{ "num_pairs": 45, "pairs": [ { "index": 1, "nt1": "///R/11", "nt2": "///R/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.187, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.920, "chi2": -126.031, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.020, "C1C1_dist": 10.373, "N1N9_dist": 8.637, "C6C8_dist": 9.571, "CNNC_torsion": -9.011, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 12.927, "planarity": 0.180, "simple_Shear": 1.029, "simple_Stretch": -0.402, "simple_Buckle": -0.237, "simple_Propeller": -12.924, "bp_simpleParams": [ 1.029, -0.402, -0.151, -0.237, -12.924, 1.819 ], "bp_params": [ 0.985, -0.501, -0.151, -1.505, -12.839, 1.830 ], "frame": { "rmsd": null, "origin": [ 26.608, -27.811, -19.234 ], "x_axis": [ -0.758, -0.369, -0.538 ], "y_axis": [ -0.031, -0.803, 0.595 ], "z_axis": [ -0.652, 0.468, 0.597 ], "quaternion": [ -0.095, -0.335, 0.299, 0.888 ] } }, { "index": 2, "nt1": "///R/12", "nt2": "///R/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.442, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.318, "chi2": -166.675, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.138, "C1C1_dist": 10.386, "N1N9_dist": 8.737, "C6C8_dist": 9.739, "CNNC_torsion": -11.303, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.84]", "interBase_angle": 35.618, "planarity": 0.402, "simple_Shear": 0.333, "simple_Stretch": -0.065, "simple_Buckle": -20.854, "simple_Propeller": -28.875, "bp_simpleParams": [ 0.333, -0.065, -0.955, -20.854, -28.875, 8.029 ], "bp_params": [ 0.329, -0.086, -0.955, -22.496, -27.615, 8.118 ], "frame": { "rmsd": null, "origin": [ 22.491, -25.889, -19.213 ], "x_axis": [ -0.423, -0.856, -0.296 ], "y_axis": [ 0.175, -0.398, 0.900 ], "z_axis": [ -0.889, 0.329, 0.319 ], "quaternion": [ -0.353, -0.405, 0.420, 0.731 ] } }, { "index": 3, "nt1": "///R/13", "nt2": "///R/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.177, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.444, "chi2": -134.477, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.494, "C1C1_dist": 10.607, "N1N9_dist": 8.776, "C6C8_dist": 9.613, "CNNC_torsion": -13.121, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.73],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 21.446, "planarity": 0.271, "simple_Shear": 0.005, "simple_Stretch": -0.283, "simple_Buckle": -20.445, "simple_Propeller": -6.477, "bp_simpleParams": [ 0.005, -0.283, 0.809, -20.445, -6.477, -2.693 ], "bp_params": [ 0.005, -0.283, 0.809, -20.467, -6.406, -2.654 ], "frame": { "rmsd": null, "origin": [ 19.103, -26.497, -18.477 ], "x_axis": [ -0.039, -0.888, 0.457 ], "y_axis": [ 0.549, 0.363, 0.753 ], "z_axis": [ -0.835, 0.281, 0.474 ], "quaternion": [ 0.670, 0.176, -0.482, -0.536 ] } }, { "index": 4, "nt1": "///R/14", "nt2": "///R/16", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -117.066, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 115.922, "chi2": -173.246, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.436, "C1C1_dist": 8.412, "N1N9_dist": 8.379, "C6C8_dist": 8.533, "CNNC_torsion": -4.544, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N7[3.74]", "interBase_angle": 38.735, "planarity": 0.509, "simple_Shear": 0.068, "simple_Stretch": 8.259, "simple_Buckle": -32.333, "simple_Propeller": -21.331, "bp_simpleParams": [ 0.068, 8.259, 0.613, -32.333, -21.331, 0.624 ], "bp_params": [ 7.425, 3.617, 0.613, -33.354, 19.696, 0.608 ], "frame": { "rmsd": null, "origin": [ 15.682, -24.694, -21.718 ], "x_axis": [ 0.235, -0.621, 0.748 ], "y_axis": [ 0.086, 0.780, 0.620 ], "z_axis": [ -0.968, -0.081, 0.237 ], "quaternion": [ 0.750, 0.234, -0.572, -0.235 ] } }, { "index": 5, "nt1": "///R/14", "nt2": "///R/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -117.066, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.983, "chi2": -166.105, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.339, "C1C1_dist": 10.860, "N1N9_dist": 9.154, "C6C8_dist": 10.156, "CNNC_torsion": -8.532, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.42],N1(imino)-N3[3.17],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 16.105, "planarity": 0.194, "simple_Shear": -0.287, "simple_Stretch": 0.218, "simple_Buckle": 15.819, "simple_Propeller": -3.023, "bp_simpleParams": [ -0.287, 0.218, 0.694, 15.819, -3.023, 5.223 ], "bp_params": [ -0.293, 0.211, 0.694, 15.892, -2.610, 5.175 ], "frame": { "rmsd": null, "origin": [ 16.692, -25.832, -17.912 ], "x_axis": [ 0.397, -0.650, 0.648 ], "y_axis": [ 0.482, 0.749, 0.456 ], "z_axis": [ -0.781, 0.131, 0.610 ], "quaternion": [ 0.830, 0.098, -0.431, -0.341 ] } }, { "index": 6, "nt1": "///R/14", "nt2": "///R/95", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -117.066, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 103.515, "chi2": 64.252, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 15.222, "C1C1_dist": 9.855, "N1N9_dist": 8.944, "C6C8_dist": 9.986, "CNNC_torsion": 142.063, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.44]", "interBase_angle": 53.098, "planarity": 0.769, "simple_Shear": 2.522, "simple_Stretch": 3.886, "simple_Buckle": -35.970, "simple_Propeller": -39.059, "bp_simpleParams": [ 2.522, 3.886, 2.391, -35.970, -39.059, -88.890 ], "bp_params": [ 2.453, -3.929, 2.391, -20.323, 49.055, -93.397 ], "frame": { "rmsd": null, "origin": [ 16.999, -23.614, -19.314 ], "x_axis": [ 0.130, 0.120, 0.984 ], "y_axis": [ -0.211, 0.973, -0.091 ], "z_axis": [ -0.969, -0.195, 0.152 ], "quaternion": [ 0.751, 0.035, -0.650, 0.110 ] } }, { "index": 7, "nt1": "///R/17", "nt2": "///R/93", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -161.864, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 29.931, "chi2": -166.105, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 133.179, "C1C1_dist": 8.145, "N1N9_dist": 7.923, "C6C8_dist": 9.392, "CNNC_torsion": -56.612, "hbonds_num": 2, "hbonds_desc": "N3-O2'(hydroxyl)[2.86],N4(amino)-O2(carbonyl)[3.51]", "interBase_angle": 52.468, "planarity": 0.604, "simple_Shear": -5.306, "simple_Stretch": 3.293, "simple_Buckle": 6.510, "simple_Propeller": -52.063, "bp_simpleParams": [ -5.306, 3.293, 2.153, 6.510, -52.063, 64.698 ], "bp_params": [ -6.099, -1.338, 2.153, 40.680, -33.137, 63.693 ], "frame": { "rmsd": null, "origin": [ 14.728, -26.187, -20.497 ], "x_axis": [ 0.410, -0.194, 0.891 ], "y_axis": [ 0.017, 0.978, 0.206 ], "z_axis": [ -0.912, -0.069, 0.404 ], "quaternion": [ 0.836, 0.082, -0.540, -0.063 ] } }, { "index": 8, "nt1": "///R/18", "nt2": "///R/92", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -167.879, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.468, "chi2": -168.931, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 113.814, "C1C1_dist": 9.432, "N1N9_dist": 8.951, "C6C8_dist": 10.400, "CNNC_torsion": -39.181, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.89],N1-O2'(hydroxyl)[2.87]", "interBase_angle": 31.337, "planarity": 0.424, "simple_Shear": -5.232, "simple_Stretch": 3.018, "simple_Buckle": -19.389, "simple_Propeller": -24.619, "bp_simpleParams": [ -5.232, 3.018, 1.046, -19.389, -24.619, 47.731 ], "bp_params": [ -6.021, -0.483, 1.046, -1.906, -31.279, 49.345 ], "frame": { "rmsd": null, "origin": [ 11.185, -27.503, -18.756 ], "x_axis": [ 0.572, 0.381, 0.726 ], "y_axis": [ -0.088, 0.909, -0.408 ], "z_axis": [ -0.816, 0.170, 0.553 ], "quaternion": [ 0.871, -0.166, -0.443, 0.135 ] } }, { "index": 9, "nt1": "///R/19", "nt2": "///R/47", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "c.W", "DSSR": "c.-W", "intra_chain": true, "chi1": -177.582, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 14.519, "chi2": -93.801, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 29.420, "C1C1_dist": 14.463, "N1N9_dist": 11.774, "C6C8_dist": 10.966, "CNNC_torsion": -41.280, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.30]", "interBase_angle": 16.842, "planarity": 0.254, "simple_Shear": -1.594, "simple_Stretch": 3.076, "simple_Buckle": -16.383, "simple_Propeller": 3.903, "bp_simpleParams": [ -1.594, 3.076, 0.509, -16.383, 3.903, -68.850 ], "bp_params": [ -2.161, 2.708, 0.509, -16.830, 0.620, -68.273 ], "frame": { "rmsd": null, "origin": [ 8.013, -26.986, -16.836 ], "x_axis": [ -0.137, 0.961, -0.240 ], "y_axis": [ -0.565, -0.274, -0.778 ], "z_axis": [ -0.814, 0.029, 0.580 ], "quaternion": [ 0.541, -0.373, -0.266, 0.706 ] } }, { "index": 10, "nt1": "///R/20", "nt2": "///R/358", "bp": "A-a", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": 173.038, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 13.481, "chi2": -174.332, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.156, "C1C1_dist": 12.957, "N1N9_dist": 10.159, "C6C8_dist": 8.546, "CNNC_torsion": -170.829, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N7[3.36],N1-N6(amino)[3.19]", "interBase_angle": 2.547, "planarity": 0.067, "simple_Shear": 2.189, "simple_Stretch": 3.764, "simple_Buckle": 2.424, "simple_Propeller": 0.780, "bp_simpleParams": [ 2.189, 3.764, 0.326, 2.424, 0.780, -114.974 ], "bp_params": [ 3.546, 2.527, 0.326, 2.530, -0.289, -114.962 ], "frame": { "rmsd": null, "origin": [ 6.826, -26.173, -13.088 ], "x_axis": [ -0.508, 0.338, -0.792 ], "y_axis": [ -0.227, -0.940, -0.256 ], "z_axis": [ -0.831, 0.050, 0.554 ], "quaternion": [ 0.163, -0.468, -0.060, 0.866 ] } }, { "index": 11, "nt1": "///R/21", "nt2": "///R/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.874, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.600, "chi2": -163.490, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.458, "C1C1_dist": 10.940, "N1N9_dist": 9.039, "C6C8_dist": 9.821, "CNNC_torsion": 6.984, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[3.04]", "interBase_angle": 8.519, "planarity": 0.102, "simple_Shear": -0.586, "simple_Stretch": -0.175, "simple_Buckle": 2.617, "simple_Propeller": 8.107, "bp_simpleParams": [ -0.586, -0.175, -0.037, 2.617, 8.107, -5.145 ], "bp_params": [ -0.575, -0.206, -0.037, 2.178, 8.236, -5.157 ], "frame": { "rmsd": null, "origin": [ 3.871, -23.271, -11.806 ], "x_axis": [ -0.410, 0.650, -0.640 ], "y_axis": [ -0.415, -0.758, -0.503 ], "z_axis": [ -0.812, 0.059, 0.581 ], "quaternion": [ 0.321, -0.438, -0.134, 0.829 ] } }, { "index": 12, "nt1": "///R/22", "nt2": "///R/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.612, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.168, "chi2": 177.025, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.106, "C1C1_dist": 10.633, "N1N9_dist": 8.921, "C6C8_dist": 9.887, "CNNC_torsion": 1.505, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[3.14]", "interBase_angle": 10.467, "planarity": 0.153, "simple_Shear": 0.789, "simple_Stretch": -0.067, "simple_Buckle": 9.844, "simple_Propeller": 3.557, "bp_simpleParams": [ 0.789, -0.067, -0.013, 9.844, 3.557, 3.014 ], "bp_params": [ 0.782, -0.126, -0.013, 10.084, 2.806, 3.003 ], "frame": { "rmsd": null, "origin": [ 1.301, -21.169, -9.891 ], "x_axis": [ -0.612, 0.026, -0.790 ], "y_axis": [ -0.010, -1.000, -0.025 ], "z_axis": [ -0.791, -0.007, 0.612 ], "quaternion": [ 0.010, -0.440, -0.009, 0.898 ] } }, { "index": 13, "nt1": "///R/23", "nt2": "///R/44", "bp": "A-C", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -136.617, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 109.396, "chi2": -155.895, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.515, "C1C1_dist": 8.728, "N1N9_dist": 7.876, "C6C8_dist": 8.447, "CNNC_torsion": -94.296, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[3.18]", "interBase_angle": 23.347, "planarity": 0.395, "simple_Shear": 8.063, "simple_Stretch": 2.843, "simple_Buckle": 12.147, "simple_Propeller": 19.938, "bp_simpleParams": [ 8.063, 2.843, 1.476, 12.147, 19.938, 7.769 ], "bp_params": [ 6.849, -5.117, 1.476, 23.322, 1.071, 7.609 ], "frame": { "rmsd": null, "origin": [ -0.523, -20.763, -7.219 ], "x_axis": [ -0.216, -0.760, -0.612 ], "y_axis": [ 0.449, -0.634, 0.629 ], "z_axis": [ -0.867, -0.139, 0.479 ], "quaternion": [ -0.396, -0.485, 0.160, 0.763 ] } }, { "index": 14, "nt1": "///R/25", "nt2": "///R/42", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": 172.483, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.978, "chi2": -167.885, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 98.122, "C1C1_dist": 9.430, "N1N9_dist": 8.294, "C6C8_dist": 8.746, "CNNC_torsion": -113.535, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.81],N6(amino)-O2'(hydroxyl)[2.77],N6(amino)-N3[2.99]", "interBase_angle": 7.138, "planarity": 0.115, "simple_Shear": -7.567, "simple_Stretch": 2.434, "simple_Buckle": -6.190, "simple_Propeller": -3.553, "bp_simpleParams": [ -7.567, 2.434, 0.521, -6.190, -3.553, -3.433 ], "bp_params": [ -6.712, -4.258, 0.521, -1.232, -7.031, -3.440 ], "frame": { "rmsd": null, "origin": [ -6.759, -19.925, -2.394 ], "x_axis": [ 0.040, -0.954, -0.298 ], "y_axis": [ 0.891, -0.101, 0.443 ], "z_axis": [ -0.453, -0.283, 0.845 ], "quaternion": [ 0.668, 0.272, -0.058, -0.690 ] } }, { "index": 15, "nt1": "///R/26", "nt2": "///R/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.213, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.601, "chi2": -168.632, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.824, "C1C1_dist": 10.760, "N1N9_dist": 9.113, "C6C8_dist": 10.164, "CNNC_torsion": -10.502, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[3.12],N4(amino)-O6(carbonyl)[3.45]", "interBase_angle": 12.653, "planarity": 0.160, "simple_Shear": 0.374, "simple_Stretch": 0.166, "simple_Buckle": 5.183, "simple_Propeller": -11.543, "bp_simpleParams": [ 0.374, 0.166, 0.182, 5.183, -11.543, 6.329 ], "bp_params": [ 0.378, 0.155, 0.182, 4.825, -11.697, 6.356 ], "frame": { "rmsd": null, "origin": [ -8.703, -21.275, -0.010 ], "x_axis": [ 0.875, -0.450, 0.179 ], "y_axis": [ 0.321, 0.816, 0.481 ], "z_axis": [ -0.362, -0.363, 0.858 ], "quaternion": [ 0.942, 0.224, -0.144, -0.205 ] } }, { "index": 16, "nt1": "///R/27", "nt2": "///R/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.588, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.032, "chi2": -178.953, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.879, "C1C1_dist": 10.576, "N1N9_dist": 8.794, "C6C8_dist": 9.695, "CNNC_torsion": -12.242, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 17.517, "planarity": 0.217, "simple_Shear": 0.365, "simple_Stretch": -0.292, "simple_Buckle": 9.722, "simple_Propeller": -14.572, "bp_simpleParams": [ 0.365, -0.292, 0.181, 9.722, -14.572, -0.224 ], "bp_params": [ 0.357, -0.301, 0.181, 9.311, -14.838, -0.226 ], "frame": { "rmsd": null, "origin": [ -10.182, -24.053, 1.816 ], "x_axis": [ 0.962, 0.031, 0.271 ], "y_axis": [ -0.126, 0.932, 0.339 ], "z_axis": [ -0.242, -0.360, 0.901 ], "quaternion": [ 0.974, 0.179, -0.132, 0.040 ] } }, { "index": 17, "nt1": "///R/28", "nt2": "///R/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.117, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.762, "chi2": -162.486, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.054, "C1C1_dist": 10.769, "N1N9_dist": 9.170, "C6C8_dist": 10.305, "CNNC_torsion": -15.575, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.86],N1-N3(imino)[3.33]", "interBase_angle": 18.395, "planarity": 0.226, "simple_Shear": -0.714, "simple_Stretch": 0.426, "simple_Buckle": 1.923, "simple_Propeller": -18.294, "bp_simpleParams": [ -0.714, 0.426, 0.180, 1.923, -18.294, 9.977 ], "bp_params": [ -0.742, 0.376, 0.180, 3.159, -18.121, 10.098 ], "frame": { "rmsd": null, "origin": [ -9.877, -26.506, 4.358 ], "x_axis": [ 0.817, 0.551, 0.169 ], "y_axis": [ -0.576, 0.781, 0.242 ], "z_axis": [ 0.002, -0.295, 0.955 ], "quaternion": [ 0.943, 0.143, -0.044, 0.299 ] } }, { "index": 18, "nt1": "///R/29", "nt2": "///R/38", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.593, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 73.204, "chi2": -179.048, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.854, "C1C1_dist": 10.418, "N1N9_dist": 8.909, "C6C8_dist": 9.987, "CNNC_torsion": -13.174, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.71],N3(imino)-O6(carbonyl)[3.25]", "interBase_angle": 15.507, "planarity": 0.194, "simple_Shear": 2.915, "simple_Stretch": 0.456, "simple_Buckle": 7.004, "simple_Propeller": -13.835, "bp_simpleParams": [ 2.915, 0.456, 0.161, 7.004, -13.835, 9.529 ], "bp_params": [ 2.924, -0.395, 0.161, 2.742, -15.263, 9.611 ], "frame": { "rmsd": null, "origin": [ -8.839, -27.442, 7.495 ], "x_axis": [ 0.168, 0.959, 0.229 ], "y_axis": [ -0.984, 0.151, 0.093 ], "z_axis": [ 0.054, -0.240, 0.969 ], "quaternion": [ 0.756, 0.110, -0.058, 0.642 ] } }, { "index": 19, "nt1": "///R/30", "nt2": "///R/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.707, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.064, "chi2": -167.265, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.234, "C1C1_dist": 10.621, "N1N9_dist": 8.768, "C6C8_dist": 9.630, "CNNC_torsion": -10.540, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.71],O4(carbonyl)-N6(amino)[2.66]", "interBase_angle": 15.447, "planarity": 0.186, "simple_Shear": 0.151, "simple_Stretch": -0.316, "simple_Buckle": -0.831, "simple_Propeller": -15.425, "bp_simpleParams": [ 0.151, -0.316, -0.145, -0.831, -15.425, -3.332 ], "bp_params": [ 0.147, -0.317, -0.145, -1.014, -15.414, -3.362 ], "frame": { "rmsd": null, "origin": [ -6.498, -28.209, 10.098 ], "x_axis": [ -0.237, 0.968, 0.084 ], "y_axis": [ -0.953, -0.249, 0.173 ], "z_axis": [ 0.188, -0.039, 0.981 ], "quaternion": [ 0.611, 0.087, 0.043, 0.785 ] } }, { "index": 20, "nt1": "///R/31", "nt2": "///R/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.856, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.419, "chi2": -172.465, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.233, "C1C1_dist": 10.482, "N1N9_dist": 8.770, "C6C8_dist": 9.723, "CNNC_torsion": 0.474, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 1.967, "planarity": 0.034, "simple_Shear": 0.509, "simple_Stretch": -0.300, "simple_Buckle": 1.093, "simple_Propeller": 1.636, "bp_simpleParams": [ 0.509, -0.300, 0.037, 1.093, 1.636, 1.335 ], "bp_params": [ 0.495, -0.323, 0.037, 1.167, 1.583, 1.335 ], "frame": { "rmsd": null, "origin": [ -4.859, -26.938, 13.122 ], "x_axis": [ -0.760, 0.648, 0.051 ], "y_axis": [ -0.640, -0.760, 0.108 ], "z_axis": [ 0.109, 0.049, 0.993 ], "quaternion": [ 0.344, 0.043, 0.042, 0.937 ] } }, { "index": 21, "nt1": "///R/32", "nt2": "///R/35", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -154.767, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.795, "chi2": -150.992, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 13.609, "C1C1_dist": 9.455, "N1N9_dist": 8.233, "C6C8_dist": 8.387, "CNNC_torsion": -132.001, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.35],N2(amino)-N7[2.85]", "interBase_angle": 18.366, "planarity": 0.323, "simple_Shear": 8.162, "simple_Stretch": 3.361, "simple_Buckle": 12.045, "simple_Propeller": 13.865, "bp_simpleParams": [ 8.162, 3.361, 0.956, 12.045, 13.865, -21.172 ], "bp_params": [ 7.114, -5.225, 0.956, 18.108, -3.070, -20.921 ], "frame": { "rmsd": null, "origin": [ -1.805, -26.318, 15.818 ], "x_axis": [ -0.988, -0.150, -0.030 ], "y_axis": [ 0.146, -0.983, 0.109 ], "z_axis": [ -0.046, 0.104, 0.994 ], "quaternion": [ -0.074, -0.019, 0.054, 0.996 ] } }, { "index": 22, "nt1": "///R/34", "nt2": "///R/60", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -153.091, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.491, "chi2": -169.959, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 144.358, "C1C1_dist": 5.769, "N1N9_dist": 7.310, "C6C8_dist": 9.853, "CNNC_torsion": -47.855, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.70],N3-O2'(hydroxyl)[2.71]", "interBase_angle": 28.445, "planarity": 0.363, "simple_Shear": -0.732, "simple_Stretch": 7.416, "simple_Buckle": 2.008, "simple_Propeller": -28.374, "bp_simpleParams": [ -0.732, 7.416, 0.840, 2.008, -28.374, 150.792 ], "bp_params": [ -2.525, 7.011, 0.840, 8.853, -27.033, 151.482 ], "frame": { "rmsd": null, "origin": [ 6.388, -26.699, 19.846 ], "x_axis": [ 0.693, -0.717, 0.074 ], "y_axis": [ -0.712, -0.697, -0.090 ], "z_axis": [ 0.117, 0.009, -0.993 ], "quaternion": [ -0.027, 0.920, -0.389, 0.052 ] } }, { "index": 23, "nt1": "///R/35", "nt2": "///R/79", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -150.992, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.220, "chi2": 179.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.734, "C1C1_dist": 8.055, "N1N9_dist": 7.962, "C6C8_dist": 10.396, "CNNC_torsion": 163.820, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.04],N3-N2(amino)[3.27]", "interBase_angle": 17.523, "planarity": 0.308, "simple_Shear": 7.431, "simple_Stretch": 4.235, "simple_Buckle": -6.213, "simple_Propeller": -16.384, "bp_simpleParams": [ 7.431, 4.235, 0.917, -6.213, -16.384, 161.235 ], "bp_params": [ 3.108, 7.969, 0.917, 5.519, -16.631, 161.407 ], "frame": { "rmsd": null, "origin": [ 5.767, -26.161, 16.077 ], "x_axis": [ 0.168, -0.981, 0.098 ], "y_axis": [ -0.986, -0.169, -0.009 ], "z_axis": [ 0.026, -0.095, -0.995 ], "quaternion": [ 0.028, 0.764, -0.644, 0.040 ] } }, { "index": 24, "nt1": "///R/44", "nt2": "///R/83", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.895, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.218, "chi2": -99.588, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.545, "C1C1_dist": 10.685, "N1N9_dist": 8.964, "C6C8_dist": 9.936, "CNNC_torsion": -13.905, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 12.274, "planarity": 0.185, "simple_Shear": 0.177, "simple_Stretch": -0.103, "simple_Buckle": 3.864, "simple_Propeller": -11.650, "bp_simpleParams": [ 0.177, -0.103, 0.453, 3.864, -11.650, 2.071 ], "bp_params": [ 0.176, -0.105, 0.453, 3.723, -11.695, 2.081 ], "frame": { "rmsd": null, "origin": [ 1.844, -19.626, -3.687 ], "x_axis": [ -0.328, -0.756, -0.566 ], "y_axis": [ -0.627, 0.622, -0.468 ], "z_axis": [ 0.706, 0.202, -0.679 ], "quaternion": [ 0.392, -0.427, 0.811, -0.082 ] } }, { "index": 25, "nt1": "///R/45", "nt2": "///R/49", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 177.025, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.721, "chi2": -167.968, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.406, "C1C1_dist": 8.833, "N1N9_dist": 8.247, "C6C8_dist": 10.342, "CNNC_torsion": 163.816, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N1[2.84],N2(amino)-O2'(hydroxyl)[3.12],N2(amino)-N3[2.93]", "interBase_angle": 29.027, "planarity": 0.346, "simple_Shear": 6.485, "simple_Stretch": 3.485, "simple_Buckle": 23.973, "simple_Propeller": -16.366, "bp_simpleParams": [ 6.485, 3.485, 1.356, 23.973, -16.366, -147.181 ], "bp_params": [ -1.911, -7.110, 1.356, -28.329, -6.329, -146.256 ], "frame": { "rmsd": null, "origin": [ 3.596, -19.451, -7.021 ], "x_axis": [ -0.262, 0.961, -0.089 ], "y_axis": [ 0.763, 0.262, 0.591 ], "z_axis": [ 0.591, 0.087, -0.802 ], "quaternion": [ 0.223, 0.565, 0.763, 0.222 ] } }, { "index": 26, "nt1": "///R/48", "nt2": "///R/90", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -110.064, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 23.708, "chi2": -169.729, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 32.244, "C1C1_dist": 9.851, "N1N9_dist": 7.372, "C6C8_dist": 6.474, "CNNC_torsion": 161.434, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[3.18],N6(amino)-O2(carbonyl)[3.38]", "interBase_angle": 10.970, "planarity": 0.163, "simple_Shear": -4.707, "simple_Stretch": 2.013, "simple_Buckle": 7.359, "simple_Propeller": -8.135, "bp_simpleParams": [ -4.707, 2.013, -0.270, 7.359, -8.135, -98.566 ], "bp_params": [ -4.670, -2.099, -0.270, 10.969, -0.100, -98.306 ], "frame": { "rmsd": null, "origin": [ 11.510, -31.410, -8.927 ], "x_axis": [ 0.959, -0.210, 0.192 ], "y_axis": [ 0.197, 0.977, 0.084 ], "z_axis": [ -0.205, -0.043, 0.978 ], "quaternion": [ 0.989, 0.032, -0.100, -0.103 ] } }, { "index": 27, "nt1": "///R/50", "nt2": "///R/89", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.925, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 34.955, "chi2": -172.506, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.118, "C1C1_dist": 10.560, "N1N9_dist": 8.817, "C6C8_dist": 9.650, "CNNC_torsion": -13.815, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.79],N1(imino)-O2(carbonyl)[2.74]", "interBase_angle": 15.541, "planarity": 0.206, "simple_Shear": -3.223, "simple_Stretch": 0.176, "simple_Buckle": -1.805, "simple_Propeller": -15.436, "bp_simpleParams": [ -3.223, 0.176, 0.065, -1.805, -15.436, -1.815 ], "bp_params": [ -3.110, -0.864, 0.065, 3.237, -15.200, -1.830 ], "frame": { "rmsd": null, "origin": [ 15.050, -32.068, -4.941 ], "x_axis": [ 0.615, 0.787, -0.055 ], "y_axis": [ -0.773, 0.588, -0.238 ], "z_axis": [ -0.155, 0.189, 0.970 ], "quaternion": [ 0.891, -0.120, -0.028, 0.438 ] } }, { "index": 28, "nt1": "///R/51", "nt2": "///R/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.411, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.771, "chi2": -172.075, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.471, "C1C1_dist": 10.504, "N1N9_dist": 8.763, "C6C8_dist": 9.692, "CNNC_torsion": -9.982, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.69],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 24.216, "planarity": 0.275, "simple_Shear": -0.461, "simple_Stretch": -0.268, "simple_Buckle": 10.993, "simple_Propeller": -21.577, "bp_simpleParams": [ -0.461, -0.268, -0.458, 10.993, -21.577, 2.913 ], "bp_params": [ -0.444, -0.295, -0.458, 12.208, -20.913, 2.946 ], "frame": { "rmsd": null, "origin": [ 16.197, -31.278, -1.931 ], "x_axis": [ -0.001, 0.965, -0.263 ], "y_axis": [ -0.997, -0.021, -0.072 ], "z_axis": [ -0.075, 0.262, 0.962 ], "quaternion": [ 0.697, -0.120, 0.067, 0.704 ] } }, { "index": 29, "nt1": "///R/52", "nt2": "///R/87", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.672, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.461, "chi2": -167.360, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.850, "C1C1_dist": 10.790, "N1N9_dist": 9.004, "C6C8_dist": 9.917, "CNNC_torsion": -11.405, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 11.700, "planarity": 0.159, "simple_Shear": -0.493, "simple_Stretch": -0.100, "simple_Buckle": -5.448, "simple_Propeller": -10.355, "bp_simpleParams": [ -0.493, -0.100, 0.298, -5.448, -10.355, -0.285 ], "bp_params": [ -0.487, -0.125, 0.298, -4.893, -10.628, -0.286 ], "frame": { "rmsd": null, "origin": [ 17.046, -29.448, 1.445 ], "x_axis": [ -0.537, 0.689, -0.487 ], "y_axis": [ -0.821, -0.561, 0.112 ], "z_axis": [ -0.196, 0.460, 0.866 ], "quaternion": [ 0.438, -0.199, 0.166, 0.861 ] } }, { "index": 30, "nt1": "///R/53", "nt2": "///R/55", "bp": "U+C", "name": "--", "Saenger": "--", "LW": "c.H", "DSSR": "c.+M", "intra_chain": true, "chi1": -85.517, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 105.801, "chi2": -167.301, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 32.016, "C1C1_dist": 9.723, "N1N9_dist": 8.874, "C6C8_dist": 9.121, "CNNC_torsion": -10.718, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.42]", "interBase_angle": 12.219, "planarity": 0.143, "simple_Shear": -0.399, "simple_Stretch": 5.389, "simple_Buckle": 11.837, "simple_Propeller": 3.031, "bp_simpleParams": [ -0.399, 5.389, -0.329, 11.837, 3.031, -43.606 ], "bp_params": [ 5.317, 0.967, -0.329, 4.259, -11.452, -43.777 ], "frame": { "rmsd": null, "origin": [ 16.484, -24.644, 6.425 ], "x_axis": [ -0.980, -0.196, -0.038 ], "y_axis": [ 0.151, -0.852, 0.502 ], "z_axis": [ -0.131, 0.486, 0.864 ], "quaternion": [ -0.090, -0.044, 0.257, 0.961 ] } }, { "index": 31, "nt1": "///R/54", "nt2": "///R/82", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -177.746, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 5.784, "chi2": -90.754, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 42.446, "C1C1_dist": 13.004, "N1N9_dist": 10.474, "C6C8_dist": 9.807, "CNNC_torsion": -179.328, "hbonds_num": 1, "hbonds_desc": "N4(amino)-N1[2.77]", "interBase_angle": 6.375, "planarity": 0.093, "simple_Shear": -4.247, "simple_Stretch": 2.856, "simple_Buckle": 3.839, "simple_Propeller": 5.089, "bp_simpleParams": [ -4.247, 2.856, 0.438, 3.839, 5.089, -70.304 ], "bp_params": [ -5.111, 0.267, 0.438, 0.676, 6.339, -70.386 ], "frame": { "rmsd": null, "origin": [ 17.409, -29.130, 5.069 ], "x_axis": [ -0.849, -0.445, 0.285 ], "y_axis": [ 0.524, -0.639, 0.563 ], "z_axis": [ -0.068, 0.627, 0.776 ], "quaternion": [ -0.268, 0.060, 0.329, 0.903 ] } }, { "index": 32, "nt1": "///R/54", "nt2": "///R/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.746, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.993, "chi2": -169.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.639, "C1C1_dist": 10.646, "N1N9_dist": 8.925, "C6C8_dist": 9.894, "CNNC_torsion": -6.697, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 13.674, "planarity": 0.156, "simple_Shear": -0.235, "simple_Stretch": -0.120, "simple_Buckle": 6.373, "simple_Propeller": -12.098, "bp_simpleParams": [ -0.235, -0.120, -0.218, 6.373, -12.098, 2.912 ], "bp_params": [ -0.231, -0.127, -0.218, 6.738, -11.899, 2.923 ], "frame": { "rmsd": null, "origin": [ 19.493, -27.942, 4.682 ], "x_axis": [ -0.972, -0.065, -0.228 ], "y_axis": [ -0.074, -0.830, 0.553 ], "z_axis": [ -0.225, 0.554, 0.802 ], "quaternion": [ 0.002, -0.119, 0.292, 0.949 ] } }, { "index": 33, "nt1": "///R/55", "nt2": "///R/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.301, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.816, "chi2": 177.846, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.232, "C1C1_dist": 10.714, "N1N9_dist": 8.928, "C6C8_dist": 9.840, "CNNC_torsion": -3.015, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[2.81]", "interBase_angle": 1.357, "planarity": 0.065, "simple_Shear": -0.504, "simple_Stretch": -0.180, "simple_Buckle": -1.269, "simple_Propeller": -0.479, "bp_simpleParams": [ -0.504, -0.180, 0.323, -1.269, -0.479, -0.181 ], "bp_params": [ -0.493, -0.207, 0.323, -1.241, -0.548, -0.181 ], "frame": { "rmsd": null, "origin": [ 18.879, -23.912, 6.350 ], "x_axis": [ -0.832, -0.551, 0.056 ], "y_axis": [ 0.504, -0.711, 0.491 ], "z_axis": [ -0.231, 0.437, 0.869 ], "quaternion": [ -0.286, -0.048, 0.251, 0.924 ] } }, { "index": 34, "nt1": "///R/56", "nt2": "///R/84", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 173.572, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.496, "chi2": -172.109, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.420, "C1C1_dist": 10.918, "N1N9_dist": 9.184, "C6C8_dist": 10.164, "CNNC_torsion": 3.618, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.28],N1(imino)-N3[3.12],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 5.101, "planarity": 0.059, "simple_Shear": -0.162, "simple_Stretch": 0.151, "simple_Buckle": 3.612, "simple_Propeller": 3.602, "bp_simpleParams": [ -0.162, 0.151, 0.042, 3.612, 3.602, 3.361 ], "bp_params": [ -0.164, 0.149, 0.042, 3.575, 3.638, 3.361 ], "frame": { "rmsd": null, "origin": [ 16.358, -21.833, 7.975 ], "x_axis": [ -0.470, -0.864, 0.182 ], "y_axis": [ 0.819, -0.350, 0.454 ], "z_axis": [ -0.329, 0.363, 0.872 ], "quaternion": [ 0.513, 0.045, -0.249, -0.820 ] } }, { "index": 35, "nt1": "///R/57", "nt2": "///R/81", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.901, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.119, "chi2": -149.237, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.671, "C1C1_dist": 10.938, "N1N9_dist": 9.080, "C6C8_dist": 9.835, "CNNC_torsion": -5.224, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.01],N1(imino)-O2(carbonyl)[3.24]", "interBase_angle": 6.605, "planarity": 0.089, "simple_Shear": -1.444, "simple_Stretch": -0.052, "simple_Buckle": 0.015, "simple_Propeller": -6.605, "bp_simpleParams": [ -1.444, -0.052, -0.053, 0.015, -6.605, -8.657 ], "bp_params": [ -1.423, -0.255, -0.053, 0.947, -6.537, -8.671 ], "frame": { "rmsd": null, "origin": [ 13.193, -22.850, 10.569 ], "x_axis": [ 0.253, -0.912, 0.323 ], "y_axis": [ 0.885, 0.353, 0.305 ], "z_axis": [ -0.392, 0.209, 0.896 ], "quaternion": [ 0.791, 0.030, -0.226, -0.568 ] } }, { "index": 36, "nt1": "///R/58", "nt2": "///R/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.903, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.807, "chi2": 177.191, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.539, "C1C1_dist": 10.454, "N1N9_dist": 8.869, "C6C8_dist": 9.953, "CNNC_torsion": -12.492, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.50],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[3.31]", "interBase_angle": 21.068, "planarity": 0.259, "simple_Shear": 0.059, "simple_Stretch": 0.031, "simple_Buckle": 14.030, "simple_Propeller": -15.717, "bp_simpleParams": [ 0.059, 0.031, 0.147, 14.030, -15.717, 8.124 ], "bp_params": [ 0.059, 0.031, 0.147, 14.143, -15.614, 8.139 ], "frame": { "rmsd": null, "origin": [ 11.595, -23.520, 13.311 ], "x_axis": [ 0.795, -0.492, 0.355 ], "y_axis": [ 0.536, 0.844, -0.029 ], "z_axis": [ -0.286, 0.213, 0.934 ], "quaternion": [ 0.945, -0.064, -0.170, -0.272 ] } }, { "index": 37, "nt1": "///R/59", "nt2": "///R/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.047, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.818, "chi2": 179.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.381, "C1C1_dist": 10.270, "N1N9_dist": 8.584, "C6C8_dist": 9.566, "CNNC_torsion": -19.135, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 23.184, "planarity": 0.284, "simple_Shear": 1.178, "simple_Stretch": -0.371, "simple_Buckle": 7.469, "simple_Propeller": -21.948, "bp_simpleParams": [ 1.178, -0.371, 0.122, 7.469, -21.948, 4.123 ], "bp_params": [ 1.131, -0.497, 0.122, 4.970, -22.645, 4.201 ], "frame": { "rmsd": null, "origin": [ 9.974, -24.103, 16.631 ], "x_axis": [ 0.979, 0.083, 0.184 ], "y_axis": [ -0.045, 0.978, -0.202 ], "z_axis": [ -0.197, 0.189, 0.962 ], "quaternion": [ 0.990, -0.099, -0.096, 0.032 ] } }, { "index": 38, "nt1": "///R/60", "nt2": "///R/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.959, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.224, "chi2": -168.601, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.121, "C1C1_dist": 10.432, "N1N9_dist": 8.801, "C6C8_dist": 9.893, "CNNC_torsion": -13.020, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[3.28]", "interBase_angle": 13.457, "planarity": 0.176, "simple_Shear": 0.218, "simple_Stretch": -0.038, "simple_Buckle": -1.762, "simple_Propeller": -13.341, "bp_simpleParams": [ 0.218, -0.038, 0.343, -1.762, -13.341, 6.749 ], "bp_params": [ 0.218, -0.041, 0.343, -1.991, -13.308, 6.794 ], "frame": { "rmsd": null, "origin": [ 9.621, -25.237, 20.503 ], "x_axis": [ 0.908, 0.419, -0.005 ], "y_axis": [ -0.405, 0.874, -0.270 ], "z_axis": [ -0.109, 0.247, 0.963 ], "quaternion": [ 0.968, -0.133, -0.027, 0.213 ] } }, { "index": 39, "nt1": "///R/61", "nt2": "///R/77", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -145.494, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.045, "chi2": -171.878, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.145, "C1C1_dist": 10.484, "N1N9_dist": 9.075, "C6C8_dist": 10.271, "CNNC_torsion": -8.795, "hbonds_num": 1, "hbonds_desc": "N1*O4(carbonyl)[2.79]", "interBase_angle": 8.091, "planarity": 0.105, "simple_Shear": 2.936, "simple_Stretch": 0.845, "simple_Buckle": 6.304, "simple_Propeller": -5.072, "bp_simpleParams": [ 2.936, 0.845, 0.309, 6.304, -5.072, 13.501 ], "bp_params": [ 3.054, -0.082, 0.309, 4.478, -6.739, 13.514 ], "frame": { "rmsd": null, "origin": [ 11.054, -24.684, 23.492 ], "x_axis": [ 0.428, 0.846, -0.317 ], "y_axis": [ -0.895, 0.446, -0.016 ], "z_axis": [ 0.128, 0.291, 0.948 ], "quaternion": [ 0.840, -0.091, 0.132, 0.518 ] } }, { "index": 40, "nt1": "///R/63", "nt2": "///R/77", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW-.", "intra_chain": true, "chi1": -162.707, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 34.896, "chi2": -171.878, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.289, "C1C1_dist": 10.341, "N1N9_dist": 9.334, "C6C8_dist": 10.486, "CNNC_torsion": -8.503, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.87]", "interBase_angle": 29.604, "planarity": 0.324, "simple_Shear": -4.770, "simple_Stretch": 2.333, "simple_Buckle": 20.819, "simple_Propeller": -21.048, "bp_simpleParams": [ -4.770, 2.333, 0.714, 20.819, -21.048, 24.374 ], "bp_params": [ -5.295, -0.404, 0.714, 28.610, -7.609, 23.694 ], "frame": { "rmsd": null, "origin": [ 9.699, -28.350, 24.947 ], "x_axis": [ 0.354, 0.881, -0.313 ], "y_axis": [ -0.878, 0.428, 0.213 ], "z_axis": [ 0.322, 0.200, 0.925 ], "quaternion": [ 0.823, 0.004, 0.193, 0.535 ] } }, { "index": 41, "nt1": "///R/64", "nt2": "///R/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.647, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.976, "chi2": -172.058, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.849, "C1C1_dist": 10.331, "N1N9_dist": 8.772, "C6C8_dist": 9.831, "CNNC_torsion": -11.075, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[3.27]", "interBase_angle": 32.426, "planarity": 0.350, "simple_Shear": -0.037, "simple_Stretch": 0.025, "simple_Buckle": 22.663, "simple_Propeller": -23.191, "bp_simpleParams": [ -0.037, 0.025, -0.618, 22.663, -23.191, 10.728 ], "bp_params": [ -0.038, 0.024, -0.618, 23.332, -22.518, 10.721 ], "frame": { "rmsd": null, "origin": [ 11.168, -28.526, 28.085 ], "x_axis": [ -0.521, 0.840, -0.150 ], "y_axis": [ -0.780, -0.397, 0.485 ], "z_axis": [ 0.347, 0.370, 0.862 ], "quaternion": [ 0.486, 0.059, 0.256, 0.834 ] } }, { "index": 42, "nt1": "///R/65", "nt2": "///R/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.406, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.418, "chi2": -166.287, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.663, "C1C1_dist": 10.452, "N1N9_dist": 8.804, "C6C8_dist": 9.772, "CNNC_torsion": -6.308, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.96],O2(carbonyl)-N2(amino)[3.31],N3*O6(carbonyl)[2.98]", "unusual_base2base_hbonds": 1, "interBase_angle": 15.679, "planarity": 0.277, "simple_Shear": 1.885, "simple_Stretch": -0.084, "simple_Buckle": -0.935, "simple_Propeller": -15.651, "bp_simpleParams": [ 1.885, -0.084, -0.605, -0.935, -15.651, 5.073 ], "bp_params": [ 1.837, -0.432, -0.605, -3.811, -15.209, 5.115 ], "frame": { "rmsd": null, "origin": [ 12.939, -25.937, 30.834 ], "x_axis": [ -0.964, 0.264, 0.029 ], "y_axis": [ -0.204, -0.806, 0.556 ], "z_axis": [ 0.170, 0.530, 0.831 ], "quaternion": [ 0.123, 0.053, 0.286, 0.949 ] } }, { "index": 43, "nt1": "///R/661", "nt2": "///R/663", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -155.847, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 124.855, "chi2": -96.665, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 92.217, "C1C1_dist": 7.273, "N1N9_dist": 8.199, "C6C8_dist": 10.370, "CNNC_torsion": 15.055, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92]", "interBase_angle": 70.038, "planarity": 0.688, "simple_Shear": 0.720, "simple_Stretch": 5.741, "simple_Buckle": 59.617, "simple_Propeller": 36.759, "bp_simpleParams": [ 0.720, 5.741, -2.708, 59.617, 36.759, 121.422 ], "bp_params": [ 1.843, 5.485, -2.708, 66.412, 22.243, 113.161 ], "frame": { "rmsd": null, "origin": [ 10.222, -19.305, 37.155 ], "x_axis": [ -0.984, -0.144, 0.103 ], "y_axis": [ 0.135, -0.987, -0.092 ], "z_axis": [ 0.115, -0.076, 0.990 ], "quaternion": [ -0.070, 0.055, -0.042, 0.995 ] } }, { "index": 44, "nt1": "///R/664", "nt2": "///R/665", "bp": "C+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -99.103, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 140.315, "chi2": -160.465, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.942, "C1C1_dist": 6.132, "N1N9_dist": 6.335, "C6C8_dist": 6.396, "CNNC_torsion": 66.197, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.96],O2(carbonyl)-N6(amino)[3.72]", "interBase_angle": 52.994, "planarity": 0.643, "simple_Shear": 0.209, "simple_Stretch": 7.175, "simple_Buckle": -52.497, "simple_Propeller": 7.246, "bp_simpleParams": [ 0.209, 7.175, -2.005, -52.497, 7.246, 10.995 ], "bp_params": [ 7.178, 0.069, -2.005, 4.705, 52.785, 12.257 ], "frame": { "rmsd": null, "origin": [ 14.401, -1.962, 37.018 ], "x_axis": [ 0.277, -0.017, 0.961 ], "y_axis": [ 0.473, -0.868, -0.152 ], "z_axis": [ 0.836, 0.497, -0.232 ], "quaternion": [ -0.210, 0.771, 0.148, 0.583 ] } }, { "index": 45, "nt1": "///R/94", "nt2": "///R/95", "bp": "G-A", "name": "Platform", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -134.477, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 131.353, "chi2": 64.252, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 76.618, "C1C1_dist": 7.369, "N1N9_dist": 8.065, "C6C8_dist": 10.411, "CNNC_torsion": -40.203, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[3.08],N2(amino)-N1[3.22]", "interBase_angle": 48.783, "planarity": 0.627, "simple_Shear": 1.362, "simple_Stretch": 5.507, "simple_Buckle": -25.707, "simple_Propeller": -41.460, "bp_simpleParams": [ 1.362, 5.507, 1.164, -25.707, -41.460, 116.355 ], "bp_params": [ 2.984, 4.825, 1.164, -36.757, -32.074, 115.607 ], "frame": { "rmsd": null, "origin": [ 18.552, -24.087, -19.723 ], "x_axis": [ 0.070, -0.111, 0.991 ], "y_axis": [ 0.118, -0.986, -0.119 ], "z_axis": [ 0.990, 0.126, -0.056 ], "quaternion": [ -0.084, 0.727, 0.002, 0.682 ] } } ], "num_multiplets": 9, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "CGA", "nts_long": "///R/13,///R/94,///R/95", "planarity": 0.734 }, { "index": 2, "num_nts": 3, "nts_short": "CGA", "nts_long": "///R/22,///R/45,///R/49", "planarity": 0.353 }, { "index": 3, "num_nts": 3, "nts_short": "ACG", "nts_long": "///R/23,///R/44,///R/83", "planarity": 0.470 }, { "index": 4, "num_nts": 3, "nts_short": "AUA", "nts_long": "///R/34,///R/60,///R/78", "planarity": 0.454 }, { "index": 5, "num_nts": 3, "nts_short": "UCG", "nts_long": "///R/53,///R/55,///R/85", "planarity": 0.166 }, { "index": 6, "num_nts": 3, "nts_short": "CAG", "nts_long": "///R/54,///R/82,///R/86", "planarity": 0.217 }, { "index": 7, "num_nts": 3, "nts_short": "AAU", "nts_long": "///R/61,///R/63,///R/77", "planarity": 0.383 }, { "index": 8, "num_nts": 4, "nts_short": "GCCA", "nts_long": "///R/14,///R/17,///R/93,///R/95", "planarity": 1.540 }, { "index": 9, "num_nts": 4, "nts_short": "GACG", "nts_long": "///R/32,///R/35,///R/59,///R/79", "planarity": 0.458 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 4, "strand1": "CACGAGAGCGACCAUUCG", "strand2": "GUGCUAaCGCGGGUGAGA", "bp_type": "||||...|||.||||||.", "helix_form": ".x.xxxxAxx.AA..A.", "helical_rise": 2.601, "helical_rise_std": 1.657, "helical_radius": 10.236, "helical_radius_std": 3.669, "helical_axis": [ -0.497, -0.132, 0.858 ], "point1": [ 14.724, -21.883, -25.156 ], "point2": [ -7.156, -27.679, 12.605 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///R/11", "nt2": "///R/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.985, -0.501, -0.151, -1.505, -12.839, 1.830 ], "step_params": [ 1.239, -1.705, 4.025, 8.646, 20.809, 31.126 ], "heli_params": [ -5.576, -0.653, 2.664, 33.793, -14.041, 38.262 ], "bp2_params": [ 0.329, -0.086, -0.955, -22.496, -27.615, 8.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.025, "simple_Twist": 33.239, "simple_hRise": 2.766, "simple_hTwist": 39.978 }, { "index": 2, "nt1": "///R/12", "nt2": "///R/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.329, -0.086, -0.955, -22.496, -27.615, 8.118 ], "step_params": [ 1.634, -0.707, 3.037, -9.455, 2.670, 50.196 ], "heli_params": [ -0.983, -2.472, 2.670, 3.113, 11.023, 51.087 ], "bp2_params": [ 0.005, -0.283, 0.809, -20.467, -6.406, -2.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.037, "simple_Twist": 53.260, "simple_hRise": 2.697, "simple_hTwist": 54.093 }, { "index": 3, "nt1": "///R/13", "nt2": "///R/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.005, -0.283, 0.809, -20.467, -6.406, -2.654 ], "step_params": [ -0.646, -0.612, 2.405, -1.601, 11.908, 28.550 ], "heli_params": [ -2.775, 0.992, 2.026, 22.907, 3.079, 30.927 ], "bp2_params": [ -0.293, 0.211, 0.694, 15.892, -2.610, 5.175 ], "groove_widths": [ 20.757, null, 14.400, null ], "simple_Rise": 2.405, "simple_Twist": 30.349, "simple_hRise": 2.056, "simple_hTwist": 32.589 }, { "index": 4, "nt1": "///R/14", "nt2": "///R/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.293, 0.211, 0.694, 15.892, -2.610, 5.175 ], "step_params": [ -3.519, -2.841, 3.658, -1.583, -4.126, 63.146 ], "heli_params": [ -2.497, 3.273, 3.896, -3.935, 1.509, 63.284 ], "bp2_params": [ -6.021, -0.483, 1.046, -1.906, -31.279, 49.345 ], "groove_widths": [ 17.398, 11.250, 13.820, 9.566 ], "simple_Rise": 3.658, "simple_Twist": 101.235, "simple_hRise": 3.780, "simple_hTwist": 101.305 }, { "index": 5, "nt1": "///R/18", "nt2": "///R/92", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "bp1_params": [ -6.021, -0.483, 1.046, -1.906, -31.279, 49.345 ], "step_params": [ 0.030, 0.274, 3.733, 4.727, -6.730, 83.298 ], "heli_params": [ 0.389, 0.106, 3.704, -5.053, -3.549, 83.629 ], "bp2_params": [ -2.161, 2.708, 0.509, -16.830, 0.620, -68.273 ], "groove_widths": [ 15.031, 13.048, 13.941, 6.358 ], "simple_Rise": 3.733, "simple_Twist": 51.930, "simple_hRise": 3.663, "simple_hTwist": 52.532 }, { "index": 6, "nt1": "///R/19", "nt2": "///R/47", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "c.W", "DSSR": "c.-W", "bp1_params": [ -2.161, 2.708, 0.509, -16.830, 0.620, -68.273 ], "step_params": [ -1.142, -2.234, 3.134, -0.491, 2.079, 54.214 ], "heli_params": [ -2.570, 1.224, 3.063, 2.280, 0.539, 54.253 ], "bp2_params": [ 3.546, 2.527, 0.326, 2.530, -0.289, -114.962 ], "groove_widths": [ 16.089, 15.414, 19.308, 19.212 ], "simple_Rise": 3.134, "simple_Twist": 30.295, "simple_hRise": 2.996, "simple_hTwist": 30.369 }, { "index": 7, "nt1": "///R/20", "nt2": "///R/358", "bp": "A-a", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 3.546, 2.527, 0.326, 2.530, -0.289, -114.962 ], "step_params": [ 1.912, -2.042, 3.313, 1.427, -1.343, -20.725 ], "heli_params": [ 6.212, 5.890, 3.038, 3.723, 3.956, -20.817 ], "bp2_params": [ -0.575, -0.206, -0.037, 2.178, 8.236, -5.157 ], "groove_widths": [ 13.437, 13.134, 22.296, 22.235 ], "simple_Rise": 3.313, "simple_Twist": -2.111, "simple_hRise": 0.529, "simple_hTwist": -2.881 }, { "index": 8, "nt1": "///R/21", "nt2": "///R/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.575, -0.206, -0.037, 2.178, 8.236, -5.157 ], "step_params": [ 0.725, -1.883, 3.258, -2.782, -3.409, 39.159 ], "heli_params": [ -2.385, -1.409, 3.347, -5.066, 4.135, 39.396 ], "bp2_params": [ 0.782, -0.126, -0.013, 10.084, 2.806, 3.003 ], "groove_widths": [ 16.563, 14.982, 21.169, 21.132 ], "simple_Rise": 3.258, "simple_Twist": 31.937, "simple_hRise": 3.363, "simple_hTwist": 32.231 }, { "index": 9, "nt1": "///R/22", "nt2": "///R/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.782, -0.126, -0.013, 10.084, 2.806, 3.003 ], "step_params": [ -5.394, 0.337, 3.458, -12.714, -0.879, 51.407 ], "heli_params": [ 0.449, 5.035, 4.574, -0.996, 14.405, 52.858 ], "bp2_params": [ -0.176, -0.105, 0.453, -3.723, -11.695, 2.081 ], "groove_widths": [ 21.135, 14.844, 15.625, 14.446 ], "simple_Rise": 3.458, "simple_Twist": 56.480, "simple_hRise": 4.471, "simple_hTwist": 57.784 }, { "index": 10, "nt1": "///R/83", "nt2": "///R/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, -0.105, 0.453, -3.723, -11.695, 2.081 ], "step_params": [ 1.223, -6.069, 6.119, -17.921, -2.340, 29.009 ], "heli_params": [ -9.669, -7.356, 5.009, -4.196, 32.142, 34.076 ], "bp2_params": [ -6.712, -4.258, 0.521, -1.232, -7.031, -3.440 ], "groove_widths": [ 19.443, 11.688, 11.531, 11.276 ], "simple_Rise": 6.119, "simple_Twist": 73.328, "simple_hRise": 5.899, "simple_hTwist": 75.218 }, { "index": 11, "nt1": "///R/25", "nt2": "///R/42", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.712, -4.258, 0.521, -1.232, -7.031, -3.440 ], "step_params": [ -0.060, -0.785, 3.266, -2.206, 6.608, 65.469 ], "heli_params": [ -0.989, -0.033, 3.183, 6.092, 2.034, 65.798 ], "bp2_params": [ 0.378, 0.155, 0.182, 4.825, -11.697, 6.356 ], "groove_widths": [ 19.832, 14.077, 19.874, 17.085 ], "simple_Rise": 3.266, "simple_Twist": 18.286, "simple_hRise": 2.799, "simple_hTwist": 19.557 }, { "index": 12, "nt1": "///R/26", "nt2": "///R/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.378, 0.155, 0.182, 4.825, -11.697, 6.356 ], "step_params": [ -0.366, -1.928, 3.064, -1.895, 7.044, 27.949 ], "heli_params": [ -5.231, 0.368, 2.531, 14.278, 3.842, 28.867 ], "bp2_params": [ 0.357, -0.301, 0.181, 9.311, -14.838, -0.226 ], "groove_widths": [ 18.639, 15.102, 14.326, 9.919 ], "simple_Rise": 3.064, "simple_Twist": 28.382, "simple_hRise": 2.541, "simple_hTwist": 29.286 }, { "index": 13, "nt1": "///R/27", "nt2": "///R/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.301, 0.181, 9.311, -14.838, -0.226 ], "step_params": [ 0.116, -1.618, 3.152, 0.853, 14.818, 28.297 ], "heli_params": [ -5.237, -0.080, 2.071, 28.005, -1.611, 31.883 ], "bp2_params": [ -0.742, 0.376, 0.180, 3.159, -18.121, 10.098 ], "groove_widths": [ 17.288, 15.832, 15.396, 8.613 ], "simple_Rise": 3.152, "simple_Twist": 33.732, "simple_hRise": 2.269, "simple_hTwist": 36.765 }, { "index": 14, "nt1": "///R/28", "nt2": "///R/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.742, 0.376, 0.180, 3.159, -18.121, 10.098 ], "step_params": [ 0.454, -0.832, 3.301, 0.831, 4.341, 45.039 ], "heli_params": [ -1.468, -0.516, 3.219, 5.651, -1.082, 45.244 ], "bp2_params": [ 2.924, -0.395, 0.161, 2.742, -15.263, 9.611 ], "groove_widths": [ 17.061, 15.519, 14.983, 11.111 ], "simple_Rise": 3.301, "simple_Twist": 25.295, "simple_hRise": 3.129, "simple_hTwist": 25.672 }, { "index": 15, "nt1": "///R/29", "nt2": "///R/38", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.924, -0.395, 0.161, 2.742, -15.263, 9.611 ], "step_params": [ -0.457, -1.981, 2.952, 8.133, 11.284, 22.246 ], "heli_params": [ -6.644, 2.648, 1.531, 26.207, -18.890, 26.190 ], "bp2_params": [ 0.147, -0.317, -0.145, -1.014, -15.414, -3.362 ], "groove_widths": [ 16.948, null, 17.154, null ], "simple_Rise": 2.952, "simple_Twist": 37.311, "simple_hRise": 2.146, "simple_hTwist": 39.733 }, { "index": 16, "nt1": "///R/30", "nt2": "///R/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.317, -0.145, -1.014, -15.414, -3.362 ], "step_params": [ 0.445, -1.657, 3.240, -1.215, 6.737, 35.143 ], "heli_params": [ -3.610, -0.889, 2.867, 11.028, 1.990, 35.783 ], "bp2_params": [ 0.495, -0.323, 0.037, 1.167, 1.583, 1.335 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.240, "simple_Twist": 33.263, "simple_hRise": 2.842, "simple_hTwist": 33.940 }, { "index": 17, "nt1": "///R/31", "nt2": "///R/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.495, -0.323, 0.037, 1.167, 1.583, 1.335 ], "step_params": [ -2.742, -1.203, 2.832, 0.571, 9.381, 48.394 ], "heli_params": [ -2.026, 3.326, 2.541, 11.320, -0.689, 49.244 ], "bp2_params": [ 7.114, -5.225, 0.956, 18.108, -3.070, -20.921 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.832, "simple_Twist": 2.024, "simple_hRise": -0.740, "simple_hTwist": 9.614 }, { "index": 18, "nt1": "///R/32", "nt2": "///R/35", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 2, "num_stems": 4, "strand1": "AGCCCCGGCCUACC", "strand2": "UUGGGGCUGGAUGG", "bp_type": ".||||||||||.||", "helix_form": "x.AxAAx....x.", "helical_rise": 2.813, "helical_rise_std": 0.599, "helical_radius": 9.351, "helical_radius_std": 2.900, "helical_axis": [ -0.246, 0.348, 0.905 ], "point1": [ 20.027, -34.062, -5.441 ], "point2": [ 11.101, -21.445, 27.382 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///R/48", "nt2": "///R/90", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.670, -2.099, -0.270, 10.969, -0.100, -98.306 ], "step_params": [ 3.620, -2.322, 3.218, -11.560, 7.254, 65.563 ], "heli_params": [ -2.356, -3.682, 2.384, 6.625, 10.556, 66.812 ], "bp2_params": [ -3.110, -0.864, 0.065, 3.237, -15.200, -1.830 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 53.992, "simple_hRise": 2.157, "simple_hTwist": 55.564 }, { "index": 2, "nt1": "///R/50", "nt2": "///R/89", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.110, -0.864, 0.065, 3.237, -15.200, -1.830 ], "step_params": [ 0.575, -1.386, 2.958, 2.998, 5.459, 39.025 ], "heli_params": [ -2.618, -0.539, 2.782, 8.109, -4.454, 39.500 ], "bp2_params": [ -0.444, -0.295, -0.458, 12.208, -20.913, 2.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 25.103, "simple_hRise": 2.651, "simple_hTwist": 25.852 }, { "index": 3, "nt1": "///R/51", "nt2": "///R/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.444, -0.295, -0.458, 12.208, -20.913, 2.946 ], "step_params": [ 0.048, -1.438, 3.659, -3.070, 14.100, 34.892 ], "heli_params": [ -4.128, -0.488, 2.873, 22.369, 4.870, 37.672 ], "bp2_params": [ -0.487, -0.125, 0.298, -4.893, -10.628, -0.286 ], "groove_widths": [ 18.053, null, 16.329, null ], "simple_Rise": 3.659, "simple_Twist": 34.185, "simple_hRise": 2.853, "simple_hTwist": 37.022 }, { "index": 4, "nt1": "///R/52", "nt2": "///R/87", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.487, -0.125, 0.298, -4.893, -10.628, -0.286 ], "step_params": [ -2.904, -1.256, 2.954, 4.767, 4.758, 53.847 ], "heli_params": [ -1.626, 3.434, 2.596, 5.231, -5.240, 54.235 ], "bp2_params": [ -0.231, -0.127, -0.218, 6.738, -11.899, 2.923 ], "groove_widths": [ 16.653, 14.382, 13.971, 13.059 ], "simple_Rise": 2.954, "simple_Twist": 52.791, "simple_hRise": 2.587, "simple_hTwist": 53.189 }, { "index": 5, "nt1": "///R/54", "nt2": "///R/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.127, -0.218, 6.738, -11.899, 2.923 ], "step_params": [ -0.801, -2.498, 3.538, -7.445, 2.186, 33.723 ], "heli_params": [ -4.569, 0.100, 3.467, 3.707, 12.627, 34.579 ], "bp2_params": [ -0.493, -0.207, 0.323, -1.241, -0.548, -0.181 ], "groove_widths": [ 16.705, 14.880, 14.206, 12.807 ], "simple_Rise": 3.538, "simple_Twist": 35.066, "simple_hRise": 3.473, "simple_hTwist": 35.888 }, { "index": 6, "nt1": "///R/55", "nt2": "///R/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.493, -0.207, 0.323, -1.241, -0.548, -0.181 ], "step_params": [ 0.367, -2.105, 2.958, 1.399, 6.865, 27.809 ], "heli_params": [ -5.541, -0.479, 2.395, 14.005, -2.853, 28.661 ], "bp2_params": [ -0.164, 0.149, 0.042, 3.575, 3.638, 3.361 ], "groove_widths": [ 17.065, 15.381, 13.802, 9.838 ], "simple_Rise": 2.958, "simple_Twist": 25.816, "simple_hRise": 2.345, "simple_hTwist": 26.735 }, { "index": 7, "nt1": "///R/56", "nt2": "///R/84", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.164, 0.149, 0.042, 3.575, 3.638, 3.361 ], "step_params": [ 2.019, -1.939, 3.153, 2.784, 9.247, 42.373 ], "heli_params": [ -3.450, -2.481, 2.811, 12.597, -3.793, 43.410 ], "bp2_params": [ -1.423, -0.255, -0.053, 0.947, -6.537, -8.671 ], "groove_widths": [ 16.767, 14.705, 15.645, 12.288 ], "simple_Rise": 3.153, "simple_Twist": 49.081, "simple_hRise": 2.870, "simple_hTwist": 49.964 }, { "index": 8, "nt1": "///R/57", "nt2": "///R/81", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.423, -0.255, -0.053, 0.947, -6.537, -8.671 ], "step_params": [ 0.647, -1.269, 2.915, -5.112, 4.004, 39.987 ], "heli_params": [ -2.219, -1.427, 2.682, 5.808, 7.416, 40.489 ], "bp2_params": [ 0.059, 0.031, 0.147, 14.143, -15.614, 8.139 ], "groove_widths": [ 15.956, 13.385, 16.866, 15.178 ], "simple_Rise": 2.915, "simple_Twist": 32.761, "simple_hRise": 2.618, "simple_hTwist": 33.381 }, { "index": 9, "nt1": "///R/58", "nt2": "///R/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, 0.031, 0.147, 14.143, -15.614, 8.139 ], "step_params": [ -0.448, -1.434, 3.425, 0.211, 5.506, 36.205 ], "heli_params": [ -3.051, 0.742, 3.178, 8.797, -0.337, 36.608 ], "bp2_params": [ 1.131, -0.497, 0.122, 4.970, -22.645, 4.201 ], "groove_widths": [ 15.866, 14.286, 16.578, 13.504 ], "simple_Rise": 3.425, "simple_Twist": 29.855, "simple_hRise": 3.114, "simple_hTwist": 30.348 }, { "index": 10, "nt1": "///R/59", "nt2": "///R/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.131, -0.497, 0.122, 4.970, -22.645, 4.201 ], "step_params": [ -0.267, -1.952, 3.538, -1.951, 5.705, 21.903 ], "heli_params": [ -7.039, -0.035, 2.953, 14.661, 5.014, 22.708 ], "bp2_params": [ 0.218, -0.041, 0.343, -1.991, -13.308, 6.794 ], "groove_widths": [ 18.378, 15.280, 16.074, 11.891 ], "simple_Rise": 3.538, "simple_Twist": 26.908, "simple_hRise": 3.078, "simple_hTwist": 27.563 }, { "index": 11, "nt1": "///R/60", "nt2": "///R/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.218, -0.041, 0.343, -1.991, -13.308, 6.794 ], "step_params": [ 0.815, -1.176, 3.041, 7.559, 11.587, 40.367 ], "heli_params": [ -2.681, -0.431, 2.722, 16.225, -10.585, 42.579 ], "bp2_params": [ 3.054, -0.082, 0.309, 4.478, -6.739, 13.514 ], "groove_widths": [ 19.230, null, 14.439, null ], "simple_Rise": 3.041, "simple_Twist": 24.487, "simple_hRise": 2.397, "simple_hTwist": 28.073 }, { "index": 12, "nt1": "///R/61", "nt2": "///R/77", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.054, -0.082, 0.309, 4.478, -6.739, 13.514 ], "step_params": [ -5.130, 0.959, 2.938, 13.384, 5.075, 57.830 ], "heli_params": [ 0.775, 5.682, 1.885, 5.162, -13.612, 59.426 ], "bp2_params": [ -0.038, 0.024, -0.618, 23.332, -22.518, 10.721 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.938, "simple_Twist": 76.339, "simple_hRise": 2.204, "simple_hTwist": 77.468 }, { "index": 13, "nt1": "///R/64", "nt2": "///R/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, 0.024, -0.618, 23.332, -22.518, 10.721 ], "step_params": [ -0.076, -1.251, 3.978, 1.579, 13.748, 41.855 ], "heli_params": [ -3.179, 0.275, 3.418, 18.642, -2.141, 43.986 ], "bp2_params": [ 1.837, -0.432, -0.605, -3.811, -15.209, 5.115 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.978, "simple_Twist": 29.925, "simple_hRise": 3.113, "simple_hTwist": 32.903 }, { "index": 14, "nt1": "///R/65", "nt2": "///R/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 8, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CA", "strand2": "GU", "bp_type": "||", "helix_form": ".", "helical_rise": 2.646, "helical_rise_std": 0.020, "helical_radius": 9.517, "helical_radius_std": 1.613, "helical_axis": [ -0.681, 0.173, 0.711 ], "point1": [ 23.900, -30.830, -21.429 ], "point2": [ 22.096, -30.371, -19.546 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///R/11", "nt2": "///R/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.985, -0.501, -0.151, -1.505, -12.839, 1.830 ], "step_params": [ 1.239, -1.705, 4.025, 8.646, 20.809, 31.126 ], "heli_params": [ -5.576, -0.653, 2.664, 33.793, -14.041, 38.262 ], "bp2_params": [ 0.329, -0.086, -0.955, -22.496, -27.615, 8.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.025, "simple_Twist": 33.239, "simple_hRise": 2.766, "simple_hTwist": 39.978 }, { "index": 2, "nt1": "///R/12", "nt2": "///R/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CG", "strand2": "GC", "bp_type": "||", "helix_form": ".", "helical_rise": 2.380, "helical_rise_std": 0.020, "helical_radius": 7.641, "helical_radius_std": 1.051, "helical_axis": [ -0.275, 0.526, 0.805 ], "point1": [ 17.492, -30.020, -17.399 ], "point2": [ 16.838, -28.768, -15.482 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///R/13", "nt2": "///R/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.005, -0.283, 0.809, -20.467, -6.406, -2.654 ], "step_params": [ -0.646, -0.612, 2.405, -1.601, 11.908, 28.550 ], "heli_params": [ -2.775, 0.992, 2.026, 22.907, 3.079, 30.927 ], "bp2_params": [ -0.293, 0.211, 0.694, 15.892, -2.610, 5.175 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.405, "simple_Twist": 30.349, "simple_hRise": 2.056, "simple_hTwist": 32.589 }, { "index": 2, "nt1": "///R/14", "nt2": "///R/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "GC", "strand2": "CG", "bp_type": "||", "helix_form": "A", "helical_rise": 3.452, "helical_rise_std": 0.017, "helical_radius": 9.677, "helical_radius_std": 1.888, "helical_axis": [ -0.736, -0.008, 0.677 ], "point1": [ 0.776, -22.191, -14.569 ], "point2": [ -1.767, -22.219, -12.232 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///R/21", "nt2": "///R/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.575, -0.206, -0.037, 2.178, 8.236, -5.157 ], "step_params": [ 0.725, -1.883, 3.258, -2.782, -3.409, 39.159 ], "heli_params": [ -2.385, -1.409, 3.347, -5.066, 4.135, 39.396 ], "bp2_params": [ 0.782, -0.126, -0.013, 10.084, 2.806, 3.003 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.258, "simple_Twist": 31.937, "simple_hRise": 3.363, "simple_hTwist": 32.231 }, { "index": 2, "nt1": "///R/22", "nt2": "///R/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "CCAUUC", "strand2": "GGUGAG", "bp_type": "||||||", "helix_form": "AA..A", "helical_rise": 2.277, "helical_rise_std": 0.230, "helical_radius": 9.069, "helical_radius_std": 0.595, "helical_axis": [ -0.232, -0.020, 0.972 ], "point1": [ -5.456, -23.893, 0.991 ], "point2": [ -8.065, -24.122, 11.913 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///R/26", "nt2": "///R/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.378, 0.155, 0.182, 4.825, -11.697, 6.356 ], "step_params": [ -0.366, -1.928, 3.064, -1.895, 7.044, 27.949 ], "heli_params": [ -5.231, 0.368, 2.531, 14.278, 3.842, 28.867 ], "bp2_params": [ 0.357, -0.301, 0.181, 9.311, -14.838, -0.226 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.064, "simple_Twist": 28.382, "simple_hRise": 2.541, "simple_hTwist": 29.286 }, { "index": 2, "nt1": "///R/27", "nt2": "///R/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.301, 0.181, 9.311, -14.838, -0.226 ], "step_params": [ 0.116, -1.618, 3.152, 0.853, 14.818, 28.297 ], "heli_params": [ -5.237, -0.080, 2.071, 28.005, -1.611, 31.883 ], "bp2_params": [ -0.742, 0.376, 0.180, 3.159, -18.121, 10.098 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.152, "simple_Twist": 33.732, "simple_hRise": 2.269, "simple_hTwist": 36.765 }, { "index": 3, "nt1": "///R/28", "nt2": "///R/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.742, 0.376, 0.180, 3.159, -18.121, 10.098 ], "step_params": [ 0.454, -0.832, 3.301, 0.831, 4.341, 45.039 ], "heli_params": [ -1.468, -0.516, 3.219, 5.651, -1.082, 45.244 ], "bp2_params": [ 2.924, -0.395, 0.161, 2.742, -15.263, 9.611 ], "groove_widths": [ 17.061, null, 14.983, null ], "simple_Rise": 3.301, "simple_Twist": 25.295, "simple_hRise": 3.129, "simple_hTwist": 25.672 }, { "index": 4, "nt1": "///R/29", "nt2": "///R/38", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.924, -0.395, 0.161, 2.742, -15.263, 9.611 ], "step_params": [ -0.457, -1.981, 2.952, 8.133, 11.284, 22.246 ], "heli_params": [ -6.644, 2.648, 1.531, 26.207, -18.890, 26.190 ], "bp2_params": [ 0.147, -0.317, -0.145, -1.014, -15.414, -3.362 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.952, "simple_Twist": 37.311, "simple_hRise": 2.146, "simple_hTwist": 39.733 }, { "index": 5, "nt1": "///R/30", "nt2": "///R/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.317, -0.145, -1.014, -15.414, -3.362 ], "step_params": [ 0.445, -1.657, 3.240, -1.215, 6.737, 35.143 ], "heli_params": [ -3.610, -0.889, 2.867, 11.028, 1.990, 35.783 ], "bp2_params": [ 0.495, -0.323, 0.037, 1.167, 1.583, 1.335 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.240, "simple_Twist": 33.263, "simple_hRise": 2.842, "simple_hTwist": 33.940 }, { "index": 6, "nt1": "///R/31", "nt2": "///R/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 2, "strand1": "GCC", "strand2": "UGG", "bp_type": "|||", "helix_form": ".A", "helical_rise": 1.704, "helical_rise_std": 0.134, "helical_radius": 8.990, "helical_radius_std": 1.004, "helical_axis": [ -0.597, 0.248, 0.763 ], "point1": [ 16.910, -26.868, -4.337 ], "point2": [ 15.003, -26.074, -1.898 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///R/50", "nt2": "///R/89", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.110, -0.864, 0.065, 3.237, -15.200, -1.830 ], "step_params": [ 0.575, -1.386, 2.958, 2.998, 5.459, 39.025 ], "heli_params": [ -2.618, -0.539, 2.782, 8.109, -4.454, 39.500 ], "bp2_params": [ -0.444, -0.295, -0.458, 12.208, -20.913, 2.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 25.103, "simple_hRise": 2.651, "simple_hTwist": 25.852 }, { "index": 2, "nt1": "///R/51", "nt2": "///R/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.444, -0.295, -0.458, 12.208, -20.913, 2.946 ], "step_params": [ 0.048, -1.438, 3.659, -3.070, 14.100, 34.892 ], "heli_params": [ -4.128, -0.488, 2.873, 22.369, 4.870, 37.672 ], "bp2_params": [ -0.487, -0.125, 0.298, -4.893, -10.628, -0.286 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.659, "simple_Twist": 34.185, "simple_hRise": 2.853, "simple_hTwist": 37.022 }, { "index": 3, "nt1": "///R/52", "nt2": "///R/87", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 2, "strand1": "CCG", "strand2": "GGC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.679, "helical_rise_std": 0.238, "helical_radius": 9.356, "helical_radius_std": 0.337, "helical_axis": [ -0.129, 0.345, 0.930 ], "point1": [ 14.910, -27.332, 4.464 ], "point2": [ 14.226, -25.497, 9.405 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///R/54", "nt2": "///R/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.127, -0.218, 6.738, -11.899, 2.923 ], "step_params": [ -0.801, -2.498, 3.538, -7.445, 2.186, 33.723 ], "heli_params": [ -4.569, 0.100, 3.467, 3.707, 12.627, 34.579 ], "bp2_params": [ -0.493, -0.207, 0.323, -1.241, -0.548, -0.181 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.538, "simple_Twist": 35.066, "simple_hRise": 3.473, "simple_hTwist": 35.888 }, { "index": 2, "nt1": "///R/55", "nt2": "///R/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.493, -0.207, 0.323, -1.241, -0.548, -0.181 ], "step_params": [ 0.367, -2.105, 2.958, 1.399, 6.865, 27.809 ], "heli_params": [ -5.541, -0.479, 2.395, 14.005, -2.853, 28.661 ], "bp2_params": [ -0.164, 0.149, 0.042, 3.575, 3.638, 3.361 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 25.816, "simple_hRise": 2.345, "simple_hTwist": 26.735 }, { "index": 3, "nt1": "///R/56", "nt2": "///R/84", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 2, "strand1": "GCCU", "strand2": "UGGA", "bp_type": "||||", "helix_form": "...", "helical_rise": 2.268, "helical_rise_std": 0.231, "helical_radius": 9.570, "helical_radius_std": 0.910, "helical_axis": [ -0.159, 0.539, 0.827 ], "point1": [ 15.626, -26.729, 14.288 ], "point2": [ 14.578, -23.170, 19.744 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///R/57", "nt2": "///R/81", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.423, -0.255, -0.053, 0.947, -6.537, -8.671 ], "step_params": [ 0.647, -1.269, 2.915, -5.112, 4.004, 39.987 ], "heli_params": [ -2.219, -1.427, 2.682, 5.808, 7.416, 40.489 ], "bp2_params": [ 0.059, 0.031, 0.147, 14.143, -15.614, 8.139 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.915, "simple_Twist": 32.761, "simple_hRise": 2.618, "simple_hTwist": 33.381 }, { "index": 2, "nt1": "///R/58", "nt2": "///R/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, 0.031, 0.147, 14.143, -15.614, 8.139 ], "step_params": [ -0.448, -1.434, 3.425, 0.211, 5.506, 36.205 ], "heli_params": [ -3.051, 0.742, 3.178, 8.797, -0.337, 36.608 ], "bp2_params": [ 1.131, -0.497, 0.122, 4.970, -22.645, 4.201 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.425, "simple_Twist": 29.855, "simple_hRise": 3.114, "simple_hTwist": 30.348 }, { "index": 3, "nt1": "///R/59", "nt2": "///R/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.131, -0.497, 0.122, 4.970, -22.645, 4.201 ], "step_params": [ -0.267, -1.952, 3.538, -1.951, 5.705, 21.903 ], "heli_params": [ -7.039, -0.035, 2.953, 14.661, 5.014, 22.708 ], "bp2_params": [ 0.218, -0.041, 0.343, -1.991, -13.308, 6.794 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.538, "simple_Twist": 26.908, "simple_hRise": 3.078, "simple_hTwist": 27.563 }, { "index": 4, "nt1": "///R/60", "nt2": "///R/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 2, "strand1": "CC", "strand2": "GG", "bp_type": "||", "helix_form": ".", "helical_rise": 3.025, "helical_rise_std": 0.027, "helical_radius": 9.582, "helical_radius_std": 0.432, "helical_axis": [ 0.123, 0.434, 0.893 ], "point1": [ 8.958, -25.633, 27.586 ], "point2": [ 9.330, -24.320, 30.286 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///R/64", "nt2": "///R/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, 0.024, -0.618, 23.332, -22.518, 10.721 ], "step_params": [ -0.076, -1.251, 3.978, 1.579, 13.748, 41.855 ], "heli_params": [ -3.179, 0.275, 3.418, 18.642, -2.141, 43.986 ], "bp2_params": [ 1.837, -0.432, -0.605, -3.811, -15.209, 5.115 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.978, "simple_Twist": 29.925, "simple_hRise": 3.113, "simple_hTwist": 32.903 }, { "index": 2, "nt1": "///R/65", "nt2": "///R/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///R/44", "nt2": "///R/83", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 4, "stem_indices": [ 1, 2, 3, 4 ] }, { "index": 2, "helix_index": 2, "num_stems": 4, "stem_indices": [ 5, 6, 7, 8 ] } ], "num_stacks": 24, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "YC", "nts_long": "///P/13,///R/664" }, { "index": 2, "num_nts": 2, "nts_short": "AC", "nts_long": "///R/12,///R/13" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/32,///R/36" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///R/49,///R/83" }, { "index": 5, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/56,///R/57" }, { "index": 6, "num_nts": 2, "nts_short": "UA", "nts_long": "///R/60,///R/61" }, { "index": 7, "num_nts": 2, "nts_short": "GU", "nts_long": "///R/76,///R/77" }, { "index": 8, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/86,///R/87" }, { "index": 9, "num_nts": 2, "nts_short": "UU", "nts_long": "///R/89,///R/90" }, { "index": 10, "num_nts": 2, "nts_short": "UC", "nts_long": "///R/92,///R/93" }, { "index": 11, "num_nts": 2, "nts_short": "GU", "nts_long": "///R/94,///R/96" }, { "index": 12, "num_nts": 3, "nts_short": "QGU", "nts_long": "///P/54,///R/663,///R/662" }, { "index": 13, "num_nts": 3, "nts_short": "FAC", "nts_long": "///P/56,///R/665,///R/666" }, { "index": 14, "num_nts": 3, "nts_short": "gGU", "nts_long": "///R/8,///R/9,///R/10" }, { "index": 15, "num_nts": 3, "nts_short": "CaA", "nts_long": "///R/46,///R/358,///R/47" }, { "index": 16, "num_nts": 3, "nts_short": "GAA", "nts_long": "///R/50,///R/48,///R/91" }, { "index": 17, "num_nts": 3, "nts_short": "UAG", "nts_long": "///R/661,///R/660,///R/75" }, { "index": 18, "num_nts": 3, "nts_short": "UCC", "nts_long": "///R/667,///R/668,///R/669" }, { "index": 19, "num_nts": 4, "nts_short": "CAAC", "nts_long": "///R/15,///R/95,///R/16,///R/17" }, { "index": 20, "num_nts": 4, "nts_short": "AGAG", "nts_long": "///R/18,///R/19,///R/20,///R/21" }, { "index": 21, "num_nts": 4, "nts_short": "CAUU", "nts_long": "///R/52,///R/82,///R/53,///R/81" }, { "index": 22, "num_nts": 5, "nts_short": "CAAGG", "nts_long": "///R/22,///R/23,///R/43,///R/42,///R/41" }, { "index": 23, "num_nts": 5, "nts_short": "CAACG", "nts_long": "///R/26,///R/25,///R/24,///R/44,///R/45" }, { "index": 24, "num_nts": 6, "nts_short": "AAAAAC", "nts_long": "///R/35,///R/34,///R/33,///R/62,///R/63,///R/64" } ], "nonStack": { "num_nts": 1, "nts_short": "C", "nts_long": "///R/54" }, "num_atom2bases": 7, "atom2bases": [ { "index": 1, "type": "other", "atom": "///R/358/N71", "nt": "///R/14", "vert_dist": 3.365 }, { "index": 2, "type": "sugar", "atom": "///R/44/O4'", "nt": "///R/24", "vert_dist": 2.991 }, { "index": 3, "type": "phosphate", "atom": "///R/34/OP2", "nt": "///R/32", "vert_dist": 2.926 }, { "index": 4, "type": "sugar", "atom": "///R/36/O4'", "nt": "///R/35", "vert_dist": 3.484 }, { "index": 5, "type": "sugar", "atom": "///R/46/O4'", "nt": "///R/49", "vert_dist": 2.942 }, { "index": 6, "type": "sugar", "atom": "///R/83/O4'", "nt": "///R/49", "vert_dist": 3.196 }, { "index": 7, "type": "sugar", "atom": "///R/662/O4'", "nt": "///R/663", "vert_dist": 3.002 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 4 ], "summary": "[1] 4 [R.31 R.36] 6", "num_nts": 6, "nts_short": "CGAAAG", "nts_long": "///R/31,///R/32,///R/33,///R/34,///R/35,///R/36", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///R/32,///R/33,///R/34,///R/35" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 10 ], "stem_indices": [ 8 ], "summary": "[1] 10 [R.65 R.75] 2", "num_nts": 12, "nts_short": "CAUUGCACUCCG", "nts_long": "///R/65,///R/660,///R/661,///R/662,///R/663,///R/664,///R/665,///R/666,///R/667,///R/668,///R/669,///R/75", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGCACUCC", "nts_long": "///R/660,///R/661,///R/662,///R/663,///R/664,///R/665,///R/666,///R/667,///R/668,///R/669" } ] } ], "num_bulges": 3, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 0 1 [R.12 R.96 R.13 R.94] 2 2", "num_nts": 5, "nts_short": "ACGAU", "nts_long": "///R/12,///R/13,///R/94,///R/95,///R/96", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///R/95" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 5, 6 ], "summary": "[2] 1 0 [R.52 R.87 R.54 R.86] 3 3", "num_nts": 5, "nts_short": "CUCGG", "nts_long": "///R/52,///R/53,///R/54,///R/86,///R/87", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///R/53" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 3, "type": "bulge", "bridging_nts": [ 0, 2 ], "stem_indices": [ 6, 7 ], "summary": "[2] 0 2 [R.56 R.84 R.57 R.81] 3 4", "num_nts": 6, "nts_short": "GGUAGC", "nts_long": "///R/56,///R/57,///R/81,///R/82,///R/83,///R/84", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///R/82,///R/83" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 3, 1 ], "stem_indices": [ 7, 8 ], "summary": "[2] 3 1 [R.60 R.78 R.64 R.76] 4 2", "num_nts": 8, "nts_short": "UAAACGUA", "nts_long": "///R/60,///R/61,///R/62,///R/63,///R/64,///R/76,///R/77,///R/78", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AAA", "nts_long": "///R/61,///R/62,///R/63" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///R/77" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 6, 3, 3 ], "stem_indices": [ 2, 3, 5 ], "summary": "[3] 6 3 3 [R.14 R.93 R.21 R.46 R.50 R.89] 2 2 3", "num_nts": 18, "nts_short": "GCACAGAGCAAAGUUAUC", "nts_long": "///R/14,///R/15,///R/16,///R/17,///R/18,///R/19,///R/20,///R/21,///R/46,///R/47,///R/48,///R/49,///R/50,///R/89,///R/90,///R/91,///R/92,///R/93", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "CACAGA", "nts_long": "///R/15,///R/16,///R/17,///R/18,///R/19,///R/20" }, { "index": 2, "num_nts": 3, "nts_short": "AAA", "nts_long": "///R/47,///R/48,///R/49" }, { "index": 3, "num_nts": 3, "nts_short": "UAU", "nts_long": "///R/90,///R/91,///R/92" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 3, "nts_short": "gGU", "nts_long": "///R/8,///R/9,///R/10" }, { "index": 2, "num_nts": 3, "nts_short": "AAA", "nts_long": "///R/23,///R/24,///R/25" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///R/42,///R/43" }, { "index": 4, "num_nts": 1, "nts_short": "a", "nts_long": "///R/358" } ], "num_Aminors": 7, "Aminors": [ { "index": 1, "type": "II", "desc_short": "A vs U-A (WC)", "desc_long": "///R/34 vs ///R/60,///R/78", "A_nt1": { "desc": "///R/34 vs ///R/60", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.70],N3-O2'(hydroxyl)[2.71]" }, "A_nt2": { "desc": "///R/34 vs ///R/78", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 2, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///R/35 vs ///R/59,///R/79", "A_nt1": { "desc": "///R/35 vs ///R/59", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.62]" }, "A_nt2": { "desc": "///R/35 vs ///R/79", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.04],N3-N2(amino)[3.27]" } }, { "index": 3, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///R/49 vs ///R/22,///R/45", "A_nt1": { "desc": "///R/49 vs ///R/22", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O3'-O2'(hydroxyl)[3.22],O2'(hydroxyl)-O2(carbonyl)[3.19]" }, "A_nt2": { "desc": "///R/49 vs ///R/45", "face_type": "+", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N2(amino)[3.12],N1-O2'(hydroxyl)[2.84],N3-N2(amino)[2.93]" } }, { "index": 4, "type": "X", "desc_short": "A vs A-U (--)", "desc_long": "///R/62 vs ///R/61,///R/77", "A_nt1": { "desc": "///R/62 vs ///R/61", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N7-O2'(hydroxyl)[2.87]" }, "A_nt2": { "desc": "///R/62 vs ///R/77", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 5, "type": "X", "desc_short": "A vs A-U (--)", "desc_long": "///R/63 vs ///R/61,///R/77", "A_nt1": { "desc": "///R/63 vs ///R/61", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///R/63 vs ///R/77", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.87]" } }, { "index": 6, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///R/95 vs ///R/13,///R/94", "A_nt1": { "desc": "///R/95 vs ///R/13", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///R/95 vs ///R/94", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "OP2-O2'(hydroxyl)[3.08],N1-N2(amino)[3.22]" } }, { "index": 7, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///R/95 vs ///R/14,///R/93", "A_nt1": { "desc": "///R/95 vs ///R/14", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[3.44]" }, "A_nt2": { "desc": "///R/95 vs ///R/93", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "AACU", "nts_long": "///R/34,///R/35,///R/59,///R/60" } ], "num_splayUnits": 5, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "AAG", "nts_long": "///R/48,///R/49,///R/50" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///R/663,///R/664" }, { "index": 3, "num_nts": 2, "nts_short": "CU", "nts_long": "///R/666,///R/667" }, { "index": 4, "num_nts": 2, "nts_short": "CG", "nts_long": "///R/669,///R/75" }, { "index": 5, "num_nts": 3, "nts_short": "AGC", "nts_long": "///R/82,///R/83,///R/84" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 2, "nts_short": "CG", "nts_long": "///R/44,///R/83" } ], "dbn": { "all_chains": { "num_nts": 92, "num_chars": 93, "bseq": "gGUCACGCACAGAGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUAUCGAUG&a", "bseqUP": "GGUCACGCACAGAGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUAUCGAUG&A", "sstr": "...((((......((...((((((....))))))..[))...(((.(((((((...((..........)).)))).]))))))...)).))&.", "form": "AA.AA.....AA.A....AA.AAA....AAAAA....A.....A...AAAAA..AAAAA....A.AA.A.AAAA...AA.AAAA.A....-&-" }, "chain_R": { "num_nts": 92, "num_chars": 93, "bseq": "gGUCACGCACAGAGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUAUCGAUG&a", "bseqUP": "GGUCACGCACAGAGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUAUCGAUG&A", "sstr": "...((((......((...((((((....))))))..[))...(((.(((((((...((..........)).)))).]))))))...)).))&.", "form": "AA.AA.....AA.A....AA.AAA....AAAAA....A.....A...AAAAA..AAAAA....A.AA.A.AAAA...AA.AAAA.A....-&-" } }, "chains": { "chain_R": { "num_nts": 92, "bseq": "gGUCACGCACAGAGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUAUCGAUG&a", "sstr": "...((((......((...((((((....))))))..[))...(((.(((((((...((..........)).)))).]))))))...)).))&.", "form": "AA.AA.....AA.A....AA.AAA....AAAAA....A.....A...AAAAA..AAAAA....A.AA.A.AAAA...AA.AAAA.A....-&-", "helical_rise": 0.057, "helical_rise_std": 3.486, "helical_axis": [ 0.326, -0.137, 0.935 ], "point1": [ 7.281, -21.350, -18.330 ], "point2": [ 8.971, -22.057, -13.486 ], "num_chars": 274, "suite": "g!!G1aU1aC1aA1aC!!G4gC!!A1aC1aA1eG!!A!!G1aC1bA4aA1aA1aC1aC1aA1aU1aU1aC1aG1gA1aA1aA!!G1aA1aG1aU1aG1LG!!G!!A4gC1cG1aC7rA!!A4pA6jG1aC1aC1bU!!C1aC!!G1LG1aC1aC1aU1aA3aA1aA1aC1aC1aA1aU!!U6gG!!C0aA1aC!!U1cC1aC7dG1aG1aU1aA!!G1LG!!U1[A!!G6dC1aG1aG1aG1aG1aU1LU1aA1aU1aC!!G!!A!!U!!G..a" } }, "num_nts": 92, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "R", "nt_resnum": 8, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///R/8", "linked_nts": [ null, "///R/9" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -55.625, "delta": 100.906, "epsilon": -170.459, "zeta": -85.293, "epsilon_zeta": -85.166, "bb_type": "BI", "chi": -164.297, "glyco_bond": "anti", "C5prime_xyz": [ -0.575, 8.271, 0.770 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.429, "Dp": 4.458, "splay_angle": 22.740, "splay_distance": 3.576, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 18.079, "v1": -27.769, "v2": 26.944, "v3": -16.890, "v4": -0.654, "amplitude": 28.610, "phase_angle": 340.348, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.072, "origin": [ 25.992, -37.481, -25.525 ], "x_axis": [ -0.003, 0.919, -0.395 ], "y_axis": [ -0.971, -0.098, -0.220 ], "z_axis": [ -0.241, 0.383, 0.892 ], "quaternion": [ 0.669, -0.225, 0.058, 0.706 ] } }, { "index": 2, "index_chain": 2, "chain_name": "R", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///R/9", "linked_nts": [ "///R/8", "///R/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 179.799, "beta": -129.198, "gamma": 126.740, "delta": 72.952, "epsilon": -130.126, "zeta": -78.410, "epsilon_zeta": -51.716, "bb_type": "BI", "chi": -178.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.668, 1.607 ], "P_xyz": [ 0.794, 9.108, 1.135 ], "form": "A", "ssZp": 4.688, "Dp": 4.721, "splay_angle": 22.322, "splay_distance": 3.585, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 152.115, "theta": -135.667, "eta_prime": 172.265, "theta_prime": -136.483, "eta_base": -143.997, "theta_base": -96.785, "v0": 2.757, "v1": -30.622, "v2": 45.777, "v3": -45.024, "v4": 26.552, "amplitude": 47.430, "phase_angle": 15.169, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 26.446, -35.364, -22.679 ], "x_axis": [ -0.482, 0.651, -0.586 ], "y_axis": [ -0.822, -0.568, 0.046 ], "z_axis": [ -0.303, 0.504, 0.809 ], "quaternion": [ 0.436, -0.263, 0.163, 0.845 ] } }, { "index": 3, "index_chain": 3, "chain_name": "R", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///R/10", "linked_nts": [ "///R/9", "///R/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -58.031, "beta": 159.546, "gamma": 62.328, "delta": 80.481, "epsilon": -143.829, "zeta": -93.285, "epsilon_zeta": -50.544, "bb_type": "BI", "chi": -160.565, "glyco_bond": "anti", "C5prime_xyz": [ -1.669, 8.846, 0.513 ], "P_xyz": [ 0.879, 9.387, 0.146 ], "form": ".", "ssZp": 4.371, "Dp": 4.601, "splay_angle": 30.351, "splay_distance": 4.941, "splay_ratio": 0.263, "d22": 5.102, "d64": 5.369, "eta": 171.102, "theta": -160.422, "eta_prime": -171.045, "theta_prime": -161.753, "eta_base": -111.731, "theta_base": -154.377, "v0": -2.696, "v1": -22.311, "v2": 37.319, "v3": -39.850, "v4": 26.899, "amplitude": 40.340, "phase_angle": 22.312, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.599, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 25.284, -32.023, -22.100 ], "x_axis": [ -0.920, 0.158, -0.360 ], "y_axis": [ -0.354, -0.731, 0.584 ], "z_axis": [ -0.171, 0.664, 0.728 ], "quaternion": [ 0.139, -0.144, 0.340, 0.919 ] } }, { "index": 4, "index_chain": 4, "chain_name": "R", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///R/11", "linked_nts": [ "///R/10", "///R/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -54.491, "beta": 173.788, "gamma": 35.093, "delta": 79.676, "epsilon": -135.895, "zeta": -69.972, "epsilon_zeta": -65.923, "bb_type": "BI", "chi": -164.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.828, 0.771 ], "P_xyz": [ 0.975, 9.484, 1.489 ], "form": "A", "ssZp": 4.447, "Dp": 4.658, "splay_angle": 23.010, "splay_distance": 3.838, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 167.723, "theta": -138.379, "eta_prime": 168.556, "theta_prime": -134.626, "eta_base": -177.124, "theta_base": -100.196, "v0": 2.591, "v1": -27.216, "v2": 40.408, "v3": -39.985, "v4": 23.475, "amplitude": 41.861, "phase_angle": 15.142, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.338, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 26.292, -27.827, -19.693 ], "x_axis": [ -0.826, -0.328, -0.458 ], "y_axis": [ -0.010, -0.804, 0.594 ], "z_axis": [ -0.564, 0.496, 0.661 ], "quaternion": [ -0.088, -0.282, 0.300, 0.907 ] } }, { "index": 5, "index_chain": 5, "chain_name": "R", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///R/12", "linked_nts": [ "///R/11", "///R/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -72.791, "beta": 163.039, "gamma": 69.592, "delta": 76.033, "epsilon": -157.692, "zeta": -65.820, "epsilon_zeta": -91.872, "bb_type": "BI", "chi": -166.442, "glyco_bond": "anti", "C5prime_xyz": [ -1.792, 8.839, 0.832 ], "P_xyz": [ 0.658, 9.782, 0.392 ], "form": "A", "ssZp": 4.592, "Dp": 4.644, "splay_angle": 27.989, "splay_distance": 4.293, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": 160.021, "theta": -148.217, "eta_prime": -179.845, "theta_prime": -146.882, "eta_base": -128.445, "theta_base": -104.036, "v0": -0.589, "v1": -26.770, "v2": 42.082, "v3": -43.257, "v4": 27.820, "amplitude": 44.539, "phase_angle": 19.119, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.516, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 22.839, -26.170, -19.452 ], "x_axis": [ -0.593, -0.795, -0.133 ], "y_axis": [ 0.377, -0.419, 0.826 ], "z_axis": [ -0.712, 0.439, 0.548 ], "quaternion": [ -0.366, -0.264, 0.396, 0.800 ] } }, { "index": 6, "index_chain": 6, "chain_name": "R", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///R/13", "linked_nts": [ "///R/12", "///R/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor", "alpha": -70.807, "beta": 174.110, "gamma": 64.392, "delta": 85.731, "epsilon": -177.067, "zeta": -68.553, "epsilon_zeta": -108.514, "bb_type": "BI", "chi": -167.177, "glyco_bond": "anti", "C5prime_xyz": [ -1.328, 8.716, 1.001 ], "P_xyz": [ 1.276, 8.907, 1.227 ], "form": ".", "ssZp": 4.314, "Dp": 4.320, "splay_angle": 16.325, "splay_distance": 2.503, "splay_ratio": 0.142, "d22": null, "d64": null, "eta": 173.605, "theta": -147.958, "eta_prime": -165.392, "theta_prime": -140.889, "eta_base": -104.537, "theta_base": -127.626, "v0": 3.413, "v1": -24.700, "v2": 35.217, "v3": -34.263, "v4": 19.663, "amplitude": 36.202, "phase_angle": 13.396, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 18.687, -26.437, -18.391 ], "x_axis": [ -0.099, -0.876, 0.471 ], "y_axis": [ 0.687, 0.283, 0.670 ], "z_axis": [ -0.720, 0.390, 0.574 ], "quaternion": [ 0.663, 0.106, -0.449, -0.589 ] } }, { "index": 7, "index_chain": 7, "chain_name": "R", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///R/14", "linked_nts": [ "///R/13", "///R/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,cap-acceptor", "alpha": -115.386, "beta": -149.866, "gamma": 96.229, "delta": 141.465, "epsilon": -91.868, "zeta": -157.871, "epsilon_zeta": 66.003, "bb_type": "BII", "chi": -117.066, "glyco_bond": "anti", "C5prime_xyz": [ -1.664, 8.534, -1.344 ], "P_xyz": [ 0.949, 8.596, -0.912 ], "form": ".", "ssZp": 0.517, "Dp": 0.926, "splay_angle": 72.418, "splay_distance": 11.299, "splay_ratio": 0.597, "d22": null, "d64": null, "eta": -157.288, "theta": 171.668, "eta_prime": -136.763, "theta_prime": 133.402, "eta_base": -124.720, "theta_base": 97.873, "v0": -13.879, "v1": 28.056, "v2": -31.055, "v3": 23.707, "v4": -6.349, "amplitude": 31.293, "phase_angle": 172.915, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 16.414, -25.612, -17.747 ], "x_axis": [ 0.395, -0.613, 0.685 ], "y_axis": [ 0.351, 0.789, 0.504 ], "z_axis": [ -0.849, 0.041, 0.527 ], "quaternion": [ 0.823, 0.141, -0.466, -0.293 ] } }, { "index": 8, "index_chain": 8, "chain_name": "R", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///R/15", "linked_nts": [ "///R/14", "///R/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,junction-loop", "alpha": -168.315, "beta": 108.914, "gamma": 44.826, "delta": 80.935, "epsilon": -96.471, "zeta": -123.659, "epsilon_zeta": 27.188, "bb_type": "--", "chi": -134.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.717, 8.840, -1.041 ], "P_xyz": [ 0.723, 8.185, -1.835 ], "form": ".", "ssZp": 2.455, "Dp": 4.464, "splay_angle": 53.650, "splay_distance": 9.531, "splay_ratio": 0.452, "d22": null, "d64": null, "eta": 93.914, "theta": -114.915, "eta_prime": 90.837, "theta_prime": -126.594, "eta_base": 85.164, "theta_base": -129.495, "v0": -3.801, "v1": -20.550, "v2": 35.623, "v3": -38.778, "v4": 26.766, "amplitude": 38.992, "phase_angle": 23.992, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.010, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 21.650, -17.379, -23.444 ], "x_axis": [ 0.233, -0.800, 0.553 ], "y_axis": [ -0.748, 0.216, 0.628 ], "z_axis": [ -0.622, -0.560, -0.548 ], "quaternion": [ 0.475, 0.625, -0.619, -0.027 ] } }, { "index": 9, "index_chain": 9, "chain_name": "R", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///R/16", "linked_nts": [ "///R/15", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop", "alpha": 77.701, "beta": -104.506, "gamma": -117.298, "delta": 89.127, "epsilon": -134.367, "zeta": -54.420, "epsilon_zeta": -79.947, "bb_type": "BI", "chi": -173.246, "glyco_bond": "anti", "C5prime_xyz": [ -1.186, 8.348, 1.370 ], "P_xyz": [ -1.325, 10.758, 0.347 ], "form": ".", "ssZp": 4.672, "Dp": 4.706, "splay_angle": 28.221, "splay_distance": 4.499, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -153.033, "theta": -172.523, "eta_prime": -152.648, "theta_prime": -156.584, "eta_base": -141.929, "theta_base": -96.371, "v0": 9.992, "v1": -28.974, "v2": 35.864, "v3": -31.251, "v4": 13.562, "amplitude": 35.914, "phase_angle": 3.032, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 14.950, -23.776, -25.689 ], "x_axis": [ 0.067, -0.648, 0.758 ], "y_axis": [ -0.199, 0.736, 0.647 ], "z_axis": [ -0.978, -0.195, -0.080 ], "quaternion": [ 0.656, 0.321, -0.661, -0.171 ] } }, { "index": 10, "index_chain": 10, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/16", "///R/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -86.922, "beta": 172.475, "gamma": 62.829, "delta": 77.606, "epsilon": -143.123, "zeta": -69.100, "epsilon_zeta": -74.023, "bb_type": "BI", "chi": -161.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.855, 0.628 ], "P_xyz": [ 1.196, 9.390, 0.401 ], "form": ".", "ssZp": 4.469, "Dp": 4.698, "splay_angle": 29.513, "splay_distance": 4.834, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 149.569, "theta": -140.155, "eta_prime": 176.791, "theta_prime": -139.695, "eta_base": -107.291, "theta_base": -120.492, "v0": 3.679, "v1": -30.128, "v2": 43.702, "v3": -42.682, "v4": 24.624, "amplitude": 45.037, "phase_angle": 13.986, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.426, "filter_rmsd": 0.068, "frame": { "rmsd": 0.009, "origin": [ 12.485, -26.324, -22.918 ], "x_axis": [ -0.051, 0.260, 0.964 ], "y_axis": [ -0.342, 0.902, -0.262 ], "z_axis": [ -0.938, -0.343, 0.043 ], "quaternion": [ 0.688, 0.030, -0.691, 0.219 ] } }, { "index": 11, "index_chain": 11, "chain_name": "R", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///R/18", "linked_nts": [ "///R/17", "///R/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -81.240, "beta": -171.564, "gamma": 57.399, "delta": 74.503, "epsilon": -120.277, "zeta": -50.244, "epsilon_zeta": -70.033, "bb_type": "--", "chi": -167.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.823, 8.797, 0.863 ], "P_xyz": [ 0.580, 9.681, 1.382 ], "form": "A", "ssZp": 4.451, "Dp": 4.745, "splay_angle": 21.064, "splay_distance": 3.618, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.839, "theta": -136.376, "eta_prime": 175.488, "theta_prime": -141.415, "eta_base": -155.440, "theta_base": -115.257, "v0": -4.081, "v1": -25.280, "v2": 43.221, "v3": -46.572, "v4": 31.993, "amplitude": 47.069, "phase_angle": 23.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.667, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 9.058, -28.782, -20.555 ], "x_axis": [ 0.270, 0.756, 0.597 ], "y_axis": [ -0.204, 0.651, -0.731 ], "z_axis": [ -0.941, 0.075, 0.330 ], "quaternion": [ 0.750, -0.269, -0.513, 0.320 ] } }, { "index": 12, "index_chain": 12, "chain_name": "R", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///R/19", "linked_nts": [ "///R/18", "///R/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -104.113, "beta": 83.127, "gamma": 156.578, "delta": 98.090, "epsilon": -105.312, "zeta": -42.614, "epsilon_zeta": -62.698, "bb_type": "--", "chi": -177.582, "glyco_bond": "anti", "C5prime_xyz": [ -0.730, 7.945, 1.674 ], "P_xyz": [ -0.272, 10.005, 0.088 ], "form": "A", "ssZp": 4.591, "Dp": 4.700, "splay_angle": 21.368, "splay_distance": 3.623, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -167.008, "theta": -151.206, "eta_prime": -167.182, "theta_prime": -150.169, "eta_base": -130.046, "theta_base": -116.480, "v0": 22.761, "v1": -35.191, "v2": 34.330, "v3": -21.858, "v4": -0.478, "amplitude": 36.329, "phase_angle": 340.908, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.072, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 7.189, -28.389, -17.483 ], "x_axis": [ 0.137, 0.950, 0.279 ], "y_axis": [ -0.438, 0.311, -0.844 ], "z_axis": [ -0.889, -0.006, 0.459 ], "quaternion": [ 0.690, -0.303, -0.423, 0.503 ] } }, { "index": 13, "index_chain": 13, "chain_name": "R", "nt_resnum": 20, "nt_name": "A", "nt_code": "A", "nt_id": "///R/20", "linked_nts": [ "///R/19", "///R/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -116.690, "beta": 111.106, "gamma": 122.048, "delta": 73.145, "epsilon": -117.476, "zeta": -121.614, "epsilon_zeta": 4.138, "bb_type": "--", "chi": 173.038, "glyco_bond": "anti", "C5prime_xyz": [ -1.339, 8.043, 2.059 ], "P_xyz": [ -0.312, 9.912, 0.493 ], "form": ".", "ssZp": 4.756, "Dp": 4.752, "splay_angle": 30.994, "splay_distance": 4.835, "splay_ratio": 0.287, "d22": null, "d64": null, "eta": 130.334, "theta": -162.279, "eta_prime": 163.000, "theta_prime": -156.884, "eta_base": -137.655, "theta_base": -129.134, "v0": 15.388, "v1": -40.635, "v2": 50.126, "v3": -42.683, "v4": 17.003, "amplitude": 50.140, "phase_angle": 1.360, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 5.504, -26.753, -14.725 ], "x_axis": [ -0.068, 0.973, -0.220 ], "y_axis": [ -0.562, -0.219, -0.798 ], "z_axis": [ -0.824, 0.069, 0.562 ], "quaternion": [ 0.564, -0.384, -0.268, 0.680 ] } }, { "index": 14, "index_chain": 14, "chain_name": "R", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///R/21", "linked_nts": [ "///R/20", "///R/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 9.949, "beta": 113.807, "gamma": 53.289, "delta": 73.217, "epsilon": -149.814, "zeta": -75.064, "epsilon_zeta": -74.750, "bb_type": "BI", "chi": -178.874, "glyco_bond": "anti", "C5prime_xyz": [ -2.278, 8.871, 1.356 ], "P_xyz": [ 0.336, 9.237, 1.352 ], "form": "A", "ssZp": 4.441, "Dp": 4.454, "splay_angle": 25.239, "splay_distance": 4.000, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": -172.918, "theta": -140.283, "eta_prime": -156.593, "theta_prime": -143.899, "eta_base": -117.397, "theta_base": -105.885, "v0": -10.571, "v1": -18.345, "v2": 38.672, "v3": -45.449, "v4": 35.238, "amplitude": 45.352, "phase_angle": 31.492, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 4.047, -23.381, -11.581 ], "x_axis": [ -0.332, 0.677, -0.657 ], "y_axis": [ -0.446, -0.726, -0.523 ], "z_axis": [ -0.831, 0.120, 0.543 ], "quaternion": [ 0.348, -0.462, -0.125, 0.806 ] } }, { "index": 15, "index_chain": 15, "chain_name": "R", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///R/22", "linked_nts": [ "///R/21", "///R/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor", "alpha": -62.460, "beta": 169.652, "gamma": 57.844, "delta": 81.854, "epsilon": -143.810, "zeta": -66.215, "epsilon_zeta": -77.595, "bb_type": "BI", "chi": -165.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.833, 0.871 ], "P_xyz": [ 1.088, 9.212, 1.245 ], "form": ".", "ssZp": 4.391, "Dp": 4.511, "splay_angle": 27.008, "splay_distance": 4.205, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 173.847, "theta": -132.599, "eta_prime": -171.707, "theta_prime": -123.978, "eta_base": -115.694, "theta_base": -72.890, "v0": 0.648, "v1": -23.321, "v2": 36.147, "v3": -36.661, "v4": 22.651, "amplitude": 37.927, "phase_angle": 17.624, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 1.068, -21.096, -10.203 ], "x_axis": [ -0.595, -0.001, -0.804 ], "y_axis": [ -0.065, -0.997, 0.049 ], "z_axis": [ -0.801, 0.081, 0.593 ], "quaternion": [ 0.018, -0.450, 0.036, 0.892 ] } }, { "index": 16, "index_chain": 16, "chain_name": "R", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///R/23", "linked_nts": [ "///R/22", "///R/24" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -69.207, "beta": 177.680, "gamma": 67.171, "delta": 131.658, "epsilon": -134.910, "zeta": -176.089, "epsilon_zeta": 41.179, "bb_type": "BII", "chi": -136.617, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.658, -0.412 ], "P_xyz": [ 1.107, 8.774, 0.122 ], "form": ".", "ssZp": 2.443, "Dp": 2.533, "splay_angle": 63.844, "splay_distance": 10.326, "splay_ratio": 0.530, "d22": null, "d64": null, "eta": -179.089, "theta": 168.485, "eta_prime": -146.833, "theta_prime": 160.559, "eta_base": -86.609, "theta_base": 179.844, "v0": -13.722, "v1": 20.406, "v2": -19.125, "v3": 11.693, "v4": 1.152, "amplitude": 20.604, "phase_angle": 158.163, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.491, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ -3.053, -21.846, -10.571 ], "x_axis": [ -0.190, -0.801, -0.568 ], "y_axis": [ 0.278, -0.598, 0.751 ], "z_axis": [ -0.942, -0.015, 0.336 ], "quaternion": [ -0.370, -0.518, 0.253, 0.729 ] } }, { "index": 17, "index_chain": 17, "chain_name": "R", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///R/24", "linked_nts": [ "///R/23", "///R/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,cap-acceptor,phosphate", "alpha": -51.309, "beta": 153.516, "gamma": 39.973, "delta": 81.822, "epsilon": -139.264, "zeta": -54.294, "epsilon_zeta": -84.970, "bb_type": "BI", "chi": -174.399, "glyco_bond": "anti", "C5prime_xyz": [ -1.718, 8.704, 1.309 ], "P_xyz": [ 0.788, 9.109, 2.073 ], "form": ".", "ssZp": 4.512, "Dp": 4.536, "splay_angle": 32.317, "splay_distance": 5.141, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": -167.807, "theta": -121.650, "eta_prime": -177.845, "theta_prime": -121.114, "eta_base": -167.030, "theta_base": -77.531, "v0": -0.125, "v1": -24.314, "v2": 38.228, "v3": -38.937, "v4": 24.712, "amplitude": 40.321, "phase_angle": 18.541, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.159, "filter_rmsd": 0.042, "frame": { "rmsd": 0.012, "origin": [ -4.565, -14.313, -3.674 ], "x_axis": [ -0.662, -0.496, -0.562 ], "y_axis": [ 0.467, -0.859, 0.210 ], "z_axis": [ -0.587, -0.124, 0.800 ], "quaternion": [ -0.264, -0.315, 0.024, 0.911 ] } }, { "index": 18, "index_chain": 18, "chain_name": "R", "nt_resnum": 25, "nt_name": "A", "nt_code": "A", "nt_id": "///R/25", "linked_nts": [ "///R/24", "///R/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -88.573, "beta": 159.275, "gamma": 79.679, "delta": 78.043, "epsilon": -117.423, "zeta": -70.737, "epsilon_zeta": -46.686, "bb_type": "--", "chi": 172.483, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 8.330, 1.993 ], "P_xyz": [ 0.634, 9.200, 2.077 ], "form": ".", "ssZp": 4.712, "Dp": 4.706, "splay_angle": 35.087, "splay_distance": 5.269, "splay_ratio": 0.302, "d22": null, "d64": null, "eta": 163.722, "theta": -123.229, "eta_prime": -172.539, "theta_prime": -119.096, "eta_base": -104.301, "theta_base": -56.304, "v0": -0.622, "v1": -25.860, "v2": 40.988, "v3": -42.307, "v4": 27.188, "amplitude": 43.437, "phase_angle": 19.333, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.073, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -8.908, -16.582, -2.117 ], "x_axis": [ -0.014, -0.966, -0.258 ], "y_axis": [ 0.896, -0.127, 0.426 ], "z_axis": [ -0.445, -0.225, 0.867 ], "quaternion": [ 0.657, 0.248, -0.071, -0.709 ] } }, { "index": 19, "index_chain": 19, "chain_name": "R", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///R/26", "linked_nts": [ "///R/25", "///R/27" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -61.091, "beta": 160.871, "gamma": 49.972, "delta": 82.694, "epsilon": -140.526, "zeta": -85.009, "epsilon_zeta": -55.517, "bb_type": "BI", "chi": -163.213, "glyco_bond": "anti", "C5prime_xyz": [ -1.139, 8.709, 0.740 ], "P_xyz": [ 1.473, 8.731, 0.727 ], "form": "A", "ssZp": 4.468, "Dp": 4.674, "splay_angle": 22.372, "splay_distance": 3.687, "splay_ratio": 0.199, "d22": 4.286, "d64": 4.733, "eta": 153.049, "theta": -141.482, "eta_prime": -179.244, "theta_prime": -142.245, "eta_base": -92.102, "theta_base": -129.472, "v0": 6.964, "v1": -31.256, "v2": 42.525, "v3": -39.521, "v4": 20.552, "amplitude": 43.114, "phase_angle": 9.479, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.471, "filter_rmsd": 0.067, "frame": { "rmsd": 0.007, "origin": [ -8.545, -21.330, 0.139 ], "x_axis": [ 0.848, -0.441, 0.293 ], "y_axis": [ 0.257, 0.827, 0.501 ], "z_axis": [ -0.463, -0.349, 0.815 ], "quaternion": [ 0.934, 0.228, -0.202, -0.187 ] } }, { "index": 20, "index_chain": 20, "chain_name": "R", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///R/27", "linked_nts": [ "///R/26", "///R/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.937, "beta": 155.794, "gamma": 48.020, "delta": 75.656, "epsilon": -147.705, "zeta": -79.272, "epsilon_zeta": -68.432, "bb_type": "BI", "chi": -162.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.709, 8.956, 0.601 ], "P_xyz": [ 0.841, 9.628, 0.598 ], "form": "A", "ssZp": 4.456, "Dp": 4.634, "splay_angle": 21.990, "splay_distance": 3.478, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 171.036, "theta": -154.701, "eta_prime": -176.540, "theta_prime": -153.292, "eta_base": -148.034, "theta_base": -126.555, "v0": -5.278, "v1": -21.641, "v2": 38.658, "v3": -42.545, "v4": 30.329, "amplitude": 42.797, "phase_angle": 25.406, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.484, "filter_rmsd": 0.066, "frame": { "rmsd": 0.006, "origin": [ -10.013, -24.220, 1.895 ], "x_axis": [ 0.924, -0.022, 0.383 ], "y_axis": [ -0.148, 0.900, 0.410 ], "z_axis": [ -0.353, -0.435, 0.828 ], "quaternion": [ 0.955, 0.221, -0.193, 0.033 ] } }, { "index": 21, "index_chain": 21, "chain_name": "R", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///R/28", "linked_nts": [ "///R/27", "///R/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.361, "beta": 172.753, "gamma": 60.222, "delta": 81.706, "epsilon": -141.095, "zeta": -67.269, "epsilon_zeta": -73.827, "bb_type": "BI", "chi": -161.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.719, 0.605 ], "P_xyz": [ 1.337, 9.078, 0.550 ], "form": ".", "ssZp": 4.462, "Dp": 4.701, "splay_angle": 25.114, "splay_distance": 3.978, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 166.153, "theta": -132.500, "eta_prime": 175.211, "theta_prime": -130.753, "eta_base": -147.396, "theta_base": -86.525, "v0": 6.016, "v1": -30.446, "v2": 41.652, "v3": -39.159, "v4": 21.102, "amplitude": 42.364, "phase_angle": 10.517, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.789, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ -10.288, -26.590, 4.427 ], "x_axis": [ 0.755, 0.562, 0.339 ], "y_axis": [ -0.647, 0.724, 0.239 ], "z_axis": [ -0.111, -0.399, 0.910 ], "quaternion": [ 0.920, 0.173, -0.122, 0.328 ] } }, { "index": 22, "index_chain": 22, "chain_name": "R", "nt_resnum": 29, "nt_name": "U", "nt_code": "U", "nt_id": "///R/29", "linked_nts": [ "///R/28", "///R/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.583, "beta": 161.863, "gamma": 60.447, "delta": 78.276, "epsilon": -134.902, "zeta": -89.361, "epsilon_zeta": -45.541, "bb_type": "BI", "chi": -162.593, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.824, 0.673 ], "P_xyz": [ 1.134, 9.221, 0.291 ], "form": "A", "ssZp": 4.458, "Dp": 4.723, "splay_angle": 21.818, "splay_distance": 3.546, "splay_ratio": 0.192, "d22": 4.587, "d64": 4.780, "eta": 163.225, "theta": -156.075, "eta_prime": -175.126, "theta_prime": -159.576, "eta_base": -109.911, "theta_base": -160.181, "v0": 3.506, "v1": -29.005, "v2": 42.437, "v3": -41.107, "v4": 23.745, "amplitude": 43.718, "phase_angle": 13.908, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.854, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ -8.394, -26.089, 7.889 ], "x_axis": [ 0.092, 0.927, 0.363 ], "y_axis": [ -0.994, 0.066, 0.085 ], "z_axis": [ 0.055, -0.369, 0.928 ], "quaternion": [ 0.722, 0.157, -0.107, 0.665 ] } }, { "index": 23, "index_chain": 23, "chain_name": "R", "nt_resnum": 30, "nt_name": "U", "nt_code": "U", "nt_id": "///R/30", "linked_nts": [ "///R/29", "///R/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.897, "beta": 147.261, "gamma": 79.942, "delta": 75.026, "epsilon": -143.930, "zeta": -74.353, "epsilon_zeta": -69.577, "bb_type": "BI", "chi": -167.707, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 8.789, 0.939 ], "P_xyz": [ 0.829, 9.504, 0.012 ], "form": "A", "ssZp": 4.526, "Dp": 4.648, "splay_angle": 23.550, "splay_distance": 3.733, "splay_ratio": 0.207, "d22": 4.089, "d64": 4.069, "eta": 163.013, "theta": -147.800, "eta_prime": 171.185, "theta_prime": -148.373, "eta_base": -176.068, "theta_base": -117.279, "v0": -1.460, "v1": -26.044, "v2": 42.182, "v3": -44.164, "v4": 28.738, "amplitude": 45.009, "phase_angle": 20.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.075, "filter_rmsd": 0.108, "frame": { "rmsd": 0.012, "origin": [ -6.378, -28.095, 10.006 ], "x_axis": [ -0.182, 0.961, 0.210 ], "y_axis": [ -0.961, -0.220, 0.171 ], "z_axis": [ 0.210, -0.171, 0.963 ], "quaternion": [ 0.625, 0.137, -0.000, 0.769 ] } }, { "index": 24, "index_chain": 24, "chain_name": "R", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///R/31", "linked_nts": [ "///R/30", "///R/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -72.238, "beta": 178.368, "gamma": 57.172, "delta": 79.396, "epsilon": -139.228, "zeta": -67.929, "epsilon_zeta": -71.299, "bb_type": "BI", "chi": -160.856, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.851, 0.566 ], "P_xyz": [ 1.166, 9.236, 0.719 ], "form": "A", "ssZp": 4.401, "Dp": 4.664, "splay_angle": 22.575, "splay_distance": 3.759, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 165.986, "theta": -134.035, "eta_prime": 178.391, "theta_prime": -134.404, "eta_base": -136.106, "theta_base": -101.996, "v0": 4.048, "v1": -29.077, "v2": 42.031, "v3": -40.605, "v4": 23.008, "amplitude": 43.183, "phase_angle": 13.262, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -4.942, -26.654, 13.135 ], "x_axis": [ -0.769, 0.638, 0.039 ], "y_axis": [ -0.630, -0.767, 0.118 ], "z_axis": [ 0.105, 0.066, 0.992 ], "quaternion": [ 0.338, 0.038, 0.049, 0.939 ] } }, { "index": 25, "index_chain": 25, "chain_name": "R", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///R/32", "linked_nts": [ "///R/31", "///R/33" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -66.627, "beta": 172.624, "gamma": 53.784, "delta": 73.984, "epsilon": -140.047, "zeta": -52.027, "epsilon_zeta": -88.020, "bb_type": "BI", "chi": -154.767, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.949, 0.210 ], "P_xyz": [ 1.056, 9.730, -0.102 ], "form": ".", "ssZp": 4.249, "Dp": 4.755, "splay_angle": 80.279, "splay_distance": 11.108, "splay_ratio": 0.645, "d22": null, "d64": null, "eta": 160.789, "theta": -117.157, "eta_prime": 175.167, "theta_prime": -163.474, "eta_base": -134.764, "theta_base": 138.226, "v0": 3.723, "v1": -30.873, "v2": 44.705, "v3": -43.684, "v4": 25.275, "amplitude": 46.079, "phase_angle": 14.023, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -5.722, -24.232, 15.901 ], "x_axis": [ -0.998, 0.031, -0.051 ], "y_axis": [ -0.043, -0.965, 0.259 ], "z_axis": [ -0.042, 0.261, 0.964 ], "quaternion": [ 0.019, -0.023, 0.131, 0.991 ] } }, { "index": 26, "index_chain": 26, "chain_name": "R", "nt_resnum": 33, "nt_name": "A", "nt_code": "A", "nt_id": "///R/33", "linked_nts": [ "///R/32", "///R/34" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 173.540, "beta": 130.620, "gamma": 52.993, "delta": 89.139, "epsilon": -136.662, "zeta": -71.049, "epsilon_zeta": -65.613, "bb_type": "BI", "chi": -176.658, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.415, 1.518 ], "P_xyz": [ 1.101, 8.146, 1.385 ], "form": ".", "ssZp": 4.547, "Dp": 4.557, "splay_angle": 23.439, "splay_distance": 3.645, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 13.397, "theta": -118.136, "eta_prime": 46.076, "theta_prime": -123.405, "eta_base": 25.196, "theta_base": -81.557, "v0": 3.999, "v1": -23.277, "v2": 32.664, "v3": -31.285, "v4": 17.223, "amplitude": 33.385, "phase_angle": 11.926, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.508, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 2.945, -26.784, 22.362 ], "x_axis": [ 0.318, -0.907, -0.275 ], "y_axis": [ -0.915, -0.369, 0.161 ], "z_axis": [ -0.248, 0.201, -0.948 ], "quaternion": [ -0.012, 0.812, -0.561, -0.161 ] } }, { "index": 27, "index_chain": 27, "chain_name": "R", "nt_resnum": 34, "nt_name": "A", "nt_code": "A", "nt_id": "///R/34", "linked_nts": [ "///R/33", "///R/35" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate", "alpha": -76.306, "beta": 168.623, "gamma": 67.509, "delta": 86.705, "epsilon": -148.269, "zeta": -80.090, "epsilon_zeta": -68.179, "bb_type": "BI", "chi": -153.091, "glyco_bond": "anti", "C5prime_xyz": [ -1.384, 8.792, 0.091 ], "P_xyz": [ 1.207, 9.019, -0.353 ], "form": ".", "ssZp": 4.183, "Dp": 4.536, "splay_angle": 21.389, "splay_distance": 3.424, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 163.785, "theta": -144.976, "eta_prime": -172.281, "theta_prime": -147.603, "eta_base": -104.371, "theta_base": -107.453, "v0": 1.424, "v1": -22.918, "v2": 34.269, "v3": -34.021, "v4": 20.856, "amplitude": 35.676, "phase_angle": 16.147, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.532, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 3.067, -28.232, 19.019 ], "x_axis": [ -0.511, -0.836, -0.200 ], "y_axis": [ -0.859, 0.499, 0.113 ], "z_axis": [ 0.006, 0.230, -0.973 ], "quaternion": [ 0.060, -0.491, 0.864, 0.099 ] } }, { "index": 28, "index_chain": 28, "chain_name": "R", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///R/35", "linked_nts": [ "///R/34", "///R/36" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate", "alpha": -63.966, "beta": 160.747, "gamma": 52.967, "delta": 86.998, "epsilon": -115.237, "zeta": -53.047, "epsilon_zeta": -62.190, "bb_type": "--", "chi": -150.992, "glyco_bond": "anti", "C5prime_xyz": [ -1.031, 8.601, 0.015 ], "P_xyz": [ 1.560, 8.523, -0.473 ], "form": ".", "ssZp": 3.888, "Dp": 4.781, "splay_angle": 46.051, "splay_distance": 7.468, "splay_ratio": 0.391, "d22": null, "d64": null, "eta": 171.290, "theta": -96.309, "eta_prime": -175.955, "theta_prime": -87.695, "eta_base": -123.005, "theta_base": -59.431, "v0": 10.329, "v1": -29.890, "v2": 37.446, "v3": -32.570, "v4": 14.056, "amplitude": 37.504, "phase_angle": 3.182, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.793, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 2.113, -28.404, 15.735 ], "x_axis": [ -0.943, -0.327, -0.064 ], "y_axis": [ -0.330, 0.943, 0.037 ], "z_axis": [ 0.049, 0.056, -0.997 ], "quaternion": [ 0.029, -0.167, 0.985, 0.024 ] } }, { "index": 29, "index_chain": 29, "chain_name": "R", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///R/36", "linked_nts": [ "///R/35", "///R/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor", "alpha": -65.645, "beta": 139.598, "gamma": 92.844, "delta": 74.912, "epsilon": -150.603, "zeta": -75.756, "epsilon_zeta": -74.847, "bb_type": "BI", "chi": -172.465, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.747, 1.180 ], "P_xyz": [ 0.339, 9.679, -0.113 ], "form": "A", "ssZp": 4.624, "Dp": 4.653, "splay_angle": 23.451, "splay_distance": 3.621, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 166.611, "theta": -158.449, "eta_prime": -147.259, "theta_prime": -164.919, "eta_base": -83.746, "theta_base": -141.508, "v0": 0.230, "v1": -28.461, "v2": 44.447, "v3": -45.022, "v4": 28.495, "amplitude": 46.773, "phase_angle": 18.144, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -4.777, -27.222, 13.108 ], "x_axis": [ -0.751, 0.657, 0.064 ], "y_axis": [ 0.650, 0.753, -0.099 ], "z_axis": [ -0.113, -0.033, -0.993 ], "quaternion": [ -0.047, 0.350, 0.935, -0.035 ] } }, { "index": 30, "index_chain": 30, "chain_name": "R", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///R/37", "linked_nts": [ "///R/36", "///R/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.718, "beta": 170.333, "gamma": 63.720, "delta": 82.683, "epsilon": -150.103, "zeta": -73.534, "epsilon_zeta": -76.569, "bb_type": "BI", "chi": -167.265, "glyco_bond": "anti", "C5prime_xyz": [ -1.158, 8.540, 0.999 ], "P_xyz": [ 1.427, 8.931, 0.833 ], "form": "A", "ssZp": 4.617, "Dp": 4.684, "splay_angle": 26.426, "splay_distance": 4.108, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 169.325, "theta": -148.329, "eta_prime": 179.966, "theta_prime": -149.606, "eta_base": -139.972, "theta_base": -131.775, "v0": 12.038, "v1": -34.361, "v2": 42.165, "v3": -36.505, "v4": 15.553, "amplitude": 42.205, "phase_angle": 2.497, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ -6.618, -28.322, 10.191 ], "x_axis": [ -0.289, 0.956, -0.043 ], "y_axis": [ 0.943, 0.277, -0.183 ], "z_axis": [ -0.163, -0.093, -0.982 ], "quaternion": [ -0.038, 0.595, 0.798, -0.087 ] } }, { "index": 31, "index_chain": 31, "chain_name": "R", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///R/38", "linked_nts": [ "///R/37", "///R/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -78.515, "beta": 174.891, "gamma": 66.660, "delta": 80.788, "epsilon": -131.109, "zeta": -86.896, "epsilon_zeta": -44.213, "bb_type": "BI", "chi": -179.048, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.501, 1.588 ], "P_xyz": [ 1.172, 8.937, 1.951 ], "form": "A", "ssZp": 4.737, "Dp": 4.744, "splay_angle": 24.283, "splay_distance": 3.684, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 172.914, "theta": -142.297, "eta_prime": -178.096, "theta_prime": -136.806, "eta_base": -147.149, "theta_base": -91.503, "v0": 2.235, "v1": -26.221, "v2": 38.941, "v3": -38.610, "v4": 23.071, "amplitude": 40.410, "phase_angle": 15.495, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.629, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -9.283, -28.794, 7.101 ], "x_axis": [ 0.243, 0.966, 0.092 ], "y_axis": [ 0.969, -0.236, -0.077 ], "z_axis": [ -0.053, 0.107, -0.993 ], "quaternion": [ -0.059, 0.786, 0.615, 0.012 ] } }, { "index": 32, "index_chain": 32, "chain_name": "R", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///R/39", "linked_nts": [ "///R/38", "///R/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.238, "beta": 158.592, "gamma": 40.821, "delta": 80.084, "epsilon": -138.352, "zeta": -75.963, "epsilon_zeta": -62.389, "bb_type": "BI", "chi": -162.486, "glyco_bond": "anti", "C5prime_xyz": [ -1.260, 8.701, 0.718 ], "P_xyz": [ 1.375, 8.706, 0.812 ], "form": "A", "ssZp": 4.482, "Dp": 4.716, "splay_angle": 22.677, "splay_distance": 3.705, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 163.336, "theta": -140.651, "eta_prime": -179.972, "theta_prime": -143.971, "eta_base": -118.226, "theta_base": -132.034, "v0": 10.225, "v1": -35.177, "v2": 45.816, "v3": -40.782, "v4": 19.225, "amplitude": 46.062, "phase_angle": 5.913, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.453, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ -9.465, -26.422, 4.289 ], "x_axis": [ 0.856, 0.517, -0.003 ], "y_axis": [ 0.504, -0.836, -0.216 ], "z_axis": [ -0.115, 0.183, -0.976 ], "quaternion": [ -0.104, 0.958, 0.267, -0.031 ] } }, { "index": 33, "index_chain": 33, "chain_name": "R", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///R/40", "linked_nts": [ "///R/39", "///R/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -87.720, "beta": 156.353, "gamma": 82.268, "delta": 72.814, "epsilon": -122.553, "zeta": -100.657, "epsilon_zeta": -21.896, "bb_type": "--", "chi": -178.953, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.565, 1.616 ], "P_xyz": [ 0.862, 9.501, 1.023 ], "form": "A", "ssZp": 4.792, "Dp": 4.837, "splay_angle": 22.613, "splay_distance": 3.595, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 161.408, "theta": -154.103, "eta_prime": 171.030, "theta_prime": -150.913, "eta_base": -159.235, "theta_base": -124.174, "v0": 7.720, "v1": -35.517, "v2": 48.519, "v3": -44.850, "v4": 23.589, "amplitude": 49.205, "phase_angle": 9.580, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.033, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -10.351, -23.886, 1.737 ], "x_axis": [ 0.986, 0.074, 0.151 ], "y_axis": [ 0.113, -0.958, -0.263 ], "z_axis": [ 0.126, 0.276, -0.953 ], "quaternion": [ -0.137, 0.987, 0.047, 0.070 ] } }, { "index": 34, "index_chain": 34, "chain_name": "R", "nt_resnum": 41, "nt_name": "G", "nt_code": "G", "nt_id": "///R/41", "linked_nts": [ "///R/40", "///R/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -41.382, "beta": 144.830, "gamma": 52.085, "delta": 76.885, "epsilon": -158.610, "zeta": -61.203, "epsilon_zeta": -97.407, "bb_type": "BI", "chi": -168.632, "glyco_bond": "anti", "C5prime_xyz": [ -1.720, 8.825, 0.987 ], "P_xyz": [ 0.865, 9.255, 0.697 ], "form": ".", "ssZp": 4.568, "Dp": 4.603, "splay_angle": 34.295, "splay_distance": 5.344, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 166.773, "theta": -111.697, "eta_prime": -178.459, "theta_prime": -117.764, "eta_base": -136.548, "theta_base": -68.907, "v0": 1.208, "v1": -29.168, "v2": 44.643, "v3": -44.617, "v4": 27.491, "amplitude": 46.657, "phase_angle": 16.895, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.446, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -8.860, -21.220, -0.159 ], "x_axis": [ 0.887, -0.458, 0.065 ], "y_axis": [ -0.384, -0.807, -0.448 ], "z_axis": [ 0.257, 0.373, -0.892 ], "quaternion": [ -0.217, 0.947, -0.222, 0.085 ] } }, { "index": 35, "index_chain": 35, "chain_name": "R", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///R/42", "linked_nts": [ "///R/41", "///R/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -175.512, "beta": -156.102, "gamma": 141.227, "delta": 88.525, "epsilon": -104.467, "zeta": -97.521, "epsilon_zeta": -6.946, "bb_type": "--", "chi": -167.885, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.565, 1.109 ], "P_xyz": [ 0.940, 9.357, 0.025 ], "form": ".", "ssZp": 4.290, "Dp": 4.609, "splay_angle": 41.895, "splay_distance": 6.228, "splay_ratio": 0.392, "d22": null, "d64": null, "eta": 169.787, "theta": -145.929, "eta_prime": -166.278, "theta_prime": -138.563, "eta_base": -92.829, "theta_base": -72.701, "v0": 9.623, "v1": -29.978, "v2": 37.910, "v3": -33.504, "v4": 15.124, "amplitude": 38.023, "phase_angle": 4.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -4.610, -23.267, -2.672 ], "x_axis": [ 0.095, -0.937, -0.336 ], "y_axis": [ -0.883, 0.076, -0.462 ], "z_axis": [ 0.459, 0.340, -0.821 ], "quaternion": [ -0.296, 0.678, -0.671, 0.046 ] } }, { "index": 36, "index_chain": 36, "chain_name": "R", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///R/43", "linked_nts": [ "///R/42", "///R/44" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": -70.232, "beta": 135.995, "gamma": 93.360, "delta": 137.829, "epsilon": -89.171, "zeta": -156.456, "epsilon_zeta": 67.285, "bb_type": "BII", "chi": 76.036, "glyco_bond": "syn", "C5prime_xyz": [ -5.170, 5.011, 2.159 ], "P_xyz": [ -4.544, 2.978, 3.693 ], "form": ".", "ssZp": -0.568, "Dp": 0.615, "splay_angle": 62.367, "splay_distance": 10.342, "splay_ratio": 0.518, "d22": null, "d64": null, "eta": -147.242, "theta": 165.086, "eta_prime": -132.164, "theta_prime": 159.495, "eta_base": -71.054, "theta_base": 151.351, "v0": -32.221, "v1": 41.544, "v2": -34.997, "v3": 17.560, "v4": 9.094, "amplitude": 40.926, "phase_angle": 148.773, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ -6.116, -23.895, -8.682 ], "x_axis": [ 0.252, -0.654, 0.713 ], "y_axis": [ 0.309, 0.753, 0.581 ], "z_axis": [ -0.917, 0.074, 0.392 ], "quaternion": [ 0.774, 0.164, -0.526, -0.311 ] } }, { "index": 37, "index_chain": 37, "chain_name": "R", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///R/44", "linked_nts": [ "///R/43", "///R/45" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,cap-donor", "alpha": -129.045, "beta": 140.576, "gamma": 61.198, "delta": 71.164, "epsilon": -143.985, "zeta": -96.141, "epsilon_zeta": -47.845, "bb_type": "BI", "chi": -155.895, "glyco_bond": "anti", "C5prime_xyz": [ -2.048, 9.080, 0.100 ], "P_xyz": [ 0.346, 9.752, -0.775 ], "form": ".", "ssZp": 4.151, "Dp": 4.560, "splay_angle": 36.828, "splay_distance": 5.942, "splay_ratio": 0.316, "d22": null, "d64": null, "eta": 137.593, "theta": -120.503, "eta_prime": 137.615, "theta_prime": -120.186, "eta_base": 146.257, "theta_base": -78.307, "v0": -10.464, "v1": -20.786, "v2": 42.311, "v3": -49.477, "v4": 37.507, "amplitude": 49.099, "phase_angle": 30.485, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.031, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 2.008, -19.679, -3.866 ], "x_axis": [ -0.264, -0.721, -0.640 ], "y_axis": [ -0.599, 0.643, -0.477 ], "z_axis": [ 0.756, 0.257, -0.602 ], "quaternion": [ 0.441, -0.417, 0.792, -0.069 ] } }, { "index": 38, "index_chain": 38, "chain_name": "R", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///R/45", "linked_nts": [ "///R/44", "///R/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor", "alpha": 138.649, "beta": -109.330, "gamma": 175.630, "delta": 84.530, "epsilon": -153.056, "zeta": -73.657, "epsilon_zeta": -79.399, "bb_type": "BI", "chi": 177.025, "glyco_bond": "anti", "C5prime_xyz": [ -1.667, 8.474, 1.735 ], "P_xyz": [ -0.073, 9.558, -0.095 ], "form": "A", "ssZp": 4.542, "Dp": 4.571, "splay_angle": 23.926, "splay_distance": 3.789, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 167.187, "theta": -156.547, "eta_prime": -154.630, "theta_prime": -165.040, "eta_base": -83.224, "theta_base": -143.542, "v0": 1.900, "v1": -27.109, "v2": 40.440, "v3": -39.955, "v4": 24.287, "amplitude": 42.029, "phase_angle": 15.806, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.023, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 1.535, -21.242, -9.580 ], "x_axis": [ -0.633, 0.051, -0.773 ], "y_axis": [ -0.042, 0.994, 0.100 ], "z_axis": [ 0.773, 0.096, -0.627 ], "quaternion": [ 0.428, 0.003, 0.902, 0.054 ] } }, { "index": 39, "index_chain": 39, "chain_name": "R", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///R/46", "linked_nts": [ "///R/45", "///R/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor", "alpha": -90.618, "beta": -172.415, "gamma": 74.099, "delta": 85.837, "epsilon": -113.419, "zeta": -115.793, "epsilon_zeta": 2.374, "bb_type": "--", "chi": -163.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.844, 0.697 ], "P_xyz": [ 1.190, 9.222, 0.858 ], "form": ".", "ssZp": 4.177, "Dp": 4.532, "splay_angle": 40.471, "splay_distance": 7.042, "splay_ratio": 0.348, "d22": null, "d64": null, "eta": -175.862, "theta": -135.027, "eta_prime": -168.148, "theta_prime": -134.473, "eta_base": -138.313, "theta_base": -139.923, "v0": -0.849, "v1": -21.358, "v2": 34.028, "v3": -35.175, "v4": 22.983, "amplitude": 36.160, "phase_angle": 19.774, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.199, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 3.695, -23.161, -12.032 ], "x_axis": [ -0.485, 0.617, -0.619 ], "y_axis": [ 0.379, 0.787, 0.487 ], "z_axis": [ 0.788, 0.002, -0.616 ], "quaternion": [ 0.414, 0.293, 0.850, 0.144 ] } }, { "index": 40, "index_chain": 40, "chain_name": "R", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///R/47", "linked_nts": [ "///R/46", "///R/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": 64.347, "beta": -160.192, "gamma": -68.023, "delta": 151.690, "epsilon": -85.013, "zeta": 135.585, "epsilon_zeta": 139.401, "bb_type": "BII", "chi": -93.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.792, 7.742, -2.194 ], "P_xyz": [ -1.154, 9.852, -3.613 ], "form": ".", "ssZp": -0.105, "Dp": 0.864, "splay_angle": 49.368, "splay_distance": 9.162, "splay_ratio": 0.420, "d22": null, "d64": null, "eta": -127.390, "theta": 127.011, "eta_prime": -125.291, "theta_prime": 107.257, "eta_base": -140.672, "theta_base": 114.594, "v0": -3.717, "v1": 23.636, "v2": -33.349, "v3": 32.305, "v4": -18.055, "amplitude": 34.176, "phase_angle": 192.635, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.778, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ 8.837, -25.583, -16.188 ], "x_axis": [ -0.497, 0.646, -0.580 ], "y_axis": [ 0.482, 0.761, 0.435 ], "z_axis": [ 0.722, -0.064, -0.689 ], "quaternion": [ 0.379, 0.328, 0.858, 0.108 ] } }, { "index": 41, "index_chain": 41, "chain_name": "R", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///R/48", "linked_nts": [ "///R/47", "///R/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart", "alpha": 10.821, "beta": -95.850, "gamma": -53.111, "delta": 146.711, "epsilon": -143.681, "zeta": -144.777, "epsilon_zeta": 1.096, "bb_type": "--", "chi": -110.064, "glyco_bond": "anti", "C5prime_xyz": [ -2.960, 8.376, -1.599 ], "P_xyz": [ -4.810, 10.149, -2.246 ], "form": ".", "ssZp": 2.006, "Dp": 2.185, "splay_angle": 123.010, "splay_distance": 15.559, "splay_ratio": 0.879, "d22": null, "d64": null, "eta": -73.028, "theta": 168.924, "eta_prime": -100.852, "theta_prime": 154.192, "eta_base": -108.826, "theta_base": 132.046, "v0": -34.661, "v1": 49.742, "v2": -44.396, "v3": 26.020, "v4": 5.126, "amplitude": 48.957, "phase_angle": 155.071, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 9.093, -31.939, -9.595 ], "x_axis": [ 0.494, -0.870, -0.008 ], "y_axis": [ 0.840, 0.475, 0.262 ], "z_axis": [ -0.224, -0.136, 0.965 ], "quaternion": [ 0.856, 0.116, -0.063, -0.499 ] } }, { "index": 42, "index_chain": 42, "chain_name": "R", "nt_resnum": 49, "nt_name": "A", "nt_code": "A", "nt_id": "///R/49", "linked_nts": [ "///R/48", "///R/50" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart", "alpha": 68.960, "beta": 167.093, "gamma": 68.145, "delta": 142.969, "epsilon": -105.564, "zeta": 50.567, "epsilon_zeta": 203.869, "bb_type": "--", "chi": -167.968, "glyco_bond": "anti", "C5prime_xyz": [ -1.661, 8.337, 1.514 ], "P_xyz": [ 0.486, 7.868, 2.938 ], "form": ".", "ssZp": 1.179, "Dp": 1.229, "splay_angle": 120.101, "splay_distance": 18.141, "splay_ratio": 0.867, "d22": null, "d64": null, "eta": -25.768, "theta": 91.874, "eta_prime": 1.161, "theta_prime": 45.093, "eta_base": 15.210, "theta_base": 19.840, "v0": -10.995, "v1": 27.257, "v2": -31.995, "v3": 26.518, "v4": -10.030, "amplitude": 32.000, "phase_angle": 179.009, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.050, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 5.657, -17.659, -4.461 ], "x_axis": [ 0.761, 0.548, 0.348 ], "y_axis": [ 0.532, -0.834, 0.148 ], "z_axis": [ 0.371, 0.073, -0.926 ], "quaternion": [ 0.020, 0.938, 0.288, 0.192 ] } }, { "index": 43, "index_chain": 43, "chain_name": "R", "nt_resnum": 50, "nt_name": "G", "nt_code": "G", "nt_id": "///R/50", "linked_nts": [ "///R/49", "///R/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": 82.327, "beta": 102.761, "gamma": 175.906, "delta": 86.188, "epsilon": -121.964, "zeta": -69.357, "epsilon_zeta": -52.607, "bb_type": "--", "chi": -171.925, "glyco_bond": "anti", "C5prime_xyz": [ -0.814, 8.239, 1.333 ], "P_xyz": [ -0.738, 10.736, 0.511 ], "form": ".", "ssZp": 4.698, "Dp": 4.851, "splay_angle": 23.149, "splay_distance": 3.832, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 68.136, "theta": -175.935, "eta_prime": 67.919, "theta_prime": -159.613, "eta_base": 98.081, "theta_base": -109.980, "v0": 18.202, "v1": -36.843, "v2": 41.074, "v3": -31.447, "v4": 8.563, "amplitude": 41.364, "phase_angle": 353.217, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6j", "suiteness": 0.651, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 14.423, -33.539, -4.721 ], "x_axis": [ 0.603, 0.794, 0.078 ], "y_axis": [ -0.769, 0.604, -0.210 ], "z_axis": [ -0.213, 0.067, 0.975 ], "quaternion": [ 0.892, -0.078, -0.082, 0.438 ] } }, { "index": 44, "index_chain": 44, "chain_name": "R", "nt_resnum": 51, "nt_name": "C", "nt_code": "C", "nt_id": "///R/51", "linked_nts": [ "///R/50", "///R/52" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.133, "beta": 156.400, "gamma": 60.304, "delta": 77.418, "epsilon": -136.554, "zeta": -79.673, "epsilon_zeta": -56.881, "bb_type": "BI", "chi": -159.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.689, 8.980, 0.494 ], "P_xyz": [ 0.820, 9.692, 0.039 ], "form": "A", "ssZp": 4.395, "Dp": 4.698, "splay_angle": 26.757, "splay_distance": 4.363, "splay_ratio": 0.232, "d22": 4.097, "d64": 4.176, "eta": 166.540, "theta": -147.265, "eta_prime": -169.686, "theta_prime": -146.653, "eta_base": -110.356, "theta_base": -118.885, "v0": -2.629, "v1": -22.094, "v2": 36.728, "v3": -39.273, "v4": 26.597, "amplitude": 39.703, "phase_angle": 22.319, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.522, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 16.362, -31.549, -2.082 ], "x_axis": [ -0.030, 0.996, -0.082 ], "y_axis": [ -0.999, -0.028, 0.035 ], "z_axis": [ 0.032, 0.083, 0.996 ], "quaternion": [ 0.696, -0.018, 0.041, 0.717 ] } }, { "index": 45, "index_chain": 45, "chain_name": "R", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///R/52", "linked_nts": [ "///R/51", "///R/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -81.607, "beta": 161.717, "gamma": 74.565, "delta": 80.782, "epsilon": -131.918, "zeta": -69.020, "epsilon_zeta": -62.899, "bb_type": "BI", "chi": -170.672, "glyco_bond": "anti", "C5prime_xyz": [ -1.624, 8.820, 1.095 ], "P_xyz": [ 0.914, 9.462, 0.849 ], "form": ".", "ssZp": 4.572, "Dp": 4.658, "splay_angle": 44.818, "splay_distance": 6.909, "splay_ratio": 0.381, "d22": 7.365, "d64": 7.166, "eta": 168.120, "theta": -132.114, "eta_prime": -179.306, "theta_prime": -125.147, "eta_base": -139.413, "theta_base": -99.371, "v0": 0.374, "v1": -25.740, "v2": 39.466, "v3": -40.232, "v4": 25.385, "amplitude": 41.500, "phase_angle": 18.016, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.276, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ 17.199, -29.513, 1.685 ], "x_axis": [ -0.552, 0.729, -0.405 ], "y_axis": [ -0.814, -0.576, 0.073 ], "z_axis": [ -0.180, 0.370, 0.911 ], "quaternion": [ 0.442, -0.168, 0.127, 0.872 ] } }, { "index": 46, "index_chain": 46, "chain_name": "R", "nt_resnum": 53, "nt_name": "U", "nt_code": "U", "nt_id": "///R/53", "linked_nts": [ "///R/52", "///R/54" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge", "alpha": -61.318, "beta": -157.799, "gamma": 82.158, "delta": 138.245, "epsilon": -77.786, "zeta": 129.394, "epsilon_zeta": 152.820, "bb_type": "BII", "chi": -85.517, "glyco_bond": "anti", "C5prime_xyz": [ -2.591, 7.485, -2.816 ], "P_xyz": [ -0.171, 8.258, -3.506 ], "form": ".", "ssZp": -0.290, "Dp": 0.487, "splay_angle": 37.838, "splay_distance": 6.375, "splay_ratio": 0.329, "d22": 6.997, "d64": 6.480, "eta": -118.318, "theta": 140.652, "eta_prime": -99.945, "theta_prime": 114.593, "eta_base": -89.439, "theta_base": 113.244, "v0": -20.954, "v1": 33.870, "v2": -33.476, "v3": 22.069, "v4": -0.886, "amplitude": 35.041, "phase_angle": 162.811, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.172, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 13.973, -25.657, 6.425 ], "x_axis": [ -0.972, 0.176, -0.155 ], "y_axis": [ -0.231, -0.827, 0.513 ], "z_axis": [ -0.038, 0.534, 0.845 ], "quaternion": [ 0.107, -0.050, 0.274, 0.954 ] } }, { "index": 47, "index_chain": 47, "chain_name": "R", "nt_resnum": 54, "nt_name": "C", "nt_code": "C", "nt_id": "///R/54", "linked_nts": [ "///R/53", "///R/55" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-canonical,helix,stem-end,coaxial-stack,multiplet,bulge", "alpha": 159.892, "beta": 172.655, "gamma": 61.867, "delta": 84.039, "epsilon": -141.996, "zeta": -76.437, "epsilon_zeta": -65.558, "bb_type": "BI", "chi": -177.746, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.556, 1.556 ], "P_xyz": [ 1.083, 8.847, 2.038 ], "form": ".", "ssZp": 4.649, "Dp": 4.652, "splay_angle": 29.621, "splay_distance": 4.730, "splay_ratio": 0.259, "d22": 5.062, "d64": 5.280, "eta": 105.074, "theta": -141.678, "eta_prime": 96.745, "theta_prime": -141.487, "eta_base": 111.475, "theta_base": -122.363, "v0": 5.489, "v1": -28.187, "v2": 38.675, "v3": -36.582, "v4": 19.749, "amplitude": 39.369, "phase_angle": 10.776, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 19.634, -27.942, 4.586 ], "x_axis": [ -0.991, -0.025, -0.130 ], "y_axis": [ -0.059, -0.796, 0.603 ], "z_axis": [ -0.118, 0.605, 0.787 ], "quaternion": [ 0.009, -0.066, 0.320, 0.945 ] } }, { "index": 48, "index_chain": 48, "chain_name": "R", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///R/55", "linked_nts": [ "///R/54", "///R/56" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -62.932, "beta": -173.718, "gamma": 38.817, "delta": 78.014, "epsilon": -142.297, "zeta": -62.484, "epsilon_zeta": -79.813, "bb_type": "BI", "chi": -167.301, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.742, 0.965 ], "P_xyz": [ 1.171, 9.283, 1.836 ], "form": "A", "ssZp": 4.590, "Dp": 4.697, "splay_angle": 21.657, "splay_distance": 3.523, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 164.448, "theta": -142.267, "eta_prime": 172.980, "theta_prime": -144.284, "eta_base": -153.736, "theta_base": -116.260, "v0": 7.857, "v1": -32.135, "v2": 43.265, "v3": -39.757, "v4": 20.057, "amplitude": 43.742, "phase_angle": 8.467, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.597, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 18.994, -23.632, 6.426 ], "x_axis": [ -0.834, -0.548, 0.059 ], "y_axis": [ 0.505, -0.716, 0.482 ], "z_axis": [ -0.222, 0.432, 0.874 ], "quaternion": [ -0.285, -0.044, 0.247, 0.925 ] } }, { "index": 49, "index_chain": 49, "chain_name": "R", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///R/56", "linked_nts": [ "///R/55", "///R/57" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -129.516, "beta": 148.894, "gamma": 118.949, "delta": 79.623, "epsilon": -104.397, "zeta": -103.000, "epsilon_zeta": -1.398, "bb_type": "--", "chi": 173.572, "glyco_bond": "anti", "C5prime_xyz": [ -1.105, 7.992, 2.055 ], "P_xyz": [ 0.837, 9.411, 1.037 ], "form": "A", "ssZp": 4.892, "Dp": 4.904, "splay_angle": 27.015, "splay_distance": 4.229, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 160.426, "theta": -148.472, "eta_prime": 171.919, "theta_prime": -142.990, "eta_base": -145.971, "theta_base": -112.607, "v0": 18.823, "v1": -41.487, "v2": 47.299, "v3": -37.500, "v4": 11.939, "amplitude": 47.431, "phase_angle": 355.729, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 16.451, -21.781, 8.013 ], "x_axis": [ -0.435, -0.884, 0.169 ], "y_axis": [ 0.821, -0.313, 0.477 ], "z_axis": [ -0.369, 0.346, 0.863 ], "quaternion": [ 0.528, 0.062, -0.255, -0.808 ] } }, { "index": 50, "index_chain": 50, "chain_name": "R", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///R/57", "linked_nts": [ "///R/56", "///R/58" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -34.228, "beta": 131.358, "gamma": 60.963, "delta": 74.842, "epsilon": -140.484, "zeta": -83.634, "epsilon_zeta": -56.850, "bb_type": "BI", "chi": -178.901, "glyco_bond": "anti", "C5prime_xyz": [ -2.060, 8.680, 1.511 ], "P_xyz": [ 0.511, 9.204, 1.279 ], "form": "A", "ssZp": 4.621, "Dp": 4.631, "splay_angle": 23.685, "splay_distance": 3.601, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 169.344, "theta": -143.385, "eta_prime": -169.868, "theta_prime": -143.230, "eta_base": -121.670, "theta_base": -96.636, "v0": -3.994, "v1": -23.322, "v2": 40.163, "v3": -43.653, "v4": 29.947, "amplitude": 43.864, "phase_angle": 23.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.525, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 12.911, -22.252, 10.276 ], "x_axis": [ 0.162, -0.923, 0.349 ], "y_axis": [ 0.896, 0.286, 0.339 ], "z_axis": [ -0.413, 0.257, 0.874 ], "quaternion": [ 0.762, 0.027, -0.250, -0.597 ] } }, { "index": 51, "index_chain": 51, "chain_name": "R", "nt_resnum": 58, "nt_name": "C", "nt_code": "C", "nt_id": "///R/58", "linked_nts": [ "///R/57", "///R/59" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.381, "beta": 167.329, "gamma": 50.340, "delta": 85.640, "epsilon": -145.832, "zeta": -72.016, "epsilon_zeta": -73.816, "bb_type": "BI", "chi": -159.903, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.761, 0.595 ], "P_xyz": [ 1.304, 8.771, 0.867 ], "form": "A", "ssZp": 4.428, "Dp": 4.614, "splay_angle": 22.834, "splay_distance": 3.702, "splay_ratio": 0.199, "d22": 4.189, "d64": 4.248, "eta": 171.128, "theta": -135.773, "eta_prime": -174.761, "theta_prime": -138.672, "eta_base": -112.202, "theta_base": -112.646, "v0": 3.663, "v1": -24.205, "v2": 34.245, "v3": -32.887, "v4": 18.618, "amplitude": 35.095, "phase_angle": 12.641, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.738, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 11.606, -23.505, 13.390 ], "x_axis": [ 0.777, -0.403, 0.483 ], "y_axis": [ 0.436, 0.899, 0.049 ], "z_axis": [ -0.454, 0.173, 0.874 ], "quaternion": [ 0.942, -0.033, -0.249, -0.223 ] } }, { "index": 52, "index_chain": 52, "chain_name": "R", "nt_resnum": 59, "nt_name": "C", "nt_code": "C", "nt_id": "///R/59", "linked_nts": [ "///R/58", "///R/60" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -66.812, "beta": 166.210, "gamma": 57.329, "delta": 78.620, "epsilon": -129.986, "zeta": -90.797, "epsilon_zeta": -39.189, "bb_type": "--", "chi": -163.047, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.818, 0.719 ], "P_xyz": [ 1.212, 9.375, 0.594 ], "form": "A", "ssZp": 4.437, "Dp": 4.749, "splay_angle": 24.771, "splay_distance": 4.013, "splay_ratio": 0.216, "d22": 4.240, "d64": 4.555, "eta": 169.483, "theta": -152.377, "eta_prime": -178.005, "theta_prime": -149.464, "eta_base": -134.527, "theta_base": -131.563, "v0": 6.040, "v1": -31.832, "v2": 43.759, "v3": -41.358, "v4": 22.497, "amplitude": 44.566, "phase_angle": 10.920, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.068, "frame": { "rmsd": 0.007, "origin": [ 10.527, -24.288, 16.844 ], "x_axis": [ 0.919, 0.150, 0.364 ], "y_axis": [ -0.091, 0.980, -0.174 ], "z_axis": [ -0.383, 0.127, 0.915 ], "quaternion": [ 0.977, -0.077, -0.191, 0.062 ] } }, { "index": 53, "index_chain": 53, "chain_name": "R", "nt_resnum": 60, "nt_name": "U", "nt_code": "U", "nt_id": "///R/60", "linked_nts": [ "///R/59", "///R/61" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper", "alpha": -57.389, "beta": 148.393, "gamma": 60.728, "delta": 75.300, "epsilon": -131.410, "zeta": -73.961, "epsilon_zeta": -57.449, "bb_type": "BI", "chi": -169.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.781, 8.829, 1.041 ], "P_xyz": [ 0.741, 9.455, 0.756 ], "form": ".", "ssZp": 4.544, "Dp": 4.674, "splay_angle": 22.862, "splay_distance": 3.692, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 168.741, "theta": -133.737, "eta_prime": -178.905, "theta_prime": -130.148, "eta_base": -149.676, "theta_base": -85.594, "v0": -0.339, "v1": -28.332, "v2": 44.604, "v3": -45.619, "v4": 29.030, "amplitude": 47.110, "phase_angle": 18.772, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.466, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 9.709, -25.167, 20.673 ], "x_axis": [ 0.863, 0.497, 0.089 ], "y_axis": [ -0.454, 0.842, -0.292 ], "z_axis": [ -0.220, 0.212, 0.952 ], "quaternion": [ 0.956, -0.132, -0.081, 0.249 ] } }, { "index": 54, "index_chain": 54, "chain_name": "R", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///R/61", "linked_nts": [ "///R/60", "///R/62" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate", "alpha": -65.266, "beta": 165.378, "gamma": 73.014, "delta": 97.908, "epsilon": -114.769, "zeta": -178.902, "epsilon_zeta": 64.133, "bb_type": "BII", "chi": -145.494, "glyco_bond": "anti", "C5prime_xyz": [ -1.929, 8.859, -0.434 ], "P_xyz": [ 0.589, 9.443, -0.840 ], "form": ".", "ssZp": 2.948, "Dp": 3.595, "splay_angle": 60.121, "splay_distance": 9.634, "splay_ratio": 0.506, "d22": null, "d64": null, "eta": -170.220, "theta": 126.451, "eta_prime": -152.516, "theta_prime": 118.922, "eta_base": -98.599, "theta_base": 118.112, "v0": -19.236, "v1": 3.475, "v2": 12.411, "v3": -23.910, "v4": 27.311, "amplitude": 27.039, "phase_angle": 62.676, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.145, "filter_rmsd": 0.032, "frame": { "rmsd": 0.009, "origin": [ 11.764, -23.365, 23.156 ], "x_axis": [ 0.328, 0.909, -0.256 ], "y_axis": [ -0.935, 0.352, 0.052 ], "z_axis": [ 0.137, 0.223, 0.965 ], "quaternion": [ 0.813, -0.053, 0.121, 0.567 ] } }, { "index": 55, "index_chain": 55, "chain_name": "R", "nt_resnum": 62, "nt_name": "A", "nt_code": "A", "nt_id": "///R/62", "linked_nts": [ "///R/61", "///R/63" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,phosphate", "alpha": -110.804, "beta": 138.085, "gamma": 35.999, "delta": 80.679, "epsilon": -135.876, "zeta": -69.144, "epsilon_zeta": -66.732, "bb_type": "BI", "chi": -170.156, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.583, 1.105 ], "P_xyz": [ 1.292, 8.524, 1.240 ], "form": "A", "ssZp": 4.655, "Dp": 4.750, "splay_angle": 24.101, "splay_distance": 3.971, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 133.367, "theta": -126.089, "eta_prime": 128.483, "theta_prime": -127.388, "eta_base": 135.044, "theta_base": -100.819, "v0": 6.147, "v1": -29.758, "v2": 40.753, "v3": -38.441, "v4": 20.439, "amplitude": 41.431, "phase_angle": 10.380, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.012, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 5.532, -30.634, 24.230 ], "x_axis": [ 0.767, 0.598, -0.232 ], "y_axis": [ -0.535, 0.796, 0.283 ], "z_axis": [ 0.354, -0.094, 0.931 ], "quaternion": [ 0.935, 0.101, 0.157, 0.303 ] } }, { "index": 56, "index_chain": 56, "chain_name": "R", "nt_resnum": 63, "nt_name": "A", "nt_code": "A", "nt_id": "///R/63", "linked_nts": [ "///R/62", "///R/64" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,phosphate", "alpha": -68.868, "beta": 172.173, "gamma": 57.717, "delta": 77.503, "epsilon": -145.910, "zeta": -75.573, "epsilon_zeta": -70.337, "bb_type": "BI", "chi": -162.707, "glyco_bond": "anti", "C5prime_xyz": [ -1.701, 8.866, 0.584 ], "P_xyz": [ 0.787, 9.658, 0.620 ], "form": "A", "ssZp": 4.438, "Dp": 4.636, "splay_angle": 21.405, "splay_distance": 3.360, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.321, "theta": -148.158, "eta_prime": -178.700, "theta_prime": -144.762, "eta_base": -131.172, "theta_base": -98.627, "v0": -5.271, "v1": -22.379, "v2": 39.719, "v3": -43.791, "v4": 31.011, "amplitude": 43.920, "phase_angle": 25.266, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.876, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 9.054, -30.698, 26.064 ], "x_axis": [ 0.215, 0.964, -0.159 ], "y_axis": [ -0.836, 0.265, 0.480 ], "z_axis": [ 0.505, 0.030, 0.863 ], "quaternion": [ 0.765, 0.147, 0.217, 0.588 ] } }, { "index": 57, "index_chain": 57, "chain_name": "R", "nt_resnum": 64, "nt_name": "C", "nt_code": "C", "nt_id": "///R/64", "linked_nts": [ "///R/63", "///R/65" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -66.251, "beta": 171.382, "gamma": 52.183, "delta": 84.221, "epsilon": -138.254, "zeta": -73.600, "epsilon_zeta": -64.654, "bb_type": "BI", "chi": -152.647, "glyco_bond": "anti", "C5prime_xyz": [ -1.282, 8.796, 0.155 ], "P_xyz": [ 1.311, 9.041, 0.042 ], "form": "A", "ssZp": 4.156, "Dp": 4.673, "splay_angle": 25.517, "splay_distance": 4.116, "splay_ratio": 0.221, "d22": 3.705, "d64": 3.623, "eta": 167.771, "theta": -135.829, "eta_prime": -179.024, "theta_prime": -134.794, "eta_base": -121.971, "theta_base": -102.268, "v0": 5.704, "v1": -27.582, "v2": 37.620, "v3": -35.457, "v4": 18.899, "amplitude": 38.238, "phase_angle": 10.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 11.061, -28.661, 27.828 ], "x_axis": [ -0.490, 0.869, 0.071 ], "y_axis": [ -0.640, -0.414, 0.647 ], "z_axis": [ 0.591, 0.272, 0.759 ], "quaternion": [ 0.462, 0.203, 0.281, 0.816 ] } }, { "index": 58, "index_chain": 58, "chain_name": "R", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///R/65", "linked_nts": [ "///R/64", "///R/660" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -70.736, "beta": 166.245, "gamma": 59.753, "delta": 77.483, "epsilon": -131.796, "zeta": -87.473, "epsilon_zeta": -44.323, "bb_type": "BI", "chi": -163.406, "glyco_bond": "anti", "C5prime_xyz": [ -1.377, 8.827, 0.711 ], "P_xyz": [ 1.205, 9.253, 0.576 ], "form": "A", "ssZp": 4.449, "Dp": 4.736, "splay_angle": 23.382, "splay_distance": 3.662, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 164.110, "theta": -148.238, "eta_prime": 179.583, "theta_prime": -146.139, "eta_base": -132.261, "theta_base": -116.421, "v0": 2.770, "v1": -28.257, "v2": 41.612, "v3": -41.061, "v4": 24.285, "amplitude": 43.080, "phase_angle": 15.001, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 12.046, -25.681, 30.489 ], "x_axis": [ -0.942, 0.293, 0.163 ], "y_axis": [ -0.170, -0.836, 0.521 ], "z_axis": [ 0.290, 0.463, 0.838 ], "quaternion": [ 0.122, 0.119, 0.259, 0.951 ] } }, { "index": 59, "index_chain": 59, "chain_name": "R", "nt_resnum": 660, "nt_name": "A", "nt_code": "A", "nt_id": "///R/660", "linked_nts": [ "///R/65", "///R/661" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -62.433, "beta": 154.248, "gamma": 59.664, "delta": 79.088, "epsilon": -137.433, "zeta": -73.735, "epsilon_zeta": -63.699, "bb_type": "BI", "chi": -174.470, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.596, 1.353 ], "P_xyz": [ 1.059, 8.887, 1.374 ], "form": "A", "ssZp": 4.658, "Dp": 4.698, "splay_angle": 22.825, "splay_distance": 3.661, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 164.996, "theta": -134.330, "eta_prime": 177.666, "theta_prime": -133.757, "eta_base": -138.807, "theta_base": -96.987, "v0": 3.302, "v1": -27.968, "v2": 40.761, "v3": -39.734, "v4": 23.156, "amplitude": 42.036, "phase_angle": 14.147, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.619, "filter_rmsd": 0.041, "frame": { "rmsd": 0.008, "origin": [ 11.931, -23.139, 33.122 ], "x_axis": [ -0.922, -0.371, 0.114 ], "y_axis": [ 0.387, -0.849, 0.360 ], "z_axis": [ -0.037, 0.375, 0.926 ], "quaternion": [ -0.197, 0.020, 0.191, 0.961 ] } }, { "index": 60, "index_chain": 60, "chain_name": "R", "nt_resnum": 661, "nt_name": "U", "nt_code": "U", "nt_id": "///R/661", "linked_nts": [ "///R/660", "///R/662" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -51.659, "beta": 165.265, "gamma": 50.302, "delta": 80.865, "epsilon": -165.078, "zeta": -89.063, "epsilon_zeta": -76.015, "bb_type": "BI", "chi": -155.847, "glyco_bond": "anti", "C5prime_xyz": [ -1.510, 8.863, 0.295 ], "P_xyz": [ 1.064, 9.369, 0.412 ], "form": ".", "ssZp": 4.190, "Dp": 4.396, "splay_angle": 52.302, "splay_distance": 8.478, "splay_ratio": 0.442, "d22": 7.020, "d64": 7.746, "eta": 171.213, "theta": -141.470, "eta_prime": -169.175, "theta_prime": -132.004, "eta_base": -113.310, "theta_base": -133.661, "v0": -0.927, "v1": -23.202, "v2": 37.111, "v3": -38.546, "v4": 25.079, "amplitude": 39.468, "phase_angle": 19.902, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.791, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 9.529, -22.040, 35.658 ], "x_axis": [ -0.438, -0.830, 0.344 ], "y_axis": [ 0.885, -0.331, 0.328 ], "z_axis": [ -0.159, 0.448, 0.880 ], "quaternion": [ 0.527, -0.057, -0.238, -0.814 ] } }, { "index": 61, "index_chain": 61, "chain_name": "R", "nt_resnum": 662, "nt_name": "U", "nt_code": "U", "nt_id": "///R/662", "linked_nts": [ "///R/661", "///R/663" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": 121.939, "beta": 118.960, "gamma": -59.297, "delta": 160.823, "epsilon": -90.273, "zeta": 69.272, "epsilon_zeta": 200.455, "bb_type": "--", "chi": -87.260, "glyco_bond": "anti", "C5prime_xyz": [ -1.622, 7.378, -2.354 ], "P_xyz": [ -0.613, 9.762, -1.918 ], "form": ".", "ssZp": -0.550, "Dp": 0.832, "splay_angle": 29.358, "splay_distance": 5.169, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": -130.808, "theta": 84.097, "eta_prime": -128.598, "theta_prime": 73.652, "eta_base": -141.099, "theta_base": 68.559, "v0": 0.308, "v1": 24.601, "v2": -38.472, "v3": 39.644, "v4": -25.417, "amplitude": 40.688, "phase_angle": 198.999, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.008, "origin": [ 7.483, -17.374, 42.433 ], "x_axis": [ -0.343, -0.934, -0.100 ], "y_axis": [ 0.938, -0.346, 0.014 ], "z_axis": [ -0.048, -0.089, 0.995 ], "quaternion": [ 0.571, 0.045, 0.023, -0.819 ] } }, { "index": 62, "index_chain": 62, "chain_name": "R", "nt_resnum": 663, "nt_name": "G", "nt_code": "G", "nt_id": "///R/663", "linked_nts": [ "///R/662", "///R/664" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -156.402, "beta": 176.172, "gamma": 78.930, "delta": 89.059, "epsilon": -159.660, "zeta": -56.103, "epsilon_zeta": -103.557, "bb_type": "BI", "chi": -96.665, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 7.486, -2.751 ], "P_xyz": [ 0.154, 6.572, -4.221 ], "form": ".", "ssZp": 0.970, "Dp": 4.472, "splay_angle": 95.332, "splay_distance": 14.631, "splay_ratio": 0.739, "d22": null, "d64": null, "eta": 136.078, "theta": -110.991, "eta_prime": 149.124, "theta_prime": -120.996, "eta_base": 144.219, "theta_base": -103.497, "v0": 11.627, "v1": -29.943, "v2": 35.850, "v3": -30.252, "v4": 11.988, "amplitude": 35.851, "phase_angle": 0.349, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.160, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 10.915, -16.570, 38.653 ], "x_axis": [ -0.514, 0.546, 0.662 ], "y_axis": [ 0.785, 0.611, 0.105 ], "z_axis": [ -0.347, 0.573, -0.742 ], "quaternion": [ -0.298, 0.393, 0.847, 0.200 ] } }, { "index": 63, "index_chain": 63, "chain_name": "R", "nt_resnum": 664, "nt_name": "C", "nt_code": "C", "nt_id": "///R/664", "linked_nts": [ "///R/663", "///R/665" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,hairpin-loop,splayed-apart", "alpha": 141.789, "beta": 113.780, "gamma": -46.153, "delta": 160.606, "epsilon": -153.387, "zeta": 140.939, "epsilon_zeta": 65.674, "bb_type": "--", "chi": -99.103, "glyco_bond": "anti", "C5prime_xyz": [ -1.226, 7.727, -1.910 ], "P_xyz": [ -0.057, 9.667, -0.561 ], "form": ".", "ssZp": 0.739, "Dp": 1.050, "splay_angle": 46.671, "splay_distance": 7.453, "splay_ratio": 0.408, "d22": null, "d64": null, "eta": -123.011, "theta": 125.553, "eta_prime": -100.878, "theta_prime": 117.844, "eta_base": -120.246, "theta_base": 150.767, "v0": 2.952, "v1": 21.192, "v2": -36.006, "v3": 38.374, "v4": -26.029, "amplitude": 39.005, "phase_angle": 202.616, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 14.574, -2.551, 40.693 ], "x_axis": [ -0.064, -0.333, 0.941 ], "y_axis": [ 0.519, -0.816, -0.254 ], "z_axis": [ 0.853, 0.472, 0.225 ], "quaternion": [ -0.294, 0.618, 0.075, 0.725 ] } }, { "index": 64, "index_chain": 64, "chain_name": "R", "nt_resnum": 665, "nt_name": "A", "nt_code": "A", "nt_id": "///R/665", "linked_nts": [ "///R/664", "///R/666" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,phosphate", "alpha": -52.121, "beta": 141.167, "gamma": 24.987, "delta": 91.488, "epsilon": -147.730, "zeta": -76.512, "epsilon_zeta": -71.218, "bb_type": "BI", "chi": -160.465, "glyco_bond": "anti", "C5prime_xyz": [ -0.838, 8.466, 0.619 ], "P_xyz": [ 1.696, 7.924, 1.102 ], "form": "A", "ssZp": 4.337, "Dp": 4.546, "splay_angle": 18.626, "splay_distance": 2.915, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 167.675, "theta": -135.754, "eta_prime": 164.152, "theta_prime": -136.804, "eta_base": -172.887, "theta_base": -117.925, "v0": 12.428, "v1": -29.690, "v2": 35.265, "v3": -28.780, "v4": 10.443, "amplitude": 35.278, "phase_angle": 358.472, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.102, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 14.228, -1.372, 33.342 ], "x_axis": [ 0.574, 0.291, 0.766 ], "y_axis": [ 0.507, -0.861, -0.052 ], "z_axis": [ 0.644, 0.418, -0.641 ], "quaternion": [ -0.134, 0.877, 0.227, 0.402 ] } }, { "index": 65, "index_chain": 65, "chain_name": "R", "nt_resnum": 666, "nt_name": "C", "nt_code": "C", "nt_id": "///R/666", "linked_nts": [ "///R/665", "///R/667" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -65.956, "beta": 170.034, "gamma": 56.031, "delta": 85.019, "epsilon": -134.402, "zeta": 170.812, "epsilon_zeta": 54.785, "bb_type": "BII", "chi": -139.939, "glyco_bond": "anti", "C5prime_xyz": [ -1.208, 8.734, -0.583 ], "P_xyz": [ 1.362, 8.841, -1.105 ], "form": ".", "ssZp": 3.537, "Dp": 4.657, "splay_angle": 144.059, "splay_distance": 18.230, "splay_ratio": 0.951, "d22": 9.527, "d64": 11.611, "eta": 172.731, "theta": 120.398, "eta_prime": -173.996, "theta_prime": 84.395, "eta_base": -140.495, "theta_base": -0.438, "v0": 9.487, "v1": -31.105, "v2": 39.740, "v3": -35.337, "v4": 16.386, "amplitude": 39.905, "phase_angle": 5.200, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.702, "filter_rmsd": 0.068, "frame": { "rmsd": 0.007, "origin": [ 15.698, 0.672, 31.874 ], "x_axis": [ 0.829, -0.100, 0.550 ], "y_axis": [ 0.310, -0.736, -0.602 ], "z_axis": [ 0.465, 0.669, -0.579 ], "quaternion": [ -0.358, 0.887, 0.059, 0.286 ] } }, { "index": 66, "index_chain": 66, "chain_name": "R", "nt_resnum": 667, "nt_name": "U", "nt_code": "U", "nt_id": "///R/667", "linked_nts": [ "///R/666", "///R/668" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 34.156, "beta": -140.874, "gamma": 81.704, "delta": 77.670, "epsilon": -158.686, "zeta": -86.467, "epsilon_zeta": -72.219, "bb_type": "BI", "chi": -157.967, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.975, 0.268 ], "P_xyz": [ 0.915, 9.480, 0.677 ], "form": "A", "ssZp": 4.315, "Dp": 4.503, "splay_angle": 19.144, "splay_distance": 3.208, "splay_ratio": 0.169, "d22": 3.914, "d64": 3.954, "eta": -2.378, "theta": -130.710, "eta_prime": 4.496, "theta_prime": -138.943, "eta_base": 83.400, "theta_base": -103.154, "v0": -6.184, "v1": -20.061, "v2": 36.802, "v3": -41.115, "v4": 30.214, "amplitude": 41.265, "phase_angle": 26.896, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 22.119, -11.084, 19.508 ], "x_axis": [ 0.702, 0.075, 0.708 ], "y_axis": [ -0.406, 0.859, 0.312 ], "z_axis": [ -0.585, -0.506, 0.634 ], "quaternion": [ 0.894, 0.229, -0.361, 0.134 ] } }, { "index": 67, "index_chain": 67, "chain_name": "R", "nt_resnum": 668, "nt_name": "C", "nt_code": "C", "nt_id": "///R/668", "linked_nts": [ "///R/667", "///R/669" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 143.681, "beta": -149.494, "gamma": 171.554, "delta": 83.405, "epsilon": -121.714, "zeta": -71.832, "epsilon_zeta": -49.882, "bb_type": "--", "chi": -170.077, "glyco_bond": "anti", "C5prime_xyz": [ -1.114, 8.485, 1.207 ], "P_xyz": [ 0.585, 9.760, -0.336 ], "form": "A", "ssZp": 4.614, "Dp": 4.795, "splay_angle": 22.406, "splay_distance": 3.831, "splay_ratio": 0.203, "d22": 4.110, "d64": 4.645, "eta": 157.121, "theta": -144.422, "eta_prime": 173.791, "theta_prime": -144.330, "eta_base": -130.321, "theta_base": -115.630, "v0": 11.812, "v1": -32.885, "v2": 40.551, "v3": -34.839, "v4": 14.684, "amplitude": 40.581, "phase_angle": 2.214, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.656, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 22.130, -12.937, 22.127 ], "x_axis": [ 0.384, 0.563, 0.732 ], "y_axis": [ -0.832, 0.554, 0.010 ], "z_axis": [ -0.400, -0.613, 0.682 ], "quaternion": [ 0.809, 0.193, -0.349, 0.431 ] } }, { "index": 68, "index_chain": 68, "chain_name": "R", "nt_resnum": 669, "nt_name": "C", "nt_code": "C", "nt_id": "///R/669", "linked_nts": [ "///R/668", "///R/75" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -64.330, "beta": 154.076, "gamma": 69.265, "delta": 72.201, "epsilon": -145.875, "zeta": -128.245, "epsilon_zeta": -17.631, "bb_type": "--", "chi": -163.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.957, 8.985, 0.647 ], "P_xyz": [ 0.368, 9.993, -0.086 ], "form": ".", "ssZp": 4.486, "Dp": 4.666, "splay_angle": 125.152, "splay_distance": 16.221, "splay_ratio": 0.888, "d22": null, "d64": null, "eta": 159.618, "theta": -168.639, "eta_prime": -177.537, "theta_prime": -173.109, "eta_base": -128.092, "theta_base": -162.042, "v0": -5.948, "v1": -23.788, "v2": 42.794, "v3": -47.127, "v4": 33.379, "amplitude": 47.391, "phase_angle": 25.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.331, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 23.095, -14.076, 25.655 ], "x_axis": [ -0.108, 0.790, 0.603 ], "y_axis": [ -0.971, 0.046, -0.235 ], "z_axis": [ -0.214, -0.611, 0.762 ], "quaternion": [ 0.652, 0.144, -0.313, 0.675 ] } }, { "index": 69, "index_chain": 69, "chain_name": "R", "nt_resnum": 75, "nt_name": "G", "nt_code": "G", "nt_id": "///R/75", "linked_nts": [ "///R/669", "///R/76" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 55.677, "beta": 145.787, "gamma": 83.334, "delta": 79.775, "epsilon": -158.283, "zeta": -66.356, "epsilon_zeta": -91.926, "bb_type": "BI", "chi": -166.287, "glyco_bond": "anti", "C5prime_xyz": [ -1.549, 8.758, 0.893 ], "P_xyz": [ 0.664, 9.478, -0.342 ], "form": "A", "ssZp": 4.549, "Dp": 4.604, "splay_angle": 29.472, "splay_distance": 4.406, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": -70.123, "theta": -144.629, "eta_prime": -65.733, "theta_prime": -149.613, "eta_base": -76.613, "theta_base": -113.134, "v0": 5.148, "v1": -31.251, "v2": 44.012, "v3": -42.176, "v4": 23.409, "amplitude": 45.022, "phase_angle": 12.159, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.010, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 13.832, -26.193, 31.178 ], "x_axis": [ -0.969, 0.225, -0.106 ], "y_axis": [ 0.244, 0.778, -0.579 ], "z_axis": [ -0.048, -0.587, -0.808 ], "quaternion": [ 0.015, 0.124, 0.943, -0.309 ] } }, { "index": 70, "index_chain": 70, "chain_name": "R", "nt_resnum": 76, "nt_name": "G", "nt_code": "G", "nt_id": "///R/76", "linked_nts": [ "///R/75", "///R/77" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -81.881, "beta": -173.234, "gamma": 63.202, "delta": 83.883, "epsilon": -124.004, "zeta": -71.611, "epsilon_zeta": -52.393, "bb_type": "--", "chi": -172.058, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.528, 1.271 ], "P_xyz": [ 1.446, 8.569, 1.618 ], "form": ".", "ssZp": 4.682, "Dp": 4.792, "splay_angle": 34.695, "splay_distance": 5.191, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 175.653, "theta": -120.506, "eta_prime": -173.096, "theta_prime": -114.673, "eta_base": -120.729, "theta_base": -63.291, "v0": 11.620, "v1": -33.903, "v2": 42.356, "v3": -36.500, "v4": 15.754, "amplitude": 42.412, "phase_angle": 2.956, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.628, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 11.274, -28.392, 28.343 ], "x_axis": [ -0.484, 0.802, -0.351 ], "y_axis": [ 0.872, 0.406, -0.273 ], "z_axis": [ -0.076, -0.438, -0.896 ], "quaternion": [ 0.082, 0.501, 0.835, -0.213 ] } }, { "index": 71, "index_chain": 71, "chain_name": "R", "nt_resnum": 77, "nt_name": "U", "nt_code": "U", "nt_id": "///R/77", "linked_nts": [ "///R/76", "///R/78" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor", "alpha": -61.566, "beta": 155.181, "gamma": 61.074, "delta": 82.121, "epsilon": -142.792, "zeta": -71.395, "epsilon_zeta": -71.398, "bb_type": "BI", "chi": -171.878, "glyco_bond": "anti", "C5prime_xyz": [ -1.198, 8.508, 1.262 ], "P_xyz": [ 1.411, 8.532, 1.003 ], "form": "A", "ssZp": 4.669, "Dp": 4.707, "splay_angle": 23.534, "splay_distance": 3.656, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 160.148, "theta": -135.138, "eta_prime": -171.083, "theta_prime": -137.551, "eta_base": -92.456, "theta_base": -112.180, "v0": 9.610, "v1": -33.340, "v2": 43.143, "v3": -38.451, "v4": 18.371, "amplitude": 43.377, "phase_angle": 5.964, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.575, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 10.344, -26.002, 23.829 ], "x_axis": [ 0.524, 0.771, -0.363 ], "y_axis": [ 0.844, -0.528, 0.096 ], "z_axis": [ -0.118, -0.357, -0.927 ], "quaternion": [ 0.131, 0.863, 0.468, -0.139 ] } }, { "index": 72, "index_chain": 72, "chain_name": "R", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///R/78", "linked_nts": [ "///R/77", "///R/79" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor", "alpha": -66.730, "beta": 174.506, "gamma": 52.956, "delta": 78.896, "epsilon": -129.267, "zeta": -74.483, "epsilon_zeta": -54.784, "bb_type": "BI", "chi": -168.601, "glyco_bond": "anti", "C5prime_xyz": [ -1.377, 8.628, 1.047 ], "P_xyz": [ 1.198, 8.961, 1.404 ], "form": "A", "ssZp": 4.564, "Dp": 4.746, "splay_angle": 24.643, "splay_distance": 4.155, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 168.584, "theta": -140.748, "eta_prime": -178.931, "theta_prime": -140.545, "eta_base": -134.631, "theta_base": -126.845, "v0": 4.438, "v1": -28.962, "v2": 41.442, "v3": -39.926, "v4": 22.342, "amplitude": 42.491, "phase_angle": 12.753, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.974, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 9.532, -25.307, 20.333 ], "x_axis": [ 0.936, 0.336, -0.102 ], "y_axis": [ 0.351, -0.900, 0.259 ], "z_axis": [ -0.004, -0.278, -0.960 ], "quaternion": [ 0.138, 0.974, 0.176, -0.027 ] } }, { "index": 73, "index_chain": 73, "chain_name": "R", "nt_resnum": 79, "nt_name": "G", "nt_code": "G", "nt_id": "///R/79", "linked_nts": [ "///R/78", "///R/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -77.498, "beta": 141.761, "gamma": 91.377, "delta": 71.855, "epsilon": -115.235, "zeta": -94.105, "epsilon_zeta": -21.130, "bb_type": "--", "chi": 179.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.870, 8.554, 1.691 ], "P_xyz": [ 0.180, 9.901, 0.835 ], "form": "A", "ssZp": 4.684, "Dp": 4.745, "splay_angle": 24.913, "splay_distance": 3.870, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 170.054, "theta": -155.559, "eta_prime": -176.442, "theta_prime": -153.000, "eta_base": -146.400, "theta_base": -113.518, "v0": 4.057, "v1": -34.038, "v2": 49.615, "v3": -48.656, "v4": 27.854, "amplitude": 51.161, "phase_angle": 14.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 9.421, -23.919, 16.418 ], "x_axis": [ 1.000, 0.005, 0.001 ], "y_axis": [ 0.004, -0.970, 0.244 ], "z_axis": [ 0.002, -0.244, -0.970 ], "quaternion": [ 0.123, 0.992, 0.002, 0.001 ] } }, { "index": 74, "index_chain": 74, "chain_name": "R", "nt_resnum": 80, "nt_name": "G", "nt_code": "G", "nt_id": "///R/80", "linked_nts": [ "///R/79", "///R/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.738, "beta": 137.581, "gamma": 75.375, "delta": 78.868, "epsilon": -120.107, "zeta": -126.929, "epsilon_zeta": 6.822, "bb_type": "--", "chi": 177.191, "glyco_bond": "anti", "C5prime_xyz": [ -1.718, 8.468, 1.772 ], "P_xyz": [ 0.776, 9.072, 1.196 ], "form": "A", "ssZp": 4.684, "Dp": 4.695, "splay_angle": 19.190, "splay_distance": 3.034, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 170.251, "theta": -147.564, "eta_prime": -175.255, "theta_prime": -144.988, "eta_base": -121.311, "theta_base": -122.699, "v0": 0.735, "v1": -26.524, "v2": 41.181, "v3": -41.694, "v4": 25.688, "amplitude": 43.195, "phase_angle": 17.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.404, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 11.584, -23.534, 13.233 ], "x_axis": [ 0.780, -0.580, 0.235 ], "y_axis": [ -0.617, -0.776, 0.130 ], "z_axis": [ 0.107, -0.247, -0.963 ], "quaternion": [ 0.100, 0.938, -0.319, 0.091 ] } }, { "index": 75, "index_chain": 75, "chain_name": "R", "nt_resnum": 81, "nt_name": "U", "nt_code": "U", "nt_id": "///R/81", "linked_nts": [ "///R/80", "///R/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": 5.440, "beta": 117.352, "gamma": 28.260, "delta": 78.473, "epsilon": -137.584, "zeta": -52.193, "epsilon_zeta": -85.391, "bb_type": "BI", "chi": -149.237, "glyco_bond": "anti", "C5prime_xyz": [ -2.002, 8.943, -0.258 ], "P_xyz": [ 0.623, 9.196, -0.323 ], "form": ".", "ssZp": 3.880, "Dp": 4.523, "splay_angle": 54.654, "splay_distance": 8.849, "splay_ratio": 0.459, "d22": null, "d64": null, "eta": 173.000, "theta": -109.807, "eta_prime": -177.014, "theta_prime": -103.549, "eta_base": -144.341, "theta_base": -92.543, "v0": -9.560, "v1": -17.598, "v2": 36.315, "v3": -42.761, "v4": 32.826, "amplitude": 42.432, "phase_angle": 31.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.008, "origin": [ 13.475, -23.449, 10.861 ], "x_axis": [ 0.341, -0.893, 0.293 ], "y_axis": [ -0.864, -0.420, -0.276 ], "z_axis": [ 0.370, -0.159, -0.915 ], "quaternion": [ -0.036, 0.818, -0.537, 0.203 ] } }, { "index": 76, "index_chain": 76, "chain_name": "R", "nt_resnum": 82, "nt_name": "A", "nt_code": "A", "nt_id": "///R/82", "linked_nts": [ "///R/81", "///R/83" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,phosphate,splayed-apart", "alpha": -82.697, "beta": -125.887, "gamma": 62.108, "delta": 132.337, "epsilon": -90.643, "zeta": 59.956, "epsilon_zeta": 209.401, "bb_type": "--", "chi": -90.754, "glyco_bond": "anti", "C5prime_xyz": [ -3.026, 7.673, -2.562 ], "P_xyz": [ -1.069, 9.420, -2.467 ], "form": ".", "ssZp": 0.618, "Dp": 0.950, "splay_angle": 154.787, "splay_distance": 19.491, "splay_ratio": 0.976, "d22": null, "d64": null, "eta": -145.063, "theta": 70.788, "eta_prime": -126.809, "theta_prime": 17.328, "eta_base": -115.105, "theta_base": -13.357, "v0": -29.707, "v1": 37.314, "v2": -30.247, "v3": 14.043, "v4": 9.643, "amplitude": 36.454, "phase_angle": 146.072, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.381, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 15.184, -30.319, 5.552 ], "x_axis": [ -0.394, -0.705, 0.589 ], "y_axis": [ -0.919, 0.290, -0.268 ], "z_axis": [ 0.018, -0.647, -0.762 ], "quaternion": [ -0.183, -0.519, 0.782, -0.292 ] } }, { "index": 77, "index_chain": 77, "chain_name": "R", "nt_resnum": 83, "nt_name": "G", "nt_code": "G", "nt_id": "///R/83", "linked_nts": [ "///R/82", "///R/84" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,multiplet,bulge,cap-donor,splayed-apart", "alpha": 160.336, "beta": 117.113, "gamma": 25.060, "delta": 130.034, "epsilon": -98.638, "zeta": 69.896, "epsilon_zeta": 191.466, "bb_type": "--", "chi": -99.588, "glyco_bond": "anti", "C5prime_xyz": [ -3.203, 7.981, -2.371 ], "P_xyz": [ -0.878, 9.260, -2.361 ], "form": ".", "ssZp": 0.959, "Dp": 1.003, "splay_angle": 158.713, "splay_distance": 18.684, "splay_ratio": 0.983, "d22": null, "d64": null, "eta": 4.517, "theta": 108.493, "eta_prime": 47.997, "theta_prime": 70.373, "eta_base": 68.799, "theta_base": 13.669, "v0": -39.266, "v1": 44.965, "v2": -33.463, "v3": 11.766, "v4": 17.107, "amplitude": 44.349, "phase_angle": 138.986, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 1.680, -19.572, -3.508 ], "x_axis": [ -0.385, -0.785, -0.485 ], "y_axis": [ 0.657, -0.603, 0.454 ], "z_axis": [ -0.648, -0.144, 0.748 ], "quaternion": [ -0.436, -0.343, 0.094, 0.827 ] } }, { "index": 78, "index_chain": 78, "chain_name": "R", "nt_resnum": 84, "nt_name": "C", "nt_code": "C", "nt_id": "///R/84", "linked_nts": [ "///R/83", "///R/85" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": 88.742, "beta": 130.023, "gamma": 53.923, "delta": 76.479, "epsilon": -140.089, "zeta": -80.751, "epsilon_zeta": -59.339, "bb_type": "BI", "chi": -172.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.313, 8.669, 1.265 ], "P_xyz": [ 1.252, 8.694, 0.647 ], "form": "A", "ssZp": 4.648, "Dp": 4.694, "splay_angle": 24.233, "splay_distance": 3.785, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": -36.612, "theta": -144.815, "eta_prime": -22.593, "theta_prime": -150.566, "eta_base": 47.707, "theta_base": -138.342, "v0": 6.540, "v1": -32.134, "v2": 44.487, "v3": -41.851, "v4": 22.072, "amplitude": 45.238, "phase_angle": 10.448, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.059, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 16.266, -21.885, 7.938 ], "x_axis": [ -0.504, -0.841, 0.197 ], "y_axis": [ -0.814, 0.387, -0.433 ], "z_axis": [ 0.288, -0.379, -0.880 ], "quaternion": [ 0.027, -0.497, 0.832, -0.244 ] } }, { "index": 79, "index_chain": 79, "chain_name": "R", "nt_resnum": 85, "nt_name": "G", "nt_code": "G", "nt_id": "///R/85", "linked_nts": [ "///R/84", "///R/86" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -76.790, "beta": 158.745, "gamma": 77.592, "delta": 75.449, "epsilon": -137.679, "zeta": -77.918, "epsilon_zeta": -59.761, "bb_type": "BI", "chi": 177.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.369, 1.799 ], "P_xyz": [ 1.169, 9.032, 1.425 ], "form": "A", "ssZp": 4.763, "Dp": 4.755, "splay_angle": 26.359, "splay_distance": 4.080, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 166.444, "theta": -146.694, "eta_prime": 177.088, "theta_prime": -144.763, "eta_base": -148.589, "theta_base": -118.850, "v0": 9.160, "v1": -35.013, "v2": 46.564, "v3": -42.423, "v4": 20.984, "amplitude": 46.981, "phase_angle": 7.644, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.185, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 18.763, -24.192, 6.274 ], "x_axis": [ -0.830, -0.555, 0.052 ], "y_axis": [ -0.502, 0.705, -0.501 ], "z_axis": [ 0.241, -0.442, -0.864 ], "quaternion": [ 0.051, -0.287, 0.922, -0.256 ] } }, { "index": 80, "index_chain": 80, "chain_name": "R", "nt_resnum": 86, "nt_name": "G", "nt_code": "G", "nt_id": "///R/86", "linked_nts": [ "///R/85", "///R/87" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge", "alpha": -61.565, "beta": 170.569, "gamma": 62.280, "delta": 79.452, "epsilon": -134.943, "zeta": -70.848, "epsilon_zeta": -64.095, "bb_type": "BI", "chi": -169.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.421, 8.658, 1.065 ], "P_xyz": [ 1.181, 9.044, 0.951 ], "form": ".", "ssZp": 4.644, "Dp": 4.761, "splay_angle": 29.979, "splay_distance": 4.572, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 176.127, "theta": -130.509, "eta_prime": -171.005, "theta_prime": -127.069, "eta_base": -129.937, "theta_base": -79.346, "v0": 7.720, "v1": -32.566, "v2": 43.994, "v3": -40.662, "v4": 20.797, "amplitude": 44.529, "phase_angle": 8.888, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.768, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 19.351, -27.942, 4.779 ], "x_axis": [ -0.941, -0.097, -0.324 ], "y_axis": [ 0.082, 0.864, -0.497 ], "z_axis": [ 0.328, -0.495, -0.805 ], "quaternion": [ 0.172, -0.004, 0.950, -0.261 ] } }, { "index": 81, "index_chain": 81, "chain_name": "R", "nt_resnum": 87, "nt_name": "G", "nt_code": "G", "nt_id": "///R/87", "linked_nts": [ "///R/86", "///R/88" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -59.363, "beta": 162.035, "gamma": 58.308, "delta": 81.577, "epsilon": -144.146, "zeta": -79.759, "epsilon_zeta": -64.387, "bb_type": "BI", "chi": -167.360, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.684, 0.973 ], "P_xyz": [ 1.284, 8.907, 0.803 ], "form": "A", "ssZp": 4.586, "Dp": 4.688, "splay_angle": 22.898, "splay_distance": 3.504, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 166.321, "theta": -145.094, "eta_prime": -170.436, "theta_prime": -147.028, "eta_base": -98.988, "theta_base": -117.944, "v0": 6.000, "v1": -29.403, "v2": 40.880, "v3": -38.260, "v4": 20.383, "amplitude": 41.572, "phase_angle": 10.466, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.834, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 16.893, -29.384, 1.204 ], "x_axis": [ -0.520, 0.641, -0.565 ], "y_axis": [ 0.828, 0.541, -0.149 ], "z_axis": [ 0.210, -0.545, -0.812 ], "quaternion": [ 0.229, 0.433, 0.847, -0.205 ] } }, { "index": 82, "index_chain": 82, "chain_name": "R", "nt_resnum": 88, "nt_name": "G", "nt_code": "G", "nt_id": "///R/88", "linked_nts": [ "///R/87", "///R/89" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.246, "beta": 166.204, "gamma": 54.186, "delta": 82.486, "epsilon": -125.150, "zeta": -80.313, "epsilon_zeta": -44.837, "bb_type": "--", "chi": -172.075, "glyco_bond": "anti", "C5prime_xyz": [ -1.131, 8.519, 1.243 ], "P_xyz": [ 1.510, 8.712, 1.332 ], "form": "A", "ssZp": 4.697, "Dp": 4.816, "splay_angle": 21.975, "splay_distance": 3.424, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 170.808, "theta": -137.408, "eta_prime": -179.582, "theta_prime": -135.508, "eta_base": -134.854, "theta_base": -100.720, "v0": 11.397, "v1": -34.369, "v2": 42.906, "v3": -37.251, "v4": 16.475, "amplitude": 42.983, "phase_angle": 3.450, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.924, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 16.032, -31.007, -1.780 ], "x_axis": [ 0.048, 0.903, -0.427 ], "y_axis": [ 0.983, 0.034, 0.182 ], "z_axis": [ 0.179, -0.429, -0.886 ], "quaternion": [ 0.222, 0.689, 0.684, -0.090 ] } }, { "index": 83, "index_chain": 83, "chain_name": "R", "nt_resnum": 89, "nt_name": "U", "nt_code": "U", "nt_id": "///R/89", "linked_nts": [ "///R/88", "///R/90" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -72.589, "beta": 149.312, "gamma": 71.743, "delta": 78.928, "epsilon": -115.562, "zeta": -108.545, "epsilon_zeta": -7.018, "bb_type": "--", "chi": -172.506, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.599, 1.277 ], "P_xyz": [ 1.113, 9.042, 0.644 ], "form": "A", "ssZp": 4.572, "Dp": 4.745, "splay_angle": 22.239, "splay_distance": 3.569, "splay_ratio": 0.196, "d22": 4.546, "d64": 4.693, "eta": 165.826, "theta": -155.158, "eta_prime": -177.224, "theta_prime": -155.883, "eta_base": -124.546, "theta_base": -154.328, "v0": 6.693, "v1": -32.537, "v2": 44.829, "v3": -42.114, "v4": 22.283, "amplitude": 45.569, "phase_angle": 10.338, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.306, "filter_rmsd": 0.105, "frame": { "rmsd": 0.011, "origin": [ 15.678, -30.597, -5.161 ], "x_axis": [ 0.619, 0.763, -0.186 ], "y_axis": [ 0.780, -0.569, 0.263 ], "z_axis": [ 0.094, -0.308, -0.947 ], "quaternion": [ 0.161, 0.885, 0.436, -0.026 ] } }, { "index": 84, "index_chain": 84, "chain_name": "R", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///R/90", "linked_nts": [ "///R/89", "///R/91" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop", "alpha": -53.193, "beta": 135.468, "gamma": 62.799, "delta": 76.743, "epsilon": -150.933, "zeta": -65.688, "epsilon_zeta": -85.245, "bb_type": "BI", "chi": -169.729, "glyco_bond": "anti", "C5prime_xyz": [ -1.796, 8.865, 0.977 ], "P_xyz": [ 0.713, 9.393, 0.406 ], "form": "A", "ssZp": 4.561, "Dp": 4.587, "splay_angle": 23.389, "splay_distance": 3.978, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 162.438, "theta": -138.509, "eta_prime": 173.100, "theta_prime": -144.952, "eta_base": -172.108, "theta_base": -123.443, "v0": -6.537, "v1": -20.730, "v2": 38.311, "v3": -42.964, "v4": 31.265, "amplitude": 42.992, "phase_angle": 26.984, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.724, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 13.928, -30.880, -8.259 ], "x_axis": [ 0.790, 0.601, 0.118 ], "y_axis": [ 0.584, -0.797, 0.151 ], "z_axis": [ 0.184, -0.050, -0.982 ], "quaternion": [ 0.053, 0.945, 0.314, 0.080 ] } }, { "index": 85, "index_chain": 85, "chain_name": "R", "nt_resnum": 91, "nt_name": "A", "nt_code": "A", "nt_id": "///R/91", "linked_nts": [ "///R/90", "///R/92" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,junction-loop", "alpha": -84.107, "beta": 174.413, "gamma": 70.179, "delta": 73.084, "epsilon": -158.675, "zeta": -93.391, "epsilon_zeta": -65.284, "bb_type": "BI", "chi": -168.197, "glyco_bond": "anti", "C5prime_xyz": [ -1.844, 8.883, 0.907 ], "P_xyz": [ 0.599, 9.908, 0.949 ], "form": ".", "ssZp": 4.491, "Dp": 4.533, "splay_angle": 39.977, "splay_distance": 6.091, "splay_ratio": 0.343, "d22": null, "d64": null, "eta": 161.765, "theta": 175.993, "eta_prime": 177.718, "theta_prime": -176.690, "eta_base": -139.276, "theta_base": -163.232, "v0": -2.411, "v1": -26.172, "v2": 43.406, "v3": -45.490, "v4": 30.190, "amplitude": 46.569, "phase_angle": 21.239, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.381, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ 14.490, -28.621, -11.483 ], "x_axis": [ 0.948, 0.083, 0.306 ], "y_axis": [ 0.084, -0.996, 0.011 ], "z_axis": [ 0.305, 0.015, -0.952 ], "quaternion": [ -0.001, 0.987, 0.042, 0.155 ] } }, { "index": 86, "index_chain": 86, "chain_name": "R", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///R/92", "linked_nts": [ "///R/91", "///R/93" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -65.951, "beta": -161.312, "gamma": 44.913, "delta": 86.229, "epsilon": -150.069, "zeta": -68.426, "epsilon_zeta": -81.643, "bb_type": "BI", "chi": -168.931, "glyco_bond": "anti", "C5prime_xyz": [ -1.325, 8.582, 1.053 ], "P_xyz": [ 1.050, 8.847, 2.134 ], "form": "A", "ssZp": 4.581, "Dp": 4.613, "splay_angle": 24.371, "splay_distance": 3.831, "splay_ratio": 0.215, "d22": 4.166, "d64": 4.302, "eta": -179.337, "theta": -140.353, "eta_prime": 172.936, "theta_prime": -134.576, "eta_base": 179.032, "theta_base": -96.255, "v0": 7.082, "v1": -29.536, "v2": 39.538, "v3": -36.398, "v4": 18.519, "amplitude": 39.983, "phase_angle": 8.552, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.425, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 13.311, -26.224, -16.957 ], "x_axis": [ 0.742, -0.087, 0.665 ], "y_axis": [ -0.231, -0.964, 0.132 ], "z_axis": [ 0.630, -0.251, -0.735 ], "quaternion": [ 0.103, 0.927, -0.086, 0.349 ] } }, { "index": 87, "index_chain": 87, "chain_name": "R", "nt_resnum": 93, "nt_name": "C", "nt_code": "C", "nt_id": "///R/93", "linked_nts": [ "///R/92", "///R/94" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor", "alpha": -84.727, "beta": 176.209, "gamma": 77.274, "delta": 88.596, "epsilon": -104.194, "zeta": -103.728, "epsilon_zeta": -0.466, "bb_type": "--", "chi": -166.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.831, 0.876 ], "P_xyz": [ 1.179, 9.175, 0.769 ], "form": ".", "ssZp": 4.220, "Dp": 4.499, "splay_angle": 14.835, "splay_distance": 2.643, "splay_ratio": 0.132, "d22": null, "d64": null, "eta": -175.465, "theta": -121.676, "eta_prime": -162.014, "theta_prime": -127.614, "eta_base": -115.932, "theta_base": -108.927, "v0": 1.306, "v1": -23.201, "v2": 34.752, "v3": -34.572, "v4": 21.228, "amplitude": 36.209, "phase_angle": 16.308, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.163, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 16.971, -26.051, -18.077 ], "x_axis": [ 0.387, -0.686, 0.616 ], "y_axis": [ -0.603, -0.694, -0.394 ], "z_axis": [ 0.698, -0.219, -0.682 ], "quaternion": [ -0.053, 0.831, -0.388, 0.395 ] } }, { "index": 88, "index_chain": 88, "chain_name": "R", "nt_resnum": 94, "nt_name": "G", "nt_code": "G", "nt_id": "///R/94", "linked_nts": [ "///R/93", "///R/95" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor", "alpha": 58.928, "beta": -113.732, "gamma": -111.744, "delta": 150.061, "epsilon": -152.146, "zeta": -131.827, "epsilon_zeta": -20.319, "bb_type": "--", "chi": -134.477, "glyco_bond": "anti", "C5prime_xyz": [ -1.018, 8.421, -0.151 ], "P_xyz": [ -0.163, 10.096, -1.970 ], "form": ".", "ssZp": 1.795, "Dp": 1.776, "splay_angle": 35.223, "splay_distance": 5.791, "splay_ratio": 0.315, "d22": null, "d64": null, "eta": -144.596, "theta": 137.826, "eta_prime": -141.000, "theta_prime": 143.652, "eta_base": -114.719, "theta_base": 119.214, "v0": -1.746, "v1": 22.089, "v2": -32.471, "v3": 32.295, "v4": -19.595, "amplitude": 33.726, "phase_angle": 195.680, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 19.518, -26.558, -18.563 ], "x_axis": [ 0.019, -0.891, 0.453 ], "y_axis": [ -0.392, -0.424, -0.817 ], "z_axis": [ 0.920, -0.162, -0.357 ], "quaternion": [ -0.244, 0.671, -0.478, 0.512 ] } }, { "index": 89, "index_chain": 89, "chain_name": "R", "nt_resnum": 95, "nt_name": "A", "nt_code": "A", "nt_id": "///R/95", "linked_nts": [ "///R/94", "///R/96" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge,A-minor,phosphate", "alpha": -141.682, "beta": -170.266, "gamma": 46.944, "delta": 78.658, "epsilon": -139.234, "zeta": -57.455, "epsilon_zeta": -81.780, "bb_type": "BI", "chi": 64.252, "glyco_bond": "syn", "C5prime_xyz": [ -5.526, 5.391, 1.940 ], "P_xyz": [ -6.936, 3.449, 3.051 ], "form": ".", "ssZp": -2.111, "Dp": 3.867, "splay_angle": 40.133, "splay_distance": 6.354, "splay_ratio": 0.347, "d22": null, "d64": null, "eta": 114.487, "theta": -129.870, "eta_prime": 105.900, "theta_prime": -115.593, "eta_base": 99.374, "theta_base": -102.819, "v0": -29.358, "v1": 2.952, "v2": 22.590, "v3": -40.268, "v4": 44.060, "amplitude": 44.120, "phase_angle": 59.202, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 17.585, -21.616, -20.882 ], "x_axis": [ -0.463, 0.665, 0.586 ], "y_axis": [ -0.060, 0.637, -0.769 ], "z_axis": [ -0.884, -0.391, -0.255 ], "quaternion": [ -0.479, 0.197, 0.767, -0.378 ] } }, { "index": 90, "index_chain": 90, "chain_name": "R", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///R/96", "linked_nts": [ "///R/95", "///R/97" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -73.018, "beta": 160.576, "gamma": 92.453, "delta": 84.152, "epsilon": -139.892, "zeta": -131.742, "epsilon_zeta": -8.150, "bb_type": "--", "chi": -166.675, "glyco_bond": "anti", "C5prime_xyz": [ -1.674, 8.852, 0.872 ], "P_xyz": [ 0.721, 9.638, 0.120 ], "form": ".", "ssZp": 4.342, "Dp": 4.431, "splay_angle": 32.980, "splay_distance": 5.260, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": -172.533, "theta": -149.526, "eta_prime": -138.954, "theta_prime": -139.378, "eta_base": -114.586, "theta_base": -124.429, "v0": -5.461, "v1": -17.949, "v2": 33.399, "v3": -37.265, "v4": 26.828, "amplitude": 37.372, "phase_angle": 26.658, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.012, "origin": [ 22.144, -25.608, -18.973 ], "x_axis": [ -0.195, -0.892, -0.408 ], "y_axis": [ 0.024, 0.411, -0.911 ], "z_axis": [ 0.981, -0.187, -0.059 ], "quaternion": [ 0.538, -0.336, 0.645, -0.426 ] } }, { "index": 91, "index_chain": 91, "chain_name": "R", "nt_resnum": 97, "nt_name": "G", "nt_code": "G", "nt_id": "///R/97", "linked_nts": [ "///R/96", null ], "nt_type": "RNA", "dbn": ")", "is_broken": true, "summary": "break,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 53.739, "beta": 112.437, "gamma": 9.605, "delta": 125.444, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -126.031, "glyco_bond": "anti", "C5prime_xyz": [ -1.972, 8.691, -1.283 ], "P_xyz": [ 0.247, 9.364, 0.005 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -22.579, "v1": 26.691, "v2": -20.746, "v3": 8.332, "v4": 8.816, "amplitude": 26.300, "phase_angle": 142.073, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 26.923, -27.795, -18.775 ], "x_axis": [ -0.679, -0.407, -0.611 ], "y_axis": [ 0.051, 0.804, -0.593 ], "z_axis": [ 0.732, -0.434, -0.525 ], "quaternion": [ 0.387, -0.103, 0.867, -0.296 ] } }, { "index": 92, "index_chain": 92, "chain_name": "R", "nt_resnum": 358, "nt_name": "2BA", "nt_code": "a", "is_modified": true, "nt_id": "///R/358", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-donor,phosphate", "alpha": null, "beta": -148.676, "gamma": 67.620, "delta": 102.064, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -174.332, "glyco_bond": "anti", "C5prime_xyz": [ -1.135, 8.276, 1.494 ], "P_xyz": [ 1.151, 7.868, 2.714 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 8.682, "v1": -19.285, "v2": 21.926, "v3": -17.380, "v4": 5.565, "amplitude": 21.987, "phase_angle": 355.745, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.049, "origin": [ 8.149, -25.593, -11.450 ], "x_axis": [ -0.448, -0.611, -0.653 ], "y_axis": [ -0.315, 0.791, -0.525 ], "z_axis": [ 0.837, -0.030, -0.546 ], "quaternion": [ 0.446, -0.278, 0.834, -0.166 ] } } ], "num_hbonds": 236, "hbonds": [ { "index": 1, "atom1_serNum": 26, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///P/9/ND2", "atom2_id": "///P/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 30, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///P/10/O", "atom2_id": "///P/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 40, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///P/11/O", "atom2_id": "///P/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 42, "atom2_serNum": 696, "donAcc_type": "acceptable", "distance": 2.975, "atom1_id": "///P/11/OG1", "atom2_id": "///P/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 44, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///P/12/N", "atom2_id": "///P/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 47, "atom2_serNum": 415, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///P/12/O", "atom2_id": "///P/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 52, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///P/13/N", "atom2_id": "///P/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 55, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///P/13/O", "atom2_id": "///P/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 63, "atom2_serNum": 397, "donAcc_type": "acceptable", "distance": 2.458, "atom1_id": "///P/13/OH", "atom2_id": "///P/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 63, "atom2_serNum": 2064, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///P/13/OH", "atom2_id": "///R/663/N7", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 11, "atom1_serNum": 64, "atom2_serNum": 402, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///P/14/N", "atom2_id": "///P/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 67, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///P/14/O", "atom2_id": "///P/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 72, "atom2_serNum": 78, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///P/15/N", "atom2_id": "///P/15/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 72, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///P/15/N", "atom2_id": "///P/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 75, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///P/15/O", "atom2_id": "///P/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 79, "atom2_serNum": 2044, "donAcc_type": "standard", "distance": 3.880, "atom1_id": "///P/15/ND2", "atom2_id": "///R/662/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 17, "atom1_serNum": 79, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///P/15/ND2", "atom2_id": "///R/663/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 18, "atom1_serNum": 80, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///P/16/N", "atom2_id": "///P/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 80, "atom2_serNum": 2067, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///P/16/N", "atom2_id": "///R/663/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 20, "atom1_serNum": 83, "atom2_serNum": 87, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///P/16/O", "atom2_id": "///P/16/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 86, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///P/16/OD1", "atom2_id": "///R/662/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 22, "atom1_serNum": 87, "atom2_serNum": 610, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///P/16/ND2", "atom2_id": "///P/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 88, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///P/17/N", "atom2_id": "///P/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 99, "atom2_serNum": 122, "donAcc_type": "standard", "distance": 3.909, "atom1_id": "///P/18/O", "atom2_id": "///P/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 102, "atom2_serNum": 104, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///P/18/OD1", "atom2_id": "///P/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 102, "atom2_serNum": 113, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///P/18/OD1", "atom2_id": "///P/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 107, "atom2_serNum": 343, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///P/19/O", "atom2_id": "///P/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 111, "atom2_serNum": 2025, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///P/19/OE1", "atom2_id": "///R/661/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 29, "atom1_serNum": 112, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///P/19/OE2", "atom2_id": "///R/663/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 30, "atom1_serNum": 112, "atom2_serNum": 2070, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///P/19/OE2", "atom2_id": "///R/663/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 31, "atom1_serNum": 121, "atom2_serNum": 1927, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///P/20/NZ", "atom2_id": "///R/63/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 32, "atom1_serNum": 133, "atom2_serNum": 165, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///P/22/O", "atom2_id": "///P/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 138, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///P/22/NZ", "atom2_id": "///R/61/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 34, "atom1_serNum": 142, "atom2_serNum": 173, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///P/23/O", "atom2_id": "///P/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 151, "atom2_serNum": 182, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///P/24/O", "atom2_id": "///P/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 159, "atom2_serNum": 191, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///P/25/O", "atom2_id": "///P/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 159, "atom2_serNum": 196, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///P/25/O", "atom2_id": "///P/29/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 168, "atom2_serNum": 197, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///P/26/O", "atom2_id": "///P/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 176, "atom2_serNum": 205, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///P/27/O", "atom2_id": "///P/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 181, "atom2_serNum": 307, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///P/27/NZ", "atom2_id": "///P/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 185, "atom2_serNum": 215, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///P/28/O", "atom2_id": "///P/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 196, "atom2_serNum": 589, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///P/29/OG", "atom2_id": "///P/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 200, "atom2_serNum": 220, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///P/30/O", "atom2_id": "///P/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 200, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///P/30/O", "atom2_id": "///P/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 223, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.927, "atom1_id": "///P/33/O", "atom2_id": "///P/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 231, "atom2_serNum": 256, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///P/34/O", "atom2_id": "///P/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 259, "atom2_serNum": 477, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///P/37/O", "atom2_id": "///P/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 274, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///P/39/O", "atom2_id": "///P/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 288, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///P/41/N", "atom2_id": "///P/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 299, "atom2_serNum": 422, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///P/42/O", "atom2_id": "///P/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 312, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///P/44/N", "atom2_id": "///P/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 315, "atom2_serNum": 404, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///P/44/O", "atom2_id": "///P/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 336, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///P/47/O", "atom2_id": "///P/52/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 343, "atom2_serNum": 1906, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///P/47/NH2", "atom2_id": "///R/62/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 347, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///P/48/O", "atom2_id": "///P/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 347, "atom2_serNum": 375, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///P/48/O", "atom2_id": "///P/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 350, "atom2_serNum": 2197, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///P/49/N", "atom2_id": "///R/75/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 58, "atom1_serNum": 361, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///P/50/O", "atom2_id": "///P/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 361, "atom2_serNum": 2060, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///P/50/O", "atom2_id": "///R/663/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 60, "atom1_serNum": 453, "atom2_serNum": 478, "donAcc_type": "standard", "distance": 3.674, "atom1_id": "///P/61/O", "atom2_id": "///P/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 458, "atom2_serNum": 477, "donAcc_type": "acceptable", "distance": 3.489, "atom1_id": "///P/61/OE2", "atom2_id": "///P/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 462, "atom2_serNum": 483, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///P/62/O", "atom2_id": "///P/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 469, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///P/63/O", "atom2_id": "///P/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 475, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///P/64/O", "atom2_id": "///P/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 481, "atom2_serNum": 503, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///P/65/O", "atom2_id": "///P/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 486, "atom2_serNum": 511, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///P/66/O", "atom2_id": "///P/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 488, "atom2_serNum": 661, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///P/66/OG1", "atom2_id": "///P/86/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 493, "atom2_serNum": 522, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///P/67/O", "atom2_id": "///P/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 501, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///P/68/O", "atom2_id": "///P/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 531, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///P/72/O", "atom2_id": "///P/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 531, "atom2_serNum": 549, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///P/72/O", "atom2_id": "///P/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 544, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///P/73/NE2", "atom2_id": "///P/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 545, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///P/74/N", "atom2_id": "///P/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 552, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///P/75/O", "atom2_id": "///P/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 552, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///P/75/O", "atom2_id": "///P/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 567, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///P/77/N", "atom2_id": "///P/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 606, "atom2_serNum": 2047, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///P/80/NZ", "atom2_id": "///R/662/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 78, "atom1_serNum": 648, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///P/85/OE1", "atom2_id": "///R/664/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 79, "atom1_serNum": 653, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///P/86/O", "atom2_id": "///R/664/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 80, "atom1_serNum": 667, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///P/88/N", "atom2_id": "///R/664/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 675, "atom2_serNum": 2083, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///P/88/NZ", "atom2_id": "///R/664/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 82, "atom1_serNum": 679, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///P/89/O", "atom2_id": "///R/665/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 83, "atom1_serNum": 686, "atom2_serNum": 2132, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///P/90/O", "atom2_id": "///R/666/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 84, "atom1_serNum": 694, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///P/91/O", "atom2_id": "///P/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 694, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///P/91/O", "atom2_id": "///P/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 696, "atom2_serNum": 2111, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///P/91/OG", "atom2_id": "///R/665/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 87, "atom1_serNum": 697, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///P/92/N", "atom2_id": "///R/666/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 88, "atom1_serNum": 697, "atom2_serNum": 2130, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///P/92/N", "atom2_id": "///R/666/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 708, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///P/93/O", "atom2_id": "///P/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 738, "atom2_serNum": 743, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///R/8/O2G", "atom2_id": "///R/8/O2B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 742, "atom2_serNum": 746, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///R/8/O1B", "atom2_id": "///R/8/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 755, "atom2_serNum": 771, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///R/8/O2'", "atom2_id": "///R/9/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 801, "atom2_serNum": 817, "donAcc_type": "acceptable", "distance": 3.521, "atom1_id": "///R/10/O2'", "atom2_id": "///R/11/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 825, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///R/11/O2", "atom2_id": "///R/97/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 826, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///R/11/N3", "atom2_id": "///R/97/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 828, "atom2_serNum": 2690, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///R/11/N4", "atom2_id": "///R/97/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 848, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///R/12/N6", "atom2_id": "///R/96/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 849, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///R/12/N1", "atom2_id": "///R/96/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 863, "atom2_serNum": 876, "donAcc_type": "acceptable", "distance": 2.744, "atom1_id": "///R/13/O2'", "atom2_id": "///R/14/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 867, "atom2_serNum": 2628, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///R/13/O2", "atom2_id": "///R/94/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 868, "atom2_serNum": 2626, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///R/13/N3", "atom2_id": "///R/94/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 870, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///R/13/N4", "atom2_id": "///R/94/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 883, "atom2_serNum": 2722, "donAcc_type": "acceptable", "distance": 3.509, "atom1_id": "///R/14/O2'", "atom2_id": "///R/358/O5'1", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 104, "atom1_serNum": 890, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///R/14/O6", "atom2_id": "///R/93/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 891, "atom2_serNum": 2603, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///R/14/N1", "atom2_id": "///R/93/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 893, "atom2_serNum": 930, "donAcc_type": "standard", "distance": 3.741, "atom1_id": "///R/14/N2", "atom2_id": "///R/16/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 893, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///R/14/N2", "atom2_id": "///R/93/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 894, "atom2_serNum": 2648, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///R/14/N3", "atom2_id": "///R/95/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 933, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///R/16/N6", "atom2_id": "///R/94/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 953, "atom2_serNum": 2598, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///R/17/N3", "atom2_id": "///R/93/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 955, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///R/17/N4", "atom2_id": "///R/93/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 955, "atom2_serNum": 2739, "donAcc_type": "unknown", "distance": 3.244, "atom1_id": "///R/17/N4", "atom2_id": "///R/358/N31", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 113, "atom1_serNum": 975, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///R/18/N6", "atom2_id": "///R/92/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 976, "atom2_serNum": 2578, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///R/18/N1", "atom2_id": "///R/92/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 997, "atom2_serNum": 1604, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///R/19/O6", "atom2_id": "///R/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1020, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///R/20/N6", "atom2_id": "///R/358/N7", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 117, "atom1_serNum": 1021, "atom2_serNum": 2714, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///R/20/N1", "atom2_id": "///R/358/N6", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 118, "atom1_serNum": 1042, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///R/21/O6", "atom2_id": "///R/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 1043, "atom2_serNum": 1582, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///R/21/N1", "atom2_id": "///R/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1045, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///R/21/N2", "atom2_id": "///R/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 1045, "atom2_serNum": 1654, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///R/21/N2", "atom2_id": "///R/50/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1058, "atom2_serNum": 1655, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///R/22/O2'", "atom2_id": "///R/50/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 1062, "atom2_serNum": 1564, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///R/22/O2", "atom2_id": "///R/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1062, "atom2_serNum": 1641, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///R/22/O2", "atom2_id": "///R/49/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 1063, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///R/22/N3", "atom2_id": "///R/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 1065, "atom2_serNum": 1561, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///R/22/N4", "atom2_id": "///R/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 1074, "atom2_serNum": 2388, "donAcc_type": "questionable", "distance": 3.141, "atom1_id": "///R/23/O4'", "atom2_id": "///R/83/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 1078, "atom2_serNum": 1092, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///R/23/O2'", "atom2_id": "///R/24/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 1078, "atom2_serNum": 1497, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///R/23/O2'", "atom2_id": "///R/42/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 1078, "atom2_serNum": 1516, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///R/23/O2'", "atom2_id": "///R/43/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 1088, "atom2_serNum": 1541, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///R/23/N3", "atom2_id": "///R/44/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 1092, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///R/24/OP2", "atom2_id": "///R/42/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 1092, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///R/24/OP2", "atom2_id": "///R/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1107, "atom2_serNum": 1508, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///R/24/N6", "atom2_id": "///R/43/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 1126, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///R/25/N7", "atom2_id": "///R/42/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1129, "atom2_serNum": 1489, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///R/25/N6", "atom2_id": "///R/42/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 1129, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///R/25/N6", "atom2_id": "///R/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1148, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///R/26/O2", "atom2_id": "///R/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1149, "atom2_serNum": 1474, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///R/26/N3", "atom2_id": "///R/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1151, "atom2_serNum": 1473, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///R/26/N4", "atom2_id": "///R/41/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1168, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///R/27/O2", "atom2_id": "///R/40/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1169, "atom2_serNum": 1451, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///R/27/N3", "atom2_id": "///R/40/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1171, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///R/27/N4", "atom2_id": "///R/40/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1191, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 3.860, "atom1_id": "///R/28/N6", "atom2_id": "///R/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1192, "atom2_serNum": 1428, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///R/28/N1", "atom2_id": "///R/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1210, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///R/29/O2", "atom2_id": "///R/38/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1211, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///R/29/N3", "atom2_id": "///R/38/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1231, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///R/30/N3", "atom2_id": "///R/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1233, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///R/30/O4", "atom2_id": "///R/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1250, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///R/31/O2", "atom2_id": "///R/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1251, "atom2_serNum": 1363, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///R/31/N3", "atom2_id": "///R/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1253, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///R/31/N4", "atom2_id": "///R/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1266, "atom2_serNum": 1315, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///R/32/O2'", "atom2_id": "///R/34/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1266, "atom2_serNum": 1318, "donAcc_type": "acceptable", "distance": 3.210, "atom1_id": "///R/32/O2'", "atom2_id": "///R/34/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1276, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.354, "atom1_id": "///R/32/N2", "atom2_id": "///R/35/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1276, "atom2_serNum": 1337, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///R/32/N2", "atom2_id": "///R/35/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1311, "atom2_serNum": 1329, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///R/34/O2'", "atom2_id": "///R/35/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1311, "atom2_serNum": 1872, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///R/34/O2'", "atom2_id": "///R/60/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1319, "atom2_serNum": 2293, "donAcc_type": "acceptable", "distance": 3.614, "atom1_id": "///R/34/N1", "atom2_id": "///R/79/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 1321, "atom2_serNum": 1872, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///R/34/N3", "atom2_id": "///R/60/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1329, "atom2_serNum": 1872, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///R/35/O4'", "atom2_id": "///R/60/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1333, "atom2_serNum": 1852, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///R/35/O2'", "atom2_id": "///R/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1341, "atom2_serNum": 2293, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///R/35/N1", "atom2_id": "///R/79/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 1343, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///R/35/N3", "atom2_id": "///R/79/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1355, "atom2_serNum": 2314, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///R/36/O2'", "atom2_id": "///R/80/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1355, "atom2_serNum": 2316, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///R/36/O2'", "atom2_id": "///R/80/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1538, "atom2_serNum": 2391, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///R/44/O2", "atom2_id": "///R/83/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1539, "atom2_serNum": 2389, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///R/44/N3", "atom2_id": "///R/83/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1541, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///R/44/N4", "atom2_id": "///R/83/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1554, "atom2_serNum": 1649, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///R/45/O2'", "atom2_id": "///R/49/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1564, "atom2_serNum": 1641, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///R/45/N2", "atom2_id": "///R/49/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1564, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///R/45/N2", "atom2_id": "///R/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1577, "atom2_serNum": 1632, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///R/46/O2'", "atom2_id": "///R/49/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1577, "atom2_serNum": 1634, "donAcc_type": "acceptable", "distance": 3.087, "atom1_id": "///R/46/O2'", "atom2_id": "///R/49/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1581, "atom2_serNum": 1641, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///R/46/O2", "atom2_id": "///R/49/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1589, "atom2_serNum": 2707, "donAcc_type": "acceptable", "distance": 2.487, "atom1_id": "///R/47/OP2", "atom2_id": "///R/358/O2'", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 177, "atom1_serNum": 1597, "atom2_serNum": 2733, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///R/47/O2'", "atom2_id": "///R/358/N71", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 178, "atom1_serNum": 1604, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///R/47/N6", "atom2_id": "///R/358/OP1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 179, "atom1_serNum": 1619, "atom2_serNum": 1633, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///R/48/O2'", "atom2_id": "///R/49/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1619, "atom2_serNum": 1667, "donAcc_type": "acceptable", "distance": 3.367, "atom1_id": "///R/48/O2'", "atom2_id": "///R/50/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1623, "atom2_serNum": 2541, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///R/48/N7", "atom2_id": "///R/90/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1626, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///R/48/N6", "atom2_id": "///R/90/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1633, "atom2_serNum": 2373, "donAcc_type": "questionable", "distance": 3.186, "atom1_id": "///R/49/OP2", "atom2_id": "///R/83/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1637, "atom2_serNum": 2372, "donAcc_type": "questionable", "distance": 3.047, "atom1_id": "///R/49/O4'", "atom2_id": "///R/83/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 1641, "atom2_serNum": 1651, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///R/49/O2'", "atom2_id": "///R/49/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1670, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///R/50/O6", "atom2_id": "///R/89/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1671, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///R/50/N1", "atom2_id": "///R/89/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1690, "atom2_serNum": 2503, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///R/51/O2", "atom2_id": "///R/88/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1691, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///R/51/N3", "atom2_id": "///R/88/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1693, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///R/51/N4", "atom2_id": "///R/88/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1710, "atom2_serNum": 2480, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///R/52/O2", "atom2_id": "///R/87/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1711, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///R/52/N3", "atom2_id": "///R/87/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1713, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///R/52/N4", "atom2_id": "///R/87/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 1719, "atom2_serNum": 2366, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///R/53/O5'", "atom2_id": "///R/82/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1722, "atom2_serNum": 2366, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///R/53/O4'", "atom2_id": "///R/82/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1730, "atom2_serNum": 1773, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///R/53/O2", "atom2_id": "///R/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1750, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///R/54/O2", "atom2_id": "///R/86/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1751, "atom2_serNum": 2455, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///R/54/N3", "atom2_id": "///R/86/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1753, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///R/54/N4", "atom2_id": "///R/82/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1753, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///R/54/N4", "atom2_id": "///R/86/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1770, "atom2_serNum": 2434, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///R/55/O2", "atom2_id": "///R/85/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1771, "atom2_serNum": 2432, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///R/55/N3", "atom2_id": "///R/85/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1773, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///R/55/N4", "atom2_id": "///R/85/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1793, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///R/56/O6", "atom2_id": "///R/84/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1794, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///R/56/N1", "atom2_id": "///R/84/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1796, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///R/56/N2", "atom2_id": "///R/84/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1816, "atom2_serNum": 2344, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///R/57/O6", "atom2_id": "///R/81/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1817, "atom2_serNum": 2343, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///R/57/N1", "atom2_id": "///R/81/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1836, "atom2_serNum": 2326, "donAcc_type": "standard", "distance": 2.496, "atom1_id": "///R/58/O2", "atom2_id": "///R/80/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1837, "atom2_serNum": 2324, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///R/58/N3", "atom2_id": "///R/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1839, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///R/58/N4", "atom2_id": "///R/80/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1856, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///R/59/O2", "atom2_id": "///R/79/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1857, "atom2_serNum": 2301, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///R/59/N3", "atom2_id": "///R/79/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1859, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///R/59/N4", "atom2_id": "///R/79/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1877, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///R/60/N3", "atom2_id": "///R/78/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1879, "atom2_serNum": 2278, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///R/60/O4", "atom2_id": "///R/78/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1892, "atom2_serNum": 1918, "donAcc_type": "acceptable", "distance": 2.872, "atom1_id": "///R/61/O2'", "atom2_id": "///R/62/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1900, "atom2_serNum": 2258, "donAcc_type": "questionable", "distance": 2.790, "atom1_id": "///R/61/N1", "atom2_id": "///R/77/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1943, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///R/63/N6", "atom2_id": "///R/77/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1962, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///R/64/O2", "atom2_id": "///R/76/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1963, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///R/64/N3", "atom2_id": "///R/76/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 1965, "atom2_serNum": 2235, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///R/64/N4", "atom2_id": "///R/76/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 1982, "atom2_serNum": 2213, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///R/65/O2", "atom2_id": "///R/75/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 1982, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///R/65/O2", "atom2_id": "///R/75/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 1983, "atom2_serNum": 2212, "donAcc_type": "questionable", "distance": 2.981, "atom1_id": "///R/65/N3", "atom2_id": "///R/75/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 2024, "atom2_serNum": 2070, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///R/661/O2", "atom2_id": "///R/663/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 2083, "atom2_serNum": 2095, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///R/664/O2'", "atom2_id": "///R/665/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 2087, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///R/664/O2", "atom2_id": "///R/665/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 2103, "atom2_serNum": 2121, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///R/665/O2'", "atom2_id": "///R/666/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 2339, "atom2_serNum": 2395, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///R/81/O2'", "atom2_id": "///R/84/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 2350, "atom2_serNum": 2381, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///R/82/OP1", "atom2_id": "///R/83/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 2583, "atom2_serNum": 2737, "donAcc_type": "unknown", "distance": 2.889, "atom1_id": "///R/92/N3", "atom2_id": "///R/358/N11", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 233, "atom1_serNum": 2585, "atom2_serNum": 2736, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///R/92/O4", "atom2_id": "///R/358/N61", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 234, "atom1_serNum": 2618, "atom2_serNum": 2633, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///R/94/O2'", "atom2_id": "///R/95/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2628, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///R/94/N2", "atom2_id": "///R/95/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2698, "atom2_serNum": 2729, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///R/358/OP1", "atom2_id": "///R/358/O2'1", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3muv", "num_aaChains": 1, "aaChains": "P=90", "num_naChains": 1, "naChains": "R=92", "num_atoms": 2755, "num_waters": 16, "num_metals": 1, "metals_desc": "Mg=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 20, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 9, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 10, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 11, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 12, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 13, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 14, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 15, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 16, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 17, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 18, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 19, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 20, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }