,///A/12,///A/13,///A/34,///A/35,///A/36,///A/37", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/12" }, { "index": 2, "num_nts": 2, "nts_short": "CU", "nts_long": "///A/35,///A/36" } ] } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/22,///A/23" }, { "index": 2, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/25,///A/26" } ], "dbn": { "all_chains": { "num_nts": 48, "num_chars": 48, "bseq": "GGGGUUGGUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAUCAGCUCC", "sstr": "(((((((((((.(((((((........)))))))..)).)))))))))", "form": ".AAAAAA..A.A....AAA........AAA......A...A..AAAA-" }, "m1_chain_A": { "num_nts": 48, "num_chars": 48, "bseq": "GGGGUUGGUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAUCAGCUCC", "sstr": "(((((((((((.(((((((........)))))))..)).)))))))))", "form": ".AAAAAA..A.A....AAA........AAA......A...A..AAAA-" } }, "chains": { "m1_chain_A": { "num_nts": 48, "bseq": "GGGGUUGGUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAUCAGCUCC", "sstr": "(((((((((((.(((((((........)))))))..)).)))))))))", "form": ".AAAAAA..A.A....AAA........AAA......A...A..AAAA-", "helical_rise": 0.098, "helical_rise_std": 2.843, "helical_axis": [ -0.290, 0.703, -0.649 ], "point1": [ 15.770, 31.416, -24.824 ], "point2": [ 14.335, 34.893, -28.031 ], "num_chars": 142, "suite": "G!!G!!G1aG!!U1aU!!G!!G1aU!!G!!U!!A!!U1aU!!U!!U!!U!!A!!A1aA1aU!!U!!A!!A!!U!!U!!C!!U1aU1aA1aA!!A!!A1aA!!C0aU1aA!!C!!A1aA!!U1aC!!A!!G1aC!!U1aC1aC" } }, "num_nts": 48, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 61.524, "delta": 100.295, "epsilon": -158.361, "zeta": -82.673, "epsilon_zeta": -75.688, "bb_type": "BI", "chi": -160.554, "glyco_bond": "anti", "C5prime_xyz": [ -1.885, 8.816, 0.699 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.010, "Dp": 4.022, "splay_angle": 19.839, "splay_distance": 3.176, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -9.400, "v1": -6.052, "v2": 18.040, "v3": -24.053, "v4": 21.115, "amplitude": 23.957, "phase_angle": 41.148, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -7.864, 7.811, -39.877 ], "x_axis": [ -0.129, -0.601, 0.789 ], "y_axis": [ 0.785, -0.548, -0.290 ], "z_axis": [ 0.607, 0.581, 0.542 ], "quaternion": [ -0.465, 0.468, 0.098, 0.745 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -117.706, "beta": 166.893, "gamma": 88.219, "delta": 92.888, "epsilon": -145.311, "zeta": -80.613, "epsilon_zeta": -64.699, "bb_type": "BI", "chi": -163.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.257, 8.587, 0.901 ], "P_xyz": [ 1.260, 8.993, 0.179 ], "form": "A", "ssZp": 4.517, "Dp": 4.650, "splay_angle": 23.193, "splay_distance": 3.717, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 153.298, "theta": -147.076, "eta_prime": 166.851, "theta_prime": -153.892, "eta_base": -145.337, "theta_base": -144.894, "v0": 6.547, "v1": -25.345, "v2": 33.536, "v3": -30.497, "v4": 15.103, "amplitude": 33.831, "phase_angle": 7.565, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -6.592, 10.056, -38.026 ], "x_axis": [ 0.375, -0.806, 0.458 ], "y_axis": [ 0.751, -0.026, -0.660 ], "z_axis": [ 0.544, 0.592, 0.595 ], "quaternion": [ 0.697, -0.449, 0.031, -0.558 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.404, "beta": 153.957, "gamma": 88.845, "delta": 85.211, "epsilon": -128.380, "zeta": -80.239, "epsilon_zeta": -48.141, "bb_type": "BI", "chi": -174.752, "glyco_bond": "anti", "C5prime_xyz": [ -1.614, 8.534, 1.459 ], "P_xyz": [ 0.846, 9.328, 0.910 ], "form": "A", "ssZp": 4.588, "Dp": 4.761, "splay_angle": 24.818, "splay_distance": 3.907, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 165.282, "theta": -135.324, "eta_prime": 175.775, "theta_prime": -134.264, "eta_base": -158.734, "theta_base": -89.102, "v0": 3.545, "v1": -26.406, "v2": 38.177, "v3": -37.223, "v4": 21.143, "amplitude": 39.277, "phase_angle": 13.595, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -6.365, 12.278, -35.055 ], "x_axis": [ 0.548, -0.835, 0.056 ], "y_axis": [ 0.575, 0.327, -0.750 ], "z_axis": [ 0.608, 0.443, 0.659 ], "quaternion": [ 0.796, -0.375, 0.173, -0.443 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.284, "beta": 166.073, "gamma": 37.901, "delta": 92.934, "epsilon": -166.105, "zeta": -72.372, "epsilon_zeta": -93.734, "bb_type": "BI", "chi": -159.910, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.735, 0.687 ], "P_xyz": [ 1.021, 9.100, 1.261 ], "form": "A", "ssZp": 4.399, "Dp": 4.388, "splay_angle": 21.887, "splay_distance": 3.444, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 159.659, "theta": -146.014, "eta_prime": -178.952, "theta_prime": -146.095, "eta_base": -112.867, "theta_base": -119.521, "v0": 0.103, "v1": -19.107, "v2": 29.717, "v3": -30.447, "v4": 19.133, "amplitude": 31.312, "phase_angle": 18.369, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.328, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -3.238, 11.419, -32.875 ], "x_axis": [ 0.638, -0.380, -0.669 ], "y_axis": [ 0.008, 0.872, -0.489 ], "z_axis": [ 0.770, 0.307, 0.560 ], "quaternion": [ 0.876, -0.227, 0.411, -0.111 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -101.816, "beta": 174.293, "gamma": 85.446, "delta": 95.189, "epsilon": -160.273, "zeta": -77.175, "epsilon_zeta": -83.098, "bb_type": "BI", "chi": -160.615, "glyco_bond": "anti", "C5prime_xyz": [ -1.386, 8.669, 0.766 ], "P_xyz": [ 1.185, 9.082, 0.296 ], "form": "A", "ssZp": 4.421, "Dp": 4.381, "splay_angle": 21.030, "splay_distance": 3.317, "splay_ratio": 0.183, "d22": 4.639, "d64": 4.120, "eta": 167.303, "theta": -146.332, "eta_prime": -176.336, "theta_prime": -150.230, "eta_base": -134.406, "theta_base": -130.346, "v0": 0.256, "v1": -17.711, "v2": 27.400, "v3": -27.941, "v4": 17.473, "amplitude": 28.815, "phase_angle": 18.029, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -0.460, 11.161, -30.856 ], "x_axis": [ 0.557, 0.169, -0.813 ], "y_axis": [ -0.269, 0.963, 0.016 ], "z_axis": [ 0.786, 0.210, 0.582 ], "quaternion": [ 0.881, -0.055, 0.454, 0.124 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.249, "beta": -176.328, "gamma": 55.807, "delta": 91.833, "epsilon": -127.700, "zeta": -77.715, "epsilon_zeta": -49.986, "bb_type": "BI", "chi": -150.906, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.716, 0.140 ], "P_xyz": [ 1.325, 9.051, 0.370 ], "form": "A", "ssZp": 3.986, "Dp": 4.639, "splay_angle": 21.383, "splay_distance": 3.578, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 174.046, "theta": -131.260, "eta_prime": -178.326, "theta_prime": -131.027, "eta_base": -148.260, "theta_base": -107.307, "v0": 2.482, "v1": -21.592, "v2": 31.429, "v3": -30.862, "v4": 17.897, "amplitude": 32.436, "phase_angle": 14.316, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.338, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ 2.416, 10.663, -29.282 ], "x_axis": [ 0.212, 0.641, -0.737 ], "y_axis": [ -0.422, 0.741, 0.523 ], "z_axis": [ 0.881, 0.201, 0.428 ], "quaternion": [ 0.771, 0.104, 0.525, 0.345 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -86.420, "beta": 137.789, "gamma": 88.382, "delta": 91.979, "epsilon": -165.424, "zeta": -85.115, "epsilon_zeta": -80.310, "bb_type": "BI", "chi": -171.927, "glyco_bond": "anti", "C5prime_xyz": [ -2.152, 8.740, 1.239 ], "P_xyz": [ 0.172, 9.695, 0.425 ], "form": "A", "ssZp": 4.245, "Dp": 4.196, "splay_angle": 24.869, "splay_distance": 3.928, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 154.337, "theta": -158.982, "eta_prime": -178.751, "theta_prime": -167.668, "eta_base": -135.963, "theta_base": -150.485, "v0": -11.286, "v1": -9.057, "v2": 24.462, "v3": -31.845, "v4": 27.223, "amplitude": 31.545, "phase_angle": 39.152, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 5.769, 11.912, -29.259 ], "x_axis": [ -0.374, 0.746, -0.551 ], "y_axis": [ -0.430, 0.387, 0.815 ], "z_axis": [ 0.822, 0.542, 0.177 ], "quaternion": [ 0.545, 0.125, 0.629, 0.539 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -109.113, "beta": 179.153, "gamma": 85.181, "delta": 88.085, "epsilon": -131.309, "zeta": -80.435, "epsilon_zeta": -50.874, "bb_type": "BI", "chi": -172.121, "glyco_bond": "anti", "C5prime_xyz": [ -1.602, 8.592, 1.346 ], "P_xyz": [ 0.983, 9.133, 1.444 ], "form": ".", "ssZp": 4.537, "Dp": 4.672, "splay_angle": 24.077, "splay_distance": 3.751, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 170.275, "theta": -134.243, "eta_prime": 174.686, "theta_prime": -129.707, "eta_base": -157.619, "theta_base": -75.305, "v0": 1.549, "v1": -22.735, "v2": 34.170, "v3": -34.246, "v4": 20.572, "amplitude": 35.581, "phase_angle": 16.191, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 9.613, 12.135, -30.038 ], "x_axis": [ -0.570, 0.818, -0.082 ], "y_axis": [ -0.215, -0.052, 0.975 ], "z_axis": [ 0.793, 0.573, 0.206 ], "quaternion": [ 0.382, 0.263, 0.573, 0.676 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -62.039, "beta": 150.585, "gamma": 63.313, "delta": 100.578, "epsilon": -124.692, "zeta": -89.503, "epsilon_zeta": -35.188, "bb_type": "--", "chi": -158.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.598, 8.720, 0.636 ], "P_xyz": [ 1.038, 8.878, 0.567 ], "form": ".", "ssZp": 3.911, "Dp": 4.202, "splay_angle": 34.675, "splay_distance": 5.604, "splay_ratio": 0.303, "d22": null, "d64": null, "eta": 174.031, "theta": -127.162, "eta_prime": -162.726, "theta_prime": -130.628, "eta_base": -92.941, "theta_base": -97.755, "v0": -4.497, "v1": -10.024, "v2": 19.727, "v3": -22.938, "v4": 17.344, "amplitude": 22.731, "phase_angle": 29.788, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.136, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 10.270, 15.715, -29.129 ], "x_axis": [ -0.573, 0.445, 0.689 ], "y_axis": [ 0.410, -0.572, 0.710 ], "z_axis": [ 0.710, 0.690, 0.145 ], "quaternion": [ 0.011, 0.462, 0.463, 0.757 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -110.734, "beta": 161.506, "gamma": 85.237, "delta": 102.319, "epsilon": -155.041, "zeta": -78.698, "epsilon_zeta": -76.343, "bb_type": "BI", "chi": -171.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 8.387, 1.415 ], "P_xyz": [ 1.265, 8.552, 1.170 ], "form": "A", "ssZp": 4.247, "Dp": 4.323, "splay_angle": 21.627, "splay_distance": 3.378, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 150.335, "theta": -133.757, "eta_prime": 173.938, "theta_prime": -142.847, "eta_base": -135.818, "theta_base": -125.792, "v0": 4.682, "v1": -17.811, "v2": 23.448, "v3": -21.298, "v4": 10.516, "amplitude": 23.643, "phase_angle": 7.359, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 13.831, 19.268, -26.661 ], "x_axis": [ -0.517, -0.407, 0.753 ], "y_axis": [ 0.546, -0.834, -0.076 ], "z_axis": [ 0.659, 0.372, 0.653 ], "quaternion": [ -0.275, 0.407, 0.085, 0.867 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -117.067, "beta": -177.154, "gamma": 85.149, "delta": 93.620, "epsilon": -136.367, "zeta": -70.217, "epsilon_zeta": -66.149, "bb_type": "BI", "chi": -162.427, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.623, 0.846 ], "P_xyz": [ 1.261, 8.931, 0.710 ], "form": ".", "ssZp": 4.382, "Dp": 4.581, "splay_angle": 23.514, "splay_distance": 3.746, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 161.853, "theta": -129.538, "eta_prime": 175.171, "theta_prime": -131.022, "eta_base": -149.427, "theta_base": -86.647, "v0": 2.874, "v1": -20.997, "v2": 30.146, "v3": -29.240, "v4": 16.626, "amplitude": 30.982, "phase_angle": 13.337, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ 15.210, 21.659, -24.712 ], "x_axis": [ -0.128, -0.834, 0.536 ], "y_axis": [ 0.782, -0.417, -0.462 ], "z_axis": [ 0.610, 0.361, 0.706 ], "quaternion": [ 0.539, -0.382, 0.034, -0.750 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -86.960, "beta": 139.505, "gamma": 87.796, "delta": 93.338, "epsilon": -148.509, "zeta": -67.708, "epsilon_zeta": -80.802, "bb_type": "BI", "chi": -173.338, "glyco_bond": "anti", "C5prime_xyz": [ -1.701, 8.454, 1.413 ], "P_xyz": [ 0.733, 9.101, 0.605 ], "form": "A", "ssZp": 4.412, "Dp": 4.511, "splay_angle": 20.779, "splay_distance": 3.329, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 158.166, "theta": -132.185, "eta_prime": -172.649, "theta_prime": -141.352, "eta_base": -102.568, "theta_base": -105.711, "v0": 1.320, "v1": -20.152, "v2": 30.244, "v3": -30.256, "v4": 18.243, "amplitude": 31.493, "phase_angle": 16.191, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 16.954, 20.788, -21.513 ], "x_axis": [ 0.408, -0.911, 0.055 ], "y_axis": [ 0.717, 0.282, -0.638 ], "z_axis": [ 0.566, 0.300, 0.768 ], "quaternion": [ 0.784, -0.299, 0.163, -0.519 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -105.265, "beta": 168.644, "gamma": 85.899, "delta": 94.240, "epsilon": -151.728, "zeta": -85.607, "epsilon_zeta": -66.121, "bb_type": "BI", "chi": -164.931, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.695, 0.969 ], "P_xyz": [ 0.954, 9.312, 0.652 ], "form": ".", "ssZp": 4.360, "Dp": 4.370, "splay_angle": 25.695, "splay_distance": 4.007, "splay_ratio": 0.223, "d22": 4.899, "d64": 4.348, "eta": 160.438, "theta": -150.513, "eta_prime": -178.200, "theta_prime": -148.757, "eta_base": -119.643, "theta_base": -118.379, "v0": -3.138, "v1": -15.017, "v2": 26.267, "v3": -28.882, "v4": 20.232, "amplitude": 28.919, "phase_angle": 24.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 18.497, 19.954, -18.684 ], "x_axis": [ 0.784, -0.469, -0.408 ], "y_axis": [ 0.297, 0.859, -0.417 ], "z_axis": [ 0.546, 0.206, 0.812 ], "quaternion": [ 0.929, -0.168, 0.256, -0.206 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.894, "beta": 177.425, "gamma": 54.986, "delta": 104.656, "epsilon": -165.810, "zeta": -75.193, "epsilon_zeta": -90.617, "bb_type": "BI", "chi": -147.040, "glyco_bond": "anti", "C5prime_xyz": [ -1.260, 8.637, 0.006 ], "P_xyz": [ 1.359, 8.731, 0.378 ], "form": ".", "ssZp": 3.846, "Dp": 4.100, "splay_angle": 22.771, "splay_distance": 3.714, "splay_ratio": 0.197, "d22": 4.532, "d64": 4.322, "eta": 173.433, "theta": -138.700, "eta_prime": -170.204, "theta_prime": -143.626, "eta_base": -129.412, "theta_base": -122.717, "v0": 1.576, "v1": -13.869, "v2": 20.132, "v3": -19.651, "v4": 11.452, "amplitude": 20.765, "phase_angle": 14.182, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.028, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 20.843, 19.972, -15.435 ], "x_axis": [ 0.746, 0.151, -0.648 ], "y_axis": [ -0.245, 0.968, -0.056 ], "z_axis": [ 0.619, 0.200, 0.760 ], "quaternion": [ 0.932, -0.069, 0.340, 0.106 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -97.440, "beta": 166.835, "gamma": 85.708, "delta": 99.535, "epsilon": -161.749, "zeta": -70.572, "epsilon_zeta": -91.177, "bb_type": "BI", "chi": -156.209, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.789, 0.458 ], "P_xyz": [ 0.921, 9.317, 0.028 ], "form": ".", "ssZp": 3.985, "Dp": 4.082, "splay_angle": 21.980, "splay_distance": 3.579, "splay_ratio": 0.191, "d22": 4.347, "d64": 3.784, "eta": 167.542, "theta": -135.090, "eta_prime": -172.764, "theta_prime": -141.718, "eta_base": -135.117, "theta_base": -109.114, "v0": -6.144, "v1": -9.173, "v2": 19.909, "v3": -24.032, "v4": 19.080, "amplitude": 23.791, "phase_angle": 33.191, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 23.307, 19.938, -12.656 ], "x_axis": [ 0.519, 0.600, -0.609 ], "y_axis": [ -0.564, 0.775, 0.285 ], "z_axis": [ 0.643, 0.196, 0.741 ], "quaternion": [ 0.871, 0.026, 0.359, 0.334 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -107.444, "beta": -179.999, "gamma": 80.665, "delta": 99.140, "epsilon": -164.593, "zeta": -76.226, "epsilon_zeta": -88.367, "bb_type": "BI", "chi": -150.789, "glyco_bond": "anti", "C5prime_xyz": [ -1.693, 8.835, 0.151 ], "P_xyz": [ 0.890, 9.393, -0.028 ], "form": ".", "ssZp": 3.938, "Dp": 4.042, "splay_angle": 20.326, "splay_distance": 3.331, "splay_ratio": 0.176, "d22": 4.420, "d64": 3.942, "eta": 159.563, "theta": -142.737, "eta_prime": -178.776, "theta_prime": -149.162, "eta_base": -128.418, "theta_base": -124.978, "v0": -8.066, "v1": -7.564, "v2": 19.164, "v3": -24.414, "v4": 20.511, "amplitude": 24.189, "phase_angle": 37.604, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 26.309, 20.902, -10.963 ], "x_axis": [ -0.058, 0.919, -0.389 ], "y_axis": [ -0.709, 0.236, 0.664 ], "z_axis": [ 0.702, 0.314, 0.639 ], "quaternion": [ 0.674, 0.130, 0.405, 0.604 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -108.078, "beta": 172.909, "gamma": 85.539, "delta": 97.472, "epsilon": -166.969, "zeta": -77.720, "epsilon_zeta": -89.249, "bb_type": "BI", "chi": -154.604, "glyco_bond": "anti", "C5prime_xyz": [ -1.684, 8.823, 0.377 ], "P_xyz": [ 0.857, 9.436, -0.062 ], "form": "A", "ssZp": 4.082, "Dp": 4.092, "splay_angle": 23.347, "splay_distance": 3.889, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 159.400, "theta": -149.169, "eta_prime": 177.786, "theta_prime": -156.302, "eta_base": -141.403, "theta_base": -146.241, "v0": -7.368, "v1": -9.081, "v2": 20.882, "v3": -25.792, "v4": 20.938, "amplitude": 25.495, "phase_angle": 35.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 29.147, 22.007, -9.613 ], "x_axis": [ -0.515, 0.856, -0.049 ], "y_axis": [ -0.502, -0.254, 0.827 ], "z_axis": [ 0.695, 0.451, 0.560 ], "quaternion": [ 0.445, 0.212, 0.418, 0.763 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.867, "beta": 172.964, "gamma": 84.862, "delta": 95.067, "epsilon": -162.828, "zeta": -75.723, "epsilon_zeta": -87.105, "bb_type": "BI", "chi": -160.434, "glyco_bond": "anti", "C5prime_xyz": [ -2.051, 8.841, 0.617 ], "P_xyz": [ 0.424, 9.771, 0.537 ], "form": "A", "ssZp": 4.001, "Dp": 4.038, "splay_angle": 21.673, "splay_distance": 3.627, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 168.294, "theta": -146.376, "eta_prime": -177.919, "theta_prime": -151.804, "eta_base": -153.731, "theta_base": -130.953, "v0": -12.644, "v1": -5.339, "v2": 19.923, "v3": -27.980, "v4": 25.652, "amplitude": 28.088, "phase_angle": 44.822, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 32.744, 23.450, -9.282 ], "x_axis": [ -0.743, 0.636, 0.209 ], "y_axis": [ -0.247, -0.550, 0.797 ], "z_axis": [ 0.622, 0.540, 0.566 ], "quaternion": [ 0.261, 0.246, 0.396, 0.845 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -106.222, "beta": 174.010, "gamma": 85.047, "delta": 93.673, "epsilon": -164.585, "zeta": -74.816, "epsilon_zeta": -89.769, "bb_type": "BI", "chi": -160.282, "glyco_bond": "anti", "C5prime_xyz": [ -2.049, 8.849, 0.613 ], "P_xyz": [ 0.415, 9.799, 0.483 ], "form": "A", "ssZp": 4.073, "Dp": 4.078, "splay_angle": 20.493, "splay_distance": 3.337, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 161.927, "theta": -148.515, "eta_prime": 177.994, "theta_prime": -151.485, "eta_base": -146.127, "theta_base": -116.711, "v0": -12.561, "v1": -6.210, "v2": 21.215, "v3": -29.249, "v4": 26.405, "amplitude": 29.257, "phase_angle": 43.520, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 35.075, 26.180, -8.760 ], "x_axis": [ -0.822, 0.215, 0.527 ], "y_axis": [ 0.183, -0.777, 0.602 ], "z_axis": [ 0.539, 0.591, 0.600 ], "quaternion": [ 0.009, 0.298, 0.334, 0.894 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "A", "nt_code": "A", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -79.975, "beta": 176.059, "gamma": 61.673, "delta": 93.555, "epsilon": -154.403, "zeta": -59.479, "epsilon_zeta": -94.924, "bb_type": "BI", "chi": -149.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.715, 8.822, 0.021 ], "P_xyz": [ 0.848, 9.466, 0.039 ], "form": ".", "ssZp": 4.006, "Dp": 4.300, "splay_angle": 33.811, "splay_distance": 5.382, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 169.129, "theta": -125.399, "eta_prime": -176.217, "theta_prime": -121.351, "eta_base": -128.386, "theta_base": -63.817, "v0": -5.838, "v1": -12.795, "v2": 25.318, "v3": -29.493, "v4": 22.339, "amplitude": 29.217, "phase_angle": 29.937, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.322, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 35.889, 28.930, -7.054 ], "x_axis": [ -0.506, -0.268, 0.820 ], "y_axis": [ 0.698, -0.686, 0.207 ], "z_axis": [ 0.507, 0.676, 0.534 ], "quaternion": [ -0.292, 0.402, 0.267, 0.826 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "U", "nt_code": "U", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -74.846, "beta": 166.032, "gamma": 61.720, "delta": 96.243, "epsilon": -160.490, "zeta": -91.868, "epsilon_zeta": -68.622, "bb_type": "BI", "chi": -146.092, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.707, -0.083 ], "P_xyz": [ 1.273, 8.850, -0.505 ], "form": ".", "ssZp": 4.056, "Dp": 4.355, "splay_angle": 27.024, "splay_distance": 4.346, "splay_ratio": 0.234, "d22": 5.127, "d64": 4.931, "eta": 163.241, "theta": -155.163, "eta_prime": -164.415, "theta_prime": -154.622, "eta_base": -87.395, "theta_base": -145.123, "v0": 1.142, "v1": -17.829, "v2": 26.741, "v3": -26.819, "v4": 16.234, "amplitude": 27.863, "phase_angle": 16.311, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.275, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ 37.239, 28.046, -1.919 ], "x_axis": [ 0.350, -0.769, 0.534 ], "y_axis": [ 0.863, 0.043, -0.504 ], "z_axis": [ 0.365, 0.638, 0.679 ], "quaternion": [ 0.720, -0.397, -0.059, -0.567 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "U", "nt_code": "U", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -55.638, "beta": 169.400, "gamma": 60.416, "delta": 112.267, "epsilon": -155.773, "zeta": -68.180, "epsilon_zeta": -87.592, "bb_type": "BI", "chi": -133.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.701, 8.704, -0.729 ], "P_xyz": [ 0.916, 9.096, -0.703 ], "form": ".", "ssZp": 3.139, "Dp": 3.531, "splay_angle": 86.257, "splay_distance": 12.221, "splay_ratio": 0.690, "d22": null, "d64": null, "eta": -173.110, "theta": -85.578, "eta_prime": -159.065, "theta_prime": -140.499, "eta_base": -144.738, "theta_base": 157.003, "v0": -11.129, "v1": 3.543, "v2": 4.616, "v3": -11.283, "v4": 14.163, "amplitude": 13.829, "phase_angle": 70.498, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 37.741, 31.192, 1.036 ], "x_axis": [ 0.586, -0.767, 0.260 ], "y_axis": [ 0.719, 0.344, -0.604 ], "z_axis": [ 0.374, 0.541, 0.753 ], "quaternion": [ 0.819, -0.350, 0.035, -0.454 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 102.679, "beta": 168.771, "gamma": 67.979, "delta": 114.505, "epsilon": -128.304, "zeta": -55.472, "epsilon_zeta": -72.832, "bb_type": "--", "chi": -173.734, "glyco_bond": "anti", "C5prime_xyz": [ -1.112, 7.995, 1.604 ], "P_xyz": [ 1.438, 7.357, 1.982 ], "form": ".", "ssZp": 4.136, "Dp": 4.217, "splay_angle": 21.922, "splay_distance": 3.636, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -9.329, "theta": -96.987, "eta_prime": 26.175, "theta_prime": -105.965, "eta_base": 21.744, "theta_base": -72.992, "v0": 10.637, "v1": -16.117, "v2": 15.394, "v3": -9.559, "v4": -0.620, "amplitude": 16.446, "phase_angle": 339.392, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 36.218, 43.119, -1.155 ], "x_axis": [ 0.225, 0.364, -0.904 ], "y_axis": [ 0.913, -0.404, 0.065 ], "z_axis": [ -0.341, -0.839, -0.423 ], "quaternion": [ 0.316, 0.716, 0.446, -0.435 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,phosphate", "alpha": -105.275, "beta": 125.723, "gamma": 115.628, "delta": 109.478, "epsilon": -104.589, "zeta": -94.549, "epsilon_zeta": -10.040, "bb_type": "--", "chi": -168.135, "glyco_bond": "anti", "C5prime_xyz": [ -1.829, 8.641, 1.159 ], "P_xyz": [ 0.179, 9.678, -0.227 ], "form": ".", "ssZp": 3.508, "Dp": 3.429, "splay_angle": 76.568, "splay_distance": 11.422, "splay_ratio": 0.623, "d22": null, "d64": null, "eta": -179.535, "theta": -116.524, "eta_prime": -153.752, "theta_prime": -161.779, "eta_base": -94.246, "theta_base": 137.839, "v0": -15.134, "v1": 5.821, "v2": 4.702, "v3": -13.709, "v4": 18.161, "amplitude": 17.797, "phase_angle": 74.681, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 35.423, 41.205, -4.144 ], "x_axis": [ 0.696, -0.142, -0.704 ], "y_axis": [ 0.476, -0.642, 0.601 ], "z_axis": [ -0.537, -0.753, -0.380 ], "quaternion": [ 0.411, 0.824, 0.101, -0.376 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 66.045, "beta": -154.192, "gamma": 128.856, "delta": 149.049, "epsilon": -142.909, "zeta": 13.027, "epsilon_zeta": 204.064, "bb_type": "--", "chi": -116.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.649, 8.385, -1.133 ], "P_xyz": [ 0.924, 8.123, -1.684 ], "form": ".", "ssZp": 1.816, "Dp": 2.020, "splay_angle": 114.490, "splay_distance": 16.244, "splay_ratio": 0.841, "d22": 7.709, "d64": 9.833, "eta": 13.298, "theta": 2.343, "eta_prime": 71.673, "theta_prime": -30.904, "eta_base": 43.030, "theta_base": -5.302, "v0": -9.985, "v1": 24.266, "v2": -28.889, "v3": 23.784, "v4": -8.684, "amplitude": 28.895, "phase_angle": 178.851, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 28.347, 40.118, 4.755 ], "x_axis": [ 0.616, 0.157, 0.772 ], "y_axis": [ 0.689, -0.584, -0.430 ], "z_axis": [ 0.383, 0.797, -0.468 ], "quaternion": [ -0.376, 0.817, 0.259, 0.354 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -91.264, "beta": -134.686, "gamma": 23.593, "delta": 110.206, "epsilon": -128.206, "zeta": -84.735, "epsilon_zeta": -43.470, "bb_type": "--", "chi": -146.005, "glyco_bond": "anti", "C5prime_xyz": [ -1.050, 8.446, -0.002 ], "P_xyz": [ 0.640, 9.074, 1.930 ], "form": ".", "ssZp": 3.543, "Dp": 4.283, "splay_angle": 10.682, "splay_distance": 2.156, "splay_ratio": 0.116, "d22": 4.790, "d64": 3.219, "eta": 167.366, "theta": -129.744, "eta_prime": -152.102, "theta_prime": -129.012, "eta_base": -143.327, "theta_base": -129.858, "v0": 7.688, "v1": -16.750, "v2": 19.004, "v3": -15.009, "v4": 4.629, "amplitude": 19.068, "phase_angle": 355.308, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 38.373, 29.919, -2.945 ], "x_axis": [ -0.602, -0.509, 0.615 ], "y_axis": [ -0.629, 0.777, 0.027 ], "z_axis": [ -0.491, -0.371, -0.788 ], "quaternion": [ -0.311, -0.320, 0.890, -0.097 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -112.313, "beta": 147.332, "gamma": 85.849, "delta": 101.464, "epsilon": -146.016, "zeta": -101.994, "epsilon_zeta": -44.021, "bb_type": "BI", "chi": -124.714, "glyco_bond": "anti", "C5prime_xyz": [ -1.510, 8.535, -1.270 ], "P_xyz": [ 0.424, 8.108, -3.026 ], "form": ".", "ssZp": 2.964, "Dp": 4.267, "splay_angle": 36.171, "splay_distance": 6.007, "splay_ratio": 0.315, "d22": 5.084, "d64": 5.092, "eta": 143.401, "theta": -163.473, "eta_prime": 165.862, "theta_prime": -173.555, "eta_base": 175.302, "theta_base": -159.189, "v0": -1.497, "v1": -12.490, "v2": 20.781, "v3": -22.239, "v4": 15.014, "amplitude": 22.465, "phase_angle": 22.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 37.658, 30.089, -4.973 ], "x_axis": [ -0.732, -0.157, 0.663 ], "y_axis": [ -0.617, 0.565, -0.548 ], "z_axis": [ -0.288, -0.810, -0.510 ], "quaternion": [ -0.284, -0.231, 0.838, -0.405 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -90.659, "beta": 139.525, "gamma": 85.575, "delta": 89.309, "epsilon": -153.209, "zeta": -65.549, "epsilon_zeta": -87.660, "bb_type": "BI", "chi": -165.144, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.542, 0.983 ], "P_xyz": [ 1.008, 8.897, -0.448 ], "form": "A", "ssZp": 4.673, "Dp": 4.654, "splay_angle": 24.928, "splay_distance": 3.928, "splay_ratio": 0.219, "d22": 3.870, "d64": 4.390, "eta": 161.135, "theta": -135.713, "eta_prime": 173.331, "theta_prime": -141.547, "eta_base": -157.895, "theta_base": -114.003, "v0": 5.247, "v1": -26.017, "v2": 35.909, "v3": -33.763, "v4": 17.961, "amplitude": 36.520, "phase_angle": 10.488, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 35.814, 26.016, -8.984 ], "x_axis": [ -0.808, 0.134, 0.574 ], "y_axis": [ -0.274, 0.777, -0.567 ], "z_axis": [ -0.522, -0.615, -0.591 ], "quaternion": [ -0.308, -0.039, 0.891, -0.332 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "U", "nt_code": "U", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.132, "beta": 156.439, "gamma": 85.095, "delta": 97.770, "epsilon": -155.498, "zeta": -56.084, "epsilon_zeta": -99.414, "bb_type": "BI", "chi": -170.321, "glyco_bond": "anti", "C5prime_xyz": [ -1.783, 8.612, 1.253 ], "P_xyz": [ 0.779, 9.216, 1.029 ], "form": "A", "ssZp": 4.152, "Dp": 4.178, "splay_angle": 21.871, "splay_distance": 3.839, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 178.408, "theta": -120.650, "eta_prime": -154.870, "theta_prime": -129.087, "eta_base": -102.291, "theta_base": -100.330, "v0": -5.381, "v1": -10.746, "v2": 21.687, "v3": -25.469, "v4": 19.499, "amplitude": 25.217, "phase_angle": 30.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 32.766, 23.539, -9.028 ], "x_axis": [ -0.833, 0.543, 0.105 ], "y_axis": [ 0.231, 0.514, -0.826 ], "z_axis": [ -0.503, -0.664, -0.553 ], "quaternion": [ -0.178, 0.227, 0.851, -0.438 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "A", "nt_code": "A", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.421, "beta": -168.916, "gamma": 37.043, "delta": 92.465, "epsilon": -171.087, "zeta": -74.865, "epsilon_zeta": -96.223, "bb_type": "BI", "chi": -150.568, "glyco_bond": "anti", "C5prime_xyz": [ -2.114, 8.885, 0.052 ], "P_xyz": [ -0.027, 10.185, 1.026 ], "form": "A", "ssZp": 4.032, "Dp": 4.081, "splay_angle": 19.955, "splay_distance": 3.317, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 151.327, "theta": -158.050, "eta_prime": 173.250, "theta_prime": -154.480, "eta_base": -134.977, "theta_base": -126.318, "v0": -13.164, "v1": -6.844, "v2": 22.726, "v3": -31.174, "v4": 28.013, "amplitude": 31.137, "phase_angle": 43.124, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.138, "filter_rmsd": 0.037, "frame": { "rmsd": 0.011, "origin": [ 29.378, 21.794, -9.488 ], "x_axis": [ -0.343, 0.891, -0.296 ], "y_axis": [ 0.711, 0.041, -0.702 ], "z_axis": [ -0.614, -0.451, -0.648 ], "quaternion": [ -0.112, 0.562, 0.713, -0.404 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -87.109, "beta": 174.534, "gamma": 72.016, "delta": 95.821, "epsilon": -161.402, "zeta": -82.383, "epsilon_zeta": -79.019, "bb_type": "BI", "chi": -150.680, "glyco_bond": "anti", "C5prime_xyz": [ -1.947, 8.874, 0.103 ], "P_xyz": [ 0.565, 9.695, -0.038 ], "form": ".", "ssZp": 3.976, "Dp": 4.061, "splay_angle": 22.751, "splay_distance": 3.724, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 169.831, "theta": -151.520, "eta_prime": -176.393, "theta_prime": -154.719, "eta_base": -140.489, "theta_base": -131.747, "v0": -11.585, "v1": -5.942, "v2": 19.884, "v3": -27.288, "v4": 24.573, "amplitude": 27.285, "phase_angle": 43.218, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.102, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 26.462, 20.764, -10.685 ], "x_axis": [ 0.104, 0.823, -0.559 ], "y_axis": [ 0.715, -0.453, -0.533 ], "z_axis": [ -0.692, -0.343, -0.635 ], "quaternion": [ -0.064, 0.740, 0.519, -0.422 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -101.347, "beta": 167.327, "gamma": 85.607, "delta": 98.389, "epsilon": -162.702, "zeta": -78.779, "epsilon_zeta": -83.923, "bb_type": "BI", "chi": -156.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.780, 0.503 ], "P_xyz": [ 0.772, 9.417, 0.004 ], "form": ".", "ssZp": 4.119, "Dp": 4.097, "splay_angle": 23.740, "splay_distance": 3.807, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 164.140, "theta": -147.802, "eta_prime": 179.973, "theta_prime": -153.535, "eta_base": -144.104, "theta_base": -125.965, "v0": -7.590, "v1": -8.526, "v2": 20.224, "v3": -25.241, "v4": 20.745, "amplitude": 24.966, "phase_angle": 35.897, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 23.297, 20.020, -12.502 ], "x_axis": [ 0.526, 0.526, -0.669 ], "y_axis": [ 0.535, -0.815, -0.220 ], "z_axis": [ -0.661, -0.242, -0.710 ], "quaternion": [ 0.006, 0.873, 0.304, -0.381 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "A", "nt_code": "A", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -98.148, "beta": 167.526, "gamma": 86.001, "delta": 97.993, "epsilon": -161.613, "zeta": -70.849, "epsilon_zeta": -90.764, "bb_type": "BI", "chi": -158.992, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.704, 0.632 ], "P_xyz": [ 0.968, 9.212, 0.205 ], "form": ".", "ssZp": 4.125, "Dp": 4.199, "splay_angle": 25.936, "splay_distance": 4.176, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 167.665, "theta": -138.854, "eta_prime": -174.119, "theta_prime": -141.923, "eta_base": -130.697, "theta_base": -111.068, "v0": -3.237, "v1": -12.780, "v2": 22.865, "v3": -25.378, "v4": 18.086, "amplitude": 25.382, "phase_angle": 25.735, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 20.548, 20.068, -15.133 ], "x_axis": [ 0.718, -0.030, -0.695 ], "y_axis": [ 0.132, -0.975, 0.178 ], "z_axis": [ -0.683, -0.219, -0.697 ], "quaternion": [ 0.108, 0.921, 0.028, -0.374 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "A", "nt_code": "A", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -75.173, "beta": 173.994, "gamma": 69.016, "delta": 100.992, "epsilon": -127.506, "zeta": -38.184, "epsilon_zeta": -89.322, "bb_type": "--", "chi": -148.734, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.800, -0.027 ], "P_xyz": [ 0.779, 9.366, 0.288 ], "form": ".", "ssZp": 3.265, "Dp": 4.000, "splay_angle": 33.506, "splay_distance": 5.706, "splay_ratio": 0.289, "d22": null, "d64": null, "eta": -173.193, "theta": -96.970, "eta_prime": -155.741, "theta_prime": -94.016, "eta_base": -113.690, "theta_base": -38.435, "v0": -8.135, "v1": -6.422, "v2": 17.484, "v3": -22.778, "v4": 19.524, "amplitude": 22.588, "phase_angle": 39.283, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.037, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 18.611, 19.833, -18.826 ], "x_axis": [ 0.657, -0.626, -0.420 ], "y_axis": [ -0.338, -0.742, 0.579 ], "z_axis": [ -0.674, -0.238, -0.699 ], "quaternion": [ 0.232, 0.880, -0.274, -0.311 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": -104.353, "beta": 111.012, "gamma": 136.079, "delta": 135.000, "epsilon": -145.085, "zeta": 125.030, "epsilon_zeta": 89.886, "bb_type": "--", "chi": -134.057, "glyco_bond": "anti", "C5prime_xyz": [ -1.856, 8.787, -0.486 ], "P_xyz": [ -0.556, 9.312, -2.736 ], "form": ".", "ssZp": 2.355, "Dp": 2.396, "splay_angle": 72.065, "splay_distance": 10.380, "splay_ratio": 0.600, "d22": 7.026, "d64": 8.217, "eta": -164.371, "theta": 58.236, "eta_prime": -132.014, "theta_prime": 68.756, "eta_base": -66.444, "theta_base": 112.531, "v0": -21.111, "v1": 26.859, "v2": -22.511, "v3": 10.688, "v4": 6.484, "amplitude": 26.626, "phase_angle": 147.719, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 18.833, 14.191, -19.648 ], "x_axis": [ 0.127, -0.941, 0.313 ], "y_axis": [ -0.948, -0.022, 0.319 ], "z_axis": [ -0.293, -0.337, -0.895 ], "quaternion": [ 0.229, 0.715, -0.660, 0.007 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -52.646, "beta": 144.299, "gamma": 25.700, "delta": 103.246, "epsilon": -145.229, "zeta": -42.943, "epsilon_zeta": -102.287, "bb_type": "BI", "chi": 164.260, "glyco_bond": "--", "C5prime_xyz": [ -1.572, 7.514, 2.595 ], "P_xyz": [ 0.585, 6.408, 3.656 ], "form": ".", "ssZp": 4.218, "Dp": 4.454, "splay_angle": 28.993, "splay_distance": 4.561, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": 177.318, "theta": -85.982, "eta_prime": -179.839, "theta_prime": -90.287, "eta_base": -172.463, "theta_base": -51.201, "v0": 9.912, "v1": -22.263, "v2": 25.613, "v3": -20.423, "v4": 6.631, "amplitude": 25.667, "phase_angle": 356.283, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.011, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 15.077, 23.789, -20.876 ], "x_axis": [ 0.657, -0.730, -0.187 ], "y_axis": [ -0.583, -0.649, 0.488 ], "z_axis": [ -0.478, -0.212, -0.852 ], "quaternion": [ 0.197, 0.889, -0.370, -0.187 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -94.547, "beta": -159.846, "gamma": 40.426, "delta": 91.249, "epsilon": -160.646, "zeta": -73.363, "epsilon_zeta": -87.283, "bb_type": "BI", "chi": -158.363, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.675, 0.568 ], "P_xyz": [ 0.755, 9.180, 1.900 ], "form": "A", "ssZp": 4.263, "Dp": 4.456, "splay_angle": 18.816, "splay_distance": 2.974, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 144.456, "theta": -149.642, "eta_prime": 174.794, "theta_prime": -145.158, "eta_base": -109.281, "theta_base": -114.925, "v0": 0.809, "v1": -20.405, "v2": 31.279, "v3": -31.696, "v4": 19.395, "amplitude": 32.751, "phase_angle": 17.242, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 15.213, 20.952, -24.444 ], "x_axis": [ -0.127, -0.879, 0.460 ], "y_axis": [ -0.788, 0.371, 0.492 ], "z_axis": [ -0.603, -0.300, -0.739 ], "quaternion": [ -0.355, -0.557, 0.748, 0.064 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 38, "nt_name": "C", "nt_code": "C", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -99.953, "beta": 170.311, "gamma": 85.283, "delta": 96.452, "epsilon": -130.821, "zeta": -74.139, "epsilon_zeta": -56.682, "bb_type": "BI", "chi": -154.660, "glyco_bond": "anti", "C5prime_xyz": [ -1.322, 8.755, 0.382 ], "P_xyz": [ 1.245, 9.070, -0.171 ], "form": ".", "ssZp": 4.033, "Dp": 4.437, "splay_angle": 20.257, "splay_distance": 3.378, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 173.654, "theta": -128.103, "eta_prime": -174.174, "theta_prime": -131.286, "eta_base": -136.981, "theta_base": -95.826, "v0": -0.716, "v1": -15.884, "v2": 25.433, "v3": -26.569, "v4": 17.211, "amplitude": 27.078, "phase_angle": 20.079, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 14.279, 19.377, -26.788 ], "x_axis": [ -0.538, -0.526, 0.658 ], "y_axis": [ -0.688, 0.726, 0.018 ], "z_axis": [ -0.487, -0.443, -0.753 ], "quaternion": [ -0.330, -0.350, 0.868, -0.122 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,bulge", "alpha": -87.890, "beta": 141.966, "gamma": 86.272, "delta": 96.970, "epsilon": -136.682, "zeta": -106.471, "epsilon_zeta": -30.211, "bb_type": "--", "chi": -159.656, "glyco_bond": "anti", "C5prime_xyz": [ -1.980, 8.812, 0.620 ], "P_xyz": [ 0.385, 9.505, -0.341 ], "form": ".", "ssZp": 4.076, "Dp": 4.119, "splay_angle": 17.497, "splay_distance": 2.900, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 162.011, "theta": -163.242, "eta_prime": -172.877, "theta_prime": -167.849, "eta_base": -119.495, "theta_base": -151.368, "v0": -11.381, "v1": -5.771, "v2": 19.417, "v3": -26.701, "v4": 24.108, "amplitude": 26.703, "phase_angle": 43.353, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 11.792, 17.294, -27.728 ], "x_axis": [ -0.700, 0.110, 0.706 ], "y_axis": [ -0.351, 0.808, -0.474 ], "z_axis": [ -0.622, -0.579, -0.527 ], "quaternion": [ -0.381, -0.069, 0.871, -0.302 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 40, "nt_name": "A", "nt_code": "A", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -78.813, "beta": 145.934, "gamma": 65.009, "delta": 90.880, "epsilon": -140.221, "zeta": -72.159, "epsilon_zeta": -68.063, "bb_type": "BI", "chi": -148.245, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 8.738, -0.070 ], "P_xyz": [ 1.084, 8.765, -0.793 ], "form": ".", "ssZp": 3.879, "Dp": 4.552, "splay_angle": 19.143, "splay_distance": 3.190, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 161.106, "theta": -131.113, "eta_prime": 171.124, "theta_prime": -137.720, "eta_base": -161.636, "theta_base": -109.033, "v0": -1.724, "v1": -18.575, "v2": 30.492, "v3": -32.388, "v4": 21.476, "amplitude": 32.778, "phase_angle": 21.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.058, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 10.941, 15.218, -29.564 ], "x_axis": [ -0.795, 0.468, 0.386 ], "y_axis": [ -0.124, 0.497, -0.859 ], "z_axis": [ -0.594, -0.731, -0.336 ], "quaternion": [ -0.302, 0.106, 0.811, -0.490 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.871, "beta": 140.954, "gamma": 88.375, "delta": 91.644, "epsilon": -159.578, "zeta": -84.290, "epsilon_zeta": -75.288, "bb_type": "BI", "chi": -162.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.880, 8.835, 0.751 ], "P_xyz": [ 0.364, 9.616, -0.414 ], "form": "A", "ssZp": 4.363, "Dp": 4.263, "splay_angle": 17.917, "splay_distance": 2.863, "splay_ratio": 0.156, "d22": 4.749, "d64": 4.161, "eta": 160.171, "theta": -157.746, "eta_prime": -174.385, "theta_prime": -165.052, "eta_base": -123.120, "theta_base": -147.221, "v0": -10.461, "v1": -9.894, "v2": 24.976, "v3": -31.879, "v4": 26.729, "amplitude": 31.519, "phase_angle": 37.590, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 8.085, 13.802, -29.686 ], "x_axis": [ -0.661, 0.748, -0.061 ], "y_axis": [ 0.182, 0.081, -0.980 ], "z_axis": [ -0.728, -0.659, -0.190 ], "quaternion": [ -0.240, 0.335, 0.695, -0.590 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -89.846, "beta": 173.347, "gamma": 67.972, "delta": 92.249, "epsilon": -125.630, "zeta": -77.804, "epsilon_zeta": -47.826, "bb_type": "--", "chi": -151.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.808, 0.170 ], "P_xyz": [ 1.201, 9.183, -0.110 ], "form": ".", "ssZp": 3.959, "Dp": 4.545, "splay_angle": 21.512, "splay_distance": 3.596, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 171.549, "theta": -130.098, "eta_prime": 177.767, "theta_prime": -132.918, "eta_base": -154.991, "theta_base": -106.713, "v0": -1.365, "v1": -17.730, "v2": 28.913, "v3": -30.569, "v4": 20.140, "amplitude": 30.992, "phase_angle": 21.104, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.222, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 6.105, 11.898, -28.878 ], "x_axis": [ -0.438, 0.705, -0.557 ], "y_axis": [ 0.329, -0.451, -0.830 ], "z_axis": [ -0.837, -0.547, -0.034 ], "quaternion": [ 0.138, -0.512, -0.505, 0.681 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -93.145, "beta": 139.349, "gamma": 87.378, "delta": 90.833, "epsilon": -167.688, "zeta": -88.540, "epsilon_zeta": -79.149, "bb_type": "BI", "chi": -167.342, "glyco_bond": "anti", "C5prime_xyz": [ -1.960, 8.709, 1.051 ], "P_xyz": [ 0.324, 9.552, 0.024 ], "form": ".", "ssZp": 4.384, "Dp": 4.284, "splay_angle": 27.593, "splay_distance": 4.250, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 147.927, "theta": -164.307, "eta_prime": 175.384, "theta_prime": -171.351, "eta_base": -137.989, "theta_base": -156.127, "v0": -7.567, "v1": -13.143, "v2": 27.466, "v3": -32.707, "v4": 25.384, "amplitude": 32.335, "phase_angle": 31.851, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 2.684, 11.291, -29.804 ], "x_axis": [ 0.164, 0.569, -0.806 ], "y_axis": [ 0.422, -0.779, -0.464 ], "z_axis": [ -0.892, -0.264, -0.368 ], "quaternion": [ -0.066, 0.760, 0.326, -0.558 ] } }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 44, "nt_name": "G", "nt_code": "G", "nt_id": "///A/44", "linked_nts": [ "///A/43", "///A/45" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -107.519, "beta": -178.786, "gamma": 85.726, "delta": 92.926, "epsilon": -145.227, "zeta": -64.932, "epsilon_zeta": -80.295, "bb_type": "BI", "chi": -174.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.467, 1.483 ], "P_xyz": [ 1.084, 8.796, 1.701 ], "form": "A", "ssZp": 4.462, "Dp": 4.558, "splay_angle": 21.787, "splay_distance": 3.620, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 171.202, "theta": -125.118, "eta_prime": 175.451, "theta_prime": -126.313, "eta_base": -159.772, "theta_base": -88.918, "v0": 3.215, "v1": -21.584, "v2": 30.790, "v3": -29.808, "v4": 16.757, "amplitude": 31.592, "phase_angle": 12.936, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -1.523, 11.330, -29.208 ], "x_axis": [ 0.489, 0.200, -0.849 ], "y_axis": [ 0.360, -0.933, -0.012 ], "z_axis": [ -0.795, -0.300, -0.528 ], "quaternion": [ 0.084, 0.859, 0.163, -0.479 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 45, "nt_name": "C", "nt_code": "C", "nt_id": "///A/45", "linked_nts": [ "///A/44", "///A/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.329, "beta": 175.732, "gamma": 45.344, "delta": 91.301, "epsilon": -166.963, "zeta": -72.792, "epsilon_zeta": -94.171, "bb_type": "BI", "chi": -150.702, "glyco_bond": "anti", "C5prime_xyz": [ -1.727, 8.899, 0.165 ], "P_xyz": [ 0.768, 9.697, 0.482 ], "form": "A", "ssZp": 4.234, "Dp": 4.272, "splay_angle": 22.473, "splay_distance": 3.597, "splay_ratio": 0.195, "d22": 4.296, "d64": 3.832, "eta": 162.099, "theta": -149.259, "eta_prime": -174.650, "theta_prime": -147.713, "eta_base": -114.506, "theta_base": -114.131, "v0": -7.279, "v1": -12.893, "v2": 26.779, "v3": -31.889, "v4": 24.696, "amplitude": 31.486, "phase_angle": 31.734, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.486, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -3.057, 11.751, -32.459 ], "x_axis": [ 0.563, -0.508, -0.652 ], "y_axis": [ -0.169, -0.843, 0.510 ], "z_axis": [ -0.809, -0.177, -0.560 ], "quaternion": [ 0.200, 0.861, -0.196, -0.424 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 46, "nt_name": "U", "nt_code": "U", "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -103.377, "beta": 175.902, "gamma": 85.237, "delta": 96.111, "epsilon": -156.003, "zeta": -79.025, "epsilon_zeta": -76.978, "bb_type": "BI", "chi": -155.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.461, 8.749, 0.397 ], "P_xyz": [ 1.123, 9.166, 0.010 ], "form": "A", "ssZp": 4.126, "Dp": 4.326, "splay_angle": 19.115, "splay_distance": 3.095, "splay_ratio": 0.166, "d22": 4.526, "d64": 3.904, "eta": 167.860, "theta": -144.692, "eta_prime": -176.307, "theta_prime": -149.769, "eta_base": -131.232, "theta_base": -130.982, "v0": -1.682, "v1": -15.193, "v2": 25.255, "v3": -26.932, "v4": 18.066, "amplitude": 27.249, "phase_angle": 22.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -5.034, 11.030, -35.377 ], "x_axis": [ 0.490, -0.864, -0.118 ], "y_axis": [ -0.553, -0.413, 0.723 ], "z_axis": [ -0.674, -0.289, -0.680 ], "quaternion": [ 0.315, 0.804, -0.441, -0.246 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 47, "nt_name": "C", "nt_code": "C", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -87.977, "beta": 175.377, "gamma": 61.551, "delta": 87.262, "epsilon": -150.620, "zeta": -78.508, "epsilon_zeta": -72.112, "bb_type": "BI", "chi": -149.152, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.819, -0.034 ], "P_xyz": [ 1.180, 9.251, -0.117 ], "form": "A", "ssZp": 3.995, "Dp": 4.582, "splay_angle": 21.554, "splay_distance": 3.470, "splay_ratio": 0.187, "d22": 4.086, "d64": 3.602, "eta": 160.767, "theta": -146.623, "eta_prime": 172.269, "theta_prime": -144.540, "eta_base": -154.355, "theta_base": -115.901, "v0": 0.370, "v1": -22.387, "v2": 34.697, "v3": -35.522, "v4": 22.122, "amplitude": 36.502, "phase_angle": 18.092, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.281, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -6.447, 10.493, -38.077 ], "x_axis": [ 0.236, -0.886, 0.399 ], "y_axis": [ -0.825, 0.034, 0.564 ], "z_axis": [ -0.513, -0.463, -0.723 ], "quaternion": [ 0.370, 0.694, -0.617, -0.041 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///A/48", "linked_nts": [ "///A/47", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -76.838, "beta": 167.585, "gamma": 66.478, "delta": 95.231, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -149.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.798, 0.117 ], "P_xyz": [ 1.184, 9.078, -0.136 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.606, "v1": -12.588, "v2": 22.793, "v3": -25.642, "v4": 18.551, "amplitude": 25.503, "phase_angle": 26.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.360, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ -7.654, 8.017, -40.187 ], "x_axis": [ -0.122, -0.580, 0.805 ], "y_axis": [ -0.884, 0.433, 0.178 ], "z_axis": [ -0.452, -0.690, -0.566 ], "quaternion": [ -0.431, -0.503, 0.728, -0.176 ] } } ], "num_hbonds": 98, "hbonds": [ { "index": 1, "atom1_serNum": 8, "atom2_serNum": 36, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///A/1/O2'", "atom2_id": "///A/2/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 8, "atom2_serNum": 39, "donAcc_type": "acceptable", "distance": 2.868, "atom1_id": "///A/1/O2'", "atom2_id": "///A/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 15, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/1/O6", "atom2_id": "///A/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 16, "atom2_serNum": 1507, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/1/N1", "atom2_id": "///A/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 18, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/1/N2", "atom2_id": "///A/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 43, "atom2_serNum": 73, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///A/2/O2'", "atom2_id": "///A/3/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 50, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/2/O6", "atom2_id": "///A/47/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 51, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/2/N1", "atom2_id": "///A/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 53, "atom2_serNum": 1475, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/2/N2", "atom2_id": "///A/47/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 84, "atom2_serNum": 1446, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/3/O6", "atom2_id": "///A/46/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 85, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/3/N1", "atom2_id": "///A/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 87, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///A/3/N2", "atom2_id": "///A/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 111, "atom2_serNum": 141, "donAcc_type": "acceptable", "distance": 2.881, "atom1_id": "///A/4/O2'", "atom2_id": "///A/5/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 118, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/4/O6", "atom2_id": "///A/45/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 119, "atom2_serNum": 1415, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/4/N1", "atom2_id": "///A/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 121, "atom2_serNum": 1414, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///A/4/N2", "atom2_id": "///A/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 145, "atom2_serNum": 168, "donAcc_type": "acceptable", "distance": 2.949, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 145, "atom2_serNum": 171, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 149, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/5/O2", "atom2_id": "///A/44/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 150, "atom2_serNum": 1383, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/5/N3", "atom2_id": "///A/44/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 180, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/6/N3", "atom2_id": "///A/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 182, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/6/O4", "atom2_id": "///A/43/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 205, "atom2_serNum": 232, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///A/7/O2'", "atom2_id": "///A/8/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 205, "atom2_serNum": 235, "donAcc_type": "acceptable", "distance": 3.086, "atom1_id": "///A/7/O2'", "atom2_id": "///A/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 212, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/7/O6", "atom2_id": "///A/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 213, "atom2_serNum": 1317, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/7/N1", "atom2_id": "///A/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 215, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/7/N2", "atom2_id": "///A/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 231, "atom2_serNum": 1113, "donAcc_type": "questionable", "distance": 2.857, "atom1_id": "///A/8/OP2", "atom2_id": "///A/36/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 246, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/8/O6", "atom2_id": "///A/41/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 247, "atom2_serNum": 1286, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/8/N1", "atom2_id": "///A/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 278, "atom2_serNum": 1257, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/9/N3", "atom2_id": "///A/40/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 280, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/9/O4", "atom2_id": "///A/39/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 303, "atom2_serNum": 330, "donAcc_type": "acceptable", "distance": 2.993, "atom1_id": "///A/10/O2'", "atom2_id": "///A/11/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 310, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/10/O6", "atom2_id": "///A/38/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 311, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/10/N1", "atom2_id": "///A/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 313, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/10/N2", "atom2_id": "///A/38/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 342, "atom2_serNum": 1160, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/11/N3", "atom2_id": "///A/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 344, "atom2_serNum": 1159, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/11/O4", "atom2_id": "///A/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 375, "atom2_serNum": 1129, "donAcc_type": "questionable", "distance": 2.626, "atom1_id": "///A/12/N1", "atom2_id": "///A/36/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 400, "atom2_serNum": 423, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///A/13/O2'", "atom2_id": "///A/14/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 400, "atom2_serNum": 426, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///A/13/O2'", "atom2_id": "///A/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 405, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/13/N3", "atom2_id": "///A/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 407, "atom2_serNum": 1065, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/13/O4", "atom2_id": "///A/34/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 430, "atom2_serNum": 453, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 430, "atom2_serNum": 456, "donAcc_type": "acceptable", "distance": 2.448, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 435, "atom2_serNum": 1033, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/14/N3", "atom2_id": "///A/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 437, "atom2_serNum": 1032, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/14/O4", "atom2_id": "///A/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 460, "atom2_serNum": 483, "donAcc_type": "acceptable", "distance": 2.717, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 460, "atom2_serNum": 486, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 465, "atom2_serNum": 1000, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/15/N3", "atom2_id": "///A/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 467, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/15/O4", "atom2_id": "///A/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 490, "atom2_serNum": 513, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 490, "atom2_serNum": 516, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 495, "atom2_serNum": 967, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/16/N3", "atom2_id": "///A/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 497, "atom2_serNum": 966, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/16/O4", "atom2_id": "///A/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 520, "atom2_serNum": 543, "donAcc_type": "acceptable", "distance": 2.600, "atom1_id": "///A/17/O2'", "atom2_id": "///A/18/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 520, "atom2_serNum": 546, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///A/17/O2'", "atom2_id": "///A/18/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 525, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/17/N3", "atom2_id": "///A/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 527, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///A/17/O4", "atom2_id": "///A/30/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 550, "atom2_serNum": 576, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 550, "atom2_serNum": 579, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 557, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/18/N6", "atom2_id": "///A/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 558, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/18/N1", "atom2_id": "///A/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 583, "atom2_serNum": 609, "donAcc_type": "acceptable", "distance": 2.684, "atom1_id": "///A/19/O2'", "atom2_id": "///A/20/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 583, "atom2_serNum": 612, "donAcc_type": "acceptable", "distance": 2.606, "atom1_id": "///A/19/O2'", "atom2_id": "///A/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 590, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/19/N6", "atom2_id": "///A/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 591, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/19/N1", "atom2_id": "///A/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 649, "atom2_serNum": 672, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 649, "atom2_serNum": 675, "donAcc_type": "acceptable", "distance": 2.687, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 649, "atom2_serNum": 809, "donAcc_type": "acceptable", "distance": 3.335, "atom1_id": "///A/21/O2'", "atom2_id": "///A/26/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 653, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/21/O2", "atom2_id": "///A/26/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 653, "atom2_serNum": 840, "donAcc_type": "questionable", "distance": 3.136, "atom1_id": "///A/21/O2", "atom2_id": "///A/27/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 679, "atom2_serNum": 702, "donAcc_type": "acceptable", "distance": 2.555, "atom1_id": "///A/22/O2'", "atom2_id": "///A/23/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 679, "atom2_serNum": 746, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///A/22/O2'", "atom2_id": "///A/24/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 775, "atom2_serNum": 796, "donAcc_type": "acceptable", "distance": 2.952, "atom1_id": "///A/25/O2'", "atom2_id": "///A/26/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 805, "atom2_serNum": 831, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/26/O2'", "atom2_id": "///A/27/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 835, "atom2_serNum": 862, "donAcc_type": "acceptable", "distance": 2.476, "atom1_id": "///A/27/O2'", "atom2_id": "///A/28/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 926, "atom2_serNum": 952, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/30/O2'", "atom2_id": "///A/31/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 926, "atom2_serNum": 955, "donAcc_type": "acceptable", "distance": 2.515, "atom1_id": "///A/30/O2'", "atom2_id": "///A/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 959, "atom2_serNum": 985, "donAcc_type": "acceptable", "distance": 2.758, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 959, "atom2_serNum": 988, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 992, "atom2_serNum": 1018, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///A/32/O2'", "atom2_id": "///A/33/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 992, "atom2_serNum": 1021, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///A/32/O2'", "atom2_id": "///A/33/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 1025, "atom2_serNum": 1051, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///A/33/O2'", "atom2_id": "///A/34/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 1025, "atom2_serNum": 1054, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/33/O2'", "atom2_id": "///A/34/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 1114, "atom2_serNum": 1156, "donAcc_type": "questionable", "distance": 2.963, "atom1_id": "///A/36/OP2", "atom2_id": "///A/37/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 1114, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///A/36/OP2", "atom2_id": "///A/38/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 1152, "atom2_serNum": 1181, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/37/O2'", "atom2_id": "///A/38/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 1216, "atom2_serNum": 1245, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///A/39/O2'", "atom2_id": "///A/40/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 1282, "atom2_serNum": 1305, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///A/41/O2'", "atom2_id": "///A/42/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 1282, "atom2_serNum": 1308, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///A/41/O2'", "atom2_id": "///A/42/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 1343, "atom2_serNum": 1369, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///A/43/O2'", "atom2_id": "///A/44/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 1343, "atom2_serNum": 1372, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///A/43/O2'", "atom2_id": "///A/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 1410, "atom2_serNum": 1434, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///A/45/O2'", "atom2_id": "///A/46/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 1410, "atom2_serNum": 1437, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///A/45/O2'", "atom2_id": "///A/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 1441, "atom2_serNum": 1464, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///A/46/O2'", "atom2_id": "///A/47/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 1441, "atom2_serNum": 1467, "donAcc_type": "acceptable", "distance": 2.942, "atom1_id": "///A/46/O2'", "atom2_id": "///A/47/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 1471, "atom2_serNum": 1498, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///A/47/O2'", "atom2_id": "///A/48/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2kuw", "num_naChains": 1, "naChains": "A=48", "num_atoms": 1523, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }