{ "num_pairs": 17, "pairs": [ { "index": 1, "nt1": "///B/75", "nt2": "///B/108", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.581, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.778, "chi2": -158.441, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.986, "C1C1_dist": 10.723, "N1N9_dist": 9.001, "C6C8_dist": 9.886, "CNNC_torsion": -7.200, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 8.672, "planarity": 0.113, "simple_Shear": -0.508, "simple_Stretch": -0.118, "simple_Buckle": 6.297, "simple_Propeller": -5.963, "bp_simpleParams": [ -0.508, -0.118, 0.302, 6.297, -5.963, -1.576 ], "bp_params": [ -0.502, -0.142, 0.302, 6.573, -5.657, -1.576 ], "frame": { "rmsd": null, "origin": [ -14.852, 13.793, 23.257 ], "x_axis": [ 0.977, 0.036, 0.209 ], "y_axis": [ -0.129, -0.677, 0.725 ], "z_axis": [ 0.168, -0.735, -0.657 ], "quaternion": [ 0.401, 0.910, -0.026, 0.103 ] } }, { "index": 2, "nt1": "///B/76", "nt2": "///B/107", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.534, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.609, "chi2": -164.667, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.845, "C1C1_dist": 10.759, "N1N9_dist": 8.991, "C6C8_dist": 9.845, "CNNC_torsion": -17.467, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.81],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 14.863, "planarity": 0.199, "simple_Shear": -0.058, "simple_Stretch": -0.164, "simple_Buckle": 6.698, "simple_Propeller": -13.268, "bp_simpleParams": [ -0.058, -0.164, 0.225, 6.698, -13.268, -3.159 ], "bp_params": [ -0.057, -0.164, 0.225, 6.742, -13.246, -3.175 ], "frame": { "rmsd": null, "origin": [ -13.620, 12.424, 20.155 ], "x_axis": [ 0.721, -0.268, 0.639 ], "y_axis": [ -0.642, -0.606, 0.471 ], "z_axis": [ 0.260, -0.749, -0.609 ], "quaternion": [ 0.356, 0.857, -0.266, 0.262 ] } }, { "index": 3, "nt1": "///B/77", "nt2": "///B/106", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.140, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.796, "chi2": -167.546, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.664, "C1C1_dist": 10.949, "N1N9_dist": 9.120, "C6C8_dist": 9.909, "CNNC_torsion": -17.562, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 16.462, "planarity": 0.206, "simple_Shear": -0.207, "simple_Stretch": -0.022, "simple_Buckle": -5.953, "simple_Propeller": -15.348, "bp_simpleParams": [ -0.207, -0.022, 0.063, -5.953, -15.348, -6.718 ], "bp_params": [ -0.207, -0.026, 0.063, -5.597, -15.482, -6.772 ], "frame": { "rmsd": null, "origin": [ -11.172, 10.741, 17.908 ], "x_axis": [ 0.153, -0.498, 0.854 ], "y_axis": [ -0.928, -0.370, -0.050 ], "z_axis": [ 0.341, -0.784, -0.519 ], "quaternion": [ 0.257, 0.714, -0.499, 0.418 ] } }, { "index": 4, "nt1": "///B/78", "nt2": "///B/105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.530, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.625, "chi2": -172.680, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.393, "C1C1_dist": 11.213, "N1N9_dist": 9.267, "C6C8_dist": 9.939, "CNNC_torsion": -3.986, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.73],N1-N3(imino)[3.07]", "interBase_angle": 10.944, "planarity": 0.175, "simple_Shear": 0.240, "simple_Stretch": 0.062, "simple_Buckle": -10.350, "simple_Propeller": -3.558, "bp_simpleParams": [ 0.240, 0.062, 0.232, -10.350, -3.558, -12.107 ], "bp_params": [ 0.241, 0.055, 0.232, -10.456, -3.233, -12.062 ], "frame": { "rmsd": null, "origin": [ -8.251, 8.496, 16.827 ], "x_axis": [ -0.413, -0.618, 0.669 ], "y_axis": [ -0.842, -0.020, -0.539 ], "z_axis": [ 0.347, -0.786, -0.512 ], "quaternion": [ -0.117, -0.529, 0.690, -0.480 ] } }, { "index": 5, "nt1": "///B/79", "nt2": "///B/104", "bp": "G+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -174.136, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.551, "chi2": 32.127, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 20.620, "C1C1_dist": 12.862, "N1N9_dist": 10.468, "C6C8_dist": 10.577, "CNNC_torsion": 111.731, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N1(imino)[3.08],N1(imino)-O6(carbonyl)[2.63]", "interBase_angle": 30.705, "planarity": 0.459, "simple_Shear": -1.472, "simple_Stretch": 1.103, "simple_Buckle": -19.393, "simple_Propeller": -23.805, "bp_simpleParams": [ -1.472, 1.103, -0.916, -19.393, -23.805, -151.143 ], "bp_params": [ 0.896, 1.606, -0.916, -26.224, 15.972, -150.666 ], "frame": { "rmsd": null, "origin": [ -4.812, 5.748, 16.212 ], "x_axis": [ -0.836, -0.126, -0.534 ], "y_axis": [ 0.433, 0.446, -0.783 ], "z_axis": [ 0.336, -0.886, -0.318 ], "quaternion": [ 0.270, 0.095, 0.806, -0.518 ] } }, { "index": 6, "nt1": "///B/80", "nt2": "///B/103", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.385, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.129, "chi2": -154.441, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.852, "C1C1_dist": 11.169, "N1N9_dist": 9.284, "C6C8_dist": 9.991, "CNNC_torsion": -3.312, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.05],O4(carbonyl)-N6(amino)[2.76]", "interBase_angle": 10.022, "planarity": 0.126, "simple_Shear": -0.615, "simple_Stretch": 0.113, "simple_Buckle": -9.247, "simple_Propeller": -3.865, "bp_simpleParams": [ -0.615, 0.113, 0.101, -9.247, -3.865, -10.728 ], "bp_params": [ -0.622, 0.073, 0.101, -8.978, -4.454, -10.704 ], "frame": { "rmsd": null, "origin": [ -4.448, 2.474, 15.159 ], "x_axis": [ -0.934, -0.331, -0.134 ], "y_axis": [ -0.044, 0.480, -0.876 ], "z_axis": [ 0.354, -0.812, -0.463 ], "quaternion": [ 0.144, -0.111, 0.848, -0.498 ] } }, { "index": 7, "nt1": "///B/81", "nt2": "///B/102", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.926, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.097, "chi2": -161.757, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.353, "C1C1_dist": 10.826, "N1N9_dist": 9.074, "C6C8_dist": 9.914, "CNNC_torsion": -8.148, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.85],N1-N3(imino)[2.95]", "interBase_angle": 6.548, "planarity": 0.107, "simple_Shear": 0.055, "simple_Stretch": -0.049, "simple_Buckle": 4.879, "simple_Propeller": -4.367, "bp_simpleParams": [ 0.055, -0.049, 0.437, 4.879, -4.367, -5.313 ], "bp_params": [ 0.055, -0.050, 0.437, 4.837, -4.414, -5.312 ], "frame": { "rmsd": null, "origin": [ -4.507, -0.731, 14.646 ], "x_axis": [ -0.849, 0.122, -0.514 ], "y_axis": [ 0.482, 0.578, -0.659 ], "z_axis": [ 0.217, -0.807, -0.549 ], "quaternion": [ 0.212, 0.175, 0.862, -0.425 ] } }, { "index": 8, "nt1": "///B/82", "nt2": "///B/101", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.001, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.048, "chi2": -162.685, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.976, "C1C1_dist": 10.961, "N1N9_dist": 9.163, "C6C8_dist": 9.966, "CNNC_torsion": -10.667, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 16.074, "planarity": 0.183, "simple_Shear": -0.351, "simple_Stretch": 0.035, "simple_Buckle": 6.285, "simple_Propeller": -14.794, "bp_simpleParams": [ -0.351, 0.035, -0.173, 6.285, -14.794, -6.282 ], "bp_params": [ -0.353, 0.019, -0.173, 6.905, -14.515, -6.321 ], "frame": { "rmsd": null, "origin": [ -5.144, -4.155, 13.567 ], "x_axis": [ -0.506, 0.491, -0.709 ], "y_axis": [ 0.859, 0.358, -0.365 ], "z_axis": [ 0.075, -0.794, -0.603 ], "quaternion": [ 0.249, 0.430, 0.785, -0.369 ] } }, { "index": 9, "nt1": "///B/83", "nt2": "///B/100", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.805, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.277, "chi2": -166.852, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.350, "C1C1_dist": 10.647, "N1N9_dist": 9.004, "C6C8_dist": 9.964, "CNNC_torsion": -6.184, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.93]", "interBase_angle": 5.978, "planarity": 0.076, "simple_Shear": 0.014, "simple_Stretch": -0.007, "simple_Buckle": 3.715, "simple_Propeller": -4.683, "bp_simpleParams": [ 0.014, -0.007, 0.172, 3.715, -4.683, -0.201 ], "bp_params": [ 0.014, -0.007, 0.172, 3.685, -4.707, -0.201 ], "frame": { "rmsd": null, "origin": [ -6.639, -6.621, 11.132 ], "x_axis": [ 0.042, 0.733, -0.679 ], "y_axis": [ 0.995, 0.027, 0.091 ], "z_axis": [ 0.085, -0.679, -0.729 ], "quaternion": [ 0.292, 0.660, 0.654, -0.225 ] } }, { "index": 10, "nt1": "///B/84", "nt2": "///B/99", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.619, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.064, "chi2": -165.352, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.134, "C1C1_dist": 10.727, "N1N9_dist": 9.032, "C6C8_dist": 9.936, "CNNC_torsion": -4.863, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.95]", "interBase_angle": 9.212, "planarity": 0.122, "simple_Shear": -0.014, "simple_Stretch": -0.008, "simple_Buckle": 8.281, "simple_Propeller": -4.037, "bp_simpleParams": [ -0.014, -0.008, -0.023, 8.281, -4.037, -2.277 ], "bp_params": [ -0.014, -0.008, -0.023, 8.273, -4.053, -2.273 ], "frame": { "rmsd": null, "origin": [ -8.355, -8.617, 8.429 ], "x_axis": [ 0.510, 0.691, -0.512 ], "y_axis": [ 0.857, -0.354, 0.375 ], "z_axis": [ 0.077, -0.630, -0.773 ], "quaternion": [ 0.309, 0.812, 0.477, -0.134 ] } }, { "index": 11, "nt1": "///B/85", "nt2": "///B/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.011, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.476, "chi2": -164.110, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.297, "C1C1_dist": 10.677, "N1N9_dist": 8.994, "C6C8_dist": 9.912, "CNNC_torsion": -7.390, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 3.689, "planarity": 0.058, "simple_Shear": 0.180, "simple_Stretch": -0.116, "simple_Buckle": 0.133, "simple_Propeller": -3.687, "bp_simpleParams": [ 0.180, -0.116, 0.094, 0.133, -3.687, -0.465 ], "bp_params": [ 0.178, -0.118, 0.094, 0.084, -3.688, -0.461 ], "frame": { "rmsd": null, "origin": [ -8.941, -9.601, 4.784 ], "x_axis": [ 0.873, 0.482, -0.067 ], "y_axis": [ 0.432, -0.704, 0.564 ], "z_axis": [ 0.224, -0.521, -0.823 ], "quaternion": [ 0.294, 0.922, 0.248, 0.043 ] } }, { "index": 12, "nt1": "///B/86", "nt2": "///B/97", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.185, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.160, "chi2": -163.522, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.256, "C1C1_dist": 10.744, "N1N9_dist": 9.035, "C6C8_dist": 9.947, "CNNC_torsion": -14.914, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.93]", "interBase_angle": 14.191, "planarity": 0.178, "simple_Shear": 0.078, "simple_Stretch": -0.024, "simple_Buckle": 1.571, "simple_Propeller": -14.104, "bp_simpleParams": [ 0.078, -0.024, 0.189, 1.571, -14.104, -2.129 ], "bp_params": [ 0.077, -0.025, 0.189, 1.388, -14.123, -2.145 ], "frame": { "rmsd": null, "origin": [ -8.542, -9.833, 1.222 ], "x_axis": [ 0.954, 0.077, 0.289 ], "y_axis": [ -0.076, -0.871, 0.485 ], "z_axis": [ 0.289, -0.485, -0.825 ], "quaternion": [ 0.254, 0.955, 0.000, 0.151 ] } }, { "index": 13, "nt1": "///B/87", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.683, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.859, "chi2": -166.741, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.040, "C1C1_dist": 10.956, "N1N9_dist": 9.163, "C6C8_dist": 9.977, "CNNC_torsion": -20.887, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86],N1-N3(imino)[2.97]", "interBase_angle": 15.511, "planarity": 0.206, "simple_Shear": 0.495, "simple_Stretch": 0.032, "simple_Buckle": 3.950, "simple_Propeller": -15.000, "bp_simpleParams": [ 0.495, 0.032, 0.308, 3.950, -15.000, -6.715 ], "bp_params": [ 0.496, 0.006, 0.308, 3.137, -15.191, -6.772 ], "frame": { "rmsd": null, "origin": [ -7.397, -9.843, -2.142 ], "x_axis": [ 0.755, -0.417, 0.506 ], "y_axis": [ -0.592, -0.765, 0.252 ], "z_axis": [ 0.282, -0.490, -0.825 ], "quaternion": [ 0.203, 0.914, -0.276, 0.216 ] } }, { "index": 14, "nt1": "///B/88", "nt2": "///B/95", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.540, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.482, "chi2": -169.651, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.937, "C1C1_dist": 10.544, "N1N9_dist": 8.853, "C6C8_dist": 9.756, "CNNC_torsion": -12.648, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.91],O2(carbonyl)-N2(amino)[3.12],N3(imino)-O6(carbonyl)[2.96]", "interBase_angle": 13.458, "planarity": 0.182, "simple_Shear": 1.558, "simple_Stretch": -0.158, "simple_Buckle": 3.873, "simple_Propeller": -12.889, "bp_simpleParams": [ 1.558, -0.158, 0.350, 3.873, -12.889, -1.542 ], "bp_params": [ 1.517, -0.390, 0.350, 1.887, -13.325, -1.552 ], "frame": { "rmsd": null, "origin": [ -5.129, -10.747, -4.527 ], "x_axis": [ 0.151, -0.784, 0.602 ], "y_axis": [ -0.930, -0.320, -0.183 ], "z_axis": [ 0.336, -0.532, -0.777 ], "quaternion": [ 0.116, 0.750, -0.572, 0.313 ] } }, { "index": 15, "nt1": "///B/89", "nt2": "///B/94", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.392, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.864, "chi2": -146.970, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.273, "C1C1_dist": 10.633, "N1N9_dist": 8.940, "C6C8_dist": 9.814, "CNNC_torsion": 1.244, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.89]", "interBase_angle": 7.186, "planarity": 0.192, "simple_Shear": 0.738, "simple_Stretch": -0.162, "simple_Buckle": -3.310, "simple_Propeller": -6.379, "bp_simpleParams": [ 0.738, -0.162, -0.959, -3.310, -6.379, -2.597 ], "bp_params": [ 0.723, -0.221, -0.959, -3.811, -6.093, -2.600 ], "frame": { "rmsd": null, "origin": [ -2.246, -12.120, -6.456 ], "x_axis": [ -0.293, -0.734, 0.612 ], "y_axis": [ -0.836, -0.114, -0.537 ], "z_axis": [ 0.464, -0.669, -0.581 ], "quaternion": [ -0.056, -0.592, 0.663, -0.454 ] } }, { "index": 16, "nt1": "///B/90", "nt2": "///B/93", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -147.094, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 94.284, "chi2": 49.612, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 18.000, "C1C1_dist": 9.474, "N1N9_dist": 8.402, "C6C8_dist": 9.671, "CNNC_torsion": 176.186, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O6(carbonyl)[2.84],O2(carbonyl)-N1(imino)[2.69]", "interBase_angle": 22.583, "planarity": 0.307, "simple_Shear": 3.430, "simple_Stretch": 2.470, "simple_Buckle": 22.581, "simple_Propeller": 0.264, "bp_simpleParams": [ 3.430, 2.470, -0.829, 22.581, 0.264, -106.205 ], "bp_params": [ 0.807, -4.149, -0.829, -9.217, -20.616, -106.919 ], "frame": { "rmsd": null, "origin": [ -0.122, -14.526, -6.881 ], "x_axis": [ -0.837, -0.064, -0.543 ], "y_axis": [ 0.413, 0.577, -0.704 ], "z_axis": [ 0.358, -0.814, -0.457 ], "quaternion": [ 0.266, 0.103, 0.847, -0.448 ] } }, { "index": 17, "nt1": "///B/90", "nt2": "///B/94", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.094, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 93.945, "chi2": -146.970, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.181, "C1C1_dist": 7.593, "N1N9_dist": 6.851, "C6C8_dist": 8.497, "CNNC_torsion": -6.247, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[2.82],N3(imino)-O4(carbonyl)[3.54]", "interBase_angle": 8.064, "planarity": 0.367, "simple_Shear": 2.985, "simple_Stretch": -0.846, "simple_Buckle": 6.499, "simple_Propeller": 4.774, "bp_simpleParams": [ 2.985, -0.846, 1.874, 6.499, 4.774, 36.485 ], "bp_params": [ 2.573, -1.734, 1.874, 7.664, 2.509, 36.417 ], "frame": { "rmsd": null, "origin": [ -1.738, -13.800, -6.232 ], "x_axis": [ -0.585, -0.688, 0.431 ], "y_axis": [ -0.634, 0.057, -0.771 ], "z_axis": [ 0.506, -0.724, -0.469 ], "quaternion": [ 0.026, -0.455, 0.726, -0.514 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGUAGUAUAACAAUAU", "strand2": "CCAUGAUAUUGUUGUG", "bp_type": "||||.||||||||||.", "helix_form": "AAA..AAAAAAAAA.", "helical_rise": 2.973, "helical_rise_std": 0.509, "helical_radius": 9.040, "helical_radius_std": 1.074, "helical_axis": [ 0.259, -0.685, -0.681 ], "point1": [ -12.536, 13.052, 24.786 ], "point2": [ -0.973, -17.527, -5.644 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///B/75", "nt2": "///B/108", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.502, -0.142, 0.302, 6.573, -5.657, -1.576 ], "step_params": [ -0.113, -1.567, 3.247, -0.107, 6.043, 33.545 ], "heli_params": [ -3.589, 0.177, 2.929, 10.366, 0.183, 34.069 ], "bp2_params": [ -0.057, -0.164, 0.225, 6.742, -13.246, -3.175 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.247, "simple_Twist": 31.506, "simple_hRise": 2.905, "simple_hTwist": 32.066 }, { "index": 2, "nt1": "///B/76", "nt2": "///B/107", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.164, 0.225, 6.742, -13.246, -3.175 ], "step_params": [ 0.026, -1.728, 3.300, 1.629, 7.024, 37.294 ], "heli_params": [ -3.520, 0.161, 2.937, 10.860, -2.518, 37.960 ], "bp2_params": [ -0.207, -0.026, 0.063, -5.597, -15.482, -6.772 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.300, "simple_Twist": 37.496, "simple_hRise": 2.939, "simple_hTwist": 38.158 }, { "index": 3, "nt1": "///B/77", "nt2": "///B/106", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.026, 0.063, -5.597, -15.482, -6.772 ], "step_params": [ 0.048, -1.922, 3.323, 0.405, 0.313, 35.344 ], "heli_params": [ -3.212, -0.019, 3.307, 0.515, -0.667, 35.347 ], "bp2_params": [ 0.241, 0.055, 0.232, -10.456, -3.233, -12.062 ], "groove_widths": [ 16.089, null, 13.501, null ], "simple_Rise": 3.323, "simple_Twist": 33.124, "simple_hRise": 3.306, "simple_hTwist": 33.128 }, { "index": 4, "nt1": "///B/78", "nt2": "///B/105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.241, 0.055, 0.232, -10.456, -3.233, -12.062 ], "step_params": [ -1.965, -1.353, 3.750, 11.711, 4.499, 86.699 ], "heli_params": [ -1.087, 1.703, 3.459, 3.263, -8.492, 87.424 ], "bp2_params": [ 0.896, 1.606, -0.916, -26.224, 15.972, -150.666 ], "groove_widths": [ 16.975, 16.281, 14.998, 14.503 ], "simple_Rise": 3.750, "simple_Twist": 26.626, "simple_hRise": 2.432, "simple_hTwist": 29.385 }, { "index": 5, "nt1": "///B/79", "nt2": "///B/104", "bp": "G+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ 0.896, 1.606, -0.916, -26.224, 15.972, -150.666 ], "step_params": [ 0.734, -0.583, 3.329, -9.344, 0.935, -26.668 ], "heli_params": [ 0.963, -0.800, 3.404, -1.952, -19.504, -28.245 ], "bp2_params": [ -0.622, 0.073, 0.101, -8.978, -4.454, -10.704 ], "groove_widths": [ 18.379, 17.542, 15.031, 14.405 ], "simple_Rise": 3.329, "simple_Twist": 37.687, "simple_hRise": 3.053, "simple_hTwist": 38.798 }, { "index": 6, "nt1": "///B/80", "nt2": "///B/103", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.622, 0.073, 0.101, -8.978, -4.454, -10.704 ], "step_params": [ 0.597, -1.441, 2.847, -2.323, 9.014, 33.613 ], "heli_params": [ -3.515, -1.282, 2.349, 15.228, 3.924, 34.843 ], "bp2_params": [ 0.055, -0.050, 0.437, 4.837, -4.414, -5.312 ], "groove_widths": [ 18.694, 17.376, 14.107, 12.773 ], "simple_Rise": 2.847, "simple_Twist": 30.405, "simple_hRise": 2.286, "simple_hTwist": 31.766 }, { "index": 7, "nt1": "///B/81", "nt2": "///B/102", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.050, 0.437, 4.837, -4.414, -5.312 ], "step_params": [ 0.017, -1.593, 3.280, 3.650, 7.958, 30.352 ], "heli_params": [ -4.324, 0.608, 2.767, 14.816, -6.795, 31.561 ], "bp2_params": [ -0.353, 0.019, -0.173, 6.905, -14.515, -6.321 ], "groove_widths": [ 18.082, 16.498, 15.337, 13.376 ], "simple_Rise": 3.280, "simple_Twist": 32.567, "simple_hRise": 2.809, "simple_hTwist": 33.692 }, { "index": 8, "nt1": "///B/82", "nt2": "///B/101", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.353, 0.019, -0.173, 6.905, -14.515, -6.321 ], "step_params": [ 0.576, -1.679, 3.331, -2.950, 9.295, 33.714 ], "heli_params": [ -4.107, -1.374, 2.728, 15.624, 4.960, 35.056 ], "bp2_params": [ 0.014, -0.007, 0.172, 3.685, -4.707, -0.201 ], "groove_widths": [ 17.524, 15.925, 16.463, 14.064 ], "simple_Rise": 3.331, "simple_Twist": 31.646, "simple_hRise": 2.681, "simple_hTwist": 33.077 }, { "index": 9, "nt1": "///B/83", "nt2": "///B/100", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.007, 0.172, 3.685, -4.707, -0.201 ], "step_params": [ -0.306, -1.977, 3.198, 1.525, 3.522, 28.625 ], "heli_params": [ -4.701, 0.932, 2.919, 7.083, -3.066, 28.876 ], "bp2_params": [ -0.014, -0.008, -0.023, 8.273, -4.053, -2.273 ], "groove_widths": [ 17.268, 15.790, 16.505, 13.741 ], "simple_Rise": 3.198, "simple_Twist": 28.868, "simple_hRise": 2.921, "simple_hTwist": 29.116 }, { "index": 10, "nt1": "///B/84", "nt2": "///B/99", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.014, -0.008, -0.023, 8.273, -4.053, -2.273 ], "step_params": [ 0.084, -1.736, 3.403, -0.827, 10.836, 33.961 ], "heli_params": [ -4.355, -0.254, 2.735, 17.989, 1.373, 35.608 ], "bp2_params": [ 0.178, -0.118, 0.094, 0.084, -3.688, -0.461 ], "groove_widths": [ 17.119, 15.895, 16.572, 14.051 ], "simple_Rise": 3.403, "simple_Twist": 32.679, "simple_hRise": 2.704, "simple_hTwist": 34.391 }, { "index": 11, "nt1": "///B/85", "nt2": "///B/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.118, 0.094, 0.084, -3.688, -0.461 ], "step_params": [ -0.107, -1.709, 3.157, 1.085, 4.128, 31.389 ], "heli_params": [ -3.841, 0.383, 2.909, 7.586, -1.994, 31.671 ], "bp2_params": [ 0.077, -0.025, 0.189, 1.388, -14.123, -2.145 ], "groove_widths": [ 16.509, 15.350, 15.583, 13.424 ], "simple_Rise": 3.157, "simple_Twist": 32.083, "simple_hRise": 2.915, "simple_hTwist": 32.359 }, { "index": 12, "nt1": "///B/86", "nt2": "///B/97", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.077, -0.025, 0.189, 1.388, -14.123, -2.145 ], "step_params": [ -0.370, -1.683, 3.108, -0.403, -0.300, 33.477 ], "heli_params": [ -2.874, 0.580, 3.126, -0.521, 0.699, 33.480 ], "bp2_params": [ 0.496, 0.006, 0.308, 3.137, -15.191, -6.772 ], "groove_widths": [ 16.076, 14.928, 15.084, 13.874 ], "simple_Rise": 3.108, "simple_Twist": 31.607, "simple_hRise": 3.127, "simple_hTwist": 31.610 }, { "index": 13, "nt1": "///B/87", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.496, 0.006, 0.308, 3.137, -15.191, -6.772 ], "step_params": [ 0.256, -1.456, 3.076, 1.027, 4.641, 41.506 ], "heli_params": [ -2.490, -0.261, 2.910, 6.523, -1.443, 41.765 ], "bp2_params": [ 1.517, -0.390, 0.350, 1.887, -13.325, -1.552 ], "groove_widths": [ 16.566, null, 15.821, null ], "simple_Rise": 3.076, "simple_Twist": 35.295, "simple_hRise": 2.874, "simple_hTwist": 35.603 }, { "index": 14, "nt1": "///B/88", "nt2": "///B/95", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.517, -0.390, 0.350, 1.887, -13.325, -1.552 ], "step_params": [ -0.388, -1.662, 3.317, 9.088, 12.720, 22.626 ], "heli_params": [ -6.234, 2.768, 1.856, 28.465, -20.337, 27.443 ], "bp2_params": [ 0.723, -0.221, -0.959, -3.811, -6.093, -2.600 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 27.266, "simple_hRise": 2.122, "simple_hTwist": 31.356 }, { "index": 15, "nt1": "///B/89", "nt2": "///B/94", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.723, -0.221, -0.959, -3.811, -6.093, -2.600 ], "step_params": [ -0.558, -1.337, 2.896, 7.332, 10.116, 92.133 ], "heli_params": [ -1.087, 0.504, 2.733, 6.998, -5.072, 92.786 ], "bp2_params": [ 0.807, -4.149, -0.829, -9.217, -20.616, -106.919 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.896, "simple_Twist": 4.960, "simple_hRise": -0.239, "simple_hTwist": 13.438 }, { "index": 16, "nt1": "///B/90", "nt2": "///B/93", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGUA", "strand2": "CCAU", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.397, "helical_rise_std": 0.267, "helical_radius": 8.560, "helical_radius_std": 0.608, "helical_axis": [ 0.097, -0.886, -0.454 ], "point1": [ -10.921, 13.554, 23.794 ], "point2": [ -10.245, 7.352, 20.619 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/75", "nt2": "///B/108", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.502, -0.142, 0.302, 6.573, -5.657, -1.576 ], "step_params": [ -0.113, -1.567, 3.247, -0.107, 6.043, 33.545 ], "heli_params": [ -3.589, 0.177, 2.929, 10.366, 0.183, 34.069 ], "bp2_params": [ -0.057, -0.164, 0.225, 6.742, -13.246, -3.175 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.247, "simple_Twist": 31.506, "simple_hRise": 2.905, "simple_hTwist": 32.066 }, { "index": 2, "nt1": "///B/76", "nt2": "///B/107", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.164, 0.225, 6.742, -13.246, -3.175 ], "step_params": [ 0.026, -1.728, 3.300, 1.629, 7.024, 37.294 ], "heli_params": [ -3.520, 0.161, 2.937, 10.860, -2.518, 37.960 ], "bp2_params": [ -0.207, -0.026, 0.063, -5.597, -15.482, -6.772 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.300, "simple_Twist": 37.496, "simple_hRise": 2.939, "simple_hTwist": 38.158 }, { "index": 3, "nt1": "///B/77", "nt2": "///B/106", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.026, 0.063, -5.597, -15.482, -6.772 ], "step_params": [ 0.048, -1.922, 3.323, 0.405, 0.313, 35.344 ], "heli_params": [ -3.212, -0.019, 3.307, 0.515, -0.667, 35.347 ], "bp2_params": [ 0.241, 0.055, 0.232, -10.456, -3.233, -12.062 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.323, "simple_Twist": 33.124, "simple_hRise": 3.306, "simple_hTwist": 33.128 }, { "index": 4, "nt1": "///B/78", "nt2": "///B/105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "UAUAACAAUA", "strand2": "AUAUUGUUGU", "bp_type": "||||||||||", "helix_form": "AAAAAAAAA", "helical_rise": 2.872, "helical_rise_std": 0.212, "helical_radius": 9.153, "helical_radius_std": 0.618, "helical_axis": [ 0.275, -0.636, -0.721 ], "point1": [ -9.436, 1.775, 14.575 ], "point2": [ -2.311, -14.729, -4.112 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///B/80", "nt2": "///B/103", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.622, 0.073, 0.101, -8.978, -4.454, -10.704 ], "step_params": [ 0.597, -1.441, 2.847, -2.323, 9.014, 33.613 ], "heli_params": [ -3.515, -1.282, 2.349, 15.228, 3.924, 34.843 ], "bp2_params": [ 0.055, -0.050, 0.437, 4.837, -4.414, -5.312 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.847, "simple_Twist": 30.405, "simple_hRise": 2.286, "simple_hTwist": 31.766 }, { "index": 2, "nt1": "///B/81", "nt2": "///B/102", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.050, 0.437, 4.837, -4.414, -5.312 ], "step_params": [ 0.017, -1.593, 3.280, 3.650, 7.958, 30.352 ], "heli_params": [ -4.324, 0.608, 2.767, 14.816, -6.795, 31.561 ], "bp2_params": [ -0.353, 0.019, -0.173, 6.905, -14.515, -6.321 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.280, "simple_Twist": 32.567, "simple_hRise": 2.809, "simple_hTwist": 33.692 }, { "index": 3, "nt1": "///B/82", "nt2": "///B/101", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.353, 0.019, -0.173, 6.905, -14.515, -6.321 ], "step_params": [ 0.576, -1.679, 3.331, -2.950, 9.295, 33.714 ], "heli_params": [ -4.107, -1.374, 2.728, 15.624, 4.960, 35.056 ], "bp2_params": [ 0.014, -0.007, 0.172, 3.685, -4.707, -0.201 ], "groove_widths": [ 17.524, null, 16.463, null ], "simple_Rise": 3.331, "simple_Twist": 31.646, "simple_hRise": 2.681, "simple_hTwist": 33.077 }, { "index": 4, "nt1": "///B/83", "nt2": "///B/100", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.007, 0.172, 3.685, -4.707, -0.201 ], "step_params": [ -0.306, -1.977, 3.198, 1.525, 3.522, 28.625 ], "heli_params": [ -4.701, 0.932, 2.919, 7.083, -3.066, 28.876 ], "bp2_params": [ -0.014, -0.008, -0.023, 8.273, -4.053, -2.273 ], "groove_widths": [ 17.268, 15.790, 16.505, 13.741 ], "simple_Rise": 3.198, "simple_Twist": 28.868, "simple_hRise": 2.921, "simple_hTwist": 29.116 }, { "index": 5, "nt1": "///B/84", "nt2": "///B/99", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.014, -0.008, -0.023, 8.273, -4.053, -2.273 ], "step_params": [ 0.084, -1.736, 3.403, -0.827, 10.836, 33.961 ], "heli_params": [ -4.355, -0.254, 2.735, 17.989, 1.373, 35.608 ], "bp2_params": [ 0.178, -0.118, 0.094, 0.084, -3.688, -0.461 ], "groove_widths": [ 17.119, 15.895, 16.572, 14.051 ], "simple_Rise": 3.403, "simple_Twist": 32.679, "simple_hRise": 2.704, "simple_hTwist": 34.391 }, { "index": 6, "nt1": "///B/85", "nt2": "///B/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.118, 0.094, 0.084, -3.688, -0.461 ], "step_params": [ -0.107, -1.709, 3.157, 1.085, 4.128, 31.389 ], "heli_params": [ -3.841, 0.383, 2.909, 7.586, -1.994, 31.671 ], "bp2_params": [ 0.077, -0.025, 0.189, 1.388, -14.123, -2.145 ], "groove_widths": [ 16.509, 15.350, 15.583, 13.424 ], "simple_Rise": 3.157, "simple_Twist": 32.083, "simple_hRise": 2.915, "simple_hTwist": 32.359 }, { "index": 7, "nt1": "///B/86", "nt2": "///B/97", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.077, -0.025, 0.189, 1.388, -14.123, -2.145 ], "step_params": [ -0.370, -1.683, 3.108, -0.403, -0.300, 33.477 ], "heli_params": [ -2.874, 0.580, 3.126, -0.521, 0.699, 33.480 ], "bp2_params": [ 0.496, 0.006, 0.308, 3.137, -15.191, -6.772 ], "groove_widths": [ 16.076, null, 15.084, null ], "simple_Rise": 3.108, "simple_Twist": 31.607, "simple_hRise": 3.127, "simple_hTwist": 31.610 }, { "index": 8, "nt1": "///B/87", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.496, 0.006, 0.308, 3.137, -15.191, -6.772 ], "step_params": [ 0.256, -1.456, 3.076, 1.027, 4.641, 41.506 ], "heli_params": [ -2.490, -0.261, 2.910, 6.523, -1.443, 41.765 ], "bp2_params": [ 1.517, -0.390, 0.350, 1.887, -13.325, -1.552 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.076, "simple_Twist": 35.295, "simple_hRise": 2.874, "simple_hTwist": 35.603 }, { "index": 9, "nt1": "///B/88", "nt2": "///B/95", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.517, -0.390, 0.350, 1.887, -13.325, -1.552 ], "step_params": [ -0.388, -1.662, 3.317, 9.088, 12.720, 22.626 ], "heli_params": [ -6.234, 2.768, 1.856, 28.465, -20.337, 27.443 ], "bp2_params": [ 0.723, -0.221, -0.959, -3.811, -6.093, -2.600 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 27.266, "simple_hRise": 2.122, "simple_hTwist": 31.356 }, { "index": 10, "nt1": "///B/89", "nt2": "///B/94", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GU", "nts_long": "///B/93,///B/94" }, { "index": 2, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/78,///B/79,///B/80" }, { "index": 3, "num_nts": 3, "nts_short": "AUC", "nts_long": "///B/89,///B/90,///B/92" }, { "index": 4, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/103,///B/104,///B/105" } ], "nonStack": { "num_nts": 1, "nts_short": "U", "nts_long": "///B/100" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///B/92/O4'", "nt": "///B/93", "vert_dist": 2.911 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 2 ], "summary": "[1] 4 [B.89 B.94] 10", "num_nts": 6, "nts_short": "AUCCGU", "nts_long": "///B/89,///B/90,///B/91,///B/92,///B/93,///B/94", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UCCG", "nts_long": "///B/90,///B/91,///B/92,///B/93" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [B.78 B.105 B.80 B.103] 4 10", "num_nts": 6, "nts_short": "AGUAGU", "nts_long": "///B/78,///B/79,///B/80,///B/103,///B/104,///B/105", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///B/79" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///B/104" } ] } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "UCC", "nts_long": "///B/90,///B/91,///B/92" } ], "dbn": { "all_chains": { "num_nts": 34, "num_chars": 34, "bseq": "GGUAGUAUAACAAUAUCCGUGUUGUUAUAGUACC", "sstr": "((((.((((((((((....)))))))))).))))", "form": "AAAAAAAAAAAAAAA..Z.AAAAAAAAA..AAA-" }, "m1_chain_B": { "num_nts": 34, "num_chars": 34, "bseq": "GGUAGUAUAACAAUAUCCGUGUUGUUAUAGUACC", "sstr": "((((.((((((((((....)))))))))).))))", "form": "AAAAAAAAAAAAAAA..Z.AAAAAAAAA..AAA-" } }, "chains": { "m1_chain_B": { "num_nts": 34, "bseq": "GGUAGUAUAACAAUAUCCGUGUUGUUAUAGUACC", "sstr": "((((.((((((((((....)))))))))).))))", "form": "AAAAAAAAAAAAAAA..Z.AAAAAAAAA..AAA-", "helical_rise": 0.110, "helical_rise_std": 2.774, "helical_axis": [ 0.274, 0.874, 0.401 ], "point1": [ 0.698, 10.609, 11.838 ], "point2": [ 1.754, 13.979, 13.384 ], "num_chars": 100, "suite": "G1aG1aU1aA1aG1aU1aA1aU1aA1aA1aC1aA1aA1aU1aA1aU!!C2[C!!G1aU1aG1aU1aU1aG1aU1aU1aA1aU1aA1aG1aU1aA1aC1aC" } }, "num_nts": 34, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 75, "nt_name": "G", "nt_code": "G", "nt_id": "///B/75", "linked_nts": [ null, "///B/76" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 52.083, "delta": 79.127, "epsilon": -158.723, "zeta": -69.448, "epsilon_zeta": -89.275, "bb_type": "BI", "chi": -161.581, "glyco_bond": "anti", "C5prime_xyz": [ -1.278, 8.718, 0.619 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.496, "Dp": 4.701, "splay_angle": 23.400, "splay_distance": 3.628, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.930, "v1": -30.368, "v2": 39.698, "v3": -37.636, "v4": 19.783, "amplitude": 40.233, "phase_angle": 9.352, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -15.063, 13.721, 23.054 ], "x_axis": [ 0.986, 0.011, 0.165 ], "y_axis": [ -0.107, -0.718, 0.688 ], "z_axis": [ 0.126, -0.696, -0.707 ], "quaternion": [ 0.375, 0.923, -0.026, 0.079 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 76, "nt_name": "G", "nt_code": "G", "nt_id": "///B/76", "linked_nts": [ "///B/75", "///B/77" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.087, "beta": 172.661, "gamma": 59.924, "delta": 80.801, "epsilon": -158.069, "zeta": -65.660, "epsilon_zeta": -92.409, "bb_type": "BI", "chi": -162.534, "glyco_bond": "anti", "C5prime_xyz": [ -1.339, 8.661, 0.723 ], "P_xyz": [ 1.277, 8.970, 0.748 ], "form": "A", "ssZp": 4.508, "Dp": 4.688, "splay_angle": 23.346, "splay_distance": 3.651, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 168.958, "theta": -142.629, "eta_prime": -176.546, "theta_prime": -144.252, "eta_base": -134.299, "theta_base": -118.024, "v0": 9.974, "v1": -32.435, "v2": 40.091, "v3": -36.303, "v4": 16.922, "amplitude": 40.245, "phase_angle": 5.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.864, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -13.559, 12.398, 20.030 ], "x_axis": [ 0.766, -0.333, 0.550 ], "y_axis": [ -0.607, -0.657, 0.447 ], "z_axis": [ 0.213, -0.676, -0.705 ], "quaternion": [ 0.318, 0.884, -0.266, 0.216 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 77, "nt_name": "U", "nt_code": "U", "nt_id": "///B/77", "linked_nts": [ "///B/76", "///B/78" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.032, "beta": 177.915, "gamma": 51.522, "delta": 77.032, "epsilon": -158.400, "zeta": -62.912, "epsilon_zeta": -95.488, "bb_type": "BI", "chi": -164.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.626, 0.864 ], "P_xyz": [ 1.326, 9.028, 1.164 ], "form": "A", "ssZp": 4.609, "Dp": 4.714, "splay_angle": 24.815, "splay_distance": 3.900, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 163.998, "theta": -146.019, "eta_prime": 176.923, "theta_prime": -143.959, "eta_base": -137.304, "theta_base": -118.034, "v0": 9.215, "v1": -33.358, "v2": 42.313, "v3": -39.022, "v4": 19.072, "amplitude": 42.612, "phase_angle": 6.797, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.100, "frame": { "rmsd": 0.017, "origin": [ -11.165, 10.773, 17.804 ], "x_axis": [ 0.250, -0.580, 0.776 ], "y_axis": [ -0.930, -0.368, 0.024 ], "z_axis": [ 0.271, -0.727, -0.631 ], "quaternion": [ 0.251, 0.750, -0.503, 0.349 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///B/78", "linked_nts": [ "///B/77", "///B/79" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -70.019, "beta": 177.355, "gamma": 60.350, "delta": 73.429, "epsilon": -160.271, "zeta": -75.348, "epsilon_zeta": -84.922, "bb_type": "BI", "chi": -167.530, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.632, 1.021 ], "P_xyz": [ 1.203, 9.128, 1.249 ], "form": "A", "ssZp": 4.650, "Dp": 4.723, "splay_angle": 25.771, "splay_distance": 4.019, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 172.024, "theta": -162.226, "eta_prime": -174.232, "theta_prime": -159.982, "eta_base": -132.481, "theta_base": -149.770, "v0": 6.105, "v1": -30.887, "v2": 41.321, "v3": -39.866, "v4": 21.639, "amplitude": 42.081, "phase_angle": 10.910, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.732, "filter_rmsd": 0.045, "frame": { "rmsd": 0.014, "origin": [ -8.284, 8.330, 16.834 ], "x_axis": [ -0.310, -0.642, 0.701 ], "y_axis": [ -0.908, -0.017, -0.418 ], "z_axis": [ 0.280, -0.767, -0.578 ], "quaternion": [ -0.154, -0.567, 0.684, -0.433 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 79, "nt_name": "G", "nt_code": "G", "nt_id": "///B/79", "linked_nts": [ "///B/78", "///B/80" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -67.933, "beta": 169.627, "gamma": 65.633, "delta": 84.234, "epsilon": -152.355, "zeta": -69.498, "epsilon_zeta": -82.857, "bb_type": "BI", "chi": -174.136, "glyco_bond": "anti", "C5prime_xyz": [ -1.710, 8.624, 1.132 ], "P_xyz": [ 0.849, 9.122, 1.201 ], "form": "A", "ssZp": 4.557, "Dp": 4.706, "splay_angle": 25.764, "splay_distance": 4.009, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 176.736, "theta": -138.938, "eta_prime": -172.574, "theta_prime": -139.973, "eta_base": -152.478, "theta_base": -105.345, "v0": 2.802, "v1": -25.934, "v2": 36.723, "v3": -36.558, "v4": 21.877, "amplitude": 37.970, "phase_angle": 14.723, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.617, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ -4.993, 6.456, 15.489 ], "x_axis": [ -0.571, -0.618, 0.541 ], "y_axis": [ -0.762, 0.152, -0.630 ], "z_axis": [ 0.307, -0.771, -0.557 ], "quaternion": [ -0.077, -0.457, 0.755, -0.464 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 80, "nt_name": "U", "nt_code": "U", "nt_id": "///B/80", "linked_nts": [ "///B/79", "///B/81" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -70.056, "beta": 175.107, "gamma": 55.107, "delta": 80.331, "epsilon": -160.021, "zeta": -62.524, "epsilon_zeta": -97.497, "bb_type": "BI", "chi": -161.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.303, 8.692, 0.678 ], "P_xyz": [ 1.304, 9.068, 0.686 ], "form": "A", "ssZp": 4.579, "Dp": 4.683, "splay_angle": 22.566, "splay_distance": 3.544, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 165.499, "theta": -142.095, "eta_prime": -178.015, "theta_prime": -140.823, "eta_base": -122.701, "theta_base": -109.371, "v0": 9.322, "v1": -31.697, "v2": 40.001, "v3": -36.186, "v4": 17.342, "amplitude": 40.207, "phase_angle": 5.801, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.099, "frame": { "rmsd": 0.021, "origin": [ -4.141, 2.553, 15.145 ], "x_axis": [ -0.909, -0.410, -0.075 ], "y_axis": [ -0.159, 0.506, -0.848 ], "z_axis": [ 0.386, -0.759, -0.525 ], "quaternion": [ 0.134, -0.166, 0.857, -0.469 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 81, "nt_name": "A", "nt_code": "A", "nt_id": "///B/81", "linked_nts": [ "///B/80", "///B/82" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.253, "beta": 179.325, "gamma": 54.760, "delta": 78.882, "epsilon": -159.976, "zeta": -69.508, "epsilon_zeta": -90.468, "bb_type": "BI", "chi": -157.926, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.698, 0.473 ], "P_xyz": [ 1.125, 9.137, 0.718 ], "form": "A", "ssZp": 4.416, "Dp": 4.666, "splay_angle": 21.338, "splay_distance": 3.391, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 169.149, "theta": -149.903, "eta_prime": -175.562, "theta_prime": -149.236, "eta_base": -127.488, "theta_base": -127.373, "v0": 5.229, "v1": -28.447, "v2": 38.590, "v3": -37.457, "v4": 20.607, "amplitude": 39.395, "phase_angle": 11.603, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.042, "frame": { "rmsd": 0.012, "origin": [ -4.495, -0.919, 14.528 ], "x_axis": [ -0.862, 0.065, -0.502 ], "y_axis": [ 0.452, 0.547, -0.705 ], "z_axis": [ 0.229, -0.835, -0.501 ], "quaternion": [ 0.214, 0.152, 0.853, -0.451 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 82, "nt_name": "U", "nt_code": "U", "nt_id": "///B/82", "linked_nts": [ "///B/81", "///B/83" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.925, "beta": 173.556, "gamma": 57.115, "delta": 79.209, "epsilon": -157.134, "zeta": -64.376, "epsilon_zeta": -92.758, "bb_type": "BI", "chi": -156.001, "glyco_bond": "anti", "C5prime_xyz": [ -1.378, 8.759, 0.376 ], "P_xyz": [ 1.193, 9.236, 0.238 ], "form": "A", "ssZp": 4.419, "Dp": 4.685, "splay_angle": 25.300, "splay_distance": 3.993, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 167.303, "theta": -142.475, "eta_prime": 179.095, "theta_prime": -141.807, "eta_base": -144.940, "theta_base": -111.993, "v0": 6.201, "v1": -29.522, "v2": 39.385, "v3": -37.537, "v4": 20.042, "amplitude": 40.020, "phase_angle": 10.221, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.879, "filter_rmsd": 0.102, "frame": { "rmsd": 0.018, "origin": [ -5.053, -4.170, 13.740 ], "x_axis": [ -0.543, 0.368, -0.755 ], "y_axis": [ 0.836, 0.329, -0.440 ], "z_axis": [ 0.086, -0.870, -0.486 ], "quaternion": [ 0.274, 0.392, 0.768, -0.426 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 83, "nt_name": "A", "nt_code": "A", "nt_id": "///B/83", "linked_nts": [ "///B/82", "///B/84" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.141, "beta": 178.891, "gamma": 52.971, "delta": 77.695, "epsilon": -160.199, "zeta": -70.359, "epsilon_zeta": -89.839, "bb_type": "BI", "chi": -161.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.674, 0.659 ], "P_xyz": [ 1.115, 9.187, 0.963 ], "form": "A", "ssZp": 4.516, "Dp": 4.682, "splay_angle": 23.387, "splay_distance": 3.691, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 165.299, "theta": -153.222, "eta_prime": 179.668, "theta_prime": -151.661, "eta_base": -133.601, "theta_base": -133.052, "v0": 5.369, "v1": -29.359, "v2": 39.837, "v3": -38.948, "v4": 21.444, "amplitude": 40.701, "phase_angle": 11.823, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ -6.635, -6.675, 11.064 ], "x_axis": [ 0.043, 0.705, -0.708 ], "y_axis": [ 0.998, 0.006, 0.067 ], "z_axis": [ 0.051, -0.709, -0.703 ], "quaternion": [ 0.294, 0.660, 0.645, -0.249 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 84, "nt_name": "A", "nt_code": "A", "nt_id": "///B/84", "linked_nts": [ "///B/83", "///B/85" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.097, "beta": 176.706, "gamma": 60.110, "delta": 78.026, "epsilon": -157.331, "zeta": -68.464, "epsilon_zeta": -88.867, "bb_type": "BI", "chi": -159.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.689, 0.489 ], "P_xyz": [ 1.144, 9.214, 0.525 ], "form": "A", "ssZp": 4.415, "Dp": 4.697, "splay_angle": 24.857, "splay_distance": 3.882, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 172.290, "theta": -148.772, "eta_prime": -177.565, "theta_prime": -147.783, "eta_base": -147.653, "theta_base": -120.614, "v0": 7.558, "v1": -31.389, "v2": 40.607, "v3": -38.228, "v4": 19.771, "amplitude": 41.076, "phase_angle": 8.668, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ -8.363, -8.613, 8.440 ], "x_axis": [ 0.494, 0.677, -0.546 ], "y_axis": [ 0.869, -0.386, 0.308 ], "z_axis": [ -0.003, -0.627, -0.779 ], "quaternion": [ 0.286, 0.815, 0.474, -0.168 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///B/85", "linked_nts": [ "///B/84", "///B/86" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.123, "beta": 177.065, "gamma": 54.046, "delta": 80.057, "epsilon": -160.039, "zeta": -69.994, "epsilon_zeta": -90.044, "bb_type": "BI", "chi": -165.011, "glyco_bond": "anti", "C5prime_xyz": [ -1.311, 8.658, 0.871 ], "P_xyz": [ 1.273, 9.013, 1.228 ], "form": "A", "ssZp": 4.578, "Dp": 4.677, "splay_angle": 23.273, "splay_distance": 3.594, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 166.645, "theta": -150.078, "eta_prime": 179.201, "theta_prime": -148.467, "eta_base": -138.669, "theta_base": -125.164, "v0": 7.783, "v1": -30.934, "v2": 39.676, "v3": -36.987, "v4": 18.834, "amplitude": 40.063, "phase_angle": 7.974, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -8.878, -9.541, 4.706 ], "x_axis": [ 0.878, 0.468, -0.096 ], "y_axis": [ 0.436, -0.703, 0.563 ], "z_axis": [ 0.196, -0.536, -0.821 ], "quaternion": [ 0.298, 0.922, 0.245, 0.027 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///B/86", "linked_nts": [ "///B/85", "///B/87" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.125, "beta": 172.527, "gamma": 61.587, "delta": 81.327, "epsilon": -160.019, "zeta": -70.567, "epsilon_zeta": -89.452, "bb_type": "BI", "chi": -164.185, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.610, 0.765 ], "P_xyz": [ 1.222, 8.954, 0.777 ], "form": "A", "ssZp": 4.512, "Dp": 4.678, "splay_angle": 22.918, "splay_distance": 3.546, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 170.672, "theta": -147.878, "eta_prime": -175.094, "theta_prime": -147.699, "eta_base": -136.493, "theta_base": -124.784, "v0": 7.629, "v1": -29.961, "v2": 38.491, "v3": -35.886, "v4": 18.182, "amplitude": 38.861, "phase_angle": 7.919, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.819, "filter_rmsd": 0.041, "frame": { "rmsd": 0.014, "origin": [ -8.477, -9.864, 1.149 ], "x_axis": [ 0.984, 0.034, 0.176 ], "y_axis": [ -0.055, -0.876, 0.478 ], "z_axis": [ 0.171, -0.480, -0.860 ], "quaternion": [ 0.248, 0.964, -0.005, 0.090 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///B/87", "linked_nts": [ "///B/86", "///B/88" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.916, "beta": 170.631, "gamma": 63.823, "delta": 85.052, "epsilon": -157.375, "zeta": -65.935, "epsilon_zeta": -91.440, "bb_type": "BI", "chi": -162.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.548, 8.635, 0.651 ], "P_xyz": [ 1.061, 9.001, 0.655 ], "form": "A", "ssZp": 4.386, "Dp": 4.612, "splay_angle": 21.693, "splay_distance": 3.415, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 171.895, "theta": -136.493, "eta_prime": -172.308, "theta_prime": -139.209, "eta_base": -132.777, "theta_base": -101.580, "v0": 7.371, "v1": -29.041, "v2": 37.288, "v3": -34.544, "v4": 17.545, "amplitude": 37.634, "phase_angle": 7.779, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.747, "filter_rmsd": 0.043, "frame": { "rmsd": 0.017, "origin": [ -7.169, -10.024, -2.143 ], "x_axis": [ 0.820, -0.430, 0.378 ], "y_axis": [ -0.538, -0.804, 0.251 ], "z_axis": [ 0.196, -0.409, -0.891 ], "quaternion": [ 0.176, 0.937, -0.258, 0.153 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 88, "nt_name": "U", "nt_code": "U", "nt_id": "///B/88", "linked_nts": [ "///B/87", "///B/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.448, "beta": 177.871, "gamma": 49.890, "delta": 77.980, "epsilon": -155.753, "zeta": -71.459, "epsilon_zeta": -84.294, "bb_type": "BI", "chi": -154.540, "glyco_bond": "anti", "C5prime_xyz": [ -1.168, 8.751, 0.284 ], "P_xyz": [ 1.457, 9.095, 0.512 ], "form": "A", "ssZp": 4.347, "Dp": 4.703, "splay_angle": 18.139, "splay_distance": 2.949, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 162.729, "theta": -149.658, "eta_prime": 177.363, "theta_prime": -148.646, "eta_base": -125.561, "theta_base": -137.956, "v0": 6.157, "v1": -29.254, "v2": 39.063, "v3": -37.064, "v4": 19.823, "amplitude": 39.682, "phase_angle": 10.128, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.102, "frame": { "rmsd": 0.019, "origin": [ -4.775, -11.373, -4.172 ], "x_axis": [ 0.202, -0.836, 0.510 ], "y_axis": [ -0.921, -0.339, -0.190 ], "z_axis": [ 0.331, -0.432, -0.839 ], "quaternion": [ 0.078, 0.771, -0.570, 0.273 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 89, "nt_name": "A", "nt_code": "A", "nt_id": "///B/89", "linked_nts": [ "///B/88", "///B/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -70.339, "beta": 170.760, "gamma": 55.071, "delta": 81.210, "epsilon": -155.571, "zeta": -59.880, "epsilon_zeta": -95.691, "bb_type": "BI", "chi": -157.392, "glyco_bond": "anti", "C5prime_xyz": [ -1.724, 8.757, 0.349 ], "P_xyz": [ 0.816, 9.424, 0.320 ], "form": "A", "ssZp": 4.375, "Dp": 4.657, "splay_angle": 21.259, "splay_distance": 3.539, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 161.786, "theta": -133.993, "eta_prime": 173.950, "theta_prime": -135.580, "eta_base": -161.606, "theta_base": -95.855, "v0": 1.992, "v1": -26.660, "v2": 38.489, "v3": -39.204, "v4": 23.903, "amplitude": 40.084, "phase_angle": 16.218, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.923, "filter_rmsd": 0.041, "frame": { "rmsd": 0.014, "origin": [ -2.482, -12.051, -5.897 ], "x_axis": [ -0.250, -0.767, 0.592 ], "y_axis": [ -0.857, -0.109, -0.503 ], "z_axis": [ 0.450, -0.633, -0.630 ], "quaternion": [ -0.053, -0.610, 0.665, -0.427 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///B/90", "linked_nts": [ "///B/89", "///B/91" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -76.471, "beta": 177.878, "gamma": 53.945, "delta": 70.614, "epsilon": -164.551, "zeta": -117.459, "epsilon_zeta": -47.093, "bb_type": "BI", "chi": -147.094, "glyco_bond": "anti", "C5prime_xyz": [ -1.744, 8.848, 0.064 ], "P_xyz": [ 0.720, 9.700, -0.387 ], "form": ".", "ssZp": 4.319, "Dp": 4.702, "splay_angle": 101.956, "splay_distance": 14.174, "splay_ratio": 0.777, "d22": 8.004, "d64": 10.650, "eta": 156.048, "theta": 177.712, "eta_prime": 173.358, "theta_prime": 142.979, "eta_base": -126.151, "theta_base": 96.307, "v0": -0.496, "v1": -28.142, "v2": 42.643, "v3": -45.552, "v4": 29.518, "amplitude": 45.342, "phase_angle": 19.867, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.623, "filter_rmsd": 0.099, "frame": { "rmsd": 0.027, "origin": [ -1.466, -15.411, -5.450 ], "x_axis": [ -0.754, -0.636, 0.168 ], "y_axis": [ -0.383, 0.217, -0.898 ], "z_axis": [ 0.534, -0.741, -0.407 ], "quaternion": [ 0.119, -0.330, 0.771, -0.531 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 91, "nt_name": "C", "nt_code": "C", "nt_id": "///B/91", "linked_nts": [ "///B/90", "///B/92" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 75.619, "beta": -172.681, "gamma": 167.666, "delta": 149.847, "epsilon": -76.892, "zeta": -63.460, "epsilon_zeta": -13.432, "bb_type": "--", "chi": -140.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.464, 8.580, 0.127 ], "P_xyz": [ 0.788, 9.460, -0.904 ], "form": ".", "ssZp": 0.909, "Dp": 0.894, "splay_angle": 98.788, "splay_distance": 15.146, "splay_ratio": 0.759, "d22": 7.724, "d64": 8.987, "eta": 119.911, "theta": -65.027, "eta_prime": 104.844, "theta_prime": -62.272, "eta_base": 72.730, "theta_base": -39.999, "v0": -19.159, "v1": 33.070, "v2": -32.901, "v3": 23.082, "v4": -2.794, "amplitude": 33.997, "phase_angle": 165.412, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ 4.356, -8.266, -16.219 ], "x_axis": [ -0.883, 0.453, -0.122 ], "y_axis": [ -0.467, -0.823, 0.324 ], "z_axis": [ 0.046, 0.343, 0.938 ], "quaternion": [ 0.241, -0.020, 0.175, 0.955 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 92, "nt_name": "C", "nt_code": "C", "nt_id": "///B/92", "linked_nts": [ "///B/91", "///B/93" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -68.502, "beta": -171.222, "gamma": 53.460, "delta": 122.831, "epsilon": 57.242, "zeta": -79.873, "epsilon_zeta": -222.885, "bb_type": "--", "chi": -129.432, "glyco_bond": "anti", "C5prime_xyz": [ -1.952, 8.755, -0.756 ], "P_xyz": [ 0.358, 9.701, 0.104 ], "form": "Z", "ssZp": 0.855, "Dp": 1.209, "splay_angle": 41.359, "splay_distance": 5.965, "splay_ratio": 0.360, "d22": null, "d64": null, "eta": 146.635, "theta": 141.029, "eta_prime": -139.025, "theta_prime": 70.483, "eta_base": -126.572, "theta_base": 54.749, "v0": -22.638, "v1": 27.474, "v2": -21.344, "v3": 8.960, "v4": 8.427, "amplitude": 26.740, "phase_angle": 142.957, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.013, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -2.769, -17.841, -6.894 ], "x_axis": [ -0.489, 0.076, -0.869 ], "y_axis": [ 0.872, 0.044, -0.487 ], "z_axis": [ 0.001, -0.996, -0.088 ], "quaternion": [ 0.342, 0.372, 0.636, -0.583 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 93, "nt_name": "G", "nt_code": "G", "nt_id": "///B/93", "linked_nts": [ "///B/92", "///B/94" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": 125.145, "beta": -167.603, "gamma": -177.429, "delta": 87.797, "epsilon": -142.156, "zeta": -47.959, "epsilon_zeta": -94.197, "bb_type": "BI", "chi": 49.612, "glyco_bond": "syn", "C5prime_xyz": [ -5.323, 3.711, 1.217 ], "P_xyz": [ -5.956, 3.099, 3.708 ], "form": ".", "ssZp": -3.082, "Dp": 4.539, "splay_angle": 23.915, "splay_distance": 3.773, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 130.673, "theta": -141.656, "eta_prime": 107.342, "theta_prime": -129.202, "eta_base": 117.047, "theta_base": -134.246, "v0": -3.008, "v1": -19.417, "v2": 31.905, "v3": -35.206, "v4": 24.592, "amplitude": 34.881, "phase_angle": 23.839, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 1.221, -13.641, -8.313 ], "x_axis": [ -0.178, 0.461, -0.869 ], "y_axis": [ 0.970, 0.233, -0.074 ], "z_axis": [ 0.169, -0.856, -0.489 ], "quaternion": [ 0.376, 0.519, 0.689, -0.337 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 94, "nt_name": "U", "nt_code": "U", "nt_id": "///B/94", "linked_nts": [ "///B/93", "///B/95" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -69.737, "beta": 169.656, "gamma": 69.987, "delta": 77.483, "epsilon": -160.421, "zeta": -66.152, "epsilon_zeta": -94.269, "bb_type": "BI", "chi": -146.970, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.749, -0.359 ], "P_xyz": [ 1.085, 9.019, -1.372 ], "form": "A", "ssZp": 4.029, "Dp": 4.669, "splay_angle": 28.644, "splay_distance": 4.570, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 167.821, "theta": -148.889, "eta_prime": -153.618, "theta_prime": -152.678, "eta_base": -131.274, "theta_base": -138.845, "v0": 9.449, "v1": -34.211, "v2": 43.689, "v3": -40.013, "v4": 19.564, "amplitude": 43.994, "phase_angle": 6.751, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.377, "filter_rmsd": 0.104, "frame": { "rmsd": 0.019, "origin": [ -2.010, -12.188, -7.015 ], "x_axis": [ -0.337, -0.701, 0.629 ], "y_axis": [ 0.813, 0.121, 0.569 ], "z_axis": [ -0.475, 0.703, 0.529 ], "quaternion": [ 0.573, -0.058, -0.482, -0.661 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 95, "nt_name": "G", "nt_code": "G", "nt_id": "///B/95", "linked_nts": [ "///B/94", "///B/96" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.565, "beta": 170.780, "gamma": 64.970, "delta": 80.041, "epsilon": -156.880, "zeta": -72.136, "epsilon_zeta": -84.744, "bb_type": "BI", "chi": -169.651, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 8.636, 1.256 ], "P_xyz": [ 0.840, 9.345, 1.286 ], "form": "A", "ssZp": 4.738, "Dp": 4.683, "splay_angle": 22.802, "splay_distance": 3.510, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 175.640, "theta": -149.851, "eta_prime": -170.577, "theta_prime": -149.037, "eta_base": -138.773, "theta_base": -115.059, "v0": 4.715, "v1": -27.952, "v2": 37.910, "v3": -36.929, "v4": 20.831, "amplitude": 38.776, "phase_angle": 12.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.708, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -5.484, -10.121, -4.883 ], "x_axis": [ 0.099, -0.721, 0.686 ], "y_axis": [ 0.937, 0.300, 0.180 ], "z_axis": [ -0.336, 0.624, 0.705 ], "quaternion": [ 0.725, -0.153, -0.352, -0.571 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///B/96", "linked_nts": [ "///B/95", "///B/97" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.993, "beta": 172.814, "gamma": 57.338, "delta": 79.917, "epsilon": -156.028, "zeta": -63.436, "epsilon_zeta": -92.593, "bb_type": "BI", "chi": -166.741, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.615, 0.932 ], "P_xyz": [ 1.269, 8.881, 1.198 ], "form": "A", "ssZp": 4.537, "Dp": 4.687, "splay_angle": 22.384, "splay_distance": 3.576, "splay_ratio": 0.200, "d22": 4.100, "d64": 4.400, "eta": 166.322, "theta": -138.836, "eta_prime": -179.695, "theta_prime": -139.092, "eta_base": -128.374, "theta_base": -109.996, "v0": 8.588, "v1": -31.769, "v2": 40.584, "v3": -37.346, "v4": 18.374, "amplitude": 40.890, "phase_angle": 7.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.103, "frame": { "rmsd": 0.020, "origin": [ -7.626, -9.662, -2.141 ], "x_axis": [ 0.675, -0.391, 0.625 ], "y_axis": [ 0.642, 0.729, -0.237 ], "z_axis": [ -0.363, 0.562, 0.743 ], "quaternion": [ 0.887, -0.225, -0.279, -0.291 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 97, "nt_name": "U", "nt_code": "U", "nt_id": "///B/97", "linked_nts": [ "///B/96", "///B/98" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.182, "beta": 175.158, "gamma": 58.590, "delta": 77.382, "epsilon": -159.796, "zeta": -67.649, "epsilon_zeta": -92.147, "bb_type": "BI", "chi": -163.522, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.711, 0.776 ], "P_xyz": [ 1.080, 9.274, 0.844 ], "form": "A", "ssZp": 4.578, "Dp": 4.688, "splay_angle": 22.754, "splay_distance": 3.592, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 166.919, "theta": -149.843, "eta_prime": -176.557, "theta_prime": -149.076, "eta_base": -127.003, "theta_base": -123.381, "v0": 6.272, "v1": -30.474, "v2": 40.545, "v3": -38.949, "v4": 20.904, "amplitude": 41.234, "phase_angle": 10.491, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.877, "filter_rmsd": 0.100, "frame": { "rmsd": 0.019, "origin": [ -8.607, -9.801, 1.295 ], "x_axis": [ 0.910, 0.121, 0.397 ], "y_axis": [ 0.098, 0.868, -0.487 ], "z_axis": [ -0.403, 0.482, 0.778 ], "quaternion": [ 0.943, -0.257, -0.212, 0.006 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 98, "nt_name": "G", "nt_code": "G", "nt_id": "///B/98", "linked_nts": [ "///B/97", "///B/99" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.101, "beta": 176.614, "gamma": 56.653, "delta": 79.001, "epsilon": -154.918, "zeta": -70.238, "epsilon_zeta": -84.680, "bb_type": "BI", "chi": -164.110, "glyco_bond": "anti", "C5prime_xyz": [ -1.496, 8.694, 0.752 ], "P_xyz": [ 1.068, 9.164, 1.060 ], "form": "A", "ssZp": 4.477, "Dp": 4.711, "splay_angle": 23.919, "splay_distance": 3.763, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 169.136, "theta": -146.978, "eta_prime": -179.040, "theta_prime": -146.342, "eta_base": -138.775, "theta_base": -121.149, "v0": 7.928, "v1": -31.692, "v2": 40.593, "v3": -38.120, "v4": 19.377, "amplitude": 41.006, "phase_angle": 8.143, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ -9.003, -9.661, 4.862 ], "x_axis": [ 0.868, 0.496, -0.039 ], "y_axis": [ -0.428, 0.706, -0.564 ], "z_axis": [ -0.253, 0.506, 0.825 ], "quaternion": [ 0.922, -0.290, -0.058, 0.251 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 99, "nt_name": "U", "nt_code": "U", "nt_id": "///B/99", "linked_nts": [ "///B/98", "///B/100" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.164, "beta": 177.443, "gamma": 52.612, "delta": 76.691, "epsilon": -159.493, "zeta": -64.623, "epsilon_zeta": -94.870, "bb_type": "BI", "chi": -165.352, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 8.639, 0.930 ], "P_xyz": [ 1.151, 9.111, 1.277 ], "form": "A", "ssZp": 4.631, "Dp": 4.704, "splay_angle": 24.223, "splay_distance": 3.854, "splay_ratio": 0.216, "d22": 4.285, "d64": 4.777, "eta": 164.585, "theta": -148.127, "eta_prime": 175.848, "theta_prime": -146.234, "eta_base": -143.265, "theta_base": -123.333, "v0": 7.450, "v1": -31.804, "v2": 41.450, "v3": -39.336, "v4": 20.383, "amplitude": 41.980, "phase_angle": 9.114, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.100, "frame": { "rmsd": 0.019, "origin": [ -8.347, -8.621, 8.418 ], "x_axis": [ 0.522, 0.707, -0.476 ], "y_axis": [ -0.838, 0.323, -0.440 ], "z_axis": [ -0.157, 0.629, 0.762 ], "quaternion": [ 0.807, -0.331, 0.099, 0.479 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 100, "nt_name": "U", "nt_code": "U", "nt_id": "///B/100", "linked_nts": [ "///B/99", "///B/101" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack", "alpha": -69.664, "beta": 175.241, "gamma": 60.627, "delta": 76.371, "epsilon": -159.498, "zeta": -72.376, "epsilon_zeta": -87.122, "bb_type": "BI", "chi": -166.852, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.666, 0.991 ], "P_xyz": [ 0.953, 9.267, 1.162 ], "form": "A", "ssZp": 4.625, "Dp": 4.691, "splay_angle": 23.072, "splay_distance": 3.562, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 171.880, "theta": -155.079, "eta_prime": -174.361, "theta_prime": -153.599, "eta_base": -136.085, "theta_base": -130.651, "v0": 6.134, "v1": -30.737, "v2": 40.999, "v3": -39.608, "v4": 21.475, "amplitude": 41.747, "phase_angle": 10.862, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.790, "filter_rmsd": 0.100, "frame": { "rmsd": 0.019, "origin": [ -6.644, -6.568, 11.199 ], "x_axis": [ 0.040, 0.761, -0.648 ], "y_axis": [ -0.992, -0.047, -0.116 ], "z_axis": [ -0.119, 0.648, 0.753 ], "quaternion": [ 0.661, -0.289, 0.200, 0.663 ] } }, { "index": 27, "index_chain": 27, "chain_name": "B", "nt_resnum": 101, "nt_name": "A", "nt_code": "A", "nt_id": "///B/101", "linked_nts": [ "///B/100", "///B/102" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.038, "beta": 175.677, "gamma": 58.601, "delta": 80.017, "epsilon": -150.950, "zeta": -71.897, "epsilon_zeta": -79.053, "bb_type": "BI", "chi": -162.685, "glyco_bond": "anti", "C5prime_xyz": [ -1.383, 8.604, 0.734 ], "P_xyz": [ 1.211, 8.959, 0.867 ], "form": "A", "ssZp": 4.525, "Dp": 4.738, "splay_angle": 24.771, "splay_distance": 3.915, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 172.853, "theta": -145.077, "eta_prime": -177.747, "theta_prime": -144.313, "eta_base": -143.714, "theta_base": -122.596, "v0": 7.893, "v1": -30.915, "v2": 39.513, "v3": -37.160, "v4": 18.784, "amplitude": 39.903, "phase_angle": 8.021, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.841, "filter_rmsd": 0.041, "frame": { "rmsd": 0.012, "origin": [ -5.235, -4.141, 13.393 ], "x_axis": [ -0.467, 0.608, -0.643 ], "y_axis": [ -0.882, -0.371, 0.290 ], "z_axis": [ -0.062, 0.703, 0.709 ], "quaternion": [ 0.467, -0.221, 0.311, 0.798 ] } }, { "index": 28, "index_chain": 28, "chain_name": "B", "nt_resnum": 102, "nt_name": "U", "nt_code": "U", "nt_id": "///B/102", "linked_nts": [ "///B/101", "///B/103" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.129, "beta": 176.411, "gamma": 54.631, "delta": 75.950, "epsilon": -156.563, "zeta": -71.263, "epsilon_zeta": -85.300, "bb_type": "BI", "chi": -161.757, "glyco_bond": "anti", "C5prime_xyz": [ -1.433, 8.693, 0.718 ], "P_xyz": [ 1.129, 9.211, 0.927 ], "form": "A", "ssZp": 4.558, "Dp": 4.713, "splay_angle": 19.071, "splay_distance": 2.976, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 167.154, "theta": -153.347, "eta_prime": 178.332, "theta_prime": -151.723, "eta_base": -145.592, "theta_base": -129.531, "v0": 6.453, "v1": -30.595, "v2": 40.424, "v3": -39.085, "v4": 20.837, "amplitude": 41.101, "phase_angle": 10.418, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.101, "frame": { "rmsd": 0.019, "origin": [ -4.519, -0.544, 14.764 ], "x_axis": [ -0.834, 0.181, -0.521 ], "y_axis": [ -0.512, -0.603, 0.611 ], "z_axis": [ -0.204, 0.777, 0.596 ], "quaternion": [ 0.199, -0.208, 0.398, 0.871 ] } }, { "index": 29, "index_chain": 29, "chain_name": "B", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///B/103", "linked_nts": [ "///B/102", "///B/104" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -69.872, "beta": 176.966, "gamma": 51.717, "delta": 74.074, "epsilon": -164.161, "zeta": -81.735, "epsilon_zeta": -82.425, "bb_type": "BI", "chi": -154.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.653, 0.280 ], "P_xyz": [ 1.396, 8.992, 0.326 ], "form": ".", "ssZp": 4.389, "Dp": 4.678, "splay_angle": 19.737, "splay_distance": 3.181, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 164.856, "theta": -173.433, "eta_prime": 174.792, "theta_prime": -177.847, "eta_base": -150.551, "theta_base": -157.627, "v0": 9.687, "v1": -31.598, "v2": 39.652, "v3": -36.294, "v4": 16.795, "amplitude": 39.837, "phase_angle": 5.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.792, "filter_rmsd": 0.043, "frame": { "rmsd": 0.012, "origin": [ -4.754, 2.395, 15.172 ], "x_axis": [ -0.945, -0.258, -0.202 ], "y_axis": [ -0.071, -0.441, 0.895 ], "z_axis": [ -0.320, 0.860, 0.398 ], "quaternion": [ -0.056, -0.156, 0.526, 0.834 ] } }, { "index": 30, "index_chain": 30, "chain_name": "B", "nt_resnum": 104, "nt_name": "G", "nt_code": "G", "nt_id": "///B/104", "linked_nts": [ "///B/103", "///B/105" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -70.351, "beta": 173.185, "gamma": 60.425, "delta": 78.265, "epsilon": -146.696, "zeta": -59.462, "epsilon_zeta": -87.234, "bb_type": "BI", "chi": 32.127, "glyco_bond": "syn", "C5prime_xyz": [ -5.901, 4.378, 0.544 ], "P_xyz": [ -6.711, 1.953, 1.027 ], "form": ".", "ssZp": -3.777, "Dp": 4.486, "splay_angle": 34.524, "splay_distance": 5.099, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 171.540, "theta": -131.588, "eta_prime": 167.634, "theta_prime": -121.301, "eta_base": -166.611, "theta_base": -118.693, "v0": -14.819, "v1": -12.552, "v2": 32.271, "v3": -42.635, "v4": 36.774, "amplitude": 41.781, "phase_angle": 39.432, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.681, "filter_rmsd": 0.039, "frame": { "rmsd": 0.039, "origin": [ -4.631, 5.041, 16.934 ], "x_axis": [ 0.295, 0.164, -0.941 ], "y_axis": [ 0.892, 0.305, 0.333 ], "z_axis": [ 0.342, -0.938, -0.056 ], "quaternion": [ 0.621, 0.511, 0.516, -0.293 ] } }, { "index": 31, "index_chain": 31, "chain_name": "B", "nt_resnum": 105, "nt_name": "U", "nt_code": "U", "nt_id": "///B/105", "linked_nts": [ "///B/104", "///B/106" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.351, "beta": 169.826, "gamma": 64.562, "delta": 84.730, "epsilon": -160.133, "zeta": -67.398, "epsilon_zeta": -92.735, "bb_type": "BI", "chi": -172.680, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.454, 1.396 ], "P_xyz": [ 1.381, 8.578, 1.451 ], "form": "A", "ssZp": 4.697, "Dp": 4.658, "splay_angle": 25.327, "splay_distance": 3.791, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 171.438, "theta": -140.534, "eta_prime": -155.607, "theta_prime": -141.389, "eta_base": -131.196, "theta_base": -113.294, "v0": 11.159, "v1": -31.889, "v2": 38.382, "v3": -33.065, "v4": 14.257, "amplitude": 38.407, "phase_angle": 2.072, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.100, "frame": { "rmsd": 0.019, "origin": [ -8.218, 8.663, 16.821 ], "x_axis": [ -0.506, -0.602, 0.617 ], "y_axis": [ 0.759, 0.030, 0.651 ], "z_axis": [ -0.410, 0.798, 0.442 ], "quaternion": [ -0.491, 0.075, 0.523, 0.693 ] } }, { "index": 32, "index_chain": 32, "chain_name": "B", "nt_resnum": 106, "nt_name": "A", "nt_code": "A", "nt_id": "///B/106", "linked_nts": [ "///B/105", "///B/107" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.260, "beta": 175.888, "gamma": 58.922, "delta": 84.407, "epsilon": -154.951, "zeta": -66.086, "epsilon_zeta": -88.864, "bb_type": "BI", "chi": -167.546, "glyco_bond": "anti", "C5prime_xyz": [ -1.287, 8.483, 0.960 ], "P_xyz": [ 1.324, 8.592, 1.353 ], "form": "A", "ssZp": 4.454, "Dp": 4.693, "splay_angle": 24.474, "splay_distance": 3.800, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 172.000, "theta": -136.974, "eta_prime": -171.681, "theta_prime": -137.368, "eta_base": -123.570, "theta_base": -109.094, "v0": 11.113, "v1": -31.481, "v2": 37.818, "v3": -32.993, "v4": 14.152, "amplitude": 37.847, "phase_angle": 2.240, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.845, "filter_rmsd": 0.047, "frame": { "rmsd": 0.025, "origin": [ -11.179, 10.709, 18.012 ], "x_axis": [ 0.049, -0.413, 0.910 ], "y_axis": [ 0.914, 0.386, 0.126 ], "z_axis": [ -0.403, 0.825, 0.396 ], "quaternion": [ 0.676, -0.258, -0.485, -0.490 ] } }, { "index": 33, "index_chain": 33, "chain_name": "B", "nt_resnum": 107, "nt_name": "C", "nt_code": "C", "nt_id": "///B/107", "linked_nts": [ "///B/106", "///B/108" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.214, "beta": -179.136, "gamma": 50.513, "delta": 80.954, "epsilon": -152.826, "zeta": -65.227, "epsilon_zeta": -87.600, "bb_type": "BI", "chi": -164.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.200, 8.660, 0.778 ], "P_xyz": [ 1.353, 8.947, 1.383 ], "form": "A", "ssZp": 4.481, "Dp": 4.709, "splay_angle": 22.481, "splay_distance": 3.610, "splay_ratio": 0.199, "d22": 4.120, "d64": 4.270, "eta": 166.549, "theta": -140.078, "eta_prime": -179.852, "theta_prime": -137.700, "eta_base": -133.637, "theta_base": -109.353, "v0": 8.559, "v1": -30.844, "v2": 39.189, "v3": -36.023, "v4": 17.592, "amplitude": 39.460, "phase_angle": 6.720, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.066, "frame": { "rmsd": 0.011, "origin": [ -13.682, 12.451, 20.281 ], "x_axis": [ 0.670, -0.193, 0.717 ], "y_axis": [ 0.677, 0.555, -0.484 ], "z_axis": [ -0.304, 0.809, 0.503 ], "quaternion": [ 0.826, -0.391, -0.309, -0.264 ] } }, { "index": 34, "index_chain": 34, "chain_name": "B", "nt_resnum": 108, "nt_name": "C", "nt_code": "C", "nt_id": "///B/108", "linked_nts": [ "///B/107", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -70.086, "beta": 178.467, "gamma": 52.404, "delta": 80.016, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -158.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.794, 0.538 ], "P_xyz": [ 1.127, 9.340, 0.779 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.961, "v1": -26.470, "v2": 37.489, "v3": -37.672, "v4": 22.155, "amplitude": 38.768, "phase_angle": 14.759, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.947, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ -14.641, 13.865, 23.460 ], "x_axis": [ 0.966, 0.065, 0.250 ], "y_axis": [ 0.153, 0.635, -0.757 ], "z_axis": [ -0.208, 0.770, 0.603 ], "quaternion": [ 0.895, -0.427, -0.128, -0.025 ] } } ], "num_hbonds": 114, "hbonds": [ { "index": 1, "atom1_serNum": 57, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/5/O", "atom2_id": "///A/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 76, "atom2_serNum": 123, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/6/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 76, "atom2_serNum": 133, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 90, "atom2_serNum": 152, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 95, "atom2_serNum": 1617, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///A/7/NZ", "atom2_id": "///B/89/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 112, "atom2_serNum": 169, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 126, "atom2_serNum": 186, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 136, "atom2_serNum": 205, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 155, "atom2_serNum": 219, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 172, "atom2_serNum": 234, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 189, "atom2_serNum": 253, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 212, "atom2_serNum": 1680, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///A/14/ND2", "atom2_id": "///B/91/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 13, "atom1_serNum": 212, "atom2_serNum": 1746, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/14/ND2", "atom2_id": "///B/93/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 14, "atom1_serNum": 256, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/17/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 261, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/17/NZ", "atom2_id": "///A/43/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 315, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/21/N", "atom2_id": "///A/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 318, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/21/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 323, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/21/NE2", "atom2_id": "///A/41/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 343, "atom2_serNum": 879, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///A/22/OH", "atom2_id": "///A/58/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 343, "atom2_serNum": 944, "donAcc_type": "acceptable", "distance": 3.485, "atom1_id": "///A/22/OH", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 353, "atom2_serNum": 603, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/23/N", "atom2_id": "///A/39/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 356, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/23/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 389, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/25/N", "atom2_id": "///A/37/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 392, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/25/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 413, "atom2_serNum": 531, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///A/26/OG", "atom2_id": "///A/35/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 419, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/27/N", "atom2_id": "///A/35/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 436, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///A/28/N", "atom2_id": "///A/35/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 439, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/28/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 474, "atom2_serNum": 1307, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/31/O", "atom2_id": "///B/79/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 30, "atom1_serNum": 490, "atom2_serNum": 1297, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///A/32/O", "atom2_id": "///B/79/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 31, "atom1_serNum": 517, "atom2_serNum": 786, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///A/34/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 547, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/36/N", "atom2_id": "///A/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 550, "atom2_serNum": 765, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/36/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 583, "atom2_serNum": 750, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/38/N", "atom2_id": "///A/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 586, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/38/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 603, "atom2_serNum": 605, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///A/39/O", "atom2_id": "///A/39/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 611, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/40/N", "atom2_id": "///A/47/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 614, "atom2_serNum": 712, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/40/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 642, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/42/N", "atom2_id": "///A/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 645, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/42/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 658, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/43/N", "atom2_id": "///A/43/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 735, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/48/O", "atom2_id": "///A/64/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 775, "atom2_serNum": 791, "donAcc_type": "acceptable", "distance": 2.543, "atom1_id": "///A/52/O", "atom2_id": "///A/53/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 800, "atom2_serNum": 1352, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/54/N", "atom2_id": "///B/81/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 45, "atom1_serNum": 803, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 808, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/54/NZ", "atom2_id": "///B/82/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 47, "atom1_serNum": 825, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 830, "atom2_serNum": 1861, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/55/NZ", "atom2_id": "///B/97/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 49, "atom1_serNum": 847, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 869, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 879, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 884, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/58/NZ", "atom2_id": "///B/95/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 53, "atom1_serNum": 884, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/58/NZ", "atom2_id": "///B/96/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 54, "atom1_serNum": 901, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 920, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 937, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 947, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 957, "atom2_serNum": 1020, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 957, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/63/O", "atom2_id": "///A/67/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 961, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/63/OE1", "atom2_id": "///A/67/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 972, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 972, "atom2_serNum": 1049, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///A/64/O", "atom2_id": "///A/68/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 994, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 1004, "atom2_serNum": 1075, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 1023, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/67/O", "atom2_id": "///A/71/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 1047, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/68/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 1058, "atom2_serNum": 1108, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/69/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 1058, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 1172, "atom2_serNum": 2225, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/75/O6", "atom2_id": "///B/108/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 1173, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/75/N1", "atom2_id": "///B/108/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 1175, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/75/N2", "atom2_id": "///B/108/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 1207, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/76/O6", "atom2_id": "///B/107/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 1208, "atom2_serNum": 2192, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/76/N1", "atom2_id": "///B/107/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 1210, "atom2_serNum": 2191, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/76/N2", "atom2_id": "///B/107/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 1239, "atom2_serNum": 2162, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/77/N3", "atom2_id": "///B/106/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 1241, "atom2_serNum": 2161, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/77/O4", "atom2_id": "///B/106/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 1264, "atom2_serNum": 1293, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///B/78/O2'", "atom2_id": "///B/79/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 1271, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/78/N6", "atom2_id": "///B/105/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 1272, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/78/N1", "atom2_id": "///B/105/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 1304, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/79/O6", "atom2_id": "///B/104/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 1305, "atom2_serNum": 2097, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///B/79/N1", "atom2_id": "///B/104/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 1336, "atom2_serNum": 2065, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/80/N3", "atom2_id": "///B/103/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 1336, "atom2_serNum": 2097, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/80/N3", "atom2_id": "///B/104/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 1338, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/80/O4", "atom2_id": "///B/103/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 1361, "atom2_serNum": 1390, "donAcc_type": "acceptable", "distance": 3.214, "atom1_id": "///B/81/O2'", "atom2_id": "///B/82/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 1368, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/81/N6", "atom2_id": "///B/102/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 1369, "atom2_serNum": 2032, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/81/N1", "atom2_id": "///B/102/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 1399, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/82/N3", "atom2_id": "///B/101/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 1401, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/82/O4", "atom2_id": "///B/101/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 1431, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/83/N6", "atom2_id": "///B/100/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 1432, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/83/N1", "atom2_id": "///B/100/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 1464, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/84/N6", "atom2_id": "///B/99/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 1465, "atom2_serNum": 1939, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/84/N1", "atom2_id": "///B/99/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 1494, "atom2_serNum": 1910, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/85/O2", "atom2_id": "///B/98/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 1495, "atom2_serNum": 1908, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/85/N3", "atom2_id": "///B/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 1497, "atom2_serNum": 1907, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/85/N4", "atom2_id": "///B/98/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 1528, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/86/N6", "atom2_id": "///B/97/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 1529, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/86/N1", "atom2_id": "///B/97/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 1561, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/87/N6", "atom2_id": "///B/95/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 1561, "atom2_serNum": 1847, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/87/N6", "atom2_id": "///B/96/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 1562, "atom2_serNum": 1845, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/87/N1", "atom2_id": "///B/96/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 1591, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/88/O2", "atom2_id": "///B/95/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 1591, "atom2_serNum": 1816, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/88/O2", "atom2_id": "///B/95/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 1592, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/88/N3", "atom2_id": "///B/95/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 1624, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/89/N6", "atom2_id": "///B/94/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 1625, "atom2_serNum": 1781, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/89/N1", "atom2_id": "///B/94/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 1650, "atom2_serNum": 1749, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///B/90/O2'", "atom2_id": "///B/93/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 1654, "atom2_serNum": 1750, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/90/O2", "atom2_id": "///B/93/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 1654, "atom2_serNum": 1781, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/90/O2", "atom2_id": "///B/94/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 1655, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///B/90/N3", "atom2_id": "///B/94/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 1672, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///B/91/OP2", "atom2_id": "///B/92/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 1680, "atom2_serNum": 1746, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///B/91/O2'", "atom2_id": "///B/93/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 1711, "atom2_serNum": 1734, "donAcc_type": "acceptable", "distance": 2.667, "atom1_id": "///B/92/O2'", "atom2_id": "///B/93/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 2057, "atom2_serNum": 2086, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///B/103/O2'", "atom2_id": "///B/104/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2l3c", "num_aaChains": 1, "aaChains": "A=74", "num_naChains": 1, "naChains": "B=34", "num_atoms": 2238, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 13, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 14, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }