{ "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///G/1", "nt2": "///G/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.311, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.678, "chi2": -142.989, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.010, "C1C1_dist": 10.594, "N1N9_dist": 8.898, "C6C8_dist": 9.789, "CNNC_torsion": -4.438, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[3.05]", "interBase_angle": 19.849, "planarity": 0.281, "simple_Shear": -0.357, "simple_Stretch": 0.011, "simple_Buckle": -19.849, "simple_Propeller": 0.018, "bp_simpleParams": [ -0.357, 0.011, 0.202, -19.849, 0.018, -1.238 ], "bp_params": [ -0.358, 0.000, 0.202, -19.840, -0.595, -1.220 ], "frame": { "rmsd": null, "origin": [ -3.267, 2.518, 28.696 ], "x_axis": [ 0.362, -0.360, -0.860 ], "y_axis": [ -0.522, -0.842, 0.133 ], "z_axis": [ -0.772, 0.401, -0.493 ], "quaternion": [ -0.081, 0.821, -0.269, -0.497 ] } }, { "index": 2, "nt1": "///G/2", "nt2": "///G/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.446, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.423, "chi2": -150.542, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.324, "C1C1_dist": 10.539, "N1N9_dist": 8.854, "C6C8_dist": 9.840, "CNNC_torsion": -16.204, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.05],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 16.365, "planarity": 0.209, "simple_Shear": -0.472, "simple_Stretch": -0.167, "simple_Buckle": -2.323, "simple_Propeller": -16.199, "bp_simpleParams": [ -0.472, -0.167, 0.237, -2.323, -16.199, 2.490 ], "bp_params": [ -0.465, -0.186, 0.237, -1.634, -16.283, 2.515 ], "frame": { "rmsd": null, "origin": [ -4.612, 4.689, 26.809 ], "x_axis": [ 0.042, -0.752, -0.658 ], "y_axis": [ -0.682, -0.503, 0.531 ], "z_axis": [ -0.730, 0.426, -0.534 ], "quaternion": [ 0.036, 0.721, -0.497, -0.481 ] } }, { "index": 3, "nt1": "///G/2", "nt2": "///G/19", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "t.W", "DSSR": "t.+W", "intra_chain": true, "chi1": -163.446, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.908, "chi2": -132.785, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.492, "C1C1_dist": 12.875, "N1N9_dist": 11.741, "C6C8_dist": 13.326, "CNNC_torsion": 147.639, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.99]", "interBase_angle": 46.541, "planarity": 0.512, "simple_Shear": 4.469, "simple_Stretch": 4.923, "simple_Buckle": 28.976, "simple_Propeller": -36.420, "bp_simpleParams": [ 4.469, 4.923, 1.471, 28.976, -36.420, -153.192 ], "bp_params": [ 2.330, -6.227, 1.471, -45.706, -8.779, -151.071 ], "frame": { "rmsd": null, "origin": [ -4.611, 7.773, 28.769 ], "x_axis": [ -0.613, -0.681, 0.401 ], "y_axis": [ -0.382, 0.700, 0.604 ], "z_axis": [ -0.692, 0.217, -0.689 ], "quaternion": [ -0.316, -0.307, 0.866, 0.237 ] } }, { "index": 4, "nt1": "///G/3", "nt2": "///G/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.778, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.613, "chi2": -161.441, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.056, "C1C1_dist": 10.424, "N1N9_dist": 8.826, "C6C8_dist": 9.842, "CNNC_torsion": -22.517, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 28.794, "planarity": 0.340, "simple_Shear": -0.285, "simple_Stretch": -0.152, "simple_Buckle": -9.812, "simple_Propeller": -27.071, "bp_simpleParams": [ -0.285, -0.152, 0.121, -9.812, -27.071, 3.458 ], "bp_params": [ -0.282, -0.156, 0.121, -9.266, -27.263, 3.547 ], "frame": { "rmsd": null, "origin": [ -5.966, 5.518, 23.154 ], "x_axis": [ -0.230, -0.950, -0.210 ], "y_axis": [ -0.666, -0.003, 0.746 ], "z_axis": [ -0.709, 0.311, -0.633 ], "quaternion": [ -0.183, -0.593, 0.682, 0.387 ] } }, { "index": 5, "nt1": "///G/3", "nt2": "///G/20", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -169.778, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.331, "chi2": -121.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.877, "C1C1_dist": 8.191, "N1N9_dist": 7.833, "C6C8_dist": 9.976, "CNNC_torsion": 157.720, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.68],N2(amino)-N3[3.01]", "interBase_angle": 40.538, "planarity": 0.454, "simple_Shear": 6.952, "simple_Stretch": 3.413, "simple_Buckle": 35.620, "simple_Propeller": -19.354, "bp_simpleParams": [ 6.952, 3.413, 1.426, 35.620, -19.354, -154.740 ], "bp_params": [ -2.616, -7.290, 1.426, -38.934, -11.290, -153.374 ], "frame": { "rmsd": null, "origin": [ -6.101, 8.675, 25.627 ], "x_axis": [ -0.603, -0.243, 0.760 ], "y_axis": [ 0.012, 0.950, 0.313 ], "z_axis": [ -0.798, 0.197, -0.570 ], "quaternion": [ -0.441, -0.065, 0.883, 0.144 ] } }, { "index": 6, "nt1": "///G/4", "nt2": "///G/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.786, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.563, "chi2": -166.489, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.219, "C1C1_dist": 11.231, "N1N9_dist": 9.330, "C6C8_dist": 10.009, "CNNC_torsion": -16.935, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.30],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 28.996, "planarity": 0.368, "simple_Shear": -0.077, "simple_Stretch": 0.216, "simple_Buckle": -16.660, "simple_Propeller": -23.732, "bp_simpleParams": [ -0.077, 0.216, -0.205, -16.660, -23.732, -10.294 ], "bp_params": [ -0.076, 0.216, -0.205, -16.672, -23.724, -10.411 ], "frame": { "rmsd": null, "origin": [ -6.848, 6.878, 19.728 ], "x_axis": [ -0.549, -0.758, 0.352 ], "y_axis": [ -0.418, 0.614, 0.669 ], "z_axis": [ -0.724, 0.220, -0.654 ], "quaternion": [ -0.321, -0.350, 0.839, 0.265 ] } }, { "index": 7, "nt1": "///G/8", "nt2": "///G/9", "bp": "U+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -106.607, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 141.333, "chi2": -164.841, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.589, "C1C1_dist": 7.120, "N1N9_dist": 7.129, "C6C8_dist": 7.144, "CNNC_torsion": -8.878, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)*O4(carbonyl)[3.02]", "interBase_angle": 7.036, "planarity": 0.261, "simple_Shear": -0.001, "simple_Stretch": 7.076, "simple_Buckle": 7.032, "simple_Propeller": 0.239, "bp_simpleParams": [ -0.001, 7.076, 1.317, 7.032, 0.239, 0.776 ], "bp_params": [ 7.065, 0.398, 1.317, 0.633, -7.008, 0.777 ], "frame": { "rmsd": null, "origin": [ -15.303, 6.866, 12.222 ], "x_axis": [ 0.275, 0.961, 0.018 ], "y_axis": [ -0.479, 0.121, 0.869 ], "z_axis": [ 0.833, -0.248, 0.494 ], "quaternion": [ 0.687, 0.406, 0.297, 0.524 ] } }, { "index": 8, "nt1": "///G/9", "nt2": "///G/25", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.841, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.433, "chi2": -179.031, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.486, "C1C1_dist": 10.503, "N1N9_dist": 8.849, "C6C8_dist": 9.824, "CNNC_torsion": 1.571, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 5.337, "planarity": 0.059, "simple_Shear": -0.031, "simple_Stretch": -0.126, "simple_Buckle": 5.324, "simple_Propeller": 0.375, "bp_simpleParams": [ -0.031, -0.126, -0.131, 5.324, 0.375, 0.589 ], "bp_params": [ -0.030, -0.126, -0.131, 5.321, 0.415, 0.588 ], "frame": { "rmsd": null, "origin": [ -16.705, 3.621, 11.748 ], "x_axis": [ 0.233, 0.972, -0.021 ], "y_axis": [ -0.520, 0.142, 0.842 ], "z_axis": [ 0.822, -0.185, 0.539 ], "quaternion": [ 0.692, 0.371, 0.305, 0.539 ] } }, { "index": 9, "nt1": "///G/10", "nt2": "///G/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.959, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.898, "chi2": -159.517, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.956, "C1C1_dist": 10.597, "N1N9_dist": 8.926, "C6C8_dist": 9.917, "CNNC_torsion": -9.025, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 9.720, "planarity": 0.128, "simple_Shear": 0.237, "simple_Stretch": -0.080, "simple_Buckle": 8.406, "simple_Propeller": -4.880, "bp_simpleParams": [ 0.237, -0.080, 0.429, 8.406, -4.880, 2.107 ], "bp_params": [ 0.235, -0.087, 0.429, 8.275, -5.099, 2.104 ], "frame": { "rmsd": null, "origin": [ -13.152, 2.418, 11.847 ], "x_axis": [ -0.134, 0.928, 0.348 ], "y_axis": [ -0.604, -0.355, 0.713 ], "z_axis": [ 0.786, -0.115, 0.608 ], "quaternion": [ 0.529, 0.392, 0.207, 0.724 ] } }, { "index": 10, "nt1": "///G/11", "nt2": "///G/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.667, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.790, "chi2": -158.402, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.217, "C1C1_dist": 10.405, "N1N9_dist": 8.841, "C6C8_dist": 9.892, "CNNC_torsion": -4.245, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.15]", "interBase_angle": 14.932, "planarity": 0.164, "simple_Shear": 0.493, "simple_Stretch": -0.058, "simple_Buckle": 13.177, "simple_Propeller": -7.025, "bp_simpleParams": [ 0.493, -0.058, -0.279, 13.177, -7.025, 5.815 ], "bp_params": [ 0.490, -0.078, -0.279, 12.889, -7.539, 5.791 ], "frame": { "rmsd": null, "origin": [ -10.224, 3.276, 13.223 ], "x_axis": [ -0.503, 0.620, 0.603 ], "y_axis": [ -0.367, -0.784, 0.501 ], "z_axis": [ 0.783, 0.031, 0.621 ], "quaternion": [ 0.289, 0.406, 0.156, 0.853 ] } }, { "index": 11, "nt1": "///G/12", "nt2": "///G/21", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW-.", "intra_chain": true, "chi1": -159.776, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.596, "chi2": -85.244, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 95.771, "C1C1_dist": 11.283, "N1N9_dist": 10.337, "C6C8_dist": 11.640, "CNNC_torsion": 6.861, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N2(amino)[3.02]", "interBase_angle": 27.210, "planarity": 0.350, "simple_Shear": -4.270, "simple_Stretch": 3.120, "simple_Buckle": 26.015, "simple_Propeller": -7.975, "bp_simpleParams": [ -4.270, 3.120, 0.034, 26.015, -7.975, 24.722 ], "bp_params": [ -5.218, 0.863, 0.034, 26.799, 4.711, 24.089 ], "frame": { "rmsd": null, "origin": [ -10.391, 6.117, 18.492 ], "x_axis": [ -0.563, 0.088, 0.822 ], "y_axis": [ -0.094, -0.995, 0.042 ], "z_axis": [ 0.821, -0.053, 0.568 ], "quaternion": [ 0.051, 0.465, -0.003, 0.884 ] } }, { "index": 12, "nt1": "///G/12", "nt2": "///G/22", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.776, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 77.105, "chi2": -166.500, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.791, "C1C1_dist": 8.927, "N1N9_dist": 7.538, "C6C8_dist": 8.750, "CNNC_torsion": -14.618, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[3.19],N3(imino)-O4(carbonyl)[2.95]", "interBase_angle": 19.185, "planarity": 0.229, "simple_Shear": 3.099, "simple_Stretch": -0.782, "simple_Buckle": 16.015, "simple_Propeller": -10.563, "bp_simpleParams": [ 3.099, -0.782, -0.128, 16.015, -10.563, 8.952 ], "bp_params": [ 2.718, -1.681, -0.128, 12.103, -14.886, 8.978 ], "frame": { "rmsd": null, "origin": [ -7.903, 4.707, 15.427 ], "x_axis": [ -0.678, -0.061, 0.733 ], "y_axis": [ 0.093, -0.996, 0.004 ], "z_axis": [ 0.729, 0.071, 0.681 ], "quaternion": [ -0.042, 0.399, 0.020, 0.916 ] } }, { "index": 13, "nt1": "///G/15", "nt2": "///G/20", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -150.542, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 118.624, "chi2": -121.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 101.120, "C1C1_dist": 3.857, "N1N9_dist": 5.353, "C6C8_dist": 7.519, "CNNC_torsion": 92.771, "hbonds_num": 1, "hbonds_desc": "O4'*O4'[3.03]", "interBase_angle": 28.490, "planarity": 0.597, "simple_Shear": 0.031, "simple_Stretch": 7.507, "simple_Buckle": -24.521, "simple_Propeller": 14.506, "bp_simpleParams": [ 0.031, 7.507, 1.099, -24.521, 14.506, -174.117 ], "bp_params": [ -1.828, -7.282, 1.099, 20.424, -19.863, -174.109 ], "frame": { "rmsd": null, "origin": [ -5.428, 8.048, 27.467 ], "x_axis": [ 0.567, 0.509, -0.648 ], "y_axis": [ -0.257, 0.856, 0.448 ], "z_axis": [ 0.783, -0.087, 0.616 ], "quaternion": [ 0.872, 0.153, 0.410, 0.220 ] } }, { "index": 14, "nt1": "///G/21", "nt2": "///G/22", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -85.244, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 148.005, "chi2": -166.500, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.106, "C1C1_dist": 6.572, "N1N9_dist": 6.900, "C6C8_dist": 6.888, "CNNC_torsion": 12.629, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.92],N2(amino)-O4(carbonyl)[3.22]", "interBase_angle": 21.606, "planarity": 0.231, "simple_Shear": 0.254, "simple_Stretch": 8.380, "simple_Buckle": -20.341, "simple_Propeller": -7.284, "bp_simpleParams": [ 0.254, 8.380, 0.081, -20.341, -7.284, 18.629 ], "bp_params": [ 8.246, 1.515, 0.081, -11.347, 18.386, 18.778 ], "frame": { "rmsd": null, "origin": [ -9.345, 5.367, 17.543 ], "x_axis": [ -0.639, 0.162, 0.752 ], "y_axis": [ 0.232, 0.973, -0.012 ], "z_axis": [ -0.733, 0.167, -0.659 ], "quaternion": [ -0.411, 0.109, 0.904, 0.043 ] } } ], "num_multiplets": 4, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GCA", "nts_long": "///G/2,///G/15,///G/20", "planarity": 0.762 }, { "index": 2, "num_nts": 3, "nts_short": "GCA", "nts_long": "///G/3,///G/14,///G/20", "planarity": 0.432 }, { "index": 3, "num_nts": 3, "nts_short": "UUA", "nts_long": "///G/8,///G/9,///G/25", "planarity": 0.295 }, { "index": 4, "num_nts": 3, "nts_short": "UGU", "nts_long": "///G/12,///G/21,///G/22", "planarity": 0.344 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "AGGUUGCA", "strand2": "UCCAUCGU", "bp_type": "||||.|||", "helix_form": "AAAx.AA", "helical_rise": 3.056, "helical_rise_std": 0.455, "helical_radius": 9.273, "helical_radius_std": 2.224, "helical_axis": [ -0.806, 0.184, -0.562 ], "point1": [ 0.287, 1.202, 25.315 ], "point2": [ -17.073, 5.155, 13.206 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///G/1", "nt2": "///G/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.358, 0.000, 0.202, -19.840, -0.595, -1.220 ], "step_params": [ -0.074, -1.339, 2.878, 3.347, 1.518, 31.602 ], "heli_params": [ -2.683, 0.666, 2.790, 2.775, -6.121, 31.810 ], "bp2_params": [ -0.465, -0.186, 0.237, -1.634, -16.283, 2.515 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.878, "simple_Twist": 32.316, "simple_hRise": 2.793, "simple_hTwist": 32.519 }, { "index": 2, "nt1": "///G/2", "nt2": "///G/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.465, -0.186, 0.237, -1.634, -16.283, 2.515 ], "step_params": [ 1.026, -1.765, 3.422, 2.837, 8.298, 31.497 ], "heli_params": [ -4.566, -1.336, 2.953, 14.928, -5.103, 32.666 ], "bp2_params": [ -0.282, -0.156, 0.121, -9.266, -27.263, 3.547 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 30.319, "simple_hRise": 2.930, "simple_hTwist": 31.533 }, { "index": 3, "nt1": "///G/3", "nt2": "///G/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.282, -0.156, 0.121, -9.266, -27.263, 3.547 ], "step_params": [ -1.150, -1.672, 3.200, 2.143, 4.964, 39.127 ], "heli_params": [ -3.024, 1.939, 2.911, 7.369, -3.182, 39.485 ], "bp2_params": [ -0.076, 0.216, -0.205, -16.672, -23.724, -10.411 ], "groove_widths": [ 16.595, null, 14.066, null ], "simple_Rise": 3.200, "simple_Twist": 37.346, "simple_hRise": 2.894, "simple_hTwist": 37.721 }, { "index": 4, "nt1": "///G/4", "nt2": "///G/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, 0.216, -0.205, -16.672, -23.724, -10.411 ], "step_params": [ -1.066, -3.295, 3.513, 15.334, 6.865, 47.417 ], "heli_params": [ -4.365, 2.324, 2.601, 8.240, -18.406, 50.143 ], "bp2_params": [ -2.718, -1.681, -0.128, -12.103, -14.886, 8.978 ], "groove_widths": [ 15.744, 12.717, 14.297, 13.221 ], "simple_Rise": 3.513, "simple_Twist": 65.034, "simple_hRise": 2.906, "simple_hTwist": 66.938 }, { "index": 5, "nt1": "///G/22", "nt2": "///G/12", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.718, -1.681, -0.128, -12.103, -14.886, 8.978 ], "step_params": [ -0.528, -1.162, 3.265, -0.829, 5.055, 41.581 ], "heli_params": [ -2.143, 0.654, 3.119, 7.087, 1.163, 41.881 ], "bp2_params": [ -0.490, -0.078, -0.279, -12.889, -7.539, 5.791 ], "groove_widths": [ 16.021, null, 13.997, null ], "simple_Rise": 3.265, "simple_Twist": 27.003, "simple_hRise": 3.016, "simple_hTwist": 27.475 }, { "index": 6, "nt1": "///G/23", "nt2": "///G/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.490, -0.078, -0.279, -12.889, -7.539, 5.791 ], "step_params": [ -0.371, -1.169, 3.115, -4.386, 7.163, 30.774 ], "heli_params": [ -3.331, -0.061, 2.803, 13.192, 8.078, 31.873 ], "bp2_params": [ -0.235, -0.087, 0.429, -8.275, -5.099, 2.104 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.115, "simple_Twist": 29.530, "simple_hRise": 2.786, "simple_hTwist": 30.676 }, { "index": 7, "nt1": "///G/24", "nt2": "///G/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, -0.087, 0.429, -8.275, -5.099, 2.104 ], "step_params": [ 0.957, -1.890, 3.097, 3.972, 4.521, 29.941 ], "heli_params": [ -4.419, -1.089, 2.888, 8.641, -7.591, 30.527 ], "bp2_params": [ 0.030, -0.126, -0.131, -5.321, 0.415, 0.588 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.097, "simple_Twist": 28.493, "simple_hRise": 2.874, "simple_hTwist": 29.108 }, { "index": 8, "nt1": "///G/25", "nt2": "///G/9", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AGGU", "strand2": "UCCA", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.888, "helical_rise_std": 0.394, "helical_radius": 9.249, "helical_radius_std": 0.951, "helical_axis": [ -0.825, 0.240, -0.511 ], "point1": [ -0.747, 1.030, 25.966 ], "point2": [ -7.884, 3.107, 21.549 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///G/1", "nt2": "///G/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.358, 0.000, 0.202, -19.840, -0.595, -1.220 ], "step_params": [ -0.074, -1.339, 2.878, 3.347, 1.518, 31.602 ], "heli_params": [ -2.683, 0.666, 2.790, 2.775, -6.121, 31.810 ], "bp2_params": [ -0.465, -0.186, 0.237, -1.634, -16.283, 2.515 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.878, "simple_Twist": 32.316, "simple_hRise": 2.793, "simple_hTwist": 32.519 }, { "index": 2, "nt1": "///G/2", "nt2": "///G/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.465, -0.186, 0.237, -1.634, -16.283, 2.515 ], "step_params": [ 1.026, -1.765, 3.422, 2.837, 8.298, 31.497 ], "heli_params": [ -4.566, -1.336, 2.953, 14.928, -5.103, 32.666 ], "bp2_params": [ -0.282, -0.156, 0.121, -9.266, -27.263, 3.547 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 30.319, "simple_hRise": 2.930, "simple_hTwist": 31.533 }, { "index": 3, "nt1": "///G/3", "nt2": "///G/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.282, -0.156, 0.121, -9.266, -27.263, 3.547 ], "step_params": [ -1.150, -1.672, 3.200, 2.143, 4.964, 39.127 ], "heli_params": [ -3.024, 1.939, 2.911, 7.369, -3.182, 39.485 ], "bp2_params": [ -0.076, 0.216, -0.205, -16.672, -23.724, -10.411 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.200, "simple_Twist": 37.346, "simple_hRise": 2.894, "simple_hTwist": 37.721 }, { "index": 4, "nt1": "///G/4", "nt2": "///G/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "UGC", "strand2": "ACG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.746, "helical_rise_std": 0.104, "helical_radius": 9.117, "helical_radius_std": 0.371, "helical_axis": [ 0.639, -0.237, 0.732 ], "point1": [ -14.656, 6.737, 11.618 ], "point2": [ -11.144, 5.436, 15.637 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///G/9", "nt2": "///G/25", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.030, -0.126, -0.131, 5.321, 0.415, 0.588 ], "step_params": [ -0.957, -1.890, 3.097, -3.972, 4.521, 29.941 ], "heli_params": [ -4.419, 1.089, 2.888, 8.641, 7.591, 30.527 ], "bp2_params": [ 0.235, -0.087, 0.429, 8.275, -5.099, 2.104 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.097, "simple_Twist": 28.493, "simple_hRise": 2.874, "simple_hTwist": 29.108 }, { "index": 2, "nt1": "///G/10", "nt2": "///G/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.087, 0.429, 8.275, -5.099, 2.104 ], "step_params": [ 0.371, -1.169, 3.115, 4.386, 7.163, 30.774 ], "heli_params": [ -3.331, 0.061, 2.803, 13.192, -8.078, 31.873 ], "bp2_params": [ 0.490, -0.078, -0.279, 12.889, -7.539, 5.791 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.115, "simple_Twist": 29.530, "simple_hRise": 2.786, "simple_hTwist": 30.676 }, { "index": 3, "nt1": "///G/11", "nt2": "///G/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 7, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "NC", "nts_long": "///A/60,///G/0" }, { "index": 2, "num_nts": 2, "nts_short": "CU", "nts_long": "///G/11,///G/12" }, { "index": 3, "num_nts": 3, "nts_short": "AUG", "nts_long": "///G/13,///G/22,///G/23" }, { "index": 4, "num_nts": 3, "nts_short": "UAA", "nts_long": "///G/18,///G/19,///G/20" }, { "index": 5, "num_nts": 4, "nts_short": "NAUF", "nts_long": "///A/23,c. G & i. \\-3,c. G & i. \\-2,///A/88" }, { "index": 6, "num_nts": 4, "nts_short": "AGCU", "nts_long": "///G/25,///G/26,///G/27,///G/28" }, { "index": 7, "num_nts": 5, "nts_short": "UGGUU", "nts_long": "///G/4,///G/21,///G/5,///G/8,///G/7" } ], "nonStack": { "num_nts": 8, "nts_short": "UAUUAGAa", "nts_long": "c. G & i. \\-1,///G/6,///G/9,///G/17,///G/29,///G/30,///G/31,///G/32" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///G/4/O4'", "nt": "///G/20", "vert_dist": 2.872 }, { "index": 2, "type": "sugar", "atom": "///G/4/O2'", "nt": "///G/20", "vert_dist": 3.126 }, { "index": 3, "type": "sugar", "atom": "///G/29/O4'", "nt": "///G/30", "vert_dist": 2.856 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 8 ], "stem_indices": [ 1 ], "summary": "[1] 8 [G.4 G.13] 4", "num_nts": 10, "nts_short": "UGAUUUGCUA", "nts_long": "///G/4,///G/5,///G/6,///G/7,///G/8,///G/9,///G/10,///G/11,///G/12,///G/13", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 8, "nts_short": "GAUUUGCU", "nts_long": "///G/5,///G/6,///G/7,///G/8,///G/9,///G/10,///G/11,///G/12" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 2 ], "summary": "[1] 11 [G.11 G.23] 3", "num_nts": 13, "nts_short": "CUACCUUUAAGUG", "nts_long": "///G/11,///G/12,///G/13,///G/14,///G/15,///G/16,///G/17,///G/18,///G/19,///G/20,///G/21,///G/22,///G/23", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "UACCUUUAAGU", "nts_long": "///G/12,///G/13,///G/14,///G/15,///G/16,///G/17,///G/18,///G/19,///G/20,///G/21,///G/22" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 4, "nts_short": "AUUC", "nts_long": "c. G & i. \\-3,c. G & i. \\-2,c. G & i. \\-1,///G/0" }, { "index": 2, "num_nts": 7, "nts_short": "GCUAGAa", "nts_long": "///G/26,///G/27,///G/28,///G/29,///G/30,///G/31,///G/32" } ], "num_Aminors": 2, "Aminors": [ { "index": 1, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///G/19 vs ///G/2,///G/15", "A_nt1": { "desc": "///G/19 vs ///G/2", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///G/19 vs ///G/15", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-O2'(hydroxyl)[2.62]" } }, { "index": 2, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///G/20 vs ///G/3,///G/14", "A_nt1": { "desc": "///G/20 vs ///G/3", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.68],N3-N2(amino)[3.01]" }, "A_nt2": { "desc": "///G/20 vs ///G/14", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.75],O2'(hydroxyl)-O2(carbonyl)[2.92]" } } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "CCAA", "nts_long": "///G/14,///G/15,///G/19,///G/20" } ], "num_splayUnits": 3, "splayUnits": [ { "index": 1, "num_nts": 4, "nts_short": "UUCA", "nts_long": "c. G & i. \\-2,c. G & i. \\-1,///G/0,///G/1" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///G/5,///G/6" }, { "index": 3, "num_nts": 3, "nts_short": "UUU", "nts_long": "///G/16,///G/17,///G/18" } ], "num_HtypePknots": 3, "HtypePknots": [ { "index": 1, "desc": "stem#1(hairpin#1) vs stem#2(hairpin#2) L1 groove=MAJOR nts=4 GAUU ///G/5,///G/6,///G/7,///G/8" }, { "index": 2, "desc": "stem#1(hairpin#1) vs stem#2(hairpin#2) L2 groove=----- nts=1 U ///G/12" }, { "index": 3, "desc": "stem#1(hairpin#1) vs stem#2(hairpin#2) L3 groove=minor nts=6 UUAAGU ///G/17,///G/18,///G/19,///G/20,///G/21,///G/22" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 6, "nts_short": "UGCGCA", "nts_long": "///G/9,///G/10,///G/11,///G/23,///G/24,///G/25" } ], "dbn": { "all_chains": { "num_nts": 36, "num_chars": 36, "bseq": "AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAa", "bseqUP": "AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAA", "sstr": "....((((....[[[.))))......]]].......", "form": "....AAA.....AAAAAAA......AA....AZ..-" }, "chain_G": { "num_nts": 36, "num_chars": 36, "bseq": "AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAa", "bseqUP": "AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAA", "sstr": "....((((....[[[.))))......]]].......", "form": "....AAA.....AAAAAAA......AA....AZ..-" } }, "chains": { "chain_G": { "num_nts": 36, "bseq": "AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAa", "sstr": "....((((....[[[.))))......]]].......", "form": "....AAA.....AAAAAAA......AA....AZ..-", "helical_rise": 1.053, "helical_rise_std": 2.856, "helical_axis": [ 0.340, 0.294, -0.893 ], "point1": [ -13.998, 2.423, 39.521 ], "point2": [ -1.315, 13.403, 6.212 ], "num_chars": 106, "suite": "A1aU9aU!!C!!A1aG1aG1aU1bG!!A2aU!!U4gU1aG1aC1aU1aA1aC1aC1aU!!U!!U0iA1aA7rG#aU1aG1aC1cA1aG1aC1aU1bA!!G2[A!!a" } }, "num_nts": 36, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "G", "nt_resnum": -3, "nt_name": "A", "nt_code": "A", "nt_id": "c. G & i. \\-3", "linked_nts": [ null, "c. G & i. \\-2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 40.745, "delta": 82.238, "epsilon": -141.067, "zeta": -57.103, "epsilon_zeta": -83.965, "bb_type": "BI", "chi": -176.614, "glyco_bond": "anti", "C5prime_xyz": [ -1.864, 8.519, 1.481 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.518, "Dp": 4.560, "splay_angle": 30.117, "splay_distance": 4.701, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.578, "v1": -21.967, "v2": 33.620, "v3": -34.306, "v4": 21.359, "amplitude": 35.300, "phase_angle": 17.750, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ -2.664, -17.696, 40.500 ], "x_axis": [ 0.972, 0.193, 0.133 ], "y_axis": [ 0.214, -0.492, -0.844 ], "z_axis": [ -0.098, 0.849, -0.519 ], "quaternion": [ -0.490, 0.864, 0.118, 0.010 ] } }, { "index": 2, "index_chain": 2, "chain_name": "G", "nt_resnum": -2, "nt_name": "U", "nt_code": "U", "nt_id": "c. G & i. \\-2", "linked_nts": [ "c. G & i. \\-3", "c. G & i. \\-1" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -69.926, "beta": 177.056, "gamma": 50.446, "delta": 81.851, "epsilon": -167.354, "zeta": 145.229, "epsilon_zeta": 47.417, "bb_type": "--", "chi": -156.294, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.746, 0.360 ], "P_xyz": [ 1.193, 9.128, 0.797 ], "form": ".", "ssZp": 4.225, "Dp": 4.401, "splay_angle": 97.706, "splay_distance": 12.577, "splay_ratio": 0.755, "d22": 9.952, "d64": 10.820, "eta": 157.827, "theta": 56.054, "eta_prime": -174.087, "theta_prime": 55.560, "eta_base": -93.715, "theta_base": 66.981, "v0": 3.074, "v1": -25.225, "v2": 36.530, "v3": -35.726, "v4": 20.549, "amplitude": 37.644, "phase_angle": 13.974, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 0.488, -14.833, 38.509 ], "x_axis": [ 0.655, -0.349, -0.670 ], "y_axis": [ -0.754, -0.351, -0.555 ], "z_axis": [ -0.041, 0.869, -0.494 ], "quaternion": [ -0.450, 0.791, -0.349, -0.225 ] } }, { "index": 3, "index_chain": 3, "chain_name": "G", "nt_resnum": -1, "nt_name": "U", "nt_code": "U", "nt_id": "c. G & i. \\-1", "linked_nts": [ "c. G & i. \\-2", "///G/0" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,ss-non-loop,phosphate,splayed-apart", "alpha": -77.786, "beta": 142.651, "gamma": 41.823, "delta": 79.754, "epsilon": -136.766, "zeta": 129.719, "epsilon_zeta": 93.515, "bb_type": "--", "chi": -78.283, "glyco_bond": "--", "C5prime_xyz": [ -2.887, 6.783, -3.262 ], "P_xyz": [ -1.159, 5.812, -4.901 ], "form": ".", "ssZp": -1.036, "Dp": 4.652, "splay_angle": 140.794, "splay_distance": 18.339, "splay_ratio": 0.942, "d22": 9.516, "d64": 12.188, "eta": 157.611, "theta": 94.883, "eta_prime": 175.433, "theta_prime": 119.727, "eta_base": -177.644, "theta_base": 156.346, "v0": 0.848, "v1": -23.891, "v2": 36.573, "v3": -37.075, "v4": 22.914, "amplitude": 38.324, "phase_angle": 17.389, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "9a", "suiteness": 0.495, "filter_rmsd": 0.101, "frame": { "rmsd": 0.004, "origin": [ -11.601, -18.172, 37.565 ], "x_axis": [ -0.349, 0.488, 0.800 ], "y_axis": [ -0.108, 0.827, -0.552 ], "z_axis": [ -0.931, -0.279, -0.236 ], "quaternion": [ 0.557, -0.123, -0.777, 0.267 ] } }, { "index": 4, "index_chain": 4, "chain_name": "G", "nt_resnum": 0, "nt_name": "C", "nt_code": "C", "nt_id": "///G/0", "linked_nts": [ "c. G & i. \\-1", "///G/1" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,ss-non-loop,splayed-apart", "alpha": 44.069, "beta": 139.935, "gamma": 3.402, "delta": 151.877, "epsilon": -102.369, "zeta": -114.997, "epsilon_zeta": 12.628, "bb_type": "--", "chi": -110.636, "glyco_bond": "anti", "C5prime_xyz": [ -1.887, 8.326, -1.611 ], "P_xyz": [ 0.177, 9.431, -0.391 ], "form": ".", "ssZp": 0.739, "Dp": 0.793, "splay_angle": 112.777, "splay_distance": 16.193, "splay_ratio": 0.833, "d22": null, "d64": null, "eta": -107.482, "theta": -49.585, "eta_prime": -119.325, "theta_prime": -108.280, "eta_base": -167.690, "theta_base": -158.682, "v0": -19.656, "v1": 35.866, "v2": -37.240, "v3": 27.036, "v4": -4.818, "amplitude": 38.025, "phase_angle": 168.332, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -15.742, -6.660, 23.903 ], "x_axis": [ -0.807, -0.539, 0.243 ], "y_axis": [ 0.472, -0.340, 0.813 ], "z_axis": [ -0.355, 0.771, 0.529 ], "quaternion": [ -0.309, -0.034, 0.484, 0.818 ] } }, { "index": 5, "index_chain": 5, "chain_name": "G", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1", "linked_nts": [ "///G/0", "///G/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": 55.102, "beta": 140.599, "gamma": 103.620, "delta": 82.694, "epsilon": -130.051, "zeta": -82.326, "epsilon_zeta": -47.726, "bb_type": "BI", "chi": 176.311, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.241, 1.903 ], "P_xyz": [ 0.813, 9.180, 0.904 ], "form": "A", "ssZp": 4.678, "Dp": 4.711, "splay_angle": 20.627, "splay_distance": 3.286, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -60.134, "theta": -148.176, "eta_prime": -1.116, "theta_prime": -153.404, "eta_base": 57.233, "theta_base": -134.022, "v0": 5.837, "v1": -27.581, "v2": 37.693, "v3": -35.320, "v4": 18.617, "amplitude": 38.278, "phase_angle": 10.031, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ -3.410, 2.623, 28.800 ], "x_axis": [ 0.362, -0.349, -0.864 ], "y_axis": [ -0.377, -0.903, 0.206 ], "z_axis": [ -0.852, 0.251, -0.458 ], "quaternion": [ -0.014, 0.825, -0.220, -0.520 ] } }, { "index": 6, "index_chain": 6, "chain_name": "G", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///G/2", "linked_nts": [ "///G/1", "///G/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -67.427, "beta": 159.491, "gamma": 62.984, "delta": 76.676, "epsilon": -147.849, "zeta": -61.957, "epsilon_zeta": -85.893, "bb_type": "BI", "chi": -163.446, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.744, 0.677 ], "P_xyz": [ 1.223, 9.220, 0.102 ], "form": "A", "ssZp": 4.562, "Dp": 4.738, "splay_angle": 24.260, "splay_distance": 4.037, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 161.229, "theta": -136.493, "eta_prime": 176.614, "theta_prime": -137.737, "eta_base": -143.897, "theta_base": -112.414, "v0": 3.564, "v1": -28.695, "v2": 41.384, "v3": -40.350, "v4": 23.307, "amplitude": 42.623, "phase_angle": 13.849, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -4.644, 4.961, 26.849 ], "x_axis": [ -0.077, -0.696, -0.714 ], "y_axis": [ -0.670, -0.494, 0.554 ], "z_axis": [ -0.738, 0.521, -0.428 ], "quaternion": [ 0.012, 0.679, -0.503, -0.535 ] } }, { "index": 7, "index_chain": 7, "chain_name": "G", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///G/3", "linked_nts": [ "///G/2", "///G/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -64.153, "beta": 162.116, "gamma": 68.482, "delta": 77.866, "epsilon": -163.129, "zeta": -71.365, "epsilon_zeta": -91.764, "bb_type": "BI", "chi": -169.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.890, 8.772, 1.036 ], "P_xyz": [ 0.537, 9.750, 0.747 ], "form": "A", "ssZp": 4.601, "Dp": 4.590, "splay_angle": 22.610, "splay_distance": 3.585, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 170.922, "theta": -156.930, "eta_prime": -166.140, "theta_prime": -158.840, "eta_base": -116.769, "theta_base": -138.619, "v0": 0.747, "v1": -26.247, "v2": 39.870, "v3": -40.529, "v4": 25.129, "amplitude": 41.803, "phase_angle": 17.489, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.571, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -5.924, 5.671, 23.087 ], "x_axis": [ -0.415, -0.851, -0.321 ], "y_axis": [ -0.597, -0.011, 0.802 ], "z_axis": [ -0.686, 0.525, -0.504 ], "quaternion": [ -0.132, -0.524, 0.691, 0.480 ] } }, { "index": 8, "index_chain": 8, "chain_name": "G", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///G/4", "linked_nts": [ "///G/3", "///G/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor", "alpha": -87.281, "beta": -177.137, "gamma": 65.819, "delta": 79.691, "epsilon": -94.624, "zeta": -98.182, "epsilon_zeta": 3.558, "bb_type": "--", "chi": -160.786, "glyco_bond": "anti", "C5prime_xyz": [ -1.400, 8.716, 0.574 ], "P_xyz": [ 1.182, 9.231, 0.513 ], "form": ".", "ssZp": 4.131, "Dp": 4.801, "splay_angle": 40.715, "splay_distance": 6.644, "splay_ratio": 0.348, "d22": null, "d64": null, "eta": -177.962, "theta": -130.111, "eta_prime": -174.570, "theta_prime": -115.471, "eta_base": -149.363, "theta_base": -112.432, "v0": 5.611, "v1": -28.931, "v2": 39.529, "v3": -37.490, "v4": 20.175, "amplitude": 40.237, "phase_angle": 10.761, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.447, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ -6.798, 6.951, 19.854 ], "x_axis": [ -0.660, -0.736, 0.151 ], "y_axis": [ -0.379, 0.500, 0.779 ], "z_axis": [ -0.648, 0.457, -0.609 ], "quaternion": [ -0.240, -0.335, 0.832, 0.371 ] } }, { "index": 9, "index_chain": 9, "chain_name": "G", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///G/5", "linked_nts": [ "///G/4", "///G/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -50.237, "beta": -167.530, "gamma": 54.627, "delta": 141.703, "epsilon": -112.745, "zeta": -79.204, "epsilon_zeta": -33.541, "bb_type": "--", "chi": -73.047, "glyco_bond": "anti", "C5prime_xyz": [ -3.915, 7.121, -2.559 ], "P_xyz": [ -2.264, 8.555, -3.847 ], "form": ".", "ssZp": 1.519, "Dp": 1.492, "splay_angle": 137.525, "splay_distance": 17.239, "splay_ratio": 0.933, "d22": null, "d64": null, "eta": -154.430, "theta": -41.491, "eta_prime": -136.039, "theta_prime": -89.017, "eta_base": -138.901, "theta_base": -148.189, "v0": -30.608, "v1": 41.217, "v2": -35.098, "v3": 18.690, "v4": 7.144, "amplitude": 40.193, "phase_angle": 150.837, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.024, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -12.284, 8.150, 16.304 ], "x_axis": [ -0.570, -0.703, 0.426 ], "y_axis": [ -0.342, 0.674, 0.655 ], "z_axis": [ -0.748, 0.228, -0.624 ], "quaternion": [ -0.347, -0.308, 0.847, 0.261 ] } }, { "index": 10, "index_chain": 10, "chain_name": "G", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///G/6", "linked_nts": [ "///G/5", "///G/7" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": 173.348, "beta": -148.944, "gamma": -65.622, "delta": 153.758, "epsilon": -103.115, "zeta": -72.016, "epsilon_zeta": -31.099, "bb_type": "--", "chi": 62.549, "glyco_bond": "syn", "C5prime_xyz": [ -5.160, 3.893, 1.337 ], "P_xyz": [ -7.480, 3.002, 2.164 ], "form": ".", "ssZp": -0.906, "Dp": 0.905, "splay_angle": 73.932, "splay_distance": 11.692, "splay_ratio": 0.602, "d22": null, "d64": null, "eta": -31.553, "theta": -98.907, "eta_prime": 10.911, "theta_prime": -91.341, "eta_base": 71.380, "theta_base": -65.512, "v0": -20.548, "v1": 35.412, "v2": -35.509, "v3": 24.855, "v4": -2.930, "amplitude": 36.670, "phase_angle": 165.543, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ -17.712, 24.508, 15.937 ], "x_axis": [ -0.546, 0.821, 0.164 ], "y_axis": [ -0.342, -0.398, 0.851 ], "z_axis": [ 0.765, 0.409, 0.498 ], "quaternion": [ 0.372, 0.297, 0.403, 0.781 ] } }, { "index": 11, "index_chain": 11, "chain_name": "G", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///G/7", "linked_nts": [ "///G/6", "///G/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -73.799, "beta": -176.522, "gamma": 53.304, "delta": 87.205, "epsilon": -128.922, "zeta": -68.745, "epsilon_zeta": -60.177, "bb_type": "BI", "chi": -151.913, "glyco_bond": "anti", "C5prime_xyz": [ -1.682, 8.729, 0.087 ], "P_xyz": [ 0.737, 9.357, 0.656 ], "form": ".", "ssZp": 3.841, "Dp": 4.417, "splay_angle": 24.344, "splay_distance": 4.270, "splay_ratio": 0.214, "d22": 4.122, "d64": 4.133, "eta": 161.903, "theta": -122.394, "eta_prime": -156.205, "theta_prime": -117.671, "eta_base": -148.865, "theta_base": -115.707, "v0": 1.627, "v1": -21.385, "v2": 31.928, "v3": -32.002, "v4": 19.087, "amplitude": 33.206, "phase_angle": 15.946, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.777, "filter_rmsd": 0.101, "frame": { "rmsd": 0.010, "origin": [ -16.491, 13.463, 12.302 ], "x_axis": [ 0.906, 0.410, 0.100 ], "y_axis": [ -0.239, 0.301, 0.923 ], "z_axis": [ 0.349, -0.861, 0.371 ], "quaternion": [ 0.803, 0.555, 0.077, 0.202 ] } }, { "index": 12, "index_chain": 12, "chain_name": "G", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///G/8", "linked_nts": [ "///G/7", "///G/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": -43.815, "beta": -166.765, "gamma": 18.608, "delta": 142.300, "epsilon": -95.093, "zeta": 155.770, "epsilon_zeta": 109.136, "bb_type": "BII", "chi": -106.607, "glyco_bond": "anti", "C5prime_xyz": [ -2.174, 8.219, -1.965 ], "P_xyz": [ -0.548, 10.220, -1.520 ], "form": ".", "ssZp": 0.549, "Dp": 0.888, "splay_angle": 43.231, "splay_distance": 7.198, "splay_ratio": 0.373, "d22": 7.160, "d64": 6.893, "eta": -173.549, "theta": 148.840, "eta_prime": -151.421, "theta_prime": 146.735, "eta_base": -145.410, "theta_base": 149.336, "v0": -24.830, "v1": 36.917, "v2": -34.640, "v3": 21.040, "v4": 2.158, "amplitude": 37.336, "phase_angle": 158.096, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.005, "origin": [ -13.877, 10.122, 12.784 ], "x_axis": [ 0.323, 0.945, 0.054 ], "y_axis": [ -0.477, 0.113, 0.872 ], "z_axis": [ 0.818, -0.307, 0.487 ], "quaternion": [ 0.693, 0.425, 0.275, 0.513 ] } }, { "index": 13, "index_chain": 13, "chain_name": "G", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///G/9", "linked_nts": [ "///G/8", "///G/10" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,non-canonical,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop", "alpha": -171.394, "beta": -173.406, "gamma": 53.873, "delta": 84.417, "epsilon": -155.206, "zeta": -74.632, "epsilon_zeta": -80.574, "bb_type": "BI", "chi": -164.841, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.620, 0.869 ], "P_xyz": [ 1.090, 8.832, 1.680 ], "form": "A", "ssZp": 4.420, "Dp": 4.498, "splay_angle": 25.023, "splay_distance": 3.926, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 129.472, "theta": -148.734, "eta_prime": 117.037, "theta_prime": -148.013, "eta_base": 131.646, "theta_base": -128.057, "v0": 4.222, "v1": -24.127, "v2": 33.742, "v3": -32.401, "v4": 17.729, "amplitude": 34.477, "phase_angle": 11.846, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.603, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ -16.730, 3.610, 11.660 ], "x_axis": [ 0.227, 0.974, -0.018 ], "y_axis": [ -0.482, 0.129, 0.866 ], "z_axis": [ 0.846, -0.188, 0.499 ], "quaternion": [ 0.681, 0.387, 0.317, 0.535 ] } }, { "index": 14, "index_chain": 14, "chain_name": "G", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///G/10", "linked_nts": [ "///G/9", "///G/11" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -64.005, "beta": -176.176, "gamma": 46.376, "delta": 82.375, "epsilon": -135.837, "zeta": -80.856, "epsilon_zeta": -54.981, "bb_type": "BI", "chi": -159.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.128, 8.681, 0.539 ], "P_xyz": [ 1.423, 9.006, 1.114 ], "form": "A", "ssZp": 4.392, "Dp": 4.721, "splay_angle": 18.948, "splay_distance": 2.986, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 172.742, "theta": -144.908, "eta_prime": 179.878, "theta_prime": -142.300, "eta_base": -150.562, "theta_base": -110.330, "v0": 4.248, "v1": -25.956, "v2": 36.624, "v3": -35.144, "v4": 19.506, "amplitude": 37.475, "phase_angle": 12.237, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.858, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -12.973, 2.518, 11.987 ], "x_axis": [ -0.108, 0.915, 0.388 ], "y_axis": [ -0.544, -0.381, 0.748 ], "z_axis": [ 0.832, -0.130, 0.539 ], "quaternion": [ 0.513, 0.428, 0.217, 0.712 ] } }, { "index": 15, "index_chain": 15, "chain_name": "G", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///G/11", "linked_nts": [ "///G/10", "///G/12" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -65.510, "beta": 154.349, "gamma": 59.805, "delta": 80.653, "epsilon": -142.021, "zeta": -74.006, "epsilon_zeta": -68.014, "bb_type": "BI", "chi": -163.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.724, 0.744 ], "P_xyz": [ 1.208, 9.043, 0.195 ], "form": "A", "ssZp": 4.550, "Dp": 4.732, "splay_angle": 25.873, "splay_distance": 3.990, "splay_ratio": 0.224, "d22": 3.803, "d64": 3.927, "eta": 159.344, "theta": -138.214, "eta_prime": 175.517, "theta_prime": -137.342, "eta_base": -136.782, "theta_base": -99.446, "v0": 3.998, "v1": -26.582, "v2": 37.814, "v3": -36.478, "v4": 20.526, "amplitude": 38.777, "phase_angle": 12.793, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ -10.442, 3.454, 13.265 ], "x_axis": [ -0.462, 0.583, 0.668 ], "y_axis": [ -0.252, -0.809, 0.532 ], "z_axis": [ 0.850, 0.078, 0.520 ], "quaternion": [ 0.250, 0.454, 0.182, 0.835 ] } }, { "index": 16, "index_chain": 16, "chain_name": "G", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///G/12", "linked_nts": [ "///G/11", "///G/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate", "alpha": -52.375, "beta": 169.774, "gamma": 49.117, "delta": 83.299, "epsilon": -159.883, "zeta": -68.661, "epsilon_zeta": -91.222, "bb_type": "BI", "chi": -159.776, "glyco_bond": "anti", "C5prime_xyz": [ -1.355, 8.652, 0.493 ], "P_xyz": [ 1.263, 8.929, 0.576 ], "form": "A", "ssZp": 4.449, "Dp": 4.599, "splay_angle": 26.735, "splay_distance": 4.054, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 168.652, "theta": -144.644, "eta_prime": -170.287, "theta_prime": -144.421, "eta_base": -110.797, "theta_base": -114.257, "v0": 5.165, "v1": -27.575, "v2": 38.143, "v3": -36.160, "v4": 19.515, "amplitude": 38.864, "phase_angle": 11.055, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ -8.949, 5.457, 16.376 ], "x_axis": [ -0.563, -0.121, 0.817 ], "y_axis": [ 0.219, -0.976, 0.006 ], "z_axis": [ 0.797, 0.182, 0.576 ], "quaternion": [ -0.096, 0.457, 0.053, 0.882 ] } }, { "index": 17, "index_chain": 17, "chain_name": "G", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///G/13", "linked_nts": [ "///G/12", "///G/14" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -75.558, "beta": -174.411, "gamma": 55.922, "delta": 84.021, "epsilon": -149.210, "zeta": -59.868, "epsilon_zeta": -89.341, "bb_type": "BI", "chi": -166.489, "glyco_bond": "anti", "C5prime_xyz": [ -1.250, 8.545, 0.924 ], "P_xyz": [ 1.350, 8.627, 1.320 ], "form": "A", "ssZp": 4.621, "Dp": 4.693, "splay_angle": 25.800, "splay_distance": 3.995, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 170.698, "theta": -130.375, "eta_prime": -177.148, "theta_prime": -128.041, "eta_base": -132.031, "theta_base": -88.457, "v0": 6.743, "v1": -28.997, "v2": 38.814, "v3": -35.852, "v4": 18.406, "amplitude": 39.277, "phase_angle": 8.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.808, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -6.898, 6.805, 19.602 ], "x_axis": [ -0.442, -0.717, 0.539 ], "y_axis": [ 0.488, -0.696, -0.527 ], "z_axis": [ 0.753, 0.031, 0.657 ], "quaternion": [ -0.361, 0.386, -0.148, 0.836 ] } }, { "index": 18, "index_chain": 18, "chain_name": "G", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///G/14", "linked_nts": [ "///G/13", "///G/15" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -71.515, "beta": 178.685, "gamma": 55.396, "delta": 83.495, "epsilon": -147.080, "zeta": -77.643, "epsilon_zeta": -69.438, "bb_type": "BI", "chi": -161.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.321, 8.652, 0.629 ], "P_xyz": [ 1.202, 9.006, 0.911 ], "form": "A", "ssZp": 4.449, "Dp": 4.649, "splay_angle": 24.752, "splay_distance": 3.941, "splay_ratio": 0.215, "d22": 4.584, "d64": 4.457, "eta": 168.606, "theta": -146.459, "eta_prime": -171.847, "theta_prime": -144.353, "eta_base": -112.939, "theta_base": -124.292, "v0": 3.126, "v1": -25.858, "v2": 37.084, "v3": -36.558, "v4": 21.127, "amplitude": 38.239, "phase_angle": 14.115, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.056, "frame": { "rmsd": 0.009, "origin": [ -6.007, 5.364, 23.220 ], "x_axis": [ -0.040, -0.997, -0.069 ], "y_axis": [ 0.725, 0.018, -0.689 ], "z_axis": [ 0.688, -0.078, 0.722 ], "quaternion": [ 0.652, -0.234, 0.290, -0.660 ] } }, { "index": 19, "index_chain": 19, "chain_name": "G", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///G/15", "linked_nts": [ "///G/14", "///G/16" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -52.333, "beta": 178.761, "gamma": 39.366, "delta": 82.640, "epsilon": -163.363, "zeta": -57.990, "epsilon_zeta": -105.373, "bb_type": "BI", "chi": -150.542, "glyco_bond": "anti", "C5prime_xyz": [ -1.223, 8.745, -0.017 ], "P_xyz": [ 1.241, 9.252, 0.554 ], "form": "A", "ssZp": 4.052, "Dp": 4.446, "splay_angle": 18.835, "splay_distance": 3.075, "splay_ratio": 0.164, "d22": 4.097, "d64": 3.810, "eta": 171.848, "theta": -142.924, "eta_prime": -177.242, "theta_prime": -141.797, "eta_base": -146.873, "theta_base": -118.323, "v0": 3.255, "v1": -26.419, "v2": 38.001, "v3": -37.192, "v4": 21.468, "amplitude": 39.151, "phase_angle": 13.920, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.593, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -4.579, 4.417, 26.769 ], "x_axis": [ 0.160, -0.794, -0.586 ], "y_axis": [ 0.689, 0.515, -0.510 ], "z_axis": [ 0.707, -0.322, 0.630 ], "quaternion": [ 0.759, -0.062, 0.426, -0.489 ] } }, { "index": 20, "index_chain": 20, "chain_name": "G", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///G/16", "linked_nts": [ "///G/15", "///G/17" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -78.585, "beta": -166.891, "gamma": 40.757, "delta": 77.538, "epsilon": -165.396, "zeta": 146.635, "epsilon_zeta": 47.969, "bb_type": "--", "chi": -142.989, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.707, -0.488 ], "P_xyz": [ 0.947, 9.450, -0.339 ], "form": ".", "ssZp": 4.029, "Dp": 4.707, "splay_angle": 106.446, "splay_distance": 13.548, "splay_ratio": 0.802, "d22": 11.247, "d64": 11.877, "eta": 157.101, "theta": 75.616, "eta_prime": 170.483, "theta_prime": 30.603, "eta_base": -152.286, "theta_base": -54.054, "v0": 4.679, "v1": -29.899, "v2": 42.094, "v3": -40.306, "v4": 22.667, "amplitude": 43.093, "phase_angle": 12.363, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.505, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ -3.124, 2.413, 28.592 ], "x_axis": [ 0.359, -0.371, -0.857 ], "y_axis": [ 0.651, 0.757, -0.055 ], "z_axis": [ 0.669, -0.538, 0.513 ], "quaternion": [ 0.811, 0.149, 0.470, -0.315 ] } }, { "index": 21, "index_chain": 21, "chain_name": "G", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///G/17", "linked_nts": [ "///G/16", "///G/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 60.727, "beta": -142.206, "gamma": 65.146, "delta": 143.851, "epsilon": -84.983, "zeta": -115.053, "epsilon_zeta": 30.069, "bb_type": "--", "chi": 107.531, "glyco_bond": "--", "C5prime_xyz": [ -4.522, 6.153, 2.750 ], "P_xyz": [ -5.685, 3.987, 3.671 ], "form": ".", "ssZp": -0.864, "Dp": 0.920, "splay_angle": 99.183, "splay_distance": 13.517, "splay_ratio": 0.768, "d22": 14.003, "d64": 15.248, "eta": 18.362, "theta": -37.218, "eta_prime": 55.124, "theta_prime": -55.805, "eta_base": 131.322, "theta_base": -19.020, "v0": -28.108, "v1": 41.021, "v2": -37.614, "v3": 22.332, "v4": 3.464, "amplitude": 41.007, "phase_angle": 156.531, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.011, "origin": [ 9.561, 6.606, 26.345 ], "x_axis": [ 0.992, -0.122, -0.022 ], "y_axis": [ 0.094, 0.617, 0.781 ], "z_axis": [ -0.081, -0.777, 0.624 ], "quaternion": [ 0.899, 0.433, -0.016, -0.060 ] } }, { "index": 22, "index_chain": 22, "chain_name": "G", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///G/18", "linked_nts": [ "///G/17", "///G/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 60.727, "beta": 132.509, "gamma": 0.920, "delta": 154.267, "epsilon": -85.321, "zeta": 74.656, "epsilon_zeta": 200.023, "bb_type": "--", "chi": 45.501, "glyco_bond": "syn", "C5prime_xyz": [ -5.810, 4.603, 0.416 ], "P_xyz": [ -6.492, 3.197, -1.698 ], "form": ".", "ssZp": -0.042, "Dp": 1.633, "splay_angle": 29.380, "splay_distance": 5.010, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": -160.282, "theta": 149.753, "eta_prime": -106.301, "theta_prime": 108.571, "eta_base": -120.239, "theta_base": 151.711, "v0": -32.401, "v1": 48.033, "v2": -44.428, "v3": 27.444, "v4": 2.837, "amplitude": 47.989, "phase_angle": 157.791, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ -1.218, 9.122, 34.104 ], "x_axis": [ -0.938, -0.072, 0.338 ], "y_axis": [ -0.176, 0.941, -0.290 ], "z_axis": [ -0.297, -0.332, -0.895 ], "quaternion": [ -0.164, -0.064, 0.971, -0.160 ] } }, { "index": 23, "index_chain": 23, "chain_name": "G", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///G/19", "linked_nts": [ "///G/18", "///G/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,A-minor,ribose-zipper", "alpha": 85.031, "beta": -127.250, "gamma": -172.623, "delta": 84.629, "epsilon": -143.676, "zeta": -89.739, "epsilon_zeta": -53.936, "bb_type": "BI", "chi": -132.785, "glyco_bond": "anti", "C5prime_xyz": [ -1.730, 8.666, -1.055 ], "P_xyz": [ -1.080, 8.815, -3.585 ], "form": ".", "ssZp": 3.160, "Dp": 4.429, "splay_angle": 18.352, "splay_distance": 3.232, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -175.517, "theta": 179.841, "eta_prime": 169.967, "theta_prime": -175.278, "eta_base": -142.421, "theta_base": -142.196, "v0": 0.257, "v1": -21.496, "v2": 33.151, "v3": -33.942, "v4": 21.369, "amplitude": 34.898, "phase_angle": 18.207, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "0i", "suiteness": 0.501, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ -4.578, 10.585, 30.688 ], "x_axis": [ -0.751, 0.525, 0.401 ], "y_axis": [ 0.390, 0.842, -0.372 ], "z_axis": [ -0.533, -0.123, -0.837 ], "quaternion": [ -0.252, 0.247, 0.926, -0.134 ] } }, { "index": 24, "index_chain": 24, "chain_name": "G", "nt_resnum": 20, "nt_name": "A", "nt_code": "A", "nt_id": "///G/20", "linked_nts": [ "///G/19", "///G/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor", "alpha": -64.725, "beta": 159.661, "gamma": 54.148, "delta": 88.045, "epsilon": -151.690, "zeta": -110.052, "epsilon_zeta": -41.638, "bb_type": "BI", "chi": -121.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.708, 8.339, -1.643 ], "P_xyz": [ 0.715, 8.105, -2.622 ], "form": ".", "ssZp": 2.688, "Dp": 4.518, "splay_angle": 60.392, "splay_distance": 10.584, "splay_ratio": 0.505, "d22": null, "d64": null, "eta": 165.601, "theta": -142.040, "eta_prime": -179.421, "theta_prime": -149.259, "eta_base": -140.356, "theta_base": -179.151, "v0": 1.827, "v1": -21.579, "v2": 31.933, "v3": -31.790, "v4": 18.902, "amplitude": 33.141, "phase_angle": 15.516, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.653, "filter_rmsd": 0.043, "frame": { "rmsd": 0.010, "origin": [ -6.278, 11.678, 28.166 ], "x_axis": [ -0.378, 0.875, 0.303 ], "y_axis": [ 0.448, 0.459, -0.768 ], "z_axis": [ -0.811, -0.154, -0.565 ], "quaternion": [ -0.359, 0.427, 0.775, -0.297 ] } }, { "index": 25, "index_chain": 25, "chain_name": "G", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///G/21", "linked_nts": [ "///G/20", "///G/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": 83.403, "beta": 155.670, "gamma": -80.429, "delta": 151.557, "epsilon": -165.520, "zeta": 144.508, "epsilon_zeta": 49.973, "bb_type": "--", "chi": -85.244, "glyco_bond": "anti", "C5prime_xyz": [ -2.889, 7.550, -2.555 ], "P_xyz": [ -3.266, 9.883, -3.688 ], "form": ".", "ssZp": 1.989, "Dp": 2.030, "splay_angle": 53.596, "splay_distance": 8.384, "splay_ratio": 0.451, "d22": null, "d64": null, "eta": -176.260, "theta": 79.535, "eta_prime": -176.247, "theta_prime": 80.428, "eta_base": 155.567, "theta_base": 96.907, "v0": -26.529, "v1": 42.181, "v2": -40.620, "v3": 26.562, "v4": -0.344, "amplitude": 42.831, "phase_angle": 161.511, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.259, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -11.833, 6.777, 20.608 ], "x_axis": [ -0.459, 0.278, 0.844 ], "y_axis": [ 0.388, 0.917, -0.092 ], "z_axis": [ -0.799, 0.286, -0.529 ], "quaternion": [ -0.482, 0.196, 0.852, 0.057 ] } }, { "index": 26, "index_chain": 26, "chain_name": "G", "nt_resnum": 22, "nt_name": "U", "nt_code": "U", "nt_id": "///G/22", "linked_nts": [ "///G/21", "///G/23" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate", "alpha": -74.009, "beta": 143.060, "gamma": 37.818, "delta": 79.787, "epsilon": -156.103, "zeta": -65.605, "epsilon_zeta": -90.498, "bb_type": "BI", "chi": -166.500, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 8.689, 0.869 ], "P_xyz": [ 1.019, 8.927, 1.173 ], "form": "A", "ssZp": 4.511, "Dp": 4.600, "splay_angle": 22.293, "splay_distance": 3.512, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 151.306, "theta": -138.902, "eta_prime": 147.549, "theta_prime": -139.608, "eta_base": 152.311, "theta_base": -104.526, "v0": 2.920, "v1": -27.193, "v2": 39.113, "v3": -38.876, "v4": 22.643, "amplitude": 40.422, "phase_angle": 14.622, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.874, "filter_rmsd": 0.099, "frame": { "rmsd": 0.009, "origin": [ -6.857, 3.957, 14.478 ], "x_axis": [ -0.766, 0.016, 0.642 ], "y_axis": [ 0.039, 0.999, 0.023 ], "z_axis": [ -0.641, 0.043, -0.766 ], "quaternion": [ -0.341, 0.015, 0.940, 0.017 ] } }, { "index": 27, "index_chain": 27, "chain_name": "G", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///G/23", "linked_nts": [ "///G/22", "///G/24" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -70.706, "beta": 179.521, "gamma": 50.127, "delta": 80.501, "epsilon": -159.713, "zeta": -72.885, "epsilon_zeta": -86.828, "bb_type": "BI", "chi": -158.402, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.748, 0.476 ], "P_xyz": [ 1.119, 9.133, 0.921 ], "form": "A", "ssZp": 4.370, "Dp": 4.559, "splay_angle": 23.650, "splay_distance": 3.721, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 163.650, "theta": -151.016, "eta_prime": -178.986, "theta_prime": -149.548, "eta_base": -123.846, "theta_base": -127.222, "v0": 3.725, "v1": -26.617, "v2": 38.140, "v3": -37.191, "v4": 20.951, "amplitude": 39.195, "phase_angle": 13.324, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.914, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -10.006, 3.098, 13.182 ], "x_axis": [ -0.528, 0.658, 0.537 ], "y_axis": [ 0.478, 0.753, -0.453 ], "z_axis": [ -0.702, 0.017, -0.712 ], "quaternion": [ -0.358, 0.328, 0.865, -0.126 ] } }, { "index": 28, "index_chain": 28, "chain_name": "G", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///G/24", "linked_nts": [ "///G/23", "///G/25" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.866, "beta": 177.019, "gamma": 49.168, "delta": 81.683, "epsilon": -170.269, "zeta": -52.909, "epsilon_zeta": -117.359, "bb_type": "BI", "chi": -159.517, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.754, 0.504 ], "P_xyz": [ 1.143, 9.122, 0.929 ], "form": ".", "ssZp": 4.362, "Dp": 4.463, "splay_angle": 19.652, "splay_distance": 3.600, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 172.153, "theta": -118.223, "eta_prime": -175.071, "theta_prime": -130.856, "eta_base": -139.762, "theta_base": -107.870, "v0": 2.469, "v1": -24.735, "v2": 36.338, "v3": -35.953, "v4": 21.097, "amplitude": 37.610, "phase_angle": 14.942, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.870, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -13.331, 2.319, 11.707 ], "x_axis": [ -0.155, 0.939, 0.308 ], "y_axis": [ 0.662, 0.330, -0.673 ], "z_axis": [ -0.733, 0.099, -0.673 ], "quaternion": [ -0.354, 0.545, 0.734, -0.195 ] } }, { "index": 29, "index_chain": 29, "chain_name": "G", "nt_resnum": 25, "nt_name": "A", "nt_code": "A", "nt_id": "///G/25", "linked_nts": [ "///G/24", "///G/26" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet", "alpha": 160.916, "beta": -176.695, "gamma": 165.997, "delta": 81.067, "epsilon": -123.972, "zeta": -75.991, "epsilon_zeta": -47.981, "bb_type": "--", "chi": -179.031, "glyco_bond": "anti", "C5prime_xyz": [ -1.558, 8.381, 1.585 ], "P_xyz": [ -0.133, 10.347, 0.559 ], "form": ".", "ssZp": 4.818, "Dp": 4.826, "splay_angle": 28.807, "splay_distance": 4.471, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 160.502, "theta": -155.292, "eta_prime": 176.861, "theta_prime": -146.846, "eta_base": -136.584, "theta_base": -94.372, "v0": 4.007, "v1": -25.861, "v2": 36.606, "v3": -35.243, "v4": 19.860, "amplitude": 37.513, "phase_angle": 12.625, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.592, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ -16.681, 3.633, 11.836 ], "x_axis": [ 0.239, 0.971, -0.023 ], "y_axis": [ 0.556, -0.156, -0.816 ], "z_axis": [ -0.796, 0.182, -0.577 ], "quaternion": [ -0.355, 0.702, 0.544, -0.292 ] } }, { "index": 30, "index_chain": 30, "chain_name": "G", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///G/26", "linked_nts": [ "///G/25", "///G/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -49.363, "beta": 160.594, "gamma": 46.448, "delta": 83.094, "epsilon": -138.262, "zeta": -72.249, "epsilon_zeta": -66.013, "bb_type": "BI", "chi": -163.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.545, 8.706, 0.737 ], "P_xyz": [ 1.004, 9.096, 0.953 ], "form": ".", "ssZp": 4.474, "Dp": 4.669, "splay_angle": 24.905, "splay_distance": 3.932, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.345, "theta": -132.358, "eta_prime": -170.936, "theta_prime": -131.829, "eta_base": -103.082, "theta_base": -86.640, "v0": 1.049, "v1": -22.347, "v2": 33.918, "v3": -34.345, "v4": 20.966, "amplitude": 35.467, "phase_angle": 17.000, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.534, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -18.261, 7.346, 9.912 ], "x_axis": [ 0.618, 0.460, -0.638 ], "y_axis": [ 0.075, -0.842, -0.534 ], "z_axis": [ -0.782, 0.282, -0.555 ], "quaternion": [ -0.235, 0.868, 0.154, -0.409 ] } }, { "index": 31, "index_chain": 31, "chain_name": "G", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///G/27", "linked_nts": [ "///G/26", "///G/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -56.895, "beta": 165.427, "gamma": 41.259, "delta": 81.666, "epsilon": -146.326, "zeta": -67.167, "epsilon_zeta": -79.159, "bb_type": "BI", "chi": -160.295, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.698, 0.537 ], "P_xyz": [ 1.313, 9.082, 0.513 ], "form": ".", "ssZp": 4.523, "Dp": 4.765, "splay_angle": 25.608, "splay_distance": 4.063, "splay_ratio": 0.225, "d22": 3.813, "d64": 4.154, "eta": 157.415, "theta": -134.402, "eta_prime": 176.272, "theta_prime": -130.842, "eta_base": -117.669, "theta_base": -93.038, "v0": 6.082, "v1": -28.093, "v2": 38.177, "v3": -35.660, "v4": 18.713, "amplitude": 38.737, "phase_angle": 9.754, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.688, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ -18.964, 9.280, 6.562 ], "x_axis": [ 0.570, -0.347, -0.745 ], "y_axis": [ -0.497, -0.868, 0.024 ], "z_axis": [ -0.655, 0.356, -0.667 ], "quaternion": [ -0.094, 0.881, -0.239, -0.397 ] } }, { "index": 32, "index_chain": 32, "chain_name": "G", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///G/28", "linked_nts": [ "///G/27", "///G/29" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -59.551, "beta": 160.310, "gamma": 63.057, "delta": 78.915, "epsilon": -129.289, "zeta": -79.330, "epsilon_zeta": -49.958, "bb_type": "BI", "chi": -159.594, "glyco_bond": "anti", "C5prime_xyz": [ -1.622, 8.803, 0.480 ], "P_xyz": [ 0.933, 9.340, 0.075 ], "form": "A", "ssZp": 4.317, "Dp": 4.684, "splay_angle": 28.156, "splay_distance": 4.522, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": 173.187, "theta": -138.916, "eta_prime": -166.366, "theta_prime": -130.696, "eta_base": -110.920, "theta_base": -112.415, "v0": 0.669, "v1": -24.710, "v2": 38.022, "v3": -38.564, "v4": 23.794, "amplitude": 39.876, "phase_angle": 17.537, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.782, "filter_rmsd": 0.101, "frame": { "rmsd": 0.007, "origin": [ -18.748, 9.671, 2.524 ], "x_axis": [ 0.145, -0.845, -0.515 ], "y_axis": [ -0.859, -0.366, 0.358 ], "z_axis": [ -0.491, 0.391, -0.779 ], "quaternion": [ -0.011, 0.756, -0.563, -0.332 ] } }, { "index": 33, "index_chain": 33, "chain_name": "G", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///G/29", "linked_nts": [ "///G/28", "///G/30" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,cap-donor", "alpha": -64.137, "beta": -169.515, "gamma": 49.698, "delta": 152.285, "epsilon": -101.640, "zeta": 66.602, "epsilon_zeta": 191.758, "bb_type": "--", "chi": -140.482, "glyco_bond": "anti", "C5prime_xyz": [ -1.818, 8.630, -0.041 ], "P_xyz": [ 0.094, 9.335, 1.516 ], "form": "Z", "ssZp": 0.951, "Dp": 0.926, "splay_angle": 39.942, "splay_distance": 6.368, "splay_ratio": 0.377, "d22": null, "d64": null, "eta": -172.216, "theta": 102.710, "eta_prime": -150.497, "theta_prime": 70.905, "eta_base": -128.771, "theta_base": 79.056, "v0": -22.001, "v1": 37.548, "v2": -37.773, "v3": 26.051, "v4": -2.759, "amplitude": 39.072, "phase_angle": 165.189, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.640, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -19.806, 9.683, -1.873 ], "x_axis": [ 0.256, -0.770, 0.584 ], "y_axis": [ -0.752, 0.220, 0.621 ], "z_axis": [ -0.607, -0.599, -0.523 ], "quaternion": [ 0.488, 0.624, -0.610, -0.009 ] } }, { "index": 34, "index_chain": 34, "chain_name": "G", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///G/30", "linked_nts": [ "///G/29", "///G/31" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": 110.779, "beta": -179.440, "gamma": 164.498, "delta": 142.986, "epsilon": -98.860, "zeta": -71.591, "epsilon_zeta": -27.269, "bb_type": "--", "chi": 66.999, "glyco_bond": "syn", "C5prime_xyz": [ -5.257, 4.291, 1.530 ], "P_xyz": [ -5.291, 2.773, 3.670 ], "form": ".", "ssZp": -1.021, "Dp": 1.156, "splay_angle": 34.570, "splay_distance": 5.799, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 179.699, "theta": -106.083, "eta_prime": 169.044, "theta_prime": -95.759, "eta_base": 176.837, "theta_base": -111.815, "v0": -21.947, "v1": 33.739, "v2": -32.027, "v3": 20.165, "v4": 0.864, "amplitude": 34.139, "phase_angle": 159.739, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -21.546, 14.482, 1.934 ], "x_axis": [ 0.404, -0.595, 0.694 ], "y_axis": [ -0.727, 0.252, 0.639 ], "z_axis": [ -0.556, -0.763, -0.331 ], "quaternion": [ 0.576, 0.609, -0.543, 0.057 ] } }, { "index": 35, "index_chain": 35, "chain_name": "G", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///G/31", "linked_nts": [ "///G/30", "///G/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,ss-non-loop", "alpha": -66.501, "beta": 165.346, "gamma": 43.251, "delta": 136.958, "epsilon": -73.398, "zeta": 166.238, "epsilon_zeta": 120.364, "bb_type": "BII", "chi": -86.682, "glyco_bond": "anti", "C5prime_xyz": [ -3.144, 7.572, -2.491 ], "P_xyz": [ -0.920, 8.773, -3.187 ], "form": ".", "ssZp": 0.566, "Dp": 0.516, "splay_angle": 35.107, "splay_distance": 5.662, "splay_ratio": 0.332, "d22": null, "d64": null, "eta": 157.569, "theta": -163.511, "eta_prime": -144.949, "theta_prime": 164.571, "eta_base": -158.879, "theta_base": 124.732, "v0": -27.203, "v1": 39.898, "v2": -36.908, "v3": 22.495, "v4": 2.787, "amplitude": 39.992, "phase_angle": 157.353, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.198, "filter_rmsd": 0.038, "frame": { "rmsd": 0.012, "origin": [ -20.181, 19.892, 0.354 ], "x_axis": [ -0.162, -0.769, -0.619 ], "y_axis": [ -0.966, 0.253, -0.061 ], "z_axis": [ 0.204, 0.587, -0.783 ], "quaternion": [ 0.277, -0.585, 0.741, 0.177 ] } }, { "index": 36, "index_chain": 36, "chain_name": "G", "nt_resnum": 32, "nt_name": "A23", "nt_code": "a", "is_modified": true, "nt_id": "///G/32", "linked_nts": [ "///G/31", null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,non-stack,ss-non-loop", "alpha": 139.856, "beta": -156.425, "gamma": 49.520, "delta": 162.398, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -175.293, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 7.295, 2.123 ], "P_xyz": [ -0.693, 6.045, 4.042 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 17.295, "v1": 3.525, "v2": -23.138, "v3": 33.924, "v4": -32.114, "amplitude": 34.754, "phase_angle": 228.258, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.062, "origin": [ -20.032, 23.661, 4.577 ], "x_axis": [ -0.269, -0.378, 0.886 ], "y_axis": [ -0.585, 0.795, 0.162 ], "z_axis": [ -0.765, -0.474, -0.435 ], "quaternion": [ 0.522, 0.305, -0.790, 0.099 ] } } ], "num_hbonds": 221, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 2089, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///A/1/N", "atom2_id": "///A/1164/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/2/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 17, "atom2_serNum": 2089, "donAcc_type": "acceptable", "distance": 3.039, "atom1_id": "///A/2/NZ", "atom2_id": "///A/1164/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 4, "atom1_serNum": 21, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/3/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 29, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/4/N", "atom2_id": "///A/35/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 32, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/4/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 41, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/5/N", "atom2_id": "///A/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 44, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/5/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 56, "atom2_serNum": 778, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/7/N", "atom2_id": "///A/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 59, "atom2_serNum": 89, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 61, "atom2_serNum": 783, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///A/7/OG", "atom2_id": "///A/96/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 65, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 67, "atom2_serNum": 215, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///A/8/OG", "atom2_id": "///A/25/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 67, "atom2_serNum": 216, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///A/8/OG", "atom2_id": "///A/25/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 71, "atom2_serNum": 106, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 80, "atom2_serNum": 118, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 88, "atom2_serNum": 741, "donAcc_type": "acceptable", "distance": 2.857, "atom1_id": "///A/10/OH", "atom2_id": "///A/91/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 92, "atom2_serNum": 126, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 100, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 109, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/13/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 117, "atom2_serNum": 1256, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///A/13/OH", "atom2_id": "///A/156/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 121, "atom2_serNum": 144, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/14/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 121, "atom2_serNum": 155, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 134, "atom2_serNum": 183, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/15/NZ", "atom2_id": "///A/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 134, "atom2_serNum": 200, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/15/NZ", "atom2_id": "///A/23/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 158, "atom2_serNum": 180, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/18/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 161, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///A/18/OD1", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 162, "atom2_serNum": 163, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/18/OD2", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 162, "atom2_serNum": 171, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/18/OD2", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 166, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/19/O", "atom2_id": "c. G & i. \\-3 & n. N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 31, "atom1_serNum": 174, "atom2_serNum": 1352, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/20/O", "atom2_id": "c. G & i. \\-2 & n. N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 32, "atom1_serNum": 183, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/21/O", "atom2_id": "c. G & i. \\-3 & n. N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 33, "atom1_serNum": 194, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/23/N", "atom2_id": "c. G & i. \\-3 & n. N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 34, "atom1_serNum": 205, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.909, "atom1_id": "///A/24/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 220, "atom2_serNum": 239, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/26/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 224, "atom2_serNum": 225, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/26/OD2", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 224, "atom2_serNum": 232, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/26/OD2", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 235, "atom2_serNum": 237, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///A/28/O", "atom2_id": "///A/28/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 283, "atom2_serNum": 419, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/33/NZ", "atom2_id": "///A/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 287, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/34/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 300, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/36/N", "atom2_id": "///A/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 303, "atom2_serNum": 312, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/36/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 303, "atom2_serNum": 404, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/36/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 320, "atom2_serNum": 387, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/39/N", "atom2_id": "///A/47/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 330, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/40/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 344, "atom2_serNum": 368, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/42/N", "atom2_id": "///A/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 347, "atom2_serNum": 365, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/42/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 352, "atom2_serNum": 2097, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///A/43/N", "atom2_id": "///A/1165/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 49, "atom1_serNum": 364, "atom2_serNum": 1284, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/44/O", "atom2_id": "///A/158/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 371, "atom2_serNum": 1273, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///A/45/ND1", "atom2_id": "///A/157/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 378, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/46/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 383, "atom2_serNum": 769, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/46/NZ", "atom2_id": "///A/94/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 395, "atom2_serNum": 1205, "donAcc_type": "acceptable", "distance": 3.744, "atom1_id": "///A/47/OH", "atom2_id": "///A/150/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 395, "atom2_serNum": 1242, "donAcc_type": "acceptable", "distance": 2.450, "atom1_id": "///A/47/OH", "atom2_id": "///A/154/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 396, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/48/N", "atom2_id": "///A/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 399, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/48/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 412, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/50/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 424, "atom2_serNum": 673, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/52/N", "atom2_id": "///A/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 427, "atom2_serNum": 670, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/52/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 429, "atom2_serNum": 452, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/52/OG1", "atom2_id": "///A/55/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 434, "atom2_serNum": 452, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/53/O", "atom2_id": "///A/55/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 436, "atom2_serNum": 452, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///A/53/OG", "atom2_id": "///A/55/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 444, "atom2_serNum": 482, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///A/55/N", "atom2_id": "///A/58/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 447, "atom2_serNum": 476, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/55/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 456, "atom2_serNum": 486, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/56/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 465, "atom2_serNum": 494, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/57/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 470, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/57/NE1", "atom2_id": "c. G & i. \\-2 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 68, "atom1_serNum": 479, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/58/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 479, "atom2_serNum": 578, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/58/O", "atom2_id": "///A/70/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 497, "atom2_serNum": 1391, "donAcc_type": "questionable", "distance": 2.910, "atom1_id": "///A/60/O", "atom2_id": "///G/0/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 71, "atom1_serNum": 512, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/62/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 517, "atom2_serNum": 1391, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/62/NZ", "atom2_id": "///G/0/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 73, "atom1_serNum": 517, "atom2_serNum": 1614, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/62/NZ", "atom2_id": "///G/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 74, "atom1_serNum": 518, "atom2_serNum": 1634, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/63/N", "atom2_id": "///G/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 75, "atom1_serNum": 521, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/63/O", "atom2_id": "///A/131/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 530, "atom2_serNum": 1414, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/64/O", "atom2_id": "///G/1/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 77, "atom1_serNum": 536, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/65/O", "atom2_id": "///A/131/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 538, "atom2_serNum": 547, "donAcc_type": "acceptable", "distance": 3.254, "atom1_id": "///A/65/OG", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 538, "atom2_serNum": 1398, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///A/65/OG", "atom2_id": "///G/1/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 80, "atom1_serNum": 539, "atom2_serNum": 1411, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/66/N", "atom2_id": "///G/1/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 550, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/67/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 550, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/67/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 552, "atom2_serNum": 1399, "donAcc_type": "acceptable", "distance": 3.375, "atom1_id": "///A/67/OG", "atom2_id": "///G/1/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 84, "atom1_serNum": 559, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/69/N", "atom2_id": "///A/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 562, "atom2_serNum": 678, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/69/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 579, "atom2_serNum": 669, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/71/N", "atom2_id": "///A/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 582, "atom2_serNum": 658, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/71/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 597, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/73/N", "atom2_id": "///A/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 600, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/73/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 604, "atom2_serNum": 648, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/73/OE1", "atom2_id": "///A/79/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 605, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/73/OE2", "atom2_id": "///A/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 613, "atom2_serNum": 967, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/74/ND2", "atom2_id": "///A/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 621, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/76/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 628, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/77/O", "atom2_id": "///A/80/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 632, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///A/78/N", "atom2_id": "///A/78/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 661, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/81/O", "atom2_id": "///A/117/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 681, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/84/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 689, "atom2_serNum": 711, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/85/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 692, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/85/OD1", "atom2_id": "///A/87/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 697, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 705, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/87/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 710, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/87/NZ", "atom2_id": "c. G & i. \\-1 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 103, "atom1_serNum": 756, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/93/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 761, "atom2_serNum": 2086, "donAcc_type": "acceptable", "distance": 3.326, "atom1_id": "///A/94/N", "atom2_id": "///A/1163/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 105, "atom1_serNum": 764, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/94/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 769, "atom2_serNum": 2085, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///A/94/OE2", "atom2_id": "///A/1163/O2", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 107, "atom1_serNum": 816, "atom2_serNum": 833, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/101/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 816, "atom2_serNum": 841, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 819, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///A/101/OD1", "atom2_id": "///A/104/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 824, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/102/O", "atom2_id": "///A/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 844, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/105/O", "atom2_id": "///A/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 852, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/106/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 862, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///A/107/OD1", "atom2_id": "///A/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 867, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 869, "atom2_serNum": 890, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///A/108/OG1", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 874, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 881, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 893, "atom2_serNum": 926, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 902, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 913, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/113/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 913, "atom2_serNum": 947, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 921, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 929, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 941, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 950, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 959, "atom2_serNum": 992, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 967, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 976, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 976, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/120/O", "atom2_id": "///A/124/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 987, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/121/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 987, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 995, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/122/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1011, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1014, "atom2_serNum": 1038, "donAcc_type": "standard", "distance": 3.994, "atom1_id": "///A/124/OD1", "atom2_id": "///A/127/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1019, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1025, "atom2_serNum": 1052, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1033, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1042, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1042, "atom2_serNum": 1072, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///A/128/O", "atom2_id": "///A/132/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1050, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1055, "atom2_serNum": 1081, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1055, "atom2_serNum": 1086, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///A/130/O", "atom2_id": "///A/134/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1061, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1070, "atom2_serNum": 1096, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1076, "atom2_serNum": 1107, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1084, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1086, "atom2_serNum": 1736, "donAcc_type": "acceptable", "distance": 3.217, "atom1_id": "///A/134/OG1", "atom2_id": "///G/17/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 148, "atom1_serNum": 1091, "atom2_serNum": 1123, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1099, "atom2_serNum": 1130, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1103, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/136/NE", "atom2_id": "///A/154/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1106, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/136/NH2", "atom2_id": "///A/154/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1106, "atom2_serNum": 1243, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/136/NH2", "atom2_id": "///A/154/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1110, "atom2_serNum": 1138, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1114, "atom2_serNum": 1737, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/137/ND2", "atom2_id": "///G/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 155, "atom1_serNum": 1118, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1118, "atom2_serNum": 1151, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/138/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1126, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/139/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1186, "atom2_serNum": 1191, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///A/147/OG1", "atom2_id": "///A/148/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1191, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/148/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1197, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1200, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/149/OD1", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1205, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1216, "atom2_serNum": 1244, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1222, "atom2_serNum": 1244, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/152/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1222, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1230, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1256, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/156/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1265, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/157/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1273, "atom2_serNum": 1284, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///A/157/OH", "atom2_id": "///A/158/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1277, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/158/O", "atom2_id": "///A/162/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1283, "atom2_serNum": 2084, "donAcc_type": "acceptable", "distance": 3.312, "atom1_id": "///A/158/NH1", "atom2_id": "///A/1163/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 172, "atom1_serNum": 1288, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/159/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1296, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/160/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1414, "atom2_serNum": 1732, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///G/1/N6", "atom2_id": "///G/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1415, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///G/1/N1", "atom2_id": "///G/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1436, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///G/2/O6", "atom2_id": "///G/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1437, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///G/2/N1", "atom2_id": "///G/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 1439, "atom2_serNum": 1709, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///G/2/N2", "atom2_id": "///G/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1439, "atom2_serNum": 1793, "donAcc_type": "standard", "distance": 3.990, "atom1_id": "///G/2/N2", "atom2_id": "///G/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1452, "atom2_serNum": 1815, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///G/3/O2'", "atom2_id": "///G/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1459, "atom2_serNum": 1692, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///G/3/O6", "atom2_id": "///G/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1460, "atom2_serNum": 1690, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///G/3/N1", "atom2_id": "///G/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1462, "atom2_serNum": 1689, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///G/3/N2", "atom2_id": "///G/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1462, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///G/3/N2", "atom2_id": "///G/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 1479, "atom2_serNum": 1807, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///G/4/O2", "atom2_id": "///G/20/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1480, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///G/4/N3", "atom2_id": "///G/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1482, "atom2_serNum": 1670, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///G/4/O4", "atom2_id": "///G/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1491, "atom2_serNum": 1829, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///G/5/O4'", "atom2_id": "///G/21/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1495, "atom2_serNum": 1532, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///G/5/O2'", "atom2_id": "///G/7/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1499, "atom2_serNum": 1560, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///G/5/N7", "atom2_id": "///G/8/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1502, "atom2_serNum": 1560, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///G/5/O6", "atom2_id": "///G/8/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1505, "atom2_serNum": 1844, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///G/5/N2", "atom2_id": "///G/22/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1506, "atom2_serNum": 1829, "donAcc_type": "acceptable", "distance": 2.607, "atom1_id": "///G/5/N3", "atom2_id": "///G/21/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 1564, "atom2_serNum": 1587, "donAcc_type": "questionable", "distance": 3.016, "atom1_id": "///G/8/O2", "atom2_id": "///G/9/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1585, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///G/9/N3", "atom2_id": "///G/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1587, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///G/9/O4", "atom2_id": "///G/25/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1607, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///G/10/O6", "atom2_id": "///G/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1608, "atom2_serNum": 1900, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///G/10/N1", "atom2_id": "///G/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1610, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///G/10/N2", "atom2_id": "///G/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1627, "atom2_serNum": 1882, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///G/11/O2", "atom2_id": "///G/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1628, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/11/N3", "atom2_id": "///G/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1630, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///G/11/N4", "atom2_id": "///G/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1647, "atom2_serNum": 1857, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///G/12/O2", "atom2_id": "///G/22/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1648, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///G/12/N3", "atom2_id": "///G/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1650, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///G/12/O4", "atom2_id": "///G/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1685, "atom2_serNum": 1807, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///G/14/O2'", "atom2_id": "///G/20/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1689, "atom2_serNum": 1807, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///G/14/O2", "atom2_id": "///G/20/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1701, "atom2_serNum": 1803, "donAcc_type": "questionable", "distance": 3.025, "atom1_id": "///G/15/O4'", "atom2_id": "///G/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1705, "atom2_serNum": 1785, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///G/15/O2'", "atom2_id": "///G/19/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1705, "atom2_serNum": 1795, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///G/15/O2'", "atom2_id": "///G/19/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1716, "atom2_serNum": 1745, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///G/16/OP1", "atom2_id": "///G/17/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1761, "atom2_serNum": 1781, "donAcc_type": "questionable", "distance": 2.743, "atom1_id": "///G/18/O4'", "atom2_id": "///G/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1785, "atom2_serNum": 1803, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///G/19/O2'", "atom2_id": "///G/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1829, "atom2_serNum": 1844, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///G/21/O2'", "atom2_id": "///G/22/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1839, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///G/21/N2", "atom2_id": "///G/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1947, "atom2_serNum": 2101, "donAcc_type": "acceptable", "distance": 2.871, "atom1_id": "///G/26/N2", "atom2_id": "///G/1032/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 217, "atom1_serNum": 1948, "atom2_serNum": 2101, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///G/26/N3", "atom2_id": "///G/1032/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 218, "atom1_serNum": 1956, "atom2_serNum": 2102, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///G/27/O4'", "atom2_id": "///G/1032/O2", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 219, "atom1_serNum": 1984, "atom2_serNum": 2029, "donAcc_type": "questionable", "distance": 3.138, "atom1_id": "///G/28/O2", "atom2_id": "///G/30/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1987, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///G/28/O4", "atom2_id": "///G/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 2022, "atom2_serNum": 2041, "donAcc_type": "acceptable", "distance": 3.611, "atom1_id": "///G/30/O2'", "atom2_id": "///G/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2xdb", "num_aaChains": 1, "aaChains": "A=162", "num_naChains": 1, "naChains": "G=36", "num_atoms": 2206, "num_waters": 100, "num_metals": 6, "metals_desc": "Co=6", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }