{ "num_pairs": 37, "pairs": [ { "index": 1, "nt1": "///X/2", "nt2": "///Y/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -45.374, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 42.089, "chi2": -167.702, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.487, "C1C1_dist": 11.275, "N1N9_dist": 9.162, "C6C8_dist": 9.585, "CNNC_torsion": -15.559, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.69]", "interBase_angle": 34.257, "planarity": 0.482, "simple_Shear": -0.956, "simple_Stretch": -0.104, "simple_Buckle": 10.853, "simple_Propeller": -32.492, "bp_simpleParams": [ -0.956, -0.104, -0.952, 10.853, -32.492, -19.344 ], "bp_params": [ -0.938, -0.212, -0.952, 14.255, -31.150, -19.925 ], "frame": { "rmsd": null, "origin": [ -125.943, -60.244, -83.138 ], "x_axis": [ 0.172, -0.895, -0.413 ], "y_axis": [ 0.380, 0.446, -0.810 ], "z_axis": [ 0.909, -0.018, 0.417 ], "quaternion": [ 0.713, -0.278, 0.463, -0.447 ] } }, { "index": 2, "nt1": "///X/3", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.485, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.255, "chi2": -179.558, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.198, "C1C1_dist": 11.186, "N1N9_dist": 9.157, "C6C8_dist": 9.799, "CNNC_torsion": -26.851, "hbonds_num": 2, "hbonds_desc": "N3-N1(imino)[3.17],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 33.249, "planarity": 0.399, "simple_Shear": 0.899, "simple_Stretch": -0.123, "simple_Buckle": 6.995, "simple_Propeller": -32.505, "bp_simpleParams": [ 0.899, -0.123, -0.127, 6.995, -32.505, -10.182 ], "bp_params": [ 0.886, -0.197, -0.127, 4.093, -32.996, -10.611 ], "frame": { "rmsd": null, "origin": [ -122.710, -61.434, -82.539 ], "x_axis": [ 0.296, -0.242, -0.924 ], "y_axis": [ 0.151, 0.967, -0.205 ], "z_axis": [ 0.943, -0.079, 0.323 ], "quaternion": [ 0.804, -0.039, 0.581, -0.122 ] } }, { "index": 3, "nt1": "///X/4", "nt2": "///Y/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.854, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.692, "chi2": -143.207, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.679, "C1C1_dist": 10.203, "N1N9_dist": 8.719, "C6C8_dist": 9.896, "CNNC_torsion": -29.271, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.75]", "interBase_angle": 27.880, "planarity": 0.366, "simple_Shear": 0.176, "simple_Stretch": -0.024, "simple_Buckle": -15.749, "simple_Propeller": -23.005, "bp_simpleParams": [ 0.176, -0.024, 1.295, -15.749, -23.005, 8.246 ], "bp_params": [ 0.175, -0.029, 1.295, -16.289, -22.626, 8.328 ], "frame": { "rmsd": null, "origin": [ -119.034, -61.681, -81.811 ], "x_axis": [ 0.293, 0.430, -0.854 ], "y_axis": [ -0.105, 0.902, 0.418 ], "z_axis": [ 0.950, -0.032, 0.309 ], "quaternion": [ 0.791, 0.142, 0.570, 0.169 ] } }, { "index": 4, "nt1": "///X/5", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.074, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.242, "chi2": -94.123, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 45.303, "C1C1_dist": 11.105, "N1N9_dist": 9.236, "C6C8_dist": 10.018, "CNNC_torsion": -19.033, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.06],N1(imino)-N3[3.12],N2(amino)-O2(carbonyl)[3.14],N2(amino)-N3[3.20]", "interBase_angle": 23.340, "planarity": 0.372, "simple_Shear": 0.839, "simple_Stretch": 0.065, "simple_Buckle": -13.665, "simple_Propeller": -18.921, "bp_simpleParams": [ 0.839, 0.065, 0.790, -13.665, -18.921, -7.316 ], "bp_params": [ 0.841, -0.019, 0.790, -15.448, -17.496, -7.336 ], "frame": { "rmsd": null, "origin": [ -115.669, -62.014, -81.082 ], "x_axis": [ 0.047, 0.831, -0.554 ], "y_axis": [ -0.052, 0.556, 0.830 ], "z_axis": [ 0.998, -0.010, 0.069 ], "quaternion": [ 0.647, 0.325, 0.600, 0.341 ] } }, { "index": 5, "nt1": "///X/6", "nt2": "///Y/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.301, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.262, "chi2": -117.465, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.041, "C1C1_dist": 10.930, "N1N9_dist": 9.305, "C6C8_dist": 10.304, "CNNC_torsion": -16.054, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.66]", "interBase_angle": 15.708, "planarity": 0.248, "simple_Shear": 1.109, "simple_Stretch": 0.438, "simple_Buckle": -14.130, "simple_Propeller": -6.862, "bp_simpleParams": [ 1.109, 0.438, 1.329, -14.130, -6.862, 4.574 ], "bp_params": [ 1.150, 0.314, 1.329, -14.804, -5.252, 4.541 ], "frame": { "rmsd": null, "origin": [ -112.158, -61.482, -81.957 ], "x_axis": [ 0.021, 0.996, -0.086 ], "y_axis": [ -0.154, 0.089, 0.984 ], "z_axis": [ 0.988, -0.007, 0.155 ], "quaternion": [ 0.562, 0.441, 0.478, 0.511 ] } }, { "index": 6, "nt1": "///X/7", "nt2": "///Y/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.131, "conf1": "anti", "pucker1": "----", "lambda1": 50.798, "chi2": -93.342, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.385, "C1C1_dist": 11.031, "N1N9_dist": 9.364, "C6C8_dist": 10.513, "CNNC_torsion": -8.562, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 13.744, "planarity": 0.161, "simple_Shear": -1.068, "simple_Stretch": 0.650, "simple_Buckle": -7.731, "simple_Propeller": -11.363, "bp_simpleParams": [ -1.068, 0.650, -0.106, -7.731, -11.363, 13.681 ], "bp_params": [ -1.126, 0.543, -0.106, -6.577, -12.068, 13.735 ], "frame": { "rmsd": null, "origin": [ -109.473, -60.324, -81.534 ], "x_axis": [ -0.181, 0.871, 0.456 ], "y_axis": [ 0.118, -0.442, 0.889 ], "z_axis": [ 0.976, 0.215, -0.023 ], "quaternion": [ 0.298, 0.566, 0.436, 0.632 ] } }, { "index": 7, "nt1": "///X/8", "nt2": "///Y/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.824, "conf1": "anti", "pucker1": "----", "lambda1": 56.122, "chi2": -74.559, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 45.780, "C1C1_dist": 10.948, "N1N9_dist": 9.103, "C6C8_dist": 9.914, "CNNC_torsion": -13.550, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[3.02],N2(amino)-N3[3.02]", "interBase_angle": 22.497, "planarity": 0.258, "simple_Shear": 0.835, "simple_Stretch": -0.045, "simple_Buckle": -9.306, "simple_Propeller": -20.482, "bp_simpleParams": [ 0.835, -0.045, 0.014, -9.306, -20.482, -5.465 ], "bp_params": [ 0.827, -0.125, 0.014, -11.170, -19.527, -5.520 ], "frame": { "rmsd": null, "origin": [ -105.950, -59.958, -82.203 ], "x_axis": [ -0.322, 0.403, 0.857 ], "y_axis": [ 0.183, -0.861, 0.474 ], "z_axis": [ 0.929, 0.309, 0.204 ], "quaternion": [ 0.071, 0.578, 0.253, 0.773 ] } }, { "index": 8, "nt1": "///X/9", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.028, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.604, "chi2": -92.589, "conf2": "anti", "pucker2": "----", "lambda2": 57.476, "C1C1_dist": 10.660, "N1N9_dist": 8.940, "C6C8_dist": 9.847, "CNNC_torsion": -1.997, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[3.11],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 21.998, "planarity": 0.248, "simple_Shear": -0.955, "simple_Stretch": -0.071, "simple_Buckle": -18.361, "simple_Propeller": -12.117, "bp_simpleParams": [ -0.955, -0.071, -0.934, -18.361, -12.117, 2.152 ], "bp_params": [ -0.946, -0.149, -0.934, -17.331, -13.548, 2.143 ], "frame": { "rmsd": null, "origin": [ -102.635, -58.841, -81.596 ], "x_axis": [ -0.305, -0.041, 0.952 ], "y_axis": [ 0.324, -0.944, 0.063 ], "z_axis": [ 0.896, 0.327, 0.301 ], "quaternion": [ -0.114, 0.578, 0.122, 0.798 ] } }, { "index": 9, "nt1": "///X/10", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.970, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.521, "chi2": -119.957, "conf2": "anti", "pucker2": "----", "lambda2": 54.740, "C1C1_dist": 10.542, "N1N9_dist": 8.706, "C6C8_dist": 9.534, "CNNC_torsion": -21.734, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.80]", "interBase_angle": 32.590, "planarity": 0.411, "simple_Shear": -0.762, "simple_Stretch": -0.344, "simple_Buckle": -12.954, "simple_Propeller": -29.905, "bp_simpleParams": [ -0.762, -0.344, -0.265, -12.954, -29.905, -1.998 ], "bp_params": [ -0.741, -0.388, -0.265, -10.965, -30.690, -2.064 ], "frame": { "rmsd": null, "origin": [ -99.271, -58.345, -81.791 ], "x_axis": [ -0.042, -0.535, 0.844 ], "y_axis": [ 0.258, -0.822, -0.508 ], "z_axis": [ 0.965, 0.196, 0.173 ], "quaternion": [ -0.278, 0.634, -0.109, 0.714 ] } }, { "index": 10, "nt1": "///X/11", "nt2": "///Y/27", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.486, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 35.838, "chi2": 159.274, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.728, "C1C1_dist": 13.518, "N1N9_dist": 10.918, "C6C8_dist": 10.719, "CNNC_torsion": -11.050, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02]", "interBase_angle": 26.048, "planarity": 0.393, "simple_Shear": 1.239, "simple_Stretch": 1.660, "simple_Buckle": 14.015, "simple_Propeller": -21.957, "bp_simpleParams": [ 1.239, 1.660, -1.353, 14.015, -21.957, -45.449 ], "bp_params": [ 1.435, 1.494, -1.353, 11.102, -23.564, -46.136 ], "frame": { "rmsd": null, "origin": [ -95.253, -57.538, -81.196 ], "x_axis": [ 0.107, -0.986, -0.129 ], "y_axis": [ -0.165, 0.110, -0.980 ], "z_axis": [ 0.980, 0.126, -0.151 ], "quaternion": [ 0.516, -0.536, 0.537, -0.398 ] } }, { "index": 11, "nt1": "///X/11", "nt2": "///Y/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.486, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.416, "chi2": -102.780, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.807, "C1C1_dist": 11.298, "N1N9_dist": 9.655, "C6C8_dist": 10.762, "CNNC_torsion": -22.302, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.73]", "interBase_angle": 21.439, "planarity": 0.327, "simple_Shear": 0.067, "simple_Stretch": 0.801, "simple_Buckle": -3.136, "simple_Propeller": -21.208, "bp_simpleParams": [ 0.067, 0.801, 0.785, -3.136, -21.208, 6.821 ], "bp_params": [ 0.079, 0.800, 0.785, -3.421, -21.164, 6.936 ], "frame": { "rmsd": null, "origin": [ -96.396, -58.153, -81.574 ], "x_axis": [ 0.126, -0.943, 0.307 ], "y_axis": [ 0.102, -0.296, -0.950 ], "z_axis": [ 0.987, 0.152, 0.059 ], "quaternion": [ -0.472, 0.584, -0.360, 0.554 ] } }, { "index": 12, "nt1": "///X/12", "nt2": "///Y/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.841, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.210, "chi2": 159.274, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.354, "C1C1_dist": 10.897, "N1N9_dist": 8.902, "C6C8_dist": 9.647, "CNNC_torsion": -46.397, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.19],N1-N3(imino)[2.78]", "interBase_angle": 38.730, "planarity": 0.522, "simple_Shear": 0.553, "simple_Stretch": -0.297, "simple_Buckle": 15.142, "simple_Propeller": -35.647, "bp_simpleParams": [ 0.553, -0.297, 1.142, 15.142, -35.647, -12.097 ], "bp_params": [ 0.541, -0.319, 1.142, 13.347, -36.357, -12.650 ], "frame": { "rmsd": null, "origin": [ -93.925, -57.032, -80.460 ], "x_axis": [ 0.147, -0.901, -0.407 ], "y_axis": [ -0.107, 0.395, -0.913 ], "z_axis": [ 0.983, 0.178, -0.038 ], "quaternion": [ 0.613, -0.445, 0.567, -0.324 ] } }, { "index": 13, "nt1": "///X/13", "nt2": "///Y/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.508, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.593, "chi2": -166.815, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.870, "C1C1_dist": 10.270, "N1N9_dist": 8.680, "C6C8_dist": 9.759, "CNNC_torsion": -34.659, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)*N3[2.98],N1(imino)-O2(carbonyl)[2.51],N2(amino)-O2(carbonyl)[3.15]", "unusual_base2base_hbonds": 1, "interBase_angle": 33.081, "planarity": 0.439, "simple_Shear": -2.265, "simple_Stretch": -0.009, "simple_Buckle": 0.649, "simple_Propeller": -33.075, "bp_simpleParams": [ -2.265, -0.009, 0.922, 0.649, -33.075, 7.181 ], "bp_params": [ -2.201, -0.535, 0.922, 8.298, -32.023, 7.452 ], "frame": { "rmsd": null, "origin": [ -90.419, -58.558, -79.275 ], "x_axis": [ 0.035, -0.833, -0.552 ], "y_axis": [ -0.129, 0.544, -0.829 ], "z_axis": [ 0.991, 0.100, -0.089 ], "quaternion": [ 0.610, -0.381, 0.632, -0.288 ] } }, { "index": 14, "nt1": "///X/14", "nt2": "///Y/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.355, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.015, "chi2": -102.619, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.358, "C1C1_dist": 10.559, "N1N9_dist": 8.660, "C6C8_dist": 9.449, "CNNC_torsion": -18.446, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.64],N1-N3(imino)[2.62]", "interBase_angle": 25.556, "planarity": 0.337, "simple_Shear": -0.366, "simple_Stretch": -0.457, "simple_Buckle": -12.034, "simple_Propeller": -22.545, "bp_simpleParams": [ -0.366, -0.457, 0.068, -12.034, -22.545, -7.202 ], "bp_params": [ -0.355, -0.465, 0.068, -11.410, -22.868, -7.312 ], "frame": { "rmsd": null, "origin": [ -86.150, -57.816, -78.614 ], "x_axis": [ 0.098, -0.213, -0.972 ], "y_axis": [ -0.080, 0.972, -0.221 ], "z_axis": [ 0.992, 0.099, 0.079 ], "quaternion": [ 0.733, -0.109, 0.670, -0.045 ] } }, { "index": 15, "nt1": "///X/15", "nt2": "///Y/24", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -77.964, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 63.844, "chi2": -90.507, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 70.834, "C1C1_dist": 10.711, "N1N9_dist": 9.579, "C6C8_dist": 11.081, "CNNC_torsion": -14.880, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 23.231, "planarity": 0.354, "simple_Shear": -0.617, "simple_Stretch": 1.411, "simple_Buckle": -4.678, "simple_Propeller": -22.755, "bp_simpleParams": [ -0.617, 1.411, -0.753, -4.678, -22.755, 29.849 ], "bp_params": [ -0.689, 1.377, -0.753, -3.440, -22.974, 30.418 ], "frame": { "rmsd": null, "origin": [ -83.071, -55.072, -80.002 ], "x_axis": [ -0.060, 0.469, -0.881 ], "y_axis": [ 0.071, 0.883, 0.464 ], "z_axis": [ 0.996, -0.035, -0.086 ], "quaternion": [ 0.659, 0.189, 0.712, 0.151 ] } }, { "index": 16, "nt1": "///X/16", "nt2": "///Y/24", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -81.704, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 43.761, "chi2": -90.507, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 97.345, "C1C1_dist": 9.445, "N1N9_dist": 8.601, "C6C8_dist": 9.974, "CNNC_torsion": -16.171, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.67]", "interBase_angle": 9.722, "planarity": 0.258, "simple_Shear": -4.329, "simple_Stretch": 1.307, "simple_Buckle": -4.529, "simple_Propeller": -8.603, "bp_simpleParams": [ -4.329, 1.307, 1.279, -4.529, -8.603, 29.564 ], "bp_params": [ -4.461, -0.737, 1.279, -0.264, -9.718, 29.666 ], "frame": { "rmsd": null, "origin": [ -81.784, -56.897, -79.017 ], "x_axis": [ -0.175, 0.464, -0.868 ], "y_axis": [ 0.097, 0.886, 0.454 ], "z_axis": [ 0.980, -0.005, -0.200 ], "quaternion": [ 0.615, 0.187, 0.752, 0.149 ] } }, { "index": 17, "nt1": "///X/17", "nt2": "///Y/22", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.820, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.875, "chi2": -76.997, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 84.344, "C1C1_dist": 9.112, "N1N9_dist": 8.974, "C6C8_dist": 11.200, "CNNC_torsion": -19.971, "hbonds_num": 2, "hbonds_desc": "N2(amino)-O2(carbonyl)[2.68],N2(amino)-N3[3.15]", "interBase_angle": 20.703, "planarity": 0.286, "simple_Shear": 0.244, "simple_Stretch": 3.049, "simple_Buckle": 7.603, "simple_Propeller": -19.257, "bp_simpleParams": [ 0.244, 3.049, 0.403, 7.603, -19.257, 70.742 ], "bp_params": [ 0.357, 3.037, 0.403, 6.831, -19.544, 71.439 ], "frame": { "rmsd": null, "origin": [ -77.918, -52.961, -79.265 ], "x_axis": [ 0.019, 1.000, 0.015 ], "y_axis": [ 0.447, -0.022, 0.894 ], "z_axis": [ 0.895, -0.010, -0.447 ], "quaternion": [ 0.371, 0.610, 0.593, 0.373 ] } }, { "index": 18, "nt1": "///X/18", "nt2": "///Y/21", "bp": "T-A", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.556, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 41.730, "chi2": -126.750, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.373, "C1C1_dist": 11.262, "N1N9_dist": 9.492, "C6C8_dist": 10.402, "CNNC_torsion": -26.004, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*N1[3.03]", "interBase_angle": 22.304, "planarity": 0.330, "simple_Shear": -2.060, "simple_Stretch": 0.611, "simple_Buckle": -7.742, "simple_Propeller": -20.917, "bp_simpleParams": [ -2.060, 0.611, 0.862, -7.742, -20.917, -2.481 ], "bp_params": [ -2.142, 0.169, 0.862, -3.148, -22.081, -2.527 ], "frame": { "rmsd": null, "origin": [ -74.499, -55.063, -80.862 ], "x_axis": [ -0.134, 0.902, 0.411 ], "y_axis": [ 0.300, -0.358, 0.884 ], "z_axis": [ 0.944, 0.242, -0.223 ], "quaternion": [ 0.267, 0.601, 0.500, 0.563 ] } }, { "index": 19, "nt1": "///X/19", "nt2": "///Y/20", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.990, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 87.351, "chi2": -146.957, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.992, "C1C1_dist": 9.762, "N1N9_dist": 8.593, "C6C8_dist": 9.749, "CNNC_torsion": -14.974, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.72]", "interBase_angle": 1.135, "planarity": 0.350, "simple_Shear": 4.245, "simple_Stretch": 0.725, "simple_Buckle": -0.042, "simple_Propeller": -1.134, "bp_simpleParams": [ 4.245, 0.725, 1.704, -0.042, -1.134, 18.350 ], "bp_params": [ 4.150, -1.149, 1.704, -0.520, -1.009, 18.350 ], "frame": { "rmsd": null, "origin": [ -70.054, -54.137, -79.474 ], "x_axis": [ 0.207, 0.148, 0.967 ], "y_axis": [ 0.079, -0.988, 0.134 ], "z_axis": [ 0.975, 0.049, -0.216 ], "quaternion": [ 0.027, 0.776, 0.073, 0.626 ] } }, { "index": 20, "nt1": "///X/20", "nt2": "///Y/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -73.829, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 67.239, "chi2": -113.698, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.396, "C1C1_dist": 10.647, "N1N9_dist": 9.142, "C6C8_dist": 10.310, "CNNC_torsion": -30.447, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)*N1[3.07]", "interBase_angle": 37.775, "planarity": 0.506, "simple_Shear": 2.122, "simple_Stretch": 0.717, "simple_Buckle": 20.249, "simple_Propeller": -31.890, "bp_simpleParams": [ 2.122, 0.717, 0.339, 20.249, -31.890, 12.955 ], "bp_params": [ 2.221, 0.294, 0.339, 13.457, -35.297, 13.505 ], "frame": { "rmsd": null, "origin": [ -67.271, -53.530, -81.016 ], "x_axis": [ 0.488, -0.335, 0.806 ], "y_axis": [ 0.164, -0.871, -0.462 ], "z_axis": [ 0.857, 0.358, -0.371 ], "quaternion": [ -0.248, 0.826, -0.052, 0.503 ] } }, { "index": 21, "nt1": "///X/21", "nt2": "///Y/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.997, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 43.704, "chi2": -82.323, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.876, "C1C1_dist": 10.371, "N1N9_dist": 8.523, "C6C8_dist": 9.228, "CNNC_torsion": 5.273, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.78],N1(imino)-O2(carbonyl)[2.96],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[3.19]", "interBase_angle": 22.720, "planarity": 0.297, "simple_Shear": -1.464, "simple_Stretch": -0.637, "simple_Buckle": -21.321, "simple_Propeller": -7.851, "bp_simpleParams": [ -1.464, -0.637, -1.450, -21.321, -7.851, -5.574 ], "bp_params": [ -1.365, -0.829, -1.450, -20.100, -10.592, -5.513 ], "frame": { "rmsd": null, "origin": [ -64.183, -51.893, -81.870 ], "x_axis": [ 0.019, -0.709, 0.705 ], "y_axis": [ 0.162, -0.693, -0.702 ], "z_axis": [ 0.987, 0.128, 0.102 ], "quaternion": [ -0.327, 0.635, -0.216, 0.666 ] } }, { "index": 22, "nt1": "///X/22", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -64.352, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 77.197, "chi2": -103.251, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 43.617, "C1C1_dist": 10.745, "N1N9_dist": 9.346, "C6C8_dist": 10.530, "CNNC_torsion": -16.640, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N3[2.61]", "interBase_angle": 22.419, "planarity": 0.345, "simple_Shear": 2.527, "simple_Stretch": 0.941, "simple_Buckle": 14.144, "simple_Propeller": -17.394, "bp_simpleParams": [ 2.527, 0.941, -0.256, 14.144, -17.394, 14.866 ], "bp_params": [ 2.683, 0.270, -0.256, 9.249, -20.422, 15.055 ], "frame": { "rmsd": null, "origin": [ -61.165, -52.638, -82.458 ], "x_axis": [ 0.119, -0.990, 0.075 ], "y_axis": [ -0.042, -0.080, -0.996 ], "z_axis": [ 0.992, 0.115, -0.051 ], "quaternion": [ -0.497, 0.559, -0.461, 0.477 ] } }, { "index": 23, "nt1": "///X/22", "nt2": "///Y/18", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -64.352, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 90.239, "chi2": -82.323, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 67.449, "C1C1_dist": 9.726, "N1N9_dist": 9.168, "C6C8_dist": 11.053, "CNNC_torsion": -13.919, "hbonds_num": 2, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.24],N2(amino)-N3[3.12]", "interBase_angle": 16.860, "planarity": 0.409, "simple_Shear": 1.155, "simple_Stretch": 1.921, "simple_Buckle": -10.947, "simple_Propeller": -12.823, "bp_simpleParams": [ 1.155, 1.921, 1.680, -10.947, -12.823, 47.450 ], "bp_params": [ 1.414, 1.739, 1.680, -12.636, -11.162, 47.395 ], "frame": { "rmsd": null, "origin": [ -62.263, -53.282, -82.046 ], "x_axis": [ 0.178, -0.924, 0.338 ], "y_axis": [ 0.223, -0.297, -0.928 ], "z_axis": [ 0.958, 0.241, 0.153 ], "quaternion": [ 0.508, -0.575, 0.305, -0.564 ] } }, { "index": 24, "nt1": "///X/23", "nt2": "///Y/16", "bp": "A-C", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.545, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 44.625, "chi2": -70.119, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.301, "C1C1_dist": 10.501, "N1N9_dist": 8.713, "C6C8_dist": 9.544, "CNNC_torsion": -29.503, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[2.77],N1*O2(carbonyl)[2.89]", "unusual_base2base_hbonds": 1, "interBase_angle": 38.453, "planarity": 0.440, "simple_Shear": -1.942, "simple_Stretch": -0.189, "simple_Buckle": -17.684, "simple_Propeller": -34.145, "bp_simpleParams": [ -1.942, -0.189, -0.095, -17.684, -34.145, -0.927 ], "bp_params": [ -1.878, -0.529, -0.095, -11.034, -36.836, -0.973 ], "frame": { "rmsd": null, "origin": [ -58.073, -50.774, -83.444 ], "x_axis": [ 0.130, -0.951, -0.281 ], "y_axis": [ -0.170, 0.258, -0.951 ], "z_axis": [ 0.977, 0.171, -0.128 ], "quaternion": [ 0.561, -0.500, 0.560, -0.348 ] } }, { "index": 25, "nt1": "///X/24", "nt2": "///Y/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -77.178, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.892, "chi2": -108.967, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 41.676, "C1C1_dist": 11.552, "N1N9_dist": 9.535, "C6C8_dist": 10.040, "CNNC_torsion": -9.864, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.79],N1-N3(imino)[3.43]", "interBase_angle": 39.003, "planarity": 0.470, "simple_Shear": 0.448, "simple_Stretch": 0.351, "simple_Buckle": -21.590, "simple_Propeller": -32.483, "bp_simpleParams": [ 0.448, 0.351, -1.249, -21.590, -32.483, -15.656 ], "bp_params": [ 0.474, 0.316, -1.249, -23.777, -30.918, -15.917 ], "frame": { "rmsd": null, "origin": [ -53.744, -49.893, -83.062 ], "x_axis": [ -0.235, -0.477, -0.847 ], "y_axis": [ -0.110, 0.879, -0.464 ], "z_axis": [ 0.966, -0.016, -0.259 ], "quaternion": [ 0.588, -0.190, 0.770, -0.156 ] } }, { "index": 26, "nt1": "///X/26", "nt2": "///Y/13", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.548, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 43.558, "chi2": -70.843, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 86.331, "C1C1_dist": 9.677, "N1N9_dist": 8.541, "C6C8_dist": 9.719, "CNNC_torsion": -6.307, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.77],N6(amino)-N3[3.20]", "interBase_angle": 19.573, "planarity": 0.328, "simple_Shear": -4.018, "simple_Stretch": 0.759, "simple_Buckle": -12.629, "simple_Propeller": -14.953, "bp_simpleParams": [ -4.018, 0.759, -1.068, -12.629, -14.953, 23.675 ], "bp_params": [ -3.983, -0.923, -1.068, -5.523, -18.777, 23.961 ], "frame": { "rmsd": null, "origin": [ -48.848, -49.832, -87.304 ], "x_axis": [ -0.324, 0.234, -0.917 ], "y_axis": [ 0.194, 0.965, 0.178 ], "z_axis": [ 0.926, -0.120, -0.358 ], "quaternion": [ 0.566, 0.132, 0.813, 0.018 ] } }, { "index": 27, "nt1": "///X/27", "nt2": "///Y/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.183, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.369, "chi2": -86.335, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.942, "C1C1_dist": 10.568, "N1N9_dist": 8.798, "C6C8_dist": 9.740, "CNNC_torsion": -27.763, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 43.491, "planarity": 0.547, "simple_Shear": -0.495, "simple_Stretch": -0.129, "simple_Buckle": -17.219, "simple_Propeller": -39.937, "bp_simpleParams": [ -0.495, -0.129, -0.528, -17.219, -39.937, 5.080 ], "bp_params": [ -0.491, -0.144, -0.528, -15.488, -40.640, 5.373 ], "frame": { "rmsd": null, "origin": [ -45.003, -50.291, -87.646 ], "x_axis": [ -0.133, 0.933, -0.334 ], "y_axis": [ 0.326, 0.360, 0.874 ], "z_axis": [ 0.936, 0.007, -0.352 ], "quaternion": [ 0.468, 0.464, 0.679, 0.324 ] } }, { "index": 28, "nt1": "///X/28", "nt2": "///Y/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 170.731, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.058, "chi2": -90.575, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.009, "C1C1_dist": 11.163, "N1N9_dist": 9.602, "C6C8_dist": 10.696, "CNNC_torsion": -32.932, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.95]", "interBase_angle": 40.041, "planarity": 0.463, "simple_Shear": -1.262, "simple_Stretch": 1.132, "simple_Buckle": -33.710, "simple_Propeller": -21.607, "bp_simpleParams": [ -1.262, 1.132, 1.441, -33.710, -21.607, 7.845 ], "bp_params": [ -1.376, 0.990, 1.441, -31.394, -24.853, 7.748 ], "frame": { "rmsd": null, "origin": [ -41.631, -49.793, -89.259 ], "x_axis": [ 0.041, 0.980, 0.195 ], "y_axis": [ 0.189, -0.199, 0.961 ], "z_axis": [ 0.981, -0.002, -0.194 ], "quaternion": [ 0.402, 0.599, 0.488, 0.491 ] } }, { "index": 29, "nt1": "///X/29", "nt2": "///Y/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.769, "conf1": "anti", "pucker1": "----", "lambda1": 56.072, "chi2": -107.654, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 32.630, "C1C1_dist": 11.561, "N1N9_dist": 9.504, "C6C8_dist": 9.898, "CNNC_torsion": -24.854, "hbonds_num": 1, "hbonds_desc": "N3(imino)*N6(amino)[3.05]", "interBase_angle": 34.223, "planarity": 0.426, "simple_Shear": 1.874, "simple_Stretch": 0.482, "simple_Buckle": -15.242, "simple_Propeller": -30.641, "bp_simpleParams": [ 1.874, 0.482, 0.370, -15.242, -30.641, -24.660 ], "bp_params": [ 1.934, 0.067, 0.370, -21.283, -26.800, -24.928 ], "frame": { "rmsd": null, "origin": [ -38.948, -49.757, -91.211 ], "x_axis": [ 0.094, 0.515, 0.852 ], "y_axis": [ 0.253, -0.840, 0.480 ], "z_axis": [ 0.963, 0.171, -0.209 ], "quaternion": [ 0.106, 0.732, 0.262, 0.620 ] } }, { "index": 30, "nt1": "///X/30", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.779, "conf1": "anti", "pucker1": "----", "lambda1": 52.452, "chi2": -116.176, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.174, "C1C1_dist": 11.244, "N1N9_dist": 9.398, "C6C8_dist": 10.246, "CNNC_torsion": -19.827, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.47],N3-N1(imino)[3.31],N4(amino)-O6(carbonyl)[3.35]", "interBase_angle": 30.008, "planarity": 0.348, "simple_Shear": 0.547, "simple_Stretch": 0.249, "simple_Buckle": 10.259, "simple_Propeller": -28.200, "bp_simpleParams": [ 0.547, 0.249, -0.254, 10.259, -28.200, -0.808 ], "bp_params": [ 0.556, 0.227, -0.254, 8.963, -28.638, -0.832 ], "frame": { "rmsd": null, "origin": [ -36.586, -48.409, -90.679 ], "x_axis": [ 0.426, 0.056, 0.903 ], "y_axis": [ 0.259, -0.964, -0.062 ], "z_axis": [ 0.867, 0.260, -0.425 ], "quaternion": [ -0.096, 0.839, 0.094, 0.528 ] } }, { "index": 31, "nt1": "///X/31", "nt2": "///Y/8", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.224, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.014, "chi2": 179.473, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.077, "C1C1_dist": 11.908, "N1N9_dist": 9.805, "C6C8_dist": 10.234, "CNNC_torsion": -56.854, "hbonds_num": 1, "hbonds_desc": "N1*O4(carbonyl)[2.61]", "interBase_angle": 39.634, "planarity": 0.511, "simple_Shear": 3.220, "simple_Stretch": 1.045, "simple_Buckle": 24.258, "simple_Propeller": -31.344, "bp_simpleParams": [ 3.220, 1.045, 0.419, 24.258, -31.344, -22.728 ], "bp_params": [ 3.385, -0.024, 0.419, 12.938, -37.463, -23.830 ], "frame": { "rmsd": null, "origin": [ -33.921, -47.440, -93.490 ], "x_axis": [ 0.251, -0.606, 0.755 ], "y_axis": [ -0.123, -0.793, -0.596 ], "z_axis": [ 0.960, 0.057, -0.273 ], "quaternion": [ -0.215, 0.761, -0.239, 0.563 ] } }, { "index": 32, "nt1": "///X/32", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -78.335, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.709, "chi2": -156.202, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.659, "C1C1_dist": 10.263, "N1N9_dist": 8.723, "C6C8_dist": 9.969, "CNNC_torsion": -44.415, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.69],O2(carbonyl)-N2(amino)[2.80]", "interBase_angle": 47.491, "planarity": 0.605, "simple_Shear": 1.810, "simple_Stretch": 0.151, "simple_Buckle": 10.669, "simple_Propeller": -46.277, "bp_simpleParams": [ 1.810, 0.151, 1.259, 10.669, -46.277, 13.778 ], "bp_params": [ 1.808, -0.164, 1.259, 1.954, -47.451, 15.035 ], "frame": { "rmsd": null, "origin": [ -29.983, -47.637, -92.340 ], "x_axis": [ 0.125, -0.914, 0.385 ], "y_axis": [ -0.055, -0.394, -0.917 ], "z_axis": [ 0.991, 0.093, -0.100 ], "quaternion": [ -0.397, 0.636, -0.381, 0.541 ] } }, { "index": 33, "nt1": "///X/33", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.962, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.834, "chi2": -166.111, "conf2": "anti", "pucker2": "----", "lambda2": 52.810, "C1C1_dist": 10.621, "N1N9_dist": 8.927, "C6C8_dist": 9.877, "CNNC_torsion": -24.144, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.42],N1-N3(imino)[3.08]", "interBase_angle": 11.198, "planarity": 0.339, "simple_Shear": 0.715, "simple_Stretch": -0.172, "simple_Buckle": 5.722, "simple_Propeller": -9.626, "bp_simpleParams": [ 0.715, -0.172, 1.597, 5.722, -9.626, -0.282 ], "bp_params": [ 0.700, -0.225, 1.597, 4.975, -10.032, -0.283 ], "frame": { "rmsd": null, "origin": [ -26.891, -46.762, -93.501 ], "x_axis": [ 0.098, -0.988, -0.123 ], "y_axis": [ -0.363, 0.079, -0.929 ], "z_axis": [ 0.927, 0.136, -0.350 ], "quaternion": [ -0.455, 0.585, -0.577, 0.344 ] } }, { "index": 34, "nt1": "///X/34", "nt2": "///Y/5", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.060, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.723, "chi2": -120.224, "conf2": "anti", "pucker2": "----", "lambda2": 62.600, "C1C1_dist": 11.552, "N1N9_dist": 10.021, "C6C8_dist": 11.220, "CNNC_torsion": -12.429, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.46]", "interBase_angle": 16.434, "planarity": 0.203, "simple_Shear": -0.245, "simple_Stretch": 1.274, "simple_Buckle": 4.558, "simple_Propeller": -15.789, "bp_simpleParams": [ -0.245, 1.274, -0.043, 4.558, -15.789, 14.221 ], "bp_params": [ -0.288, 1.265, -0.043, 5.067, -15.633, 14.340 ], "frame": { "rmsd": null, "origin": [ -23.605, -46.514, -93.819 ], "x_axis": [ -0.031, -0.828, -0.560 ], "y_axis": [ -0.152, 0.558, -0.816 ], "z_axis": [ 0.988, 0.059, -0.143 ], "quaternion": [ 0.588, -0.372, 0.658, -0.287 ] } }, { "index": 35, "nt1": "///X/35", "nt2": "///Y/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.392, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.588, "chi2": -102.081, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.714, "C1C1_dist": 11.190, "N1N9_dist": 9.454, "C6C8_dist": 10.353, "CNNC_torsion": -17.474, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.36],N1(imino)-N3[3.34],N2(amino)-O2(carbonyl)[3.22]", "interBase_angle": 11.958, "planarity": 0.209, "simple_Shear": 0.555, "simple_Stretch": 0.312, "simple_Buckle": 8.461, "simple_Propeller": -8.450, "bp_simpleParams": [ 0.555, 0.312, 0.918, 8.461, -8.450, -1.746 ], "bp_params": [ 0.571, 0.280, 0.918, 7.974, -8.912, -1.747 ], "frame": { "rmsd": null, "origin": [ -20.601, -46.102, -95.553 ], "x_axis": [ -0.325, -0.260, -0.909 ], "y_axis": [ -0.084, 0.966, -0.246 ], "z_axis": [ 0.942, -0.004, -0.336 ], "quaternion": [ 0.571, -0.106, 0.810, -0.077 ] } }, { "index": 36, "nt1": "///X/36", "nt2": "///Y/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.147, "conf1": "anti", "pucker1": "----", "lambda1": 47.807, "chi2": -100.702, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.598, "C1C1_dist": 11.246, "N1N9_dist": 9.250, "C6C8_dist": 9.895, "CNNC_torsion": -15.757, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.77],N1-N3(imino)[3.16]", "interBase_angle": 20.642, "planarity": 0.256, "simple_Shear": -0.307, "simple_Stretch": 0.001, "simple_Buckle": 0.271, "simple_Propeller": -20.640, "bp_simpleParams": [ -0.307, 0.001, 0.099, 0.271, -20.640, -14.309 ], "bp_params": [ -0.307, -0.008, 0.099, 0.885, -20.623, -14.541 ], "frame": { "rmsd": null, "origin": [ -17.245, -46.981, -96.439 ], "x_axis": [ -0.397, 0.235, -0.887 ], "y_axis": [ 0.117, 0.972, 0.206 ], "z_axis": [ 0.910, -0.022, -0.414 ], "quaternion": [ 0.539, 0.106, 0.834, 0.055 ] } }, { "index": 37, "nt1": "///X/37", "nt2": "///Y/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.174, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.556, "chi2": -90.864, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.580, "C1C1_dist": 10.207, "N1N9_dist": 8.890, "C6C8_dist": 10.208, "CNNC_torsion": -4.491, "hbonds_num": 3, "hbonds_desc": "N1(imino)-N3[3.13],N2(amino)-O2(carbonyl)[2.41],N2(amino)-N3[2.76]", "interBase_angle": 11.478, "planarity": 0.145, "simple_Shear": 0.592, "simple_Stretch": 0.338, "simple_Buckle": -6.538, "simple_Propeller": -9.434, "bp_simpleParams": [ 0.592, 0.338, -0.408, -6.538, -9.434, 18.776 ], "bp_params": [ 0.614, 0.296, -0.408, -7.170, -8.963, 18.796 ], "frame": { "rmsd": null, "origin": [ -14.172, -46.239, -98.441 ], "x_axis": [ -0.302, 0.858, -0.416 ], "y_axis": [ 0.492, 0.514, 0.703 ], "z_axis": [ 0.817, 0.008, -0.577 ], "quaternion": [ 0.398, 0.436, 0.773, 0.230 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "AAT", "nts_long": "///X/15,///X/16,///Y/24", "planarity": 0.703 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 5, "strand1": "ACTGTGGGAAAGAAGTTTGGAAATTTCACACGAG", "strand2": "TGACACCCTTTCTTCAAACCCTCAAAGTGTGCTC", "bp_type": "|||||||||||||..|.|||.|.||||.||.|||", "helix_form": ".BB...BBB....x.......x.........BB", "helical_rise": 3.416, "helical_rise_std": 0.974, "helical_radius": 9.770, "helical_radius_std": 2.894, "helical_axis": [ 0.976, 0.198, -0.093 ], "point1": [ -124.181, -64.777, -80.051 ], "point2": [ -14.161, -42.496, -90.502 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///X/2", "nt2": "///Y/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.938, -0.212, -0.952, 14.255, -31.150, -19.925 ], "step_params": [ 1.148, -0.401, 3.278, -0.861, 6.660, 49.172 ], "heli_params": [ -0.965, -1.432, 3.182, 7.960, 1.029, 49.600 ], "bp2_params": [ 0.886, -0.197, -0.127, 4.093, -32.996, -10.611 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.278, "simple_Twist": 38.124, "simple_hRise": 3.141, "simple_hTwist": 38.689 }, { "index": 2, "nt1": "///X/3", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.886, -0.197, -0.127, 4.093, -32.996, -10.611 ], "step_params": [ 0.467, -0.086, 3.725, -2.581, 1.133, 39.437 ], "heli_params": [ -0.279, -1.034, 3.685, 1.676, 3.819, 39.534 ], "bp2_params": [ 0.175, -0.029, 1.295, -16.289, -22.626, 8.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.725, "simple_Twist": 42.441, "simple_hRise": 3.689, "simple_hTwist": 42.530 }, { "index": 3, "nt1": "///X/4", "nt2": "///Y/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.029, 1.295, -16.289, -22.626, 8.328 ], "step_params": [ -0.225, -0.149, 3.448, 8.237, 11.439, 30.456 ], "heli_params": [ -2.222, 1.804, 3.040, 20.456, -14.730, 33.490 ], "bp2_params": [ 0.841, -0.019, 0.790, -15.448, -17.496, -7.336 ], "groove_widths": [ 13.564, null, 15.163, null ], "simple_Rise": 3.448, "simple_Twist": 26.955, "simple_hRise": 2.955, "simple_hTwist": 30.358 }, { "index": 4, "nt1": "///X/5", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.841, -0.019, 0.790, -15.448, -17.496, -7.336 ], "step_params": [ 0.950, -1.005, 3.386, -4.718, -1.458, 28.749 ], "heli_params": [ -1.672, -2.937, 3.238, -2.908, 9.414, 29.161 ], "bp2_params": [ 1.150, 0.314, 1.329, -14.804, -5.252, 4.541 ], "groove_widths": [ 12.911, 12.398, 17.514, 17.227 ], "simple_Rise": 3.386, "simple_Twist": 27.930, "simple_hRise": 3.232, "simple_hTwist": 28.355 }, { "index": 5, "nt1": "///X/6", "nt2": "///Y/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.150, 0.314, 1.329, -14.804, -5.252, 4.541 ], "step_params": [ 0.897, 0.068, 2.814, 12.440, 10.599, 33.039 ], "heli_params": [ -1.216, 0.131, 2.852, 17.377, -20.395, 36.759 ], "bp2_params": [ -1.126, 0.543, -0.106, -6.577, -12.068, 13.735 ], "groove_widths": [ 12.530, 12.143, 19.341, 19.108 ], "simple_Rise": 2.814, "simple_Twist": 44.565, "simple_hRise": 2.897, "simple_hTwist": 47.324 }, { "index": 6, "nt1": "///X/7", "nt2": "///Y/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.126, 0.543, -0.106, -6.577, -12.068, 13.735 ], "step_params": [ -1.104, -0.300, 3.418, -5.197, 13.405, 34.450 ], "heli_params": [ -2.350, 0.999, 3.214, 21.510, 8.340, 37.245 ], "bp2_params": [ 0.827, -0.125, 0.014, -11.170, -19.527, -5.520 ], "groove_widths": [ 13.046, 12.947, 19.655, 19.543 ], "simple_Rise": 3.418, "simple_Twist": 24.070, "simple_hRise": 3.008, "simple_hTwist": 27.982 }, { "index": 7, "nt1": "///X/8", "nt2": "///Y/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.827, -0.125, 0.014, -11.170, -19.527, -5.520 ], "step_params": [ -0.295, -0.047, 3.538, -0.079, 5.951, 25.591 ], "heli_params": [ -1.837, 0.627, 3.439, 13.209, 0.176, 26.262 ], "bp2_params": [ -0.946, -0.149, -0.934, -17.331, -13.548, 2.143 ], "groove_widths": [ 12.874, 12.842, 19.769, 19.678 ], "simple_Rise": 3.538, "simple_Twist": 35.187, "simple_hRise": 3.484, "simple_hTwist": 35.671 }, { "index": 8, "nt1": "///X/9", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.946, -0.149, -0.934, -17.331, -13.548, 2.143 ], "step_params": [ -0.860, 0.658, 3.230, -9.896, -5.357, 32.796 ], "heli_params": [ 1.940, -0.096, 3.204, -9.159, 16.918, 34.622 ], "bp2_params": [ -0.741, -0.388, -0.265, -10.965, -30.690, -2.064 ], "groove_widths": [ 11.444, 11.422, 18.520, 18.313 ], "simple_Rise": 3.230, "simple_Twist": 31.345, "simple_hRise": 3.195, "simple_hTwist": 33.256 }, { "index": 9, "nt1": "///X/10", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.741, -0.388, -0.265, -10.965, -30.690, -2.064 ], "step_params": [ 0.174, 0.287, 2.870, -6.838, -1.940, 40.672 ], "heli_params": [ 0.590, -0.889, 2.790, -2.765, 9.748, 41.262 ], "bp2_params": [ 0.079, 0.800, 0.785, -3.421, -21.164, 6.936 ], "groove_widths": [ 10.561, 10.521, 16.530, 16.517 ], "simple_Rise": 2.870, "simple_Twist": 36.493, "simple_hRise": 2.775, "simple_hTwist": 37.156 }, { "index": 10, "nt1": "///X/11", "nt2": "///Y/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.079, 0.800, 0.785, -3.421, -21.164, 6.936 ], "step_params": [ -0.754, -1.048, 2.633, -5.662, -1.227, 41.997 ], "heli_params": [ -1.347, 0.568, 2.735, -1.702, 7.855, 42.377 ], "bp2_params": [ 0.541, -0.319, 1.142, 13.347, -36.357, -12.650 ], "groove_widths": [ 10.188, 10.096, 18.909, 18.893 ], "simple_Rise": 2.633, "simple_Twist": 41.019, "simple_hRise": 2.738, "simple_hTwist": 41.409 }, { "index": 11, "nt1": "///X/12", "nt2": "///Y/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.541, -0.319, 1.142, 13.347, -36.357, -12.650 ], "step_params": [ 1.080, -2.183, 3.178, -0.374, 5.324, 9.886 ], "heli_params": [ -17.461, -5.960, 1.730, 28.343, 1.989, 11.231 ], "bp2_params": [ -2.201, -0.535, 0.922, 8.298, -32.023, 7.452 ], "groove_widths": [ 10.464, 10.373, 20.352, 20.352 ], "simple_Rise": 3.178, "simple_Twist": 24.838, "simple_hRise": 2.643, "simple_hTwist": 25.396 }, { "index": 12, "nt1": "///X/13", "nt2": "///Y/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.201, -0.535, 0.922, 8.298, -32.023, 7.452 ], "step_params": [ -0.739, -0.132, 4.318, 5.490, -7.881, 43.541 ], "heli_params": [ 0.778, 1.638, 4.161, -10.473, -7.296, 44.538 ], "bp2_params": [ -0.355, -0.465, 0.068, -11.410, -22.868, -7.312 ], "groove_widths": [ 13.743, 12.467, 21.409, 20.599 ], "simple_Rise": 4.318, "simple_Twist": 31.924, "simple_hRise": 4.056, "simple_hTwist": 33.302 }, { "index": 13, "nt1": "///X/14", "nt2": "///Y/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.355, -0.465, 0.068, -11.410, -22.868, -7.312 ], "step_params": [ 1.716, 2.436, 3.172, 8.901, 8.348, 40.631 ], "heli_params": [ 2.436, -1.378, 3.854, 11.707, -12.483, 42.349 ], "bp2_params": [ -0.689, 1.377, -0.753, -3.440, -22.974, 30.418 ], "groove_widths": [ 16.015, 13.095, 18.200, 18.198 ], "simple_Rise": 3.172, "simple_Twist": 42.594, "simple_hRise": 3.828, "simple_hTwist": 44.229 }, { "index": 14, "nt1": "///X/15", "nt2": "///Y/24", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.689, 1.377, -0.753, -3.440, -22.974, 30.418 ], "step_params": [ 0.850, 2.940, 4.709, 17.906, 12.149, 62.787 ], "heli_params": [ 1.931, 0.350, 5.194, 11.312, -16.672, 66.049 ], "bp2_params": [ 0.357, 3.037, 0.403, 6.831, -19.544, 71.439 ], "groove_widths": [ 14.426, 11.379, 18.189, 18.160 ], "simple_Rise": 4.709, "simple_Twist": 57.187, "simple_hRise": 5.219, "simple_hTwist": 60.819 }, { "index": 15, "nt1": "///X/17", "nt2": "///Y/22", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, 3.037, 0.403, 6.831, -19.544, 71.439 ], "step_params": [ -2.546, 0.158, 3.486, -10.061, 16.822, 18.837 ], "heli_params": [ -5.029, 2.219, 3.466, 39.949, 23.892, 27.121 ], "bp2_params": [ -2.142, 0.169, 0.862, -3.148, -22.081, -2.527 ], "groove_widths": [ 12.954, 10.211, 18.457, 17.986 ], "simple_Rise": 3.486, "simple_Twist": 32.048, "simple_hRise": 3.734, "simple_hTwist": 37.432 }, { "index": 16, "nt1": "///X/18", "nt2": "///Y/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.142, 0.169, 0.862, -3.148, -22.081, -2.527 ], "step_params": [ 2.041, 1.200, 4.116, -9.255, -6.325, 59.706 ], "heli_params": [ 1.555, -2.558, 3.662, -6.293, 9.208, 60.654 ], "bp2_params": [ 4.150, -1.149, 1.704, -0.520, -1.009, 18.350 ], "groove_widths": [ 11.737, 10.229, 18.204, 18.203 ], "simple_Rise": 4.116, "simple_Twist": 23.412, "simple_hRise": 2.716, "simple_hTwist": 25.923 }, { "index": 17, "nt1": "///X/19", "nt2": "///Y/20", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 4.150, -1.149, 1.704, -0.520, -1.009, 18.350 ], "step_params": [ -0.610, 0.124, 3.179, 16.844, -12.621, 31.844 ], "heli_params": [ 1.686, 2.933, 2.373, -20.450, -27.294, 38.020 ], "bp2_params": [ 2.221, 0.294, 0.339, 13.457, -35.297, 13.505 ], "groove_widths": [ 10.230, 9.972, 19.045, 19.001 ], "simple_Rise": 3.179, "simple_Twist": 45.890, "simple_hRise": 2.696, "simple_hTwist": 50.248 }, { "index": 18, "nt1": "///X/20", "nt2": "///Y/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.221, 0.294, 0.339, 13.457, -35.297, 13.505 ], "step_params": [ -0.769, -0.421, 3.489, 4.483, 31.067, 17.274 ], "heli_params": [ -5.161, 1.899, 1.250, 61.243, -8.837, 35.723 ], "bp2_params": [ -1.365, -0.829, -1.450, -20.100, -10.592, -5.513 ], "groove_widths": [ 10.251, 10.138, 18.437, 18.437 ], "simple_Rise": 3.489, "simple_Twist": 35.762, "simple_hRise": 2.336, "simple_hTwist": 47.242 }, { "index": 19, "nt1": "///X/21", "nt2": "///Y/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.365, -0.829, -1.450, -20.100, -10.592, -5.513 ], "step_params": [ 0.730, 1.064, 2.889, -8.242, -2.973, 40.769 ], "heli_params": [ 1.763, -1.767, 2.619, -4.209, 11.669, 41.660 ], "bp2_params": [ 2.683, 0.270, -0.256, 9.249, -20.422, 15.055 ], "groove_widths": [ 11.006, 10.966, 18.520, 18.459 ], "simple_Rise": 2.889, "simple_Twist": 19.643, "simple_hRise": 2.220, "simple_hTwist": 21.491 }, { "index": 20, "nt1": "///X/22", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.683, 0.270, -0.256, 9.249, -20.422, 15.055 ], "step_params": [ -1.320, 0.828, 3.404, -4.766, -2.791, 20.462 ], "heli_params": [ 3.493, 1.472, 3.474, -7.678, 13.110, 21.186 ], "bp2_params": [ -1.878, -0.529, -0.095, -11.034, -36.836, -0.973 ], "groove_widths": [ 12.695, 10.968, 18.026, 17.783 ], "simple_Rise": 3.404, "simple_Twist": 43.824, "simple_hRise": 3.465, "simple_hTwist": 44.154 }, { "index": 21, "nt1": "///X/23", "nt2": "///Y/16", "bp": "A-C", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.878, -0.529, -0.095, -11.034, -36.836, -0.973 ], "step_params": [ -1.189, -0.617, 4.226, 0.776, 13.124, 46.934 ], "heli_params": [ -2.028, 1.520, 3.912, 16.111, -0.953, 48.640 ], "bp2_params": [ 0.474, 0.316, -1.249, -23.777, -30.918, -15.917 ], "groove_widths": [ 14.324, 11.331, 19.261, 19.167 ], "simple_Rise": 4.226, "simple_Twist": 33.473, "simple_hRise": 3.706, "simple_hTwist": 35.894 }, { "index": 22, "nt1": "///X/24", "nt2": "///Y/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.474, 0.316, -1.249, -23.777, -30.918, -15.917 ], "step_params": [ 2.433, 0.794, 5.952, 5.124, 6.844, 41.712 ], "heli_params": [ -0.210, -2.377, 6.243, 9.492, -7.107, 42.540 ], "bp2_params": [ -3.983, -0.923, -1.068, -5.523, -18.777, 23.961 ], "groove_widths": [ 14.263, 11.573, 18.885, 18.538 ], "simple_Rise": 5.952, "simple_Twist": 70.309, "simple_hRise": 6.139, "simple_hTwist": 70.760 }, { "index": 23, "nt1": "///X/26", "nt2": "///Y/13", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.983, -0.923, -1.068, -5.523, -18.777, 23.961 ], "step_params": [ -0.953, 0.508, 3.735, -5.829, 4.422, 55.298 ], "heli_params": [ 0.247, 0.628, 3.836, 4.741, 6.249, 55.742 ], "bp2_params": [ -0.491, -0.144, -0.528, -15.488, -40.640, 5.373 ], "groove_widths": [ 13.644, 10.907, 19.734, 19.617 ], "simple_Rise": 3.735, "simple_Twist": 32.061, "simple_hRise": 3.877, "simple_hTwist": 32.864 }, { "index": 24, "nt1": "///X/27", "nt2": "///Y/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.491, -0.144, -0.528, -15.488, -40.640, 5.373 ], "step_params": [ 0.541, -0.586, 3.686, -9.381, -1.302, 32.565 ], "heli_params": [ -0.773, -2.603, 3.423, -2.263, 16.304, 33.879 ], "bp2_params": [ -1.376, 0.990, 1.441, -31.394, -24.853, 7.748 ], "groove_widths": [ 12.036, 10.551, 18.496, 18.160 ], "simple_Rise": 3.686, "simple_Twist": 36.961, "simple_hRise": 3.469, "simple_hTwist": 38.114 }, { "index": 25, "nt1": "///X/28", "nt2": "///Y/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.376, 0.990, 1.441, -31.394, -24.853, 7.748 ], "step_params": [ -0.965, -0.994, 3.015, 6.596, 7.534, 47.080 ], "heli_params": [ -1.742, 1.641, 2.685, 9.308, -8.149, 48.074 ], "bp2_params": [ 1.934, 0.067, 0.370, -21.283, -26.800, -24.928 ], "groove_widths": [ 10.946, 10.760, 16.982, 16.897 ], "simple_Rise": 3.015, "simple_Twist": 30.686, "simple_hRise": 2.454, "simple_hTwist": 32.241 }, { "index": 26, "nt1": "///X/29", "nt2": "///Y/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.934, 0.067, 0.370, -21.283, -26.800, -24.928 ], "step_params": [ 1.477, -0.452, 2.301, 9.033, -11.345, 31.169 ], "heli_params": [ 0.643, -1.383, 2.622, -19.824, -15.785, 34.301 ], "bp2_params": [ 0.556, 0.227, -0.254, 8.963, -28.638, -0.832 ], "groove_widths": [ 11.370, 11.271, 18.034, 17.845 ], "simple_Rise": 2.301, "simple_Twist": 39.279, "simple_hRise": 2.594, "simple_hTwist": 41.771 }, { "index": 27, "nt1": "///X/30", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.556, 0.227, -0.254, 8.963, -28.638, -0.832 ], "step_params": [ -1.718, 0.119, 3.603, -8.303, 13.100, 39.091 ], "heli_params": [ -1.423, 1.393, 3.730, 18.708, 11.857, 41.943 ], "bp2_params": [ 3.385, -0.024, 0.419, 12.938, -37.463, -23.830 ], "groove_widths": [ 12.628, 12.568, 19.949, 19.841 ], "simple_Rise": 3.603, "simple_Twist": 26.385, "simple_hRise": 3.631, "simple_hTwist": 30.536 }, { "index": 28, "nt1": "///X/31", "nt2": "///Y/8", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.385, -0.024, 0.419, 12.938, -37.463, -23.830 ], "step_params": [ 1.523, -1.182, 3.627, 9.245, 4.558, 28.518 ], "heli_params": [ -3.327, -0.758, 3.701, 8.894, -18.038, 30.288 ], "bp2_params": [ 1.808, -0.164, 1.259, 1.954, -47.451, 15.035 ], "groove_widths": [ 13.688, 13.658, 20.003, 19.783 ], "simple_Rise": 3.627, "simple_Twist": 33.788, "simple_hRise": 3.717, "simple_hTwist": 35.282 }, { "index": 29, "nt1": "///X/32", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.808, -0.164, 1.259, 1.954, -47.451, 15.035 ], "step_params": [ -0.552, 0.338, 3.354, -14.248, -4.804, 29.637 ], "heli_params": [ 1.449, -1.573, 3.191, -8.721, 25.864, 33.157 ], "bp2_params": [ 0.700, -0.225, 1.597, 4.975, -10.032, -0.283 ], "groove_widths": [ 13.173, 12.956, 18.537, 18.384 ], "simple_Rise": 3.354, "simple_Twist": 35.540, "simple_hRise": 3.263, "simple_hTwist": 38.495 }, { "index": 30, "nt1": "///X/33", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.700, -0.225, 1.597, 4.975, -10.032, -0.283 ], "step_params": [ -0.100, -0.507, 3.270, 13.167, 0.030, 28.183 ], "heli_params": [ -0.953, 2.708, 2.932, 0.058, -25.362, 31.051 ], "bp2_params": [ -0.288, 1.265, -0.043, 5.067, -15.633, 14.340 ], "groove_widths": [ 12.897, 12.435, 16.947, 16.865 ], "simple_Rise": 3.270, "simple_Twist": 34.049, "simple_hRise": 3.027, "simple_hTwist": 36.435 }, { "index": 31, "nt1": "///X/34", "nt2": "///Y/5", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.288, 1.265, -0.043, 5.067, -15.633, 14.340 ], "step_params": [ 0.594, 0.819, 3.343, -3.670, 11.359, 41.251 ], "heli_params": [ -0.067, -1.196, 3.381, 15.730, 5.082, 42.871 ], "bp2_params": [ 0.571, 0.280, 0.918, 7.974, -8.912, -1.747 ], "groove_widths": [ 13.620, null, 16.599, null ], "simple_Rise": 3.343, "simple_Twist": 36.334, "simple_hRise": 3.367, "simple_hTwist": 38.182 }, { "index": 32, "nt1": "///X/35", "nt2": "///Y/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, 0.280, 0.918, 7.974, -8.912, -1.747 ], "step_params": [ -0.426, -0.840, 3.454, 0.956, 4.839, 28.634 ], "heli_params": [ -2.774, 1.067, 3.255, 9.694, -1.914, 29.047 ], "bp2_params": [ -0.307, -0.008, 0.099, 0.885, -20.623, -14.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.454, "simple_Twist": 33.320, "simple_hRise": 3.290, "simple_hTwist": 33.673 }, { "index": 33, "nt1": "///X/36", "nt2": "///Y/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.307, -0.008, 0.099, 0.885, -20.623, -14.541 ], "step_params": [ 0.622, 0.495, 3.657, 5.063, 9.711, 45.381 ], "heli_params": [ -0.307, -0.300, 3.727, 12.375, -6.451, 46.616 ], "bp2_params": [ 0.614, 0.296, -0.408, -7.170, -8.963, 18.796 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.657, "simple_Twist": 40.202, "simple_hRise": 3.722, "simple_hTwist": 41.607 }, { "index": 34, "nt1": "///X/37", "nt2": "///Y/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "ACTGTGGGAAAGA", "strand2": "TGACACCCTTTCT", "bp_type": "|||||||||||||", "helix_form": ".BB...BBB...", "helical_rise": 3.256, "helical_rise_std": 0.505, "helical_radius": 9.667, "helical_radius_std": 0.701, "helical_axis": [ 0.987, 0.108, 0.123 ], "point1": [ -124.984, -61.930, -84.204 ], "point2": [ -86.517, -57.714, -79.408 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///X/2", "nt2": "///Y/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.938, -0.212, -0.952, 14.255, -31.150, -19.925 ], "step_params": [ 1.148, -0.401, 3.278, -0.861, 6.660, 49.172 ], "heli_params": [ -0.965, -1.432, 3.182, 7.960, 1.029, 49.600 ], "bp2_params": [ 0.886, -0.197, -0.127, 4.093, -32.996, -10.611 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.278, "simple_Twist": 38.124, "simple_hRise": 3.141, "simple_hTwist": 38.689 }, { "index": 2, "nt1": "///X/3", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.886, -0.197, -0.127, 4.093, -32.996, -10.611 ], "step_params": [ 0.467, -0.086, 3.725, -2.581, 1.133, 39.437 ], "heli_params": [ -0.279, -1.034, 3.685, 1.676, 3.819, 39.534 ], "bp2_params": [ 0.175, -0.029, 1.295, -16.289, -22.626, 8.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.725, "simple_Twist": 42.441, "simple_hRise": 3.689, "simple_hTwist": 42.530 }, { "index": 3, "nt1": "///X/4", "nt2": "///Y/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.029, 1.295, -16.289, -22.626, 8.328 ], "step_params": [ -0.225, -0.149, 3.448, 8.237, 11.439, 30.456 ], "heli_params": [ -2.222, 1.804, 3.040, 20.456, -14.730, 33.490 ], "bp2_params": [ 0.841, -0.019, 0.790, -15.448, -17.496, -7.336 ], "groove_widths": [ 13.564, null, 15.163, null ], "simple_Rise": 3.448, "simple_Twist": 26.955, "simple_hRise": 2.955, "simple_hTwist": 30.358 }, { "index": 4, "nt1": "///X/5", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.841, -0.019, 0.790, -15.448, -17.496, -7.336 ], "step_params": [ 0.950, -1.005, 3.386, -4.718, -1.458, 28.749 ], "heli_params": [ -1.672, -2.937, 3.238, -2.908, 9.414, 29.161 ], "bp2_params": [ 1.150, 0.314, 1.329, -14.804, -5.252, 4.541 ], "groove_widths": [ 12.911, 12.398, 17.514, 17.227 ], "simple_Rise": 3.386, "simple_Twist": 27.930, "simple_hRise": 3.232, "simple_hTwist": 28.355 }, { "index": 5, "nt1": "///X/6", "nt2": "///Y/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.150, 0.314, 1.329, -14.804, -5.252, 4.541 ], "step_params": [ 0.897, 0.068, 2.814, 12.440, 10.599, 33.039 ], "heli_params": [ -1.216, 0.131, 2.852, 17.377, -20.395, 36.759 ], "bp2_params": [ -1.126, 0.543, -0.106, -6.577, -12.068, 13.735 ], "groove_widths": [ 12.530, 12.143, 19.341, 19.108 ], "simple_Rise": 2.814, "simple_Twist": 44.565, "simple_hRise": 2.897, "simple_hTwist": 47.324 }, { "index": 6, "nt1": "///X/7", "nt2": "///Y/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.126, 0.543, -0.106, -6.577, -12.068, 13.735 ], "step_params": [ -1.104, -0.300, 3.418, -5.197, 13.405, 34.450 ], "heli_params": [ -2.350, 0.999, 3.214, 21.510, 8.340, 37.245 ], "bp2_params": [ 0.827, -0.125, 0.014, -11.170, -19.527, -5.520 ], "groove_widths": [ 13.046, 12.947, 19.655, 19.543 ], "simple_Rise": 3.418, "simple_Twist": 24.070, "simple_hRise": 3.008, "simple_hTwist": 27.982 }, { "index": 7, "nt1": "///X/8", "nt2": "///Y/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.827, -0.125, 0.014, -11.170, -19.527, -5.520 ], "step_params": [ -0.295, -0.047, 3.538, -0.079, 5.951, 25.591 ], "heli_params": [ -1.837, 0.627, 3.439, 13.209, 0.176, 26.262 ], "bp2_params": [ -0.946, -0.149, -0.934, -17.331, -13.548, 2.143 ], "groove_widths": [ 12.874, 12.842, 19.769, 19.678 ], "simple_Rise": 3.538, "simple_Twist": 35.187, "simple_hRise": 3.484, "simple_hTwist": 35.671 }, { "index": 8, "nt1": "///X/9", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.946, -0.149, -0.934, -17.331, -13.548, 2.143 ], "step_params": [ -0.860, 0.658, 3.230, -9.896, -5.357, 32.796 ], "heli_params": [ 1.940, -0.096, 3.204, -9.159, 16.918, 34.622 ], "bp2_params": [ -0.741, -0.388, -0.265, -10.965, -30.690, -2.064 ], "groove_widths": [ 11.444, 11.422, 18.520, 18.313 ], "simple_Rise": 3.230, "simple_Twist": 31.345, "simple_hRise": 3.195, "simple_hTwist": 33.256 }, { "index": 9, "nt1": "///X/10", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.741, -0.388, -0.265, -10.965, -30.690, -2.064 ], "step_params": [ 0.174, 0.287, 2.870, -6.838, -1.940, 40.672 ], "heli_params": [ 0.590, -0.889, 2.790, -2.765, 9.748, 41.262 ], "bp2_params": [ 0.079, 0.800, 0.785, -3.421, -21.164, 6.936 ], "groove_widths": [ 10.561, 10.521, 16.530, 16.517 ], "simple_Rise": 2.870, "simple_Twist": 36.493, "simple_hRise": 2.775, "simple_hTwist": 37.156 }, { "index": 10, "nt1": "///X/11", "nt2": "///Y/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.079, 0.800, 0.785, -3.421, -21.164, 6.936 ], "step_params": [ -0.754, -1.048, 2.633, -5.662, -1.227, 41.997 ], "heli_params": [ -1.347, 0.568, 2.735, -1.702, 7.855, 42.377 ], "bp2_params": [ 0.541, -0.319, 1.142, 13.347, -36.357, -12.650 ], "groove_widths": [ 10.188, null, 18.909, null ], "simple_Rise": 2.633, "simple_Twist": 41.019, "simple_hRise": 2.738, "simple_hTwist": 41.409 }, { "index": 11, "nt1": "///X/12", "nt2": "///Y/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.541, -0.319, 1.142, 13.347, -36.357, -12.650 ], "step_params": [ 1.080, -2.183, 3.178, -0.374, 5.324, 9.886 ], "heli_params": [ -17.461, -5.960, 1.730, 28.343, 1.989, 11.231 ], "bp2_params": [ -2.201, -0.535, 0.922, 8.298, -32.023, 7.452 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.178, "simple_Twist": 24.838, "simple_hRise": 2.643, "simple_hTwist": 25.396 }, { "index": 12, "nt1": "///X/13", "nt2": "///Y/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.201, -0.535, 0.922, 8.298, -32.023, 7.452 ], "step_params": [ -0.739, -0.132, 4.318, 5.490, -7.881, 43.541 ], "heli_params": [ 0.778, 1.638, 4.161, -10.473, -7.296, 44.538 ], "bp2_params": [ -0.355, -0.465, 0.068, -11.410, -22.868, -7.312 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.318, "simple_Twist": 31.924, "simple_hRise": 4.056, "simple_hTwist": 33.302 }, { "index": 13, "nt1": "///X/14", "nt2": "///Y/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "TGG", "strand2": "ACC", "bp_type": "|||", "helix_form": "..", "helical_rise": 3.438, "helical_rise_std": 0.356, "helical_radius": 7.546, "helical_radius_std": 2.314, "helical_axis": [ 0.771, 0.614, 0.167 ], "point1": [ -66.813, -53.627, -85.486 ], "point2": [ -61.112, -49.091, -84.249 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///X/20", "nt2": "///Y/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.221, 0.294, 0.339, 13.457, -35.297, 13.505 ], "step_params": [ -0.769, -0.421, 3.489, 4.483, 31.067, 17.274 ], "heli_params": [ -5.161, 1.899, 1.250, 61.243, -8.837, 35.723 ], "bp2_params": [ -1.365, -0.829, -1.450, -20.100, -10.592, -5.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.489, "simple_Twist": 35.762, "simple_hRise": 2.336, "simple_hTwist": 47.242 }, { "index": 2, "nt1": "///X/21", "nt2": "///Y/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.365, -0.829, -1.450, -20.100, -10.592, -5.513 ], "step_params": [ 0.730, 1.064, 2.889, -8.242, -2.973, 40.769 ], "heli_params": [ 1.763, -1.767, 2.619, -4.209, 11.669, 41.660 ], "bp2_params": [ 2.683, 0.270, -0.256, 9.249, -20.422, 15.055 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.889, "simple_Twist": 19.643, "simple_hRise": 2.220, "simple_hTwist": 21.491 }, { "index": 3, "nt1": "///X/22", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "TTTC", "strand2": "AAAG", "bp_type": "||||", "helix_form": "...", "helical_rise": 3.263, "helical_rise_std": 0.368, "helical_radius": 9.750, "helical_radius_std": 1.075, "helical_axis": [ 0.968, 0.145, -0.206 ], "point1": [ -46.266, -49.222, -88.531 ], "point2": [ -36.793, -47.798, -90.551 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///X/27", "nt2": "///Y/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.491, -0.144, -0.528, -15.488, -40.640, 5.373 ], "step_params": [ 0.541, -0.586, 3.686, -9.381, -1.302, 32.565 ], "heli_params": [ -0.773, -2.603, 3.423, -2.263, 16.304, 33.879 ], "bp2_params": [ -1.376, 0.990, 1.441, -31.394, -24.853, 7.748 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.686, "simple_Twist": 36.961, "simple_hRise": 3.469, "simple_hTwist": 38.114 }, { "index": 2, "nt1": "///X/28", "nt2": "///Y/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.376, 0.990, 1.441, -31.394, -24.853, 7.748 ], "step_params": [ -0.965, -0.994, 3.015, 6.596, 7.534, 47.080 ], "heli_params": [ -1.742, 1.641, 2.685, 9.308, -8.149, 48.074 ], "bp2_params": [ 1.934, 0.067, 0.370, -21.283, -26.800, -24.928 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.015, "simple_Twist": 30.686, "simple_hRise": 2.454, "simple_hTwist": 32.241 }, { "index": 3, "nt1": "///X/29", "nt2": "///Y/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.934, 0.067, 0.370, -21.283, -26.800, -24.928 ], "step_params": [ 1.477, -0.452, 2.301, 9.033, -11.345, 31.169 ], "heli_params": [ 0.643, -1.383, 2.622, -19.824, -15.785, 34.301 ], "bp2_params": [ 0.556, 0.227, -0.254, 8.963, -28.638, -0.832 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.301, "simple_Twist": 39.279, "simple_hRise": 2.594, "simple_hTwist": 41.771 }, { "index": 4, "nt1": "///X/30", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "CA", "strand2": "GT", "bp_type": "||", "helix_form": ".", "helical_rise": 3.364, "helical_rise_std": 0.102, "helical_radius": 9.318, "helical_radius_std": 1.300, "helical_axis": [ 0.977, 0.182, -0.114 ], "point1": [ -29.940, -45.392, -91.475 ], "point2": [ -26.654, -44.781, -91.857 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///X/32", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.808, -0.164, 1.259, 1.954, -47.451, 15.035 ], "step_params": [ -0.552, 0.338, 3.354, -14.248, -4.804, 29.637 ], "heli_params": [ 1.449, -1.573, 3.191, -8.721, 25.864, 33.157 ], "bp2_params": [ 0.700, -0.225, 1.597, 4.975, -10.032, -0.283 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.354, "simple_Twist": 35.540, "simple_hRise": 3.263, "simple_hTwist": 38.495 }, { "index": 2, "nt1": "///X/33", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 1, "strand1": "GAG", "strand2": "CTC", "bp_type": "|||", "helix_form": "BB", "helical_rise": 2.753, "helical_rise_std": 0.242, "helical_radius": 9.908, "helical_radius_std": 0.948, "helical_axis": [ 0.919, 0.301, -0.253 ], "point1": [ -20.109, -46.965, -97.636 ], "point2": [ -15.232, -45.366, -98.979 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///X/35", "nt2": "///Y/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, 0.280, 0.918, 7.974, -8.912, -1.747 ], "step_params": [ -0.426, -0.840, 3.454, 0.956, 4.839, 28.634 ], "heli_params": [ -2.774, 1.067, 3.255, 9.694, -1.914, 29.047 ], "bp2_params": [ -0.307, -0.008, 0.099, 0.885, -20.623, -14.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.454, "simple_Twist": 33.320, "simple_hRise": 3.290, "simple_hTwist": 33.673 }, { "index": 2, "nt1": "///X/36", "nt2": "///Y/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.307, -0.008, 0.099, 0.885, -20.623, -14.541 ], "step_params": [ 0.622, 0.495, 3.657, 5.063, 9.711, 45.381 ], "heli_params": [ -0.307, -0.300, 3.727, 12.375, -6.451, 46.616 ], "bp2_params": [ 0.614, 0.296, -0.408, -7.170, -8.963, 18.796 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.657, "simple_Twist": 40.202, "simple_hRise": 3.722, "simple_hTwist": 41.607 }, { "index": 3, "nt1": "///X/37", "nt2": "///Y/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///X/24", "nt2": "///Y/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 5, "stem_indices": [ 1, 2, 3, 4, 5 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TA", "nts_long": "///X/1,///X/2" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///X/14,///X/15" }, { "index": 3, "num_nts": 3, "nts_short": "CAC", "nts_long": "///X/30,///X/31,///X/32" }, { "index": 4, "num_nts": 3, "nts_short": "ACG", "nts_long": "///X/33,///X/34,///X/35" }, { "index": 5, "num_nts": 3, "nts_short": "CGT", "nts_long": "///Y/4,///Y/5,///Y/6" }, { "index": 6, "num_nts": 3, "nts_short": "GTG", "nts_long": "///Y/7,///Y/8,///Y/9" }, { "index": 7, "num_nts": 5, "nts_short": "AGTTT", "nts_long": "///X/16,///X/17,///X/18,///X/19,///X/20" }, { "index": 8, "num_nts": 6, "nts_short": "GAAAAT", "nts_long": "///X/22,///X/23,///X/24,///X/25,///X/26,///X/27" }, { "index": 9, "num_nts": 6, "nts_short": "ACTTCC", "nts_long": "///Y/12,///Y/13,///Y/14,///Y/15,///Y/16,///Y/17" }, { "index": 10, "num_nts": 6, "nts_short": "AAACTT", "nts_long": "///Y/19,///Y/20,///Y/21,///Y/22,///Y/24,///Y/25" } ], "nonStack": { "num_nts": 1, "nts_short": "A", "nts_long": "///Y/1" }, "num_iloops": 5, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 2, -1 ], "summary": "[2] 1 1 [X.22 Y.17 X.24 Y.15] 3 1", "num_nts": 6, "nts_short": "GAATCC", "nts_long": "///X/22,///X/23,///X/24,///Y/15,///Y/16,///Y/17", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///X/23" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///Y/16" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 3, 4 ], "summary": "[2] 1 1 [X.30 Y.9 X.32 Y.7] 4 2", "num_nts": 6, "nts_short": "CACGTG", "nts_long": "///X/30,///X/31,///X/32,///Y/7,///Y/8,///Y/9", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///X/31" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///Y/8" } ] }, { "index": 3, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 4, 5 ], "summary": "[2] 1 1 [X.33 Y.6 X.35 Y.4] 2 3", "num_nts": 6, "nts_short": "ACGCGT", "nts_long": "///X/33,///X/34,///X/35,///Y/4,///Y/5,///Y/6", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///X/34" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///Y/5" } ] }, { "index": 4, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ -1, 3 ], "summary": "[2] 2 2 [X.24 Y.15 X.27 Y.12] 1 4", "num_nts": 8, "nts_short": "AAATACTT", "nts_long": "///X/24,///X/25,///X/26,///X/27,///Y/12,///Y/13,///Y/14,///Y/15", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///X/25,///X/26" }, { "index": 2, "num_nts": 2, "nts_short": "CT", "nts_long": "///Y/13,///Y/14" } ] }, { "index": 5, "type": "symmetric internal loop", "bridging_nts": [ 5, 5 ], "stem_indices": [ 1, 2 ], "summary": "[2] 5 5 [X.14 Y.25 X.20 Y.19] 13 3", "num_nts": 14, "nts_short": "AAAGTTTAAACTTT", "nts_long": "///X/14,///X/15,///X/16,///X/17,///X/18,///X/19,///X/20,///Y/19,///Y/20,///Y/21,///Y/22,///Y/23,///Y/24,///Y/25", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "AAGTT", "nts_long": "///X/15,///X/16,///X/17,///X/18,///X/19" }, { "index": 2, "num_nts": 5, "nts_short": "AACTT", "nts_long": "///Y/20,///Y/21,///Y/22,///Y/23,///Y/24" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "T", "nts_long": "///X/1" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///Y/1" } ], "num_Aminors": 1, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs A-T (--)", "desc_long": "///X/16 vs ///X/15,///Y/24", "A_nt1": { "desc": "///X/16 vs ///X/15", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///X/16 vs ///Y/24", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.67]" } } ], "dbn": { "all_chains": { "num_nts": 74, "num_chars": 75, "bseq": "TACTGTGGGAAAGAAAGTTTGGAAAATTTCACACGAG&ACTCGTGTGAAACTTCCCAAACTTTCTTTCCCACAGT", "sstr": ".(((((((((((((.....(((.(..((((.((.(((&.))).)).))))..).))).....)))))))))))))", "form": "..B....BBB...................B.BBB..-&.B.B.B....B....B.BAB.......BBBB..BBB-" }, "chain_X": { "num_nts": 37, "num_chars": 37, "bseq": "TACTGTGGGAAAGAAAGTTTGGAAAATTTCACACGAG", "sstr": ".(((((((((((((.....(((.(..((((.((.(((", "form": "..B....BBB...................B.BBB..-" }, "chain_Y": { "num_nts": 37, "num_chars": 37, "bseq": "ACTCGTGTGAAACTTCCCAAACTTTCTTTCCCACAGT", "sstr": ".))).)).))))..).))).....)))))))))))))", "form": ".B.B.B....B....B.BAB.......BBBB..BBB-" } }, "chains": { "chain_X": { "num_nts": 37, "bseq": "TACTGTGGGAAAGAAAGTTTGGAAAATTTCACACGAG", "sstr": ".(((((((((((((.....(((.(..((((.((.(((", "form": "..B....BBB...................B.BBB..-", "helical_rise": 3.254, "helical_rise_std": 0.749, "helical_axis": [ 0.988, 0.142, -0.053 ], "point1": [ -127.533, -61.262, -80.929 ], "point2": [ -11.331, -44.545, -87.165 ], "num_chars": 109, "suite": "T!!A!!C!!T!!G!!T!!G!!G!!G!!A!!A!!A!!G!!A4bA!!A!!G!!T!!T!!T!!G!!G!!A!!A!!A!!A!!T!!T1aT!!C!!A!!C!!A!!C!!G!!A!!G" }, "chain_Y": { "num_nts": 37, "bseq": "ACTCGTGTGAAACTTCCCAAACTTTCTTTCCCACAGT", "sstr": ".))).)).))))..).))).....)))))))))))))", "form": ".B.B.B....B....B.BAB.......BBBB..BBB-", "helical_rise": 2.950, "helical_rise_std": 1.461, "helical_axis": [ -0.862, -0.272, 0.428 ], "point1": [ -23.287, -41.118, -105.264 ], "point2": [ -115.222, -70.138, -59.577 ], "num_chars": 109, "suite": "A!!C!!T!!C!!G!!T!!G1eT!!G!!A!!A!!A!!C4aT!!T!!C!!C!!C!!A!!A!!A!!C!!T!!T!!T!!C!!T1bT!!T!!C!!C!!C!!A!!C!!A!!G!!T" } }, "num_nts": 74, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "X", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/1", "linked_nts": [ null, "///X/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": 69.260, "gamma": -4.411, "delta": 97.090, "epsilon": -98.065, "zeta": -139.641, "epsilon_zeta": 41.576, "bb_type": "--", "chi": -120.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.916, 8.417, -1.605 ], "P_xyz": [ 0.009, 8.731, 0.189 ], "form": ".", "ssZp": 1.565, "Dp": 3.798, "splay_angle": 28.649, "splay_distance": 5.165, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": null, "theta": -108.124, "eta_prime": null, "theta_prime": -103.332, "eta_base": null, "theta_base": -150.182, "v0": -3.180, "v1": -10.256, "v2": 18.802, "v3": -21.112, "v4": 15.453, "amplitude": 21.102, "phase_angle": 27.004, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ -127.606, -64.153, -85.708 ], "x_axis": [ 0.588, -0.642, -0.492 ], "y_axis": [ 0.156, 0.686, -0.710 ], "z_axis": [ 0.794, 0.341, 0.503 ], "quaternion": [ 0.833, -0.315, 0.386, -0.239 ] } }, { "index": 2, "index_chain": 2, "chain_name": "X", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/2", "linked_nts": [ "///X/1", "///X/3" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -10.586, "beta": 98.580, "gamma": 29.523, "delta": 140.999, "epsilon": -86.595, "zeta": 113.193, "epsilon_zeta": 160.212, "bb_type": "--", "chi": -45.374, "glyco_bond": "--", "C5prime_xyz": [ -5.484, 5.889, -1.864 ], "P_xyz": [ -4.121, 7.136, -3.804 ], "form": ".", "ssZp": 2.588, "Dp": 2.463, "splay_angle": 25.227, "splay_distance": 4.232, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 156.401, "theta": -176.960, "eta_prime": -162.546, "theta_prime": 161.434, "eta_base": 149.868, "theta_base": -118.530, "v0": -43.887, "v1": 56.320, "v2": -45.782, "v3": 23.733, "v4": 11.802, "amplitude": 54.025, "phase_angle": 147.932, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.019, "origin": [ -126.496, -59.863, -83.056 ], "x_axis": [ 0.312, -0.940, -0.139 ], "y_axis": [ 0.548, 0.298, -0.782 ], "z_axis": [ 0.776, 0.168, 0.608 ], "quaternion": [ 0.745, -0.319, 0.307, -0.500 ] } }, { "index": 3, "index_chain": 3, "chain_name": "X", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/3", "linked_nts": [ "///X/2", "///X/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -13.627, "beta": 108.044, "gamma": 19.037, "delta": 131.056, "epsilon": -179.245, "zeta": -111.468, "epsilon_zeta": -67.777, "bb_type": "BI", "chi": -100.485, "glyco_bond": "anti", "C5prime_xyz": [ -3.243, 8.229, -2.244 ], "P_xyz": [ -0.941, 9.664, -2.050 ], "form": "B", "ssZp": 2.619, "Dp": 2.642, "splay_angle": 27.323, "splay_distance": 4.444, "splay_ratio": 0.236, "d22": 4.802, "d64": 4.086, "eta": 173.913, "theta": -147.480, "eta_prime": -167.372, "theta_prime": -165.863, "eta_base": -93.842, "theta_base": -113.264, "v0": -40.782, "v1": 49.442, "v2": -39.339, "v3": 16.257, "v4": 15.403, "amplitude": 48.896, "phase_angle": 143.567, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ -122.653, -61.631, -82.949 ], "x_axis": [ 0.532, -0.347, -0.772 ], "y_axis": [ 0.233, 0.937, -0.261 ], "z_axis": [ 0.814, -0.041, 0.579 ], "quaternion": [ 0.873, -0.063, 0.454, -0.166 ] } }, { "index": 4, "index_chain": 4, "chain_name": "X", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/4", "linked_nts": [ "///X/3", "///X/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -86.968, "beta": -179.277, "gamma": 63.953, "delta": 87.962, "epsilon": -159.483, "zeta": -76.026, "epsilon_zeta": -83.457, "bb_type": "BI", "chi": -136.854, "glyco_bond": "anti", "C5prime_xyz": [ -1.399, 8.712, -0.965 ], "P_xyz": [ 1.124, 9.292, -1.360 ], "form": ".", "ssZp": 3.252, "Dp": 4.161, "splay_angle": 17.983, "splay_distance": 3.161, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 173.459, "theta": -129.555, "eta_prime": 175.165, "theta_prime": -138.393, "eta_base": -123.644, "theta_base": -119.518, "v0": -1.241, "v1": -20.396, "v2": 33.517, "v3": -34.562, "v4": 22.576, "amplitude": 35.717, "phase_angle": 20.214, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ -118.391, -61.677, -81.691 ], "x_axis": [ 0.453, 0.492, -0.743 ], "y_axis": [ -0.268, 0.870, 0.413 ], "z_axis": [ 0.850, 0.012, 0.526 ], "quaternion": [ 0.844, 0.119, 0.472, 0.225 ] } }, { "index": 5, "index_chain": 5, "chain_name": "X", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/5", "linked_nts": [ "///X/4", "///X/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 113.235, "beta": -169.535, "gamma": -133.963, "delta": 145.377, "epsilon": 174.212, "zeta": -50.172, "epsilon_zeta": -135.616, "bb_type": "BI", "chi": -130.074, "glyco_bond": "anti", "C5prime_xyz": [ -1.048, 8.322, -0.578 ], "P_xyz": [ -0.136, 9.952, -2.402 ], "form": ".", "ssZp": 2.398, "Dp": 2.256, "splay_angle": 20.987, "splay_distance": 3.848, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -153.945, "theta": -165.670, "eta_prime": -146.488, "theta_prime": -158.596, "eta_base": -120.984, "theta_base": -112.446, "v0": 3.761, "v1": 14.269, "v2": -25.183, "v3": 27.896, "v4": -20.592, "amplitude": 28.044, "phase_angle": 206.107, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -115.255, -61.674, -81.296 ], "x_axis": [ 0.209, 0.788, -0.579 ], "y_axis": [ -0.172, 0.613, 0.772 ], "z_axis": [ 0.963, -0.062, 0.263 ], "quaternion": [ 0.722, 0.289, 0.534, 0.332 ] } }, { "index": 6, "index_chain": 6, "chain_name": "X", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/6", "linked_nts": [ "///X/5", "///X/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -124.234, "beta": 162.163, "gamma": 102.828, "delta": 79.436, "epsilon": 170.931, "zeta": -95.661, "epsilon_zeta": -93.408, "bb_type": "BI", "chi": -163.301, "glyco_bond": "anti", "C5prime_xyz": [ -2.800, 8.988, -0.074 ], "P_xyz": [ -0.941, 10.596, -0.815 ], "form": ".", "ssZp": 3.015, "Dp": 3.151, "splay_angle": 12.980, "splay_distance": 2.133, "splay_ratio": 0.113, "d22": null, "d64": null, "eta": 167.138, "theta": -166.600, "eta_prime": -166.417, "theta_prime": -163.135, "eta_base": -111.229, "theta_base": -127.173, "v0": -35.404, "v1": 9.679, "v2": 17.612, "v3": -38.418, "v4": 46.498, "amplitude": 45.764, "phase_angle": 67.366, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -111.514, -60.899, -81.749 ], "x_axis": [ 0.054, 0.998, -0.038 ], "y_axis": [ -0.282, 0.052, 0.958 ], "z_axis": [ 0.958, -0.041, 0.284 ], "quaternion": [ 0.590, 0.424, 0.422, 0.543 ] } }, { "index": 7, "index_chain": 7, "chain_name": "X", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/7", "linked_nts": [ "///X/6", "///X/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 177.661, "beta": -109.083, "gamma": 123.192, "delta": 84.447, "epsilon": 113.030, "zeta": -52.044, "epsilon_zeta": -194.926, "bb_type": "--", "chi": -134.131, "glyco_bond": "anti", "C5prime_xyz": [ -2.583, 8.866, -1.503 ], "P_xyz": [ -0.037, 9.130, -2.169 ], "form": ".", "ssZp": 2.117, "Dp": 2.186, "splay_angle": 20.443, "splay_distance": 3.532, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 152.810, "theta": -136.398, "eta_prime": -168.864, "theta_prime": -156.589, "eta_base": -128.600, "theta_base": -125.355, "v0": -41.955, "v1": 20.799, "v2": 5.878, "v3": -29.739, "v4": 45.716, "amplitude": 45.290, "phase_angle": 82.543, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ -109.391, -60.946, -81.549 ], "x_axis": [ -0.069, 0.827, 0.557 ], "y_axis": [ 0.070, -0.553, 0.830 ], "z_axis": [ 0.995, 0.096, -0.019 ], "quaternion": [ 0.299, 0.613, 0.366, 0.633 ] } }, { "index": 8, "index_chain": 8, "chain_name": "X", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/8", "linked_nts": [ "///X/7", "///X/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -175.257, "beta": -79.841, "gamma": 61.461, "delta": 85.755, "epsilon": 91.885, "zeta": -54.465, "epsilon_zeta": -213.650, "bb_type": "--", "chi": -109.824, "glyco_bond": "anti", "C5prime_xyz": [ -3.396, 8.272, -2.098 ], "P_xyz": [ -1.362, 9.920, -1.369 ], "form": "B", "ssZp": 1.986, "Dp": 1.976, "splay_angle": 19.685, "splay_distance": 3.278, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 166.390, "theta": -164.338, "eta_prime": -169.912, "theta_prime": -168.798, "eta_base": -132.522, "theta_base": -136.934, "v0": -36.252, "v1": 20.511, "v2": 1.806, "v3": -22.659, "v4": 36.743, "amplitude": 37.787, "phase_angle": 87.261, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -106.089, -59.735, -81.877 ], "x_axis": [ -0.163, 0.484, 0.860 ], "y_axis": [ 0.082, -0.862, 0.501 ], "z_axis": [ 0.983, 0.152, 0.101 ], "quaternion": [ 0.138, 0.632, 0.224, 0.729 ] } }, { "index": 9, "index_chain": 9, "chain_name": "X", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/9", "linked_nts": [ "///X/8", "///X/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 101.664, "beta": 110.752, "gamma": -64.082, "delta": 173.170, "epsilon": -179.254, "zeta": -162.724, "epsilon_zeta": -16.529, "bb_type": "--", "chi": -89.028, "glyco_bond": "anti", "C5prime_xyz": [ -1.344, 7.331, -2.152 ], "P_xyz": [ -0.001, 9.537, -1.551 ], "form": "B", "ssZp": 1.005, "Dp": 1.020, "splay_angle": 21.681, "splay_distance": 3.616, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -175.187, "theta": -159.277, "eta_prime": -158.268, "theta_prime": -167.158, "eta_base": -128.588, "theta_base": -121.669, "v0": 5.157, "v1": 24.636, "v2": -43.194, "v3": 47.280, "v4": -33.022, "amplitude": 47.500, "phase_angle": 204.586, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -102.934, -58.903, -82.191 ], "x_axis": [ -0.191, -0.029, 0.981 ], "y_axis": [ 0.186, -0.982, 0.007 ], "z_axis": [ 0.964, 0.184, 0.193 ], "quaternion": [ -0.070, 0.632, 0.062, 0.769 ] } }, { "index": 10, "index_chain": 10, "chain_name": "X", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/10", "linked_nts": [ "///X/9", "///X/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 22.508, "beta": 109.146, "gamma": 13.429, "delta": 141.465, "epsilon": -157.125, "zeta": -155.642, "epsilon_zeta": -1.484, "bb_type": "--", "chi": -100.970, "glyco_bond": "anti", "C5prime_xyz": [ -3.214, 8.196, -2.047 ], "P_xyz": [ -0.981, 9.521, -1.496 ], "form": "B", "ssZp": 2.406, "Dp": 2.398, "splay_angle": 21.695, "splay_distance": 3.480, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.172, "theta": -153.416, "eta_prime": -168.952, "theta_prime": -163.619, "eta_base": -120.862, "theta_base": -105.800, "v0": -36.810, "v1": 46.947, "v2": -39.646, "v3": 19.508, "v4": 10.714, "amplitude": 46.531, "phase_angle": 148.435, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ -99.433, -58.013, -82.028 ], "x_axis": [ 0.214, -0.460, 0.862 ], "y_axis": [ 0.169, -0.852, -0.496 ], "z_axis": [ 0.962, 0.252, -0.105 ], "quaternion": [ -0.254, 0.737, -0.099, 0.619 ] } }, { "index": 11, "index_chain": 11, "chain_name": "X", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/11", "linked_nts": [ "///X/10", "///X/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -36.552, "beta": 138.391, "gamma": 52.152, "delta": 133.923, "epsilon": 140.820, "zeta": -80.804, "epsilon_zeta": -138.376, "bb_type": "BI", "chi": -112.486, "glyco_bond": "anti", "C5prime_xyz": [ -2.439, 8.488, -1.657 ], "P_xyz": [ 0.195, 8.950, -1.700 ], "form": ".", "ssZp": 1.983, "Dp": 2.256, "splay_angle": 18.639, "splay_distance": 3.200, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 151.470, "theta": -120.170, "eta_prime": -158.447, "theta_prime": -160.027, "eta_base": -96.542, "theta_base": -132.685, "v0": -27.251, "v1": 37.712, "v2": -33.368, "v3": 18.669, "v4": 5.170, "amplitude": 37.324, "phase_angle": 153.384, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.015, "origin": [ -95.963, -58.249, -81.918 ], "x_axis": [ 0.310, -0.917, 0.252 ], "y_axis": [ 0.055, -0.248, -0.967 ], "z_axis": [ 0.949, 0.313, -0.027 ], "quaternion": [ 0.509, -0.629, 0.342, -0.477 ] } }, { "index": 12, "index_chain": 12, "chain_name": "X", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/12", "linked_nts": [ "///X/11", "///X/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -115.979, "beta": -119.773, "gamma": 70.255, "delta": 129.387, "epsilon": 163.466, "zeta": -82.072, "epsilon_zeta": -114.462, "bb_type": "BI", "chi": -90.841, "glyco_bond": "anti", "C5prime_xyz": [ -3.093, 7.756, -2.605 ], "P_xyz": [ -1.018, 9.443, -2.428 ], "form": ".", "ssZp": 2.078, "Dp": 2.130, "splay_angle": 18.712, "splay_distance": 3.906, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 169.128, "theta": -134.537, "eta_prime": -172.386, "theta_prime": -156.399, "eta_base": -137.395, "theta_base": -132.216, "v0": -32.645, "v1": 40.826, "v2": -33.983, "v3": 16.112, "v4": 10.093, "amplitude": 40.437, "phase_angle": 147.181, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ -93.307, -57.237, -80.446 ], "x_axis": [ 0.445, -0.851, -0.280 ], "y_axis": [ 0.053, 0.337, -0.940 ], "z_axis": [ 0.894, 0.403, 0.195 ], "quaternion": [ 0.703, -0.478, 0.418, -0.321 ] } }, { "index": 13, "index_chain": 13, "chain_name": "X", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/13", "linked_nts": [ "///X/12", "///X/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.204, "beta": -178.072, "gamma": 63.679, "delta": 117.250, "epsilon": -153.709, "zeta": -152.801, "epsilon_zeta": -0.908, "bb_type": "--", "chi": -128.508, "glyco_bond": "anti", "C5prime_xyz": [ -3.801, 8.330, -1.598 ], "P_xyz": [ -2.743, 10.758, -1.728 ], "form": ".", "ssZp": 2.014, "Dp": 2.430, "splay_angle": 21.896, "splay_distance": 3.860, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -169.191, "theta": -164.234, "eta_prime": -157.986, "theta_prime": -159.287, "eta_base": -131.731, "theta_base": -116.125, "v0": -55.821, "v1": 52.811, "v2": -29.983, "v3": -0.631, "v4": 34.299, "amplitude": 55.451, "phase_angle": 122.732, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -89.966, -57.740, -78.486 ], "x_axis": [ 0.303, -0.741, -0.599 ], "y_axis": [ -0.078, 0.607, -0.791 ], "z_axis": [ 0.950, 0.287, 0.126 ], "quaternion": [ 0.714, -0.377, 0.543, -0.232 ] } }, { "index": 14, "index_chain": 14, "chain_name": "X", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/14", "linked_nts": [ "///X/13", "///X/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 18.330, "beta": 114.473, "gamma": -1.167, "delta": 138.228, "epsilon": -126.071, "zeta": -168.513, "epsilon_zeta": 42.442, "bb_type": "BII", "chi": -87.355, "glyco_bond": "anti", "C5prime_xyz": [ -4.008, 7.569, -2.263 ], "P_xyz": [ -2.488, 9.735, -2.153 ], "form": ".", "ssZp": 2.092, "Dp": 2.071, "splay_angle": 27.705, "splay_distance": 4.462, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 173.037, "theta": -168.984, "eta_prime": -166.218, "theta_prime": -164.163, "eta_base": -120.114, "theta_base": -90.769, "v0": -42.619, "v1": 52.153, "v2": -41.570, "v3": 18.927, "v4": 14.250, "amplitude": 50.843, "phase_angle": 144.846, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.018, "origin": [ -86.115, -58.001, -78.387 ], "x_axis": [ 0.303, -0.240, -0.922 ], "y_axis": [ -0.157, 0.942, -0.297 ], "z_axis": [ 0.940, 0.235, 0.247 ], "quaternion": [ 0.789, -0.168, 0.590, -0.026 ] } }, { "index": 15, "index_chain": 15, "chain_name": "X", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/15", "linked_nts": [ "///X/14", "///X/16" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor", "alpha": -61.766, "beta": 144.916, "gamma": 58.829, "delta": 137.331, "epsilon": 105.377, "zeta": 179.702, "epsilon_zeta": -74.325, "bb_type": "--", "chi": -77.964, "glyco_bond": "--", "C5prime_xyz": [ -2.831, 7.274, -2.843 ], "P_xyz": [ -0.310, 7.083, -3.688 ], "form": ".", "ssZp": 1.761, "Dp": 1.801, "splay_angle": 33.151, "splay_distance": 4.881, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 134.969, "theta": -146.769, "eta_prime": -146.555, "theta_prime": 175.009, "eta_base": -84.694, "theta_base": 167.543, "v0": -17.809, "v1": 31.147, "v2": -32.073, "v3": 22.819, "v4": -3.367, "amplitude": 32.915, "phase_angle": 167.010, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.249, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ -83.376, -54.612, -79.347 ], "x_axis": [ 0.146, 0.671, -0.727 ], "y_axis": [ 0.003, 0.734, 0.679 ], "z_axis": [ 0.989, -0.101, 0.105 ], "quaternion": [ 0.704, 0.277, 0.609, 0.237 ] } }, { "index": 16, "index_chain": 16, "chain_name": "X", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/16", "linked_nts": [ "///X/15", "///X/17" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor", "alpha": 122.073, "beta": 66.918, "gamma": 42.025, "delta": 135.865, "epsilon": 130.960, "zeta": -86.074, "epsilon_zeta": -142.966, "bb_type": "--", "chi": -81.704, "glyco_bond": "--", "C5prime_xyz": [ -3.888, 7.455, -2.443 ], "P_xyz": [ -1.228, 7.937, -2.551 ], "form": ".", "ssZp": 2.617, "Dp": 2.609, "splay_angle": 46.147, "splay_distance": 6.637, "splay_ratio": 0.393, "d22": null, "d64": null, "eta": 144.606, "theta": -105.575, "eta_prime": 154.644, "theta_prime": -150.775, "eta_base": 155.600, "theta_base": -80.898, "v0": -34.468, "v1": 46.128, "v2": -39.391, "v3": 21.117, "v4": 7.900, "amplitude": 45.066, "phase_angle": 150.936, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.014, "origin": [ -80.803, -58.262, -77.375 ], "x_axis": [ -0.064, 0.674, -0.736 ], "y_axis": [ 0.115, 0.738, 0.665 ], "z_axis": [ 0.991, -0.042, -0.125 ], "quaternion": [ 0.622, 0.284, 0.694, 0.225 ] } }, { "index": 17, "index_chain": 17, "chain_name": "X", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/17", "linked_nts": [ "///X/16", "///X/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -127.042, "beta": -133.169, "gamma": 106.824, "delta": 83.217, "epsilon": -161.132, "zeta": -139.582, "epsilon_zeta": -21.550, "bb_type": "--", "chi": -114.820, "glyco_bond": "anti", "C5prime_xyz": [ -2.040, 8.460, -1.996 ], "P_xyz": [ 0.287, 8.120, -3.252 ], "form": ".", "ssZp": 2.344, "Dp": 4.333, "splay_angle": 32.336, "splay_distance": 5.545, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": -168.256, "theta": -166.282, "eta_prime": -161.886, "theta_prime": -164.926, "eta_base": -81.471, "theta_base": 173.165, "v0": -2.185, "v1": -20.876, "v2": 34.535, "v3": -36.102, "v4": 24.567, "amplitude": 37.131, "phase_angle": 21.551, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -77.057, -52.818, -77.994 ], "x_axis": [ 0.427, 0.783, 0.452 ], "y_axis": [ 0.307, -0.596, 0.742 ], "z_axis": [ 0.850, -0.178, -0.495 ], "quaternion": [ 0.290, 0.794, 0.343, 0.410 ] } }, { "index": 18, "index_chain": 18, "chain_name": "X", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/18", "linked_nts": [ "///X/17", "///X/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 25.167, "beta": 94.911, "gamma": 31.073, "delta": 128.381, "epsilon": 171.131, "zeta": -140.879, "epsilon_zeta": -47.990, "bb_type": "--", "chi": -103.556, "glyco_bond": "anti", "C5prime_xyz": [ -3.852, 8.211, -1.754 ], "P_xyz": [ -1.486, 9.402, -1.656 ], "form": ".", "ssZp": 2.965, "Dp": 2.962, "splay_angle": 43.814, "splay_distance": 6.801, "splay_ratio": 0.375, "d22": 4.181, "d64": 4.643, "eta": 157.262, "theta": -121.359, "eta_prime": -171.612, "theta_prime": -137.338, "eta_base": 174.968, "theta_base": -77.816, "v0": -44.008, "v1": 51.261, "v2": -37.544, "v3": 13.220, "v4": 18.980, "amplitude": 49.871, "phase_angle": 138.836, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ -73.924, -55.955, -81.324 ], "x_axis": [ 0.044, 0.938, 0.343 ], "y_axis": [ 0.275, -0.341, 0.899 ], "z_axis": [ 0.960, 0.055, -0.273 ], "quaternion": [ 0.328, 0.644, 0.471, 0.506 ] } }, { "index": 19, "index_chain": 19, "chain_name": "X", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/19", "linked_nts": [ "///X/18", "///X/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 45.896, "beta": 100.913, "gamma": 22.330, "delta": 121.675, "epsilon": -129.698, "zeta": 161.462, "epsilon_zeta": 68.841, "bb_type": "BII", "chi": -116.990, "glyco_bond": "anti", "C5prime_xyz": [ -2.806, 8.606, -1.690 ], "P_xyz": [ -0.369, 9.402, -1.000 ], "form": ".", "ssZp": 1.931, "Dp": 2.025, "splay_angle": 18.284, "splay_distance": 3.484, "splay_ratio": 0.187, "d22": 6.271, "d64": 5.331, "eta": -162.517, "theta": -175.693, "eta_prime": -138.534, "theta_prime": -175.434, "eta_base": -70.276, "theta_base": -143.736, "v0": -33.097, "v1": 33.423, "v2": -21.893, "v3": 3.336, "v4": 18.691, "amplitude": 34.453, "phase_angle": 129.453, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.116, "frame": { "rmsd": 0.015, "origin": [ -68.840, -53.220, -77.728 ], "x_axis": [ 0.224, -0.011, 0.974 ], "y_axis": [ 0.040, -0.999, -0.020 ], "z_axis": [ 0.974, 0.043, -0.224 ], "quaternion": [ -0.020, 0.782, 0.009, 0.623 ] } }, { "index": 20, "index_chain": 20, "chain_name": "X", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/20", "linked_nts": [ "///X/19", "///X/21" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -4.916, "beta": 102.705, "gamma": 29.972, "delta": 146.777, "epsilon": 167.215, "zeta": 171.670, "epsilon_zeta": -4.456, "bb_type": "--", "chi": -73.829, "glyco_bond": "--", "C5prime_xyz": [ -3.410, 7.469, -2.599 ], "P_xyz": [ -0.784, 7.755, -3.092 ], "form": ".", "ssZp": 2.600, "Dp": 2.782, "splay_angle": 23.231, "splay_distance": 3.691, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 154.471, "theta": -146.923, "eta_prime": -176.176, "theta_prime": -161.923, "eta_base": -139.985, "theta_base": -168.867, "v0": -31.627, "v1": 47.155, "v2": -42.918, "v3": 26.158, "v4": 3.170, "amplitude": 46.590, "phase_angle": 157.101, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ -66.560, -53.969, -80.253 ], "x_axis": [ 0.746, -0.290, 0.599 ], "y_axis": [ 0.167, -0.790, -0.591 ], "z_axis": [ 0.644, 0.541, -0.541 ], "quaternion": [ -0.322, 0.877, -0.035, 0.354 ] } }, { "index": 21, "index_chain": 21, "chain_name": "X", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/21", "linked_nts": [ "///X/20", "///X/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 48.803, "beta": 89.901, "gamma": 27.996, "delta": 134.651, "epsilon": -19.316, "zeta": 103.352, "epsilon_zeta": 237.332, "bb_type": "--", "chi": -105.997, "glyco_bond": "anti", "C5prime_xyz": [ -3.007, 8.296, -2.055 ], "P_xyz": [ -0.579, 9.118, -1.266 ], "form": ".", "ssZp": 0.118, "Dp": 1.388, "splay_angle": 28.335, "splay_distance": 4.752, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": -175.707, "theta": -107.432, "eta_prime": -151.696, "theta_prime": -136.339, "eta_base": -159.661, "theta_base": -63.197, "v0": -34.602, "v1": 43.341, "v2": -35.128, "v3": 16.208, "v4": 11.338, "amplitude": 42.399, "phase_angle": 145.946, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -64.978, -51.215, -82.133 ], "x_axis": [ 0.112, -0.665, 0.738 ], "y_axis": [ -0.007, -0.743, -0.669 ], "z_axis": [ 0.994, 0.070, -0.088 ], "quaternion": [ -0.265, 0.697, -0.241, 0.621 ] } }, { "index": 22, "index_chain": 22, "chain_name": "X", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/22", "linked_nts": [ "///X/21", "///X/23" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -13.797, "beta": 97.022, "gamma": -24.770, "delta": 121.905, "epsilon": -88.797, "zeta": 151.355, "epsilon_zeta": 119.849, "bb_type": "BII", "chi": -64.352, "glyco_bond": "--", "C5prime_xyz": [ -3.978, 6.456, -3.082 ], "P_xyz": [ -2.845, 8.802, -3.789 ], "form": ".", "ssZp": -0.268, "Dp": 1.060, "splay_angle": 28.479, "splay_distance": 5.013, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 179.980, "theta": 159.413, "eta_prime": -152.668, "theta_prime": 163.016, "eta_base": -82.670, "theta_base": -171.625, "v0": -27.122, "v1": 29.397, "v2": -21.026, "v3": 6.174, "v4": 12.981, "amplitude": 29.419, "phase_angle": 135.620, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -61.138, -53.992, -82.485 ], "x_axis": [ 0.295, -0.953, -0.059 ], "y_axis": [ -0.001, 0.062, -0.998 ], "z_axis": [ 0.955, 0.295, 0.017 ], "quaternion": [ 0.586, -0.552, 0.433, -0.406 ] } }, { "index": 23, "index_chain": 23, "chain_name": "X", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/23", "linked_nts": [ "///X/22", "///X/24" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -78.212, "beta": 121.319, "gamma": 45.583, "delta": 140.136, "epsilon": 137.211, "zeta": -106.272, "epsilon_zeta": -116.517, "bb_type": "--", "chi": -99.545, "glyco_bond": "anti", "C5prime_xyz": [ -3.700, 8.019, -1.883 ], "P_xyz": [ -1.331, 9.152, -2.339 ], "form": ".", "ssZp": 2.482, "Dp": 2.776, "splay_angle": 25.247, "splay_distance": 3.785, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 122.064, "theta": -134.426, "eta_prime": 175.284, "theta_prime": -158.081, "eta_base": -156.882, "theta_base": -121.562, "v0": -41.571, "v1": 53.704, "v2": -44.136, "v3": 22.321, "v4": 11.474, "amplitude": 51.967, "phase_angle": 148.137, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ -58.196, -49.957, -82.922 ], "x_axis": [ 0.431, -0.846, -0.314 ], "y_axis": [ -0.256, 0.219, -0.942 ], "z_axis": [ 0.865, 0.486, -0.122 ], "quaternion": [ 0.618, -0.578, 0.477, -0.239 ] } }, { "index": 24, "index_chain": 24, "chain_name": "X", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/24", "linked_nts": [ "///X/23", "///X/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -111.218, "beta": -100.019, "gamma": 77.751, "delta": 146.101, "epsilon": 161.633, "zeta": -105.842, "epsilon_zeta": -92.525, "bb_type": "BI", "chi": -77.178, "glyco_bond": "anti", "C5prime_xyz": [ -3.166, 7.112, -2.876 ], "P_xyz": [ -0.862, 8.397, -2.555 ], "form": ".", "ssZp": 2.089, "Dp": 2.160, "splay_angle": 19.318, "splay_distance": 3.062, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 177.450, "theta": -138.075, "eta_prime": -176.913, "theta_prime": -169.531, "eta_base": -130.241, "theta_base": -115.258, "v0": -28.722, "v1": 44.235, "v2": -42.425, "v3": 27.440, "v4": 0.403, "amplitude": 44.972, "phase_angle": 160.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.015, "origin": [ -54.421, -49.856, -83.174 ], "x_axis": [ 0.069, -0.553, -0.830 ], "y_axis": [ -0.304, 0.781, -0.545 ], "z_axis": [ 0.950, 0.290, -0.114 ], "quaternion": [ 0.659, -0.317, 0.676, -0.095 ] } }, { "index": 25, "index_chain": 25, "chain_name": "X", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/25", "linked_nts": [ "///X/24", "///X/26" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -152.937, "beta": 139.593, "gamma": 156.127, "delta": 142.834, "epsilon": -165.091, "zeta": -61.153, "epsilon_zeta": -103.938, "bb_type": "BI", "chi": -132.336, "glyco_bond": "anti", "C5prime_xyz": [ -0.902, 8.270, -0.440 ], "P_xyz": [ 0.755, 8.872, -2.482 ], "form": ".", "ssZp": 2.207, "Dp": 2.224, "splay_angle": 17.042, "splay_distance": 3.245, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": -151.162, "theta": -157.907, "eta_prime": -164.646, "theta_prime": -153.751, "eta_base": -108.014, "theta_base": -141.559, "v0": 4.495, "v1": 13.051, "v2": -24.106, "v3": 27.000, "v4": -20.257, "amplitude": 27.189, "phase_angle": 207.549, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ -51.734, -49.552, -84.612 ], "x_axis": [ -0.222, 0.153, -0.963 ], "y_axis": [ -0.071, 0.983, 0.172 ], "z_axis": [ 0.972, 0.106, -0.207 ], "quaternion": [ 0.623, 0.026, 0.777, 0.089 ] } }, { "index": 26, "index_chain": 26, "chain_name": "X", "nt_resnum": 26, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/26", "linked_nts": [ "///X/25", "///X/27" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -85.984, "beta": 157.137, "gamma": 74.240, "delta": 117.353, "epsilon": -159.552, "zeta": -80.635, "epsilon_zeta": -78.917, "bb_type": "BI", "chi": -124.548, "glyco_bond": "anti", "C5prime_xyz": [ -4.001, 8.290, -1.342 ], "P_xyz": [ -2.653, 10.335, -2.457 ], "form": ".", "ssZp": 2.970, "Dp": 2.972, "splay_angle": 25.666, "splay_distance": 4.156, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 157.563, "theta": -163.297, "eta_prime": -165.617, "theta_prime": 176.447, "eta_base": -148.203, "theta_base": -123.928, "v0": -50.806, "v1": 49.617, "v2": -28.602, "v3": 0.389, "v4": 30.707, "amplitude": 51.212, "phase_angle": 123.952, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.011, "origin": [ -48.787, -50.680, -85.370 ], "x_axis": [ -0.133, 0.412, -0.901 ], "y_axis": [ 0.180, 0.904, 0.387 ], "z_axis": [ 0.975, -0.111, -0.195 ], "quaternion": [ 0.628, 0.198, 0.747, 0.092 ] } }, { "index": 27, "index_chain": 27, "chain_name": "X", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/27", "linked_nts": [ "///X/26", "///X/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -134.394, "beta": 79.176, "gamma": 148.418, "delta": 109.001, "epsilon": -115.969, "zeta": -55.343, "epsilon_zeta": -60.626, "bb_type": "--", "chi": -174.183, "glyco_bond": "anti", "C5prime_xyz": [ -0.851, 7.992, 1.532 ], "P_xyz": [ -0.311, 9.554, -0.511 ], "form": ".", "ssZp": 4.313, "Dp": 4.388, "splay_angle": 27.984, "splay_distance": 4.640, "splay_ratio": 0.242, "d22": 4.164, "d64": 4.545, "eta": -167.884, "theta": -166.860, "eta_prime": 177.540, "theta_prime": -155.910, "eta_base": -116.737, "theta_base": -123.019, "v0": 19.679, "v1": -27.132, "v2": 23.930, "v3": -13.050, "v4": -4.131, "amplitude": 26.911, "phase_angle": 332.773, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.013, "origin": [ -45.241, -50.548, -87.534 ], "x_axis": [ 0.216, 0.903, -0.372 ], "y_axis": [ 0.187, 0.336, 0.923 ], "z_axis": [ 0.958, -0.269, -0.096 ], "quaternion": [ 0.603, 0.494, 0.551, 0.297 ] } }, { "index": 28, "index_chain": 28, "chain_name": "X", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/28", "linked_nts": [ "///X/27", "///X/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -109.951, "beta": 120.999, "gamma": 123.148, "delta": 90.356, "epsilon": -120.679, "zeta": -68.533, "epsilon_zeta": -52.146, "bb_type": "--", "chi": 170.731, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.124, 2.244 ], "P_xyz": [ 0.331, 9.624, 1.187 ], "form": ".", "ssZp": 4.463, "Dp": 4.525, "splay_angle": 14.580, "splay_distance": 2.887, "splay_ratio": 0.148, "d22": 4.285, "d64": 4.551, "eta": 163.062, "theta": -139.588, "eta_prime": -170.305, "theta_prime": -134.736, "eta_base": -117.602, "theta_base": -112.680, "v0": 12.227, "v1": -29.523, "v2": 34.771, "v3": -28.183, "v4": 10.204, "amplitude": 34.788, "phase_angle": 358.200, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.014, "origin": [ -40.859, -50.568, -89.057 ], "x_axis": [ 0.248, 0.938, 0.244 ], "y_axis": [ -0.097, -0.226, 0.969 ], "z_axis": [ 0.964, -0.264, 0.035 ], "quaternion": [ 0.514, 0.600, 0.350, 0.503 ] } }, { "index": 29, "index_chain": 29, "chain_name": "X", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/29", "linked_nts": [ "///X/28", "///X/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -56.474, "beta": 154.928, "gamma": 71.606, "delta": 94.505, "epsilon": -157.655, "zeta": -115.302, "epsilon_zeta": -42.352, "bb_type": "BI", "chi": -148.769, "glyco_bond": "anti", "C5prime_xyz": [ -3.355, 8.802, -0.569 ], "P_xyz": [ -1.287, 10.390, -0.766 ], "form": ".", "ssZp": 3.064, "Dp": 3.043, "splay_angle": 12.751, "splay_distance": 2.242, "splay_ratio": 0.113, "d22": 4.827, "d64": 4.107, "eta": 172.398, "theta": -155.453, "eta_prime": -153.989, "theta_prime": -159.064, "eta_base": -115.556, "theta_base": -102.952, "v0": -40.848, "v1": 25.396, "v2": -1.323, "v3": -22.243, "v4": 39.438, "amplitude": 41.586, "phase_angle": 91.823, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.163, "filter_rmsd": 0.111, "frame": { "rmsd": 0.009, "origin": [ -38.671, -49.256, -90.410 ], "x_axis": [ 0.295, 0.692, 0.658 ], "y_axis": [ 0.141, -0.713, 0.687 ], "z_axis": [ 0.945, -0.109, -0.308 ], "quaternion": [ 0.261, 0.761, 0.274, 0.527 ] } }, { "index": 30, "index_chain": 30, "chain_name": "X", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/30", "linked_nts": [ "///X/29", "///X/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -5.670, "beta": 133.236, "gamma": 23.070, "delta": 92.911, "epsilon": 119.595, "zeta": -75.518, "epsilon_zeta": -164.887, "bb_type": "--", "chi": -106.779, "glyco_bond": "anti", "C5prime_xyz": [ -3.245, 8.166, -2.315 ], "P_xyz": [ -1.108, 9.525, -3.214 ], "form": "B", "ssZp": 2.375, "Dp": 2.467, "splay_angle": 23.189, "splay_distance": 3.760, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 170.813, "theta": -166.954, "eta_prime": -162.501, "theta_prime": -160.711, "eta_base": -101.407, "theta_base": -126.004, "v0": -37.715, "v1": 22.028, "v2": 0.402, "v3": -21.967, "v4": 37.661, "amplitude": 38.788, "phase_angle": 89.406, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.059, "frame": { "rmsd": 0.006, "origin": [ -36.549, -48.535, -90.380 ], "x_axis": [ 0.622, 0.135, 0.772 ], "y_axis": [ 0.325, -0.941, -0.098 ], "z_axis": [ 0.712, 0.312, -0.629 ], "quaternion": [ -0.115, 0.893, 0.129, 0.415 ] } }, { "index": 31, "index_chain": 31, "chain_name": "X", "nt_resnum": 31, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/31", "linked_nts": [ "///X/30", "///X/32" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -153.769, "beta": -88.066, "gamma": 96.158, "delta": 127.086, "epsilon": 128.790, "zeta": -75.092, "epsilon_zeta": -156.117, "bb_type": "--", "chi": -89.224, "glyco_bond": "anti", "C5prime_xyz": [ -3.725, 7.570, -2.353 ], "P_xyz": [ -1.184, 8.276, -2.333 ], "form": ".", "ssZp": 2.664, "Dp": 2.636, "splay_angle": 25.134, "splay_distance": 4.064, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 148.343, "theta": -127.086, "eta_prime": -171.209, "theta_prime": -157.357, "eta_base": -132.995, "theta_base": -109.393, "v0": -38.446, "v1": 43.501, "v2": -30.400, "v3": 9.691, "v4": 17.445, "amplitude": 42.114, "phase_angle": 136.208, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.014, "origin": [ -33.294, -48.445, -92.263 ], "x_axis": [ 0.540, -0.371, 0.756 ], "y_axis": [ 0.093, -0.866, -0.491 ], "z_axis": [ 0.837, 0.336, -0.433 ], "quaternion": [ -0.245, 0.842, -0.082, 0.473 ] } }, { "index": 32, "index_chain": 32, "chain_name": "X", "nt_resnum": 32, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/32", "linked_nts": [ "///X/31", "///X/33" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -98.532, "beta": -127.630, "gamma": 65.611, "delta": 139.306, "epsilon": -160.974, "zeta": 171.706, "epsilon_zeta": 27.319, "bb_type": "--", "chi": -78.335, "glyco_bond": "anti", "C5prime_xyz": [ -3.237, 7.844, -2.417 ], "P_xyz": [ -0.886, 9.114, -2.748 ], "form": "B", "ssZp": 2.433, "Dp": 2.665, "splay_angle": 22.842, "splay_distance": 3.861, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -177.535, "theta": -168.140, "eta_prime": -169.018, "theta_prime": -170.377, "eta_base": -113.719, "theta_base": -138.666, "v0": -26.262, "v1": 38.839, "v2": -35.552, "v3": 21.485, "v4": 2.772, "amplitude": 38.615, "phase_angle": 157.025, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.010, "origin": [ -29.241, -48.372, -91.979 ], "x_axis": [ 0.504, -0.842, 0.193 ], "y_axis": [ -0.106, -0.282, -0.954 ], "z_axis": [ 0.857, 0.460, -0.231 ], "quaternion": [ -0.498, 0.710, -0.334, 0.370 ] } }, { "index": 33, "index_chain": 33, "chain_name": "X", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/33", "linked_nts": [ "///X/32", "///X/34" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 11.222, "beta": 95.275, "gamma": 37.074, "delta": 129.990, "epsilon": -174.239, "zeta": -178.594, "epsilon_zeta": 4.355, "bb_type": "--", "chi": -112.962, "glyco_bond": "anti", "C5prime_xyz": [ -2.923, 8.475, -1.751 ], "P_xyz": [ -0.314, 8.843, -1.269 ], "form": "B", "ssZp": 2.511, "Dp": 2.529, "splay_angle": 16.306, "splay_distance": 2.603, "splay_ratio": 0.144, "d22": null, "d64": null, "eta": 167.145, "theta": -147.956, "eta_prime": -167.083, "theta_prime": -165.428, "eta_base": -132.386, "theta_base": -133.596, "v0": -38.254, "v1": 42.766, "v2": -31.275, "v3": 10.044, "v4": 17.504, "amplitude": 42.481, "phase_angle": 137.410, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ -26.076, -47.008, -93.719 ], "x_axis": [ 0.180, -0.972, -0.149 ], "y_axis": [ -0.322, 0.084, -0.943 ], "z_axis": [ 0.929, 0.218, -0.298 ], "quaternion": [ -0.492, 0.590, -0.548, 0.331 ] } }, { "index": 34, "index_chain": 34, "chain_name": "X", "nt_resnum": 34, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/34", "linked_nts": [ "///X/33", "///X/35" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 148.754, "beta": -105.303, "gamma": 164.957, "delta": 132.027, "epsilon": -150.116, "zeta": -61.328, "epsilon_zeta": -88.788, "bb_type": "BI", "chi": -131.060, "glyco_bond": "anti", "C5prime_xyz": [ -2.297, 8.937, -0.909 ], "P_xyz": [ -0.007, 8.515, -2.297 ], "form": "B", "ssZp": 1.886, "Dp": 2.009, "splay_angle": 21.949, "splay_distance": 3.863, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 174.059, "theta": -89.158, "eta_prime": -157.097, "theta_prime": -135.570, "eta_base": -124.869, "theta_base": -96.836, "v0": -27.522, "v1": 35.084, "v2": -29.897, "v3": 14.383, "v4": 8.292, "amplitude": 35.086, "phase_angle": 148.442, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.017, "origin": [ -23.718, -46.043, -94.251 ], "x_axis": [ 0.089, -0.737, -0.670 ], "y_axis": [ -0.120, 0.660, -0.742 ], "z_axis": [ 0.989, 0.147, -0.029 ], "quaternion": [ 0.656, -0.339, 0.632, -0.235 ] } }, { "index": 35, "index_chain": 35, "chain_name": "X", "nt_resnum": 35, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/35", "linked_nts": [ "///X/34", "///X/36" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -120.433, "beta": 154.547, "gamma": 97.909, "delta": 113.479, "epsilon": -121.922, "zeta": -130.427, "epsilon_zeta": 8.505, "bb_type": "--", "chi": -120.392, "glyco_bond": "anti", "C5prime_xyz": [ -3.756, 8.219, -1.766 ], "P_xyz": [ -2.131, 9.429, -3.487 ], "form": ".", "ssZp": 1.790, "Dp": 1.801, "splay_angle": 18.487, "splay_distance": 3.299, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 161.558, "theta": -174.830, "eta_prime": -166.485, "theta_prime": 176.012, "eta_base": -125.015, "theta_base": -153.072, "v0": -51.723, "v1": 44.792, "v2": -21.418, "v3": -7.341, "v4": 36.013, "amplitude": 50.240, "phase_angle": 115.233, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -20.273, -46.043, -96.001 ], "x_axis": [ -0.250, -0.277, -0.928 ], "y_axis": [ -0.021, 0.960, -0.281 ], "z_axis": [ 0.968, -0.051, -0.246 ], "quaternion": [ 0.605, -0.095, 0.784, -0.106 ] } }, { "index": 36, "index_chain": 36, "chain_name": "X", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/36", "linked_nts": [ "///X/35", "///X/37" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -66.649, "beta": 112.634, "gamma": 77.773, "delta": 73.233, "epsilon": 169.152, "zeta": -92.195, "epsilon_zeta": -98.653, "bb_type": "BI", "chi": -160.147, "glyco_bond": "anti", "C5prime_xyz": [ -3.978, 8.527, -0.362 ], "P_xyz": [ -2.189, 10.047, -1.583 ], "form": ".", "ssZp": 3.609, "Dp": 3.571, "splay_angle": 23.881, "splay_distance": 3.617, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 160.086, "theta": -175.148, "eta_prime": 172.372, "theta_prime": -172.366, "eta_base": -154.006, "theta_base": -104.470, "v0": -48.859, "v1": 21.605, "v2": 13.352, "v3": -43.297, "v4": 58.229, "amplitude": 57.456, "phase_angle": 76.563, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.015, "origin": [ -17.140, -47.022, -96.324 ], "x_axis": [ -0.242, 0.102, -0.965 ], "y_axis": [ 0.094, 0.992, 0.082 ], "z_axis": [ 0.966, -0.071, -0.250 ], "quaternion": [ 0.612, 0.062, 0.788, 0.003 ] } }, { "index": 37, "index_chain": 37, "chain_name": "X", "nt_resnum": 37, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/37", "linked_nts": [ "///X/36", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -135.602, "beta": -131.035, "gamma": 79.410, "delta": 87.993, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -129.174, "glyco_bond": "anti", "C5prime_xyz": [ -1.214, 8.487, -1.229 ], "P_xyz": [ 1.419, 8.125, -1.216 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 11.630, "v1": -30.690, "v2": 36.808, "v3": -31.179, "v4": 12.519, "amplitude": 36.811, "phase_angle": 0.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -14.358, -45.901, -98.347 ], "x_axis": [ -0.161, 0.930, -0.331 ], "y_axis": [ 0.472, 0.368, 0.801 ], "z_axis": [ 0.867, -0.027, -0.498 ], "quaternion": [ 0.421, 0.492, 0.712, 0.272 ] } }, { "index": 38, "index_chain": 1, "chain_name": "Y", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/1", "linked_nts": [ null, "///Y/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": -161.976, "delta": 143.781, "epsilon": -80.912, "zeta": -132.488, "epsilon_zeta": 51.576, "bb_type": "--", "chi": -173.561, "glyco_bond": "anti", "C5prime_xyz": [ -3.127, 8.647, 1.128 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -0.661, "Dp": 1.596, "splay_angle": 54.901, "splay_distance": 8.957, "splay_ratio": 0.462, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.028, "v1": 50.513, "v2": -42.571, "v3": 22.238, "v4": 9.728, "amplitude": 49.219, "phase_angle": 149.873, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.022, "origin": [ -20.739, -45.552, -104.328 ], "x_axis": [ -0.839, 0.409, -0.360 ], "y_axis": [ -0.276, -0.888, -0.367 ], "z_axis": [ -0.470, -0.209, 0.858 ], "quaternion": [ 0.181, -0.219, -0.152, 0.947 ] } }, { "index": 39, "index_chain": 2, "chain_name": "Y", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/2", "linked_nts": [ "///Y/1", "///Y/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 149.243, "beta": -118.155, "gamma": 58.295, "delta": 140.023, "epsilon": -154.069, "zeta": 177.997, "epsilon_zeta": 27.934, "bb_type": "--", "chi": -90.864, "glyco_bond": "anti", "C5prime_xyz": [ -3.137, 7.905, -2.377 ], "P_xyz": [ -1.384, 9.799, -1.805 ], "form": "B", "ssZp": 2.040, "Dp": 2.059, "splay_angle": 23.562, "splay_distance": 3.922, "splay_ratio": 0.205, "d22": 4.213, "d64": 3.697, "eta": 41.245, "theta": -158.418, "eta_prime": 108.899, "theta_prime": -156.969, "eta_base": 123.631, "theta_base": -119.850, "v0": -31.770, "v1": 43.761, "v2": -38.770, "v3": 21.703, "v4": 6.057, "amplitude": 43.379, "phase_angle": 153.349, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.005, "origin": [ -13.986, -46.577, -98.535 ], "x_axis": [ -0.447, 0.760, -0.471 ], "y_axis": [ -0.475, -0.648, -0.595 ], "z_axis": [ -0.758, -0.043, 0.651 ], "quaternion": [ 0.373, -0.371, -0.192, 0.829 ] } }, { "index": 40, "index_chain": 3, "chain_name": "Y", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/3", "linked_nts": [ "///Y/2", "///Y/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 20.439, "beta": 87.432, "gamma": 33.361, "delta": 129.902, "epsilon": 178.819, "zeta": -172.184, "epsilon_zeta": -8.997, "bb_type": "--", "chi": -100.702, "glyco_bond": "anti", "C5prime_xyz": [ -3.808, 8.071, -1.933 ], "P_xyz": [ -1.324, 9.107, -1.736 ], "form": ".", "ssZp": 2.826, "Dp": 2.810, "splay_angle": 24.091, "splay_distance": 3.938, "splay_ratio": 0.212, "d22": 4.321, "d64": 4.131, "eta": 157.191, "theta": -146.296, "eta_prime": -173.798, "theta_prime": -161.798, "eta_base": -131.789, "theta_base": -124.932, "v0": -43.712, "v1": 50.077, "v2": -36.474, "v3": 12.508, "v4": 19.345, "amplitude": 48.983, "phase_angle": 138.127, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ -17.351, -46.940, -96.554 ], "x_axis": [ -0.536, 0.356, -0.766 ], "y_axis": [ -0.179, -0.934, -0.309 ], "z_axis": [ -0.825, -0.028, 0.564 ], "quaternion": [ 0.154, -0.457, -0.097, 0.871 ] } }, { "index": 41, "index_chain": 4, "chain_name": "Y", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/4", "linked_nts": [ "///Y/3", "///Y/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 44.877, "beta": 102.285, "gamma": 18.896, "delta": 137.705, "epsilon": -165.946, "zeta": -114.939, "epsilon_zeta": -51.007, "bb_type": "BI", "chi": -102.081, "glyco_bond": "anti", "C5prime_xyz": [ -3.012, 8.364, -2.130 ], "P_xyz": [ -0.726, 9.523, -1.312 ], "form": "B", "ssZp": 1.897, "Dp": 2.116, "splay_angle": 19.620, "splay_distance": 3.194, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 178.653, "theta": -138.230, "eta_prime": -161.387, "theta_prime": -160.231, "eta_base": -120.245, "theta_base": -111.561, "v0": -27.398, "v1": 40.482, "v2": -38.868, "v3": 23.600, "v4": 2.223, "amplitude": 41.701, "phase_angle": 158.757, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.016, "origin": [ -20.929, -46.161, -95.105 ], "x_axis": [ -0.399, -0.247, -0.883 ], "y_axis": [ 0.142, -0.968, 0.206 ], "z_axis": [ -0.906, -0.043, 0.421 ], "quaternion": [ -0.116, -0.536, 0.049, 0.835 ] } }, { "index": 42, "index_chain": 5, "chain_name": "Y", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/5", "linked_nts": [ "///Y/4", "///Y/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -164.242, "beta": 140.902, "gamma": 145.989, "delta": 150.370, "epsilon": 173.649, "zeta": -80.671, "epsilon_zeta": -105.680, "bb_type": "BI", "chi": -120.224, "glyco_bond": "anti", "C5prime_xyz": [ -0.792, 8.071, -0.903 ], "P_xyz": [ 1.114, 8.027, -2.752 ], "form": ".", "ssZp": 1.553, "Dp": 1.606, "splay_angle": 22.918, "splay_distance": 4.241, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 176.963, "theta": -131.334, "eta_prime": -167.802, "theta_prime": -159.545, "eta_base": -117.419, "theta_base": -130.643, "v0": 11.219, "v1": 11.244, "v2": -27.950, "v3": 34.313, "v4": -28.933, "amplitude": 34.686, "phase_angle": 216.314, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -23.492, -46.985, -93.387 ], "x_axis": [ -0.139, -0.893, -0.428 ], "y_axis": [ 0.214, -0.449, 0.867 ], "z_axis": [ -0.967, 0.029, 0.254 ], "quaternion": [ -0.408, -0.514, 0.330, 0.679 ] } }, { "index": 43, "index_chain": 6, "chain_name": "Y", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/6", "linked_nts": [ "///Y/5", "///Y/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 162.655, "beta": -160.057, "gamma": 163.788, "delta": 94.345, "epsilon": -121.581, "zeta": -76.810, "epsilon_zeta": -44.771, "bb_type": "--", "chi": -166.111, "glyco_bond": "anti", "C5prime_xyz": [ -3.175, 8.873, 0.026 ], "P_xyz": [ -1.549, 10.718, -0.964 ], "form": "B", "ssZp": 2.346, "Dp": 2.486, "splay_angle": 17.334, "splay_distance": 3.098, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 174.711, "theta": -160.039, "eta_prime": -167.547, "theta_prime": -164.609, "eta_base": -133.378, "theta_base": -122.850, "v0": -43.045, "v1": 25.425, "v2": 0.455, "v3": -25.214, "v4": 42.054, "amplitude": 44.106, "phase_angle": 89.408, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ -27.706, -46.515, -93.283 ], "x_axis": [ 0.017, -0.996, -0.092 ], "y_axis": [ 0.403, -0.078, 0.912 ], "z_axis": [ -0.915, -0.052, 0.400 ], "quaternion": [ 0.578, 0.417, -0.356, -0.604 ] } }, { "index": 44, "index_chain": 7, "chain_name": "Y", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/7", "linked_nts": [ "///Y/6", "///Y/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -89.215, "beta": 106.833, "gamma": 119.891, "delta": 72.201, "epsilon": -150.827, "zeta": -29.997, "epsilon_zeta": -120.830, "bb_type": "BI", "chi": -156.202, "glyco_bond": "anti", "C5prime_xyz": [ -2.518, 9.128, 0.021 ], "P_xyz": [ -1.762, 9.978, -2.327 ], "form": ".", "ssZp": 3.925, "Dp": 4.174, "splay_angle": 24.463, "splay_distance": 4.348, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 168.064, "theta": -167.886, "eta_prime": 179.343, "theta_prime": 175.664, "eta_base": -131.478, "theta_base": -173.213, "v0": -26.723, "v1": -1.305, "v2": 27.069, "v3": -42.971, "v4": 44.126, "amplitude": 45.489, "phase_angle": 53.483, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ -30.724, -46.901, -92.701 ], "x_axis": [ -0.272, -0.814, 0.513 ], "y_axis": [ 0.109, 0.503, 0.857 ], "z_axis": [ -0.956, 0.289, -0.048 ], "quaternion": [ 0.544, 0.261, -0.675, -0.424 ] } }, { "index": 45, "index_chain": 8, "chain_name": "Y", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/8", "linked_nts": [ "///Y/7", "///Y/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -122.333, "beta": 67.250, "gamma": 169.804, "delta": 83.626, "epsilon": -116.971, "zeta": -102.341, "epsilon_zeta": -14.631, "bb_type": "--", "chi": 179.473, "glyco_bond": "anti", "C5prime_xyz": [ -0.980, 8.132, 1.829 ], "P_xyz": [ -1.102, 10.428, 0.445 ], "form": ".", "ssZp": 4.766, "Dp": 4.814, "splay_angle": 29.471, "splay_distance": 4.660, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 171.056, "theta": -167.412, "eta_prime": 165.130, "theta_prime": -135.913, "eta_base": -173.638, "theta_base": -81.465, "v0": 17.868, "v1": -37.783, "v2": 42.735, "v3": -33.402, "v4": 9.919, "amplitude": 42.922, "phase_angle": 354.644, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.015, "filter_rmsd": 0.109, "frame": { "rmsd": 0.015, "origin": [ -34.548, -46.435, -94.718 ], "x_axis": [ -0.115, -0.727, 0.677 ], "y_axis": [ 0.214, 0.647, 0.732 ], "z_axis": [ -0.970, 0.228, 0.081 ], "quaternion": [ 0.635, 0.198, -0.648, -0.370 ] } }, { "index": 46, "index_chain": 9, "chain_name": "Y", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/9", "linked_nts": [ "///Y/8", "///Y/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 33.388, "beta": 94.198, "gamma": 41.043, "delta": 128.394, "epsilon": -169.557, "zeta": 165.535, "epsilon_zeta": 24.909, "bb_type": "--", "chi": -116.176, "glyco_bond": "anti", "C5prime_xyz": [ -3.433, 8.540, -1.506 ], "P_xyz": [ -0.884, 9.323, -1.137 ], "form": ".", "ssZp": 2.674, "Dp": 2.709, "splay_angle": 21.739, "splay_distance": 3.428, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 155.791, "theta": -162.275, "eta_prime": -145.279, "theta_prime": -171.837, "eta_base": -79.144, "theta_base": -162.572, "v0": -43.834, "v1": 48.612, "v2": -35.345, "v3": 11.161, "v4": 20.203, "amplitude": 48.339, "phase_angle": 136.986, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -36.624, -48.282, -90.977 ], "x_axis": [ 0.197, -0.007, 0.980 ], "y_axis": [ -0.185, 0.982, 0.045 ], "z_axis": [ -0.963, -0.191, 0.192 ], "quaternion": [ 0.770, 0.076, -0.631, 0.058 ] } }, { "index": 47, "index_chain": 10, "chain_name": "Y", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/10", "linked_nts": [ "///Y/9", "///Y/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 31.645, "beta": 88.486, "gamma": 43.572, "delta": 128.943, "epsilon": 142.718, "zeta": -96.801, "epsilon_zeta": -120.481, "bb_type": "BI", "chi": -107.654, "glyco_bond": "anti", "C5prime_xyz": [ -3.639, 8.131, -1.860 ], "P_xyz": [ -1.072, 8.881, -1.815 ], "form": ".", "ssZp": 2.552, "Dp": 2.767, "splay_angle": 28.597, "splay_distance": 4.260, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 153.335, "theta": -109.409, "eta_prime": -170.820, "theta_prime": -141.125, "eta_base": -156.562, "theta_base": -75.737, "v0": -43.221, "v1": 49.327, "v2": -35.753, "v3": 12.057, "v4": 19.198, "amplitude": 48.244, "phase_angle": 137.825, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.016, "origin": [ -39.226, -50.258, -92.013 ], "x_axis": [ -0.030, 0.264, 0.964 ], "y_axis": [ -0.444, 0.861, -0.250 ], "z_axis": [ -0.896, -0.435, 0.091 ], "quaternion": [ 0.693, 0.067, -0.671, 0.255 ] } }, { "index": 48, "index_chain": 11, "chain_name": "Y", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/11", "linked_nts": [ "///Y/10", "///Y/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -139.027, "beta": -108.234, "gamma": 91.585, "delta": 125.466, "epsilon": 124.494, "zeta": -87.771, "epsilon_zeta": -147.735, "bb_type": "--", "chi": -90.575, "glyco_bond": "anti", "C5prime_xyz": [ -2.826, 7.805, -2.627 ], "P_xyz": [ -0.262, 8.529, -2.457 ], "form": "B", "ssZp": 1.756, "Dp": 1.836, "splay_angle": 19.424, "splay_distance": 3.084, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 151.702, "theta": -139.735, "eta_prime": -165.579, "theta_prime": -168.333, "eta_base": -89.628, "theta_base": -136.910, "v0": -23.981, "v1": 32.021, "v2": -28.437, "v3": 15.128, "v4": 5.442, "amplitude": 32.174, "phase_angle": 152.112, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.017, "origin": [ -42.404, -49.018, -89.462 ], "x_axis": [ -0.193, 0.961, 0.200 ], "y_axis": [ -0.435, 0.099, -0.895 ], "z_axis": [ -0.880, -0.260, 0.398 ], "quaternion": [ 0.571, -0.278, -0.473, 0.611 ] } }, { "index": 49, "index_chain": 12, "chain_name": "Y", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/12", "linked_nts": [ "///Y/11", "///Y/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -130.784, "beta": -124.654, "gamma": 98.705, "delta": 151.439, "epsilon": 158.661, "zeta": -153.344, "epsilon_zeta": -47.995, "bb_type": "--", "chi": -86.335, "glyco_bond": "anti", "C5prime_xyz": [ -3.413, 7.798, -2.269 ], "P_xyz": [ -0.996, 8.808, -2.630 ], "form": ".", "ssZp": 2.504, "Dp": 2.544, "splay_angle": 31.025, "splay_distance": 4.525, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": 147.825, "theta": -119.142, "eta_prime": -177.123, "theta_prime": -145.560, "eta_base": -140.025, "theta_base": -73.301, "v0": -32.985, "v1": 50.961, "v2": -48.919, "v3": 31.351, "v4": 0.784, "amplitude": 51.903, "phase_angle": 160.478, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -44.765, -50.034, -87.758 ], "x_axis": [ -0.461, 0.863, -0.209 ], "y_axis": [ -0.423, -0.420, -0.803 ], "z_axis": [ -0.780, -0.282, 0.558 ], "quaternion": [ 0.411, -0.317, -0.347, 0.781 ] } }, { "index": 50, "index_chain": 13, "chain_name": "Y", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/13", "linked_nts": [ "///Y/12", "///Y/14" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 73.299, "beta": 107.927, "gamma": -3.012, "delta": 139.134, "epsilon": -141.206, "zeta": -156.684, "epsilon_zeta": 15.478, "bb_type": "--", "chi": -70.843, "glyco_bond": "--", "C5prime_xyz": [ -2.772, 6.990, -3.075 ], "P_xyz": [ -0.332, 8.072, -3.110 ], "form": ".", "ssZp": 0.718, "Dp": 1.967, "splay_angle": 29.432, "splay_distance": 5.436, "splay_ratio": 0.295, "d22": 5.931, "d64": 4.890, "eta": -166.156, "theta": -164.038, "eta_prime": -156.329, "theta_prime": -178.522, "eta_base": -80.342, "theta_base": -108.236, "v0": -11.005, "v1": 23.327, "v2": -25.980, "v3": 20.208, "v4": -5.965, "amplitude": 26.115, "phase_angle": 174.174, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ -48.909, -48.985, -89.239 ], "x_axis": [ -0.509, 0.050, -0.859 ], "y_axis": [ -0.134, -0.991, 0.022 ], "z_axis": [ -0.850, 0.127, 0.511 ], "quaternion": [ 0.053, -0.493, 0.043, 0.868 ] } }, { "index": 51, "index_chain": 14, "chain_name": "Y", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/14", "linked_nts": [ "///Y/13", "///Y/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop", "alpha": -60.966, "beta": 124.248, "gamma": 52.337, "delta": 80.961, "epsilon": -118.646, "zeta": -120.084, "epsilon_zeta": 1.439, "bb_type": "--", "chi": -119.163, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.273, -1.811 ], "P_xyz": [ 0.704, 7.109, -3.049 ], "form": ".", "ssZp": 1.864, "Dp": 4.785, "splay_angle": 31.833, "splay_distance": 5.235, "splay_ratio": 0.276, "d22": 4.401, "d64": 4.736, "eta": 167.627, "theta": -161.472, "eta_prime": 169.806, "theta_prime": -163.270, "eta_base": -122.016, "theta_base": 148.760, "v0": 15.138, "v1": -36.495, "v2": 43.462, "v3": -35.223, "v4": 12.878, "amplitude": 43.477, "phase_angle": 358.488, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.010, "filter_rmsd": 0.114, "frame": { "rmsd": 0.012, "origin": [ -52.550, -52.592, -87.427 ], "x_axis": [ -0.539, -0.702, -0.466 ], "y_axis": [ 0.293, -0.674, 0.678 ], "z_axis": [ -0.790, 0.229, 0.569 ], "quaternion": [ -0.298, -0.376, 0.272, 0.834 ] } }, { "index": 52, "index_chain": 15, "chain_name": "Y", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/15", "linked_nts": [ "///Y/14", "///Y/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -54.472, "beta": 108.637, "gamma": 92.470, "delta": 137.615, "epsilon": 175.761, "zeta": -126.489, "epsilon_zeta": -57.750, "bb_type": "BI", "chi": -108.967, "glyco_bond": "anti", "C5prime_xyz": [ -3.378, 8.444, -1.588 ], "P_xyz": [ -1.405, 8.405, -3.309 ], "form": ".", "ssZp": 2.629, "Dp": 2.760, "splay_angle": 31.752, "splay_distance": 5.256, "splay_ratio": 0.283, "d22": 4.220, "d64": 3.947, "eta": 133.156, "theta": -83.959, "eta_prime": -154.134, "theta_prime": -148.367, "eta_base": 163.540, "theta_base": -92.670, "v0": -40.133, "v1": 50.017, "v2": -39.940, "v3": 17.970, "v4": 13.717, "amplitude": 48.726, "phase_angle": 145.054, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -53.068, -49.929, -82.949 ], "x_axis": [ -0.469, -0.310, -0.827 ], "y_axis": [ -0.149, -0.895, 0.420 ], "z_axis": [ -0.870, 0.321, 0.374 ], "quaternion": [ -0.049, -0.513, 0.224, 0.827 ] } }, { "index": 53, "index_chain": 16, "chain_name": "Y", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/16", "linked_nts": [ "///Y/15", "///Y/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 70.644, "beta": 111.628, "gamma": -36.767, "delta": 147.174, "epsilon": -159.522, "zeta": 176.673, "epsilon_zeta": 23.805, "bb_type": "--", "chi": -70.119, "glyco_bond": "anti", "C5prime_xyz": [ -2.979, 7.054, -2.984 ], "P_xyz": [ -1.616, 9.318, -3.206 ], "form": "B", "ssZp": 1.387, "Dp": 1.777, "splay_angle": 20.839, "splay_distance": 3.601, "splay_ratio": 0.186, "d22": 4.258, "d64": 3.338, "eta": 167.081, "theta": -176.062, "eta_prime": -168.021, "theta_prime": -175.688, "eta_base": -107.685, "theta_base": -135.033, "v0": -16.998, "v1": 33.168, "v2": -35.828, "v3": 26.960, "v4": -6.437, "amplitude": 36.239, "phase_angle": 171.353, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.008, "origin": [ -57.949, -51.590, -83.965 ], "x_axis": [ -0.188, -0.950, -0.249 ], "y_axis": [ 0.073, -0.266, 0.961 ], "z_axis": [ -0.979, 0.163, 0.120 ], "quaternion": [ -0.408, -0.490, 0.448, 0.627 ] } }, { "index": 54, "index_chain": 17, "chain_name": "Y", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/17", "linked_nts": [ "///Y/16", "///Y/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 10.428, "beta": 95.366, "gamma": 30.111, "delta": 115.494, "epsilon": 171.490, "zeta": -85.303, "epsilon_zeta": -103.207, "bb_type": "BI", "chi": -103.251, "glyco_bond": "anti", "C5prime_xyz": [ -3.131, 8.263, -2.237 ], "P_xyz": [ -0.572, 8.895, -2.303 ], "form": ".", "ssZp": 2.549, "Dp": 2.612, "splay_angle": 15.654, "splay_distance": 2.676, "splay_ratio": 0.137, "d22": 4.439, "d64": 3.822, "eta": 163.026, "theta": -130.976, "eta_prime": -176.557, "theta_prime": -150.178, "eta_base": -134.394, "theta_base": -105.314, "v0": -39.236, "v1": 37.627, "v2": -22.250, "v3": 0.155, "v4": 24.443, "amplitude": 39.689, "phase_angle": 124.097, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.010, "origin": [ -61.192, -51.284, -82.430 ], "x_axis": [ -0.042, -0.975, 0.219 ], "y_axis": [ 0.128, 0.212, 0.969 ], "z_axis": [ -0.991, 0.069, 0.116 ], "quaternion": [ 0.567, 0.397, -0.533, -0.486 ] } }, { "index": 55, "index_chain": 18, "chain_name": "Y", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/18", "linked_nts": [ "///Y/17", "///Y/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.802, "beta": -172.175, "gamma": 58.419, "delta": 131.301, "epsilon": -170.184, "zeta": -176.054, "epsilon_zeta": 5.870, "bb_type": "--", "chi": -82.323, "glyco_bond": "anti", "C5prime_xyz": [ -3.531, 7.497, -2.693 ], "P_xyz": [ -1.713, 8.900, -4.017 ], "form": "B", "ssZp": 2.159, "Dp": 2.355, "splay_angle": 27.938, "splay_distance": 4.628, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 176.395, "theta": -175.260, "eta_prime": -160.102, "theta_prime": -177.052, "eta_base": -111.011, "theta_base": -140.498, "v0": -39.027, "v1": 45.540, "v2": -34.429, "v3": 13.014, "v4": 16.076, "amplitude": 44.677, "phase_angle": 140.410, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ -63.387, -52.572, -81.606 ], "x_axis": [ -0.054, -0.755, 0.654 ], "y_axis": [ -0.335, 0.630, 0.700 ], "z_axis": [ -0.941, -0.181, -0.287 ], "quaternion": [ 0.568, 0.388, -0.702, -0.185 ] } }, { "index": 56, "index_chain": 19, "chain_name": "Y", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/19", "linked_nts": [ "///Y/18", "///Y/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 19.392, "beta": 99.476, "gamma": 33.484, "delta": 140.705, "epsilon": 164.362, "zeta": -164.305, "epsilon_zeta": -31.333, "bb_type": "--", "chi": -113.698, "glyco_bond": "anti", "C5prime_xyz": [ -3.007, 8.464, -1.595 ], "P_xyz": [ -0.521, 9.165, -0.873 ], "form": "A", "ssZp": 2.274, "Dp": 2.605, "splay_angle": 24.141, "splay_distance": 3.868, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 151.819, "theta": -132.730, "eta_prime": -171.954, "theta_prime": -155.323, "eta_base": -130.928, "theta_base": -124.657, "v0": -37.387, "v1": 49.726, "v2": -42.512, "v3": 22.420, "v4": 9.053, "amplitude": 48.800, "phase_angle": 150.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -67.983, -53.090, -81.780 ], "x_axis": [ 0.195, -0.303, 0.933 ], "y_axis": [ -0.079, 0.943, 0.323 ], "z_axis": [ -0.978, -0.137, 0.160 ], "quaternion": [ 0.758, 0.152, -0.630, -0.074 ] } }, { "index": 57, "index_chain": 20, "chain_name": "Y", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/20", "linked_nts": [ "///Y/19", "///Y/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 179.880, "beta": -102.971, "gamma": 148.589, "delta": 123.715, "epsilon": -108.947, "zeta": -101.773, "epsilon_zeta": -7.174, "bb_type": "--", "chi": -146.957, "glyco_bond": "anti", "C5prime_xyz": [ -3.053, 8.890, -0.221 ], "P_xyz": [ -0.513, 9.380, -0.731 ], "form": "B", "ssZp": 1.744, "Dp": 1.903, "splay_angle": 24.103, "splay_distance": 3.993, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": -163.775, "theta": -132.777, "eta_prime": -161.636, "theta_prime": -149.079, "eta_base": -123.742, "theta_base": -94.097, "v0": -41.279, "v1": 44.059, "v2": -29.745, "v3": 6.647, "v4": 21.579, "amplitude": 44.116, "phase_angle": 132.396, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.015, "origin": [ -71.268, -55.053, -81.220 ], "x_axis": [ 0.182, 0.303, 0.935 ], "y_axis": [ -0.114, 0.951, -0.286 ], "z_axis": [ -0.977, -0.055, 0.208 ], "quaternion": [ 0.765, -0.076, -0.625, 0.136 ] } }, { "index": 58, "index_chain": 21, "chain_name": "Y", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/21", "linked_nts": [ "///Y/20", "///Y/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -104.025, "beta": 95.896, "gamma": 126.293, "delta": 142.911, "epsilon": -179.507, "zeta": -90.288, "epsilon_zeta": -89.218, "bb_type": "BI", "chi": -126.750, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.775, -0.881 ], "P_xyz": [ -0.917, 8.742, -3.079 ], "form": ".", "ssZp": 1.969, "Dp": 2.394, "splay_angle": 25.041, "splay_distance": 3.858, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": -158.276, "theta": -163.669, "eta_prime": -142.989, "theta_prime": -157.310, "eta_base": -91.927, "theta_base": -87.324, "v0": -30.253, "v1": 44.478, "v2": -41.363, "v3": 24.880, "v4": 3.169, "amplitude": 44.808, "phase_angle": 157.389, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ -75.075, -54.171, -80.401 ], "x_axis": [ -0.304, 0.830, 0.467 ], "y_axis": [ -0.333, 0.367, -0.869 ], "z_axis": [ -0.893, -0.420, 0.164 ], "quaternion": [ 0.554, -0.203, -0.614, 0.525 ] } }, { "index": 59, "index_chain": 22, "chain_name": "Y", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/22", "linked_nts": [ "///Y/21", "///Y/23" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -141.947, "beta": -133.227, "gamma": 81.808, "delta": 129.697, "epsilon": -142.834, "zeta": 114.815, "epsilon_zeta": 102.351, "bb_type": "--", "chi": -76.997, "glyco_bond": "anti", "C5prime_xyz": [ -3.068, 7.336, -2.988 ], "P_xyz": [ -0.665, 8.174, -3.747 ], "form": ".", "ssZp": 1.017, "Dp": 1.828, "splay_angle": 35.142, "splay_distance": 6.080, "splay_ratio": 0.312, "d22": 7.161, "d64": 6.947, "eta": 152.931, "theta": 131.014, "eta_prime": -173.280, "theta_prime": 109.131, "eta_base": -103.088, "theta_base": 66.802, "v0": -21.944, "v1": 29.979, "v2": -26.520, "v3": 14.372, "v4": 4.695, "amplitude": 29.862, "phase_angle": 152.634, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.011, "origin": [ -78.780, -53.105, -80.536 ], "x_axis": [ -0.339, 0.817, -0.467 ], "y_axis": [ -0.240, -0.555, -0.797 ], "z_axis": [ -0.910, -0.159, 0.384 ], "quaternion": [ 0.350, -0.456, -0.316, 0.755 ] } }, { "index": 60, "index_chain": 23, "chain_name": "Y", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/23", "linked_nts": [ "///Y/22", "///Y/24" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -9.557, "beta": 86.846, "gamma": -3.705, "delta": 131.037, "epsilon": -153.843, "zeta": -97.893, "epsilon_zeta": -55.950, "bb_type": "BI", "chi": -17.239, "glyco_bond": "--", "C5prime_xyz": [ -5.467, 5.977, -1.766 ], "P_xyz": [ -4.329, 6.662, -4.103 ], "form": ".", "ssZp": 0.027, "Dp": 2.842, "splay_angle": 49.297, "splay_distance": 8.775, "splay_ratio": 0.417, "d22": 6.295, "d64": 7.439, "eta": 136.769, "theta": -73.663, "eta_prime": 139.235, "theta_prime": -77.119, "eta_base": 107.327, "theta_base": -66.933, "v0": -41.947, "v1": 48.304, "v2": -35.264, "v3": 11.668, "v4": 19.019, "amplitude": 47.426, "phase_angle": 138.035, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.112, "frame": { "rmsd": 0.012, "origin": [ -74.167, -56.856, -81.807 ], "x_axis": [ -0.251, 0.568, 0.784 ], "y_axis": [ -0.619, -0.717, 0.321 ], "z_axis": [ 0.744, -0.404, 0.531 ], "quaternion": [ 0.375, 0.483, -0.026, 0.790 ] } }, { "index": 61, "index_chain": 24, "chain_name": "Y", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/24", "linked_nts": [ "///Y/23", "///Y/25" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor", "alpha": 35.242, "beta": 109.998, "gamma": -9.248, "delta": 109.653, "epsilon": -89.856, "zeta": -153.423, "epsilon_zeta": 63.566, "bb_type": "BII", "chi": -90.507, "glyco_bond": "anti", "C5prime_xyz": [ -4.109, 7.468, -2.461 ], "P_xyz": [ -2.881, 9.857, -2.814 ], "form": ".", "ssZp": 0.952, "Dp": 1.276, "splay_angle": 24.389, "splay_distance": 4.405, "splay_ratio": 0.228, "d22": 5.411, "d64": 3.971, "eta": 179.093, "theta": -170.676, "eta_prime": -143.120, "theta_prime": -164.137, "eta_base": -131.340, "theta_base": -142.450, "v0": -45.676, "v1": 39.404, "v2": -18.266, "v3": -7.608, "v4": 33.118, "amplitude": 44.772, "phase_angle": 114.078, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -82.766, -55.532, -80.658 ], "x_axis": [ -0.274, 0.221, -0.936 ], "y_axis": [ -0.030, -0.975, -0.221 ], "z_axis": [ -0.961, -0.033, 0.274 ], "quaternion": [ 0.079, -0.597, -0.080, 0.794 ] } }, { "index": 62, "index_chain": 25, "chain_name": "Y", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/25", "linked_nts": [ "///Y/24", "///Y/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -98.078, "beta": 112.310, "gamma": 84.534, "delta": 121.402, "epsilon": -170.583, "zeta": -84.654, "epsilon_zeta": -85.929, "bb_type": "BI", "chi": -102.619, "glyco_bond": "anti", "C5prime_xyz": [ -3.093, 8.187, -2.288 ], "P_xyz": [ -0.984, 7.841, -3.935 ], "form": ".", "ssZp": 2.241, "Dp": 2.298, "splay_angle": 30.605, "splay_distance": 5.148, "splay_ratio": 0.264, "d22": 4.293, "d64": 4.449, "eta": 146.770, "theta": -137.099, "eta_prime": -178.065, "theta_prime": 177.347, "eta_base": -156.245, "theta_base": -118.128, "v0": -36.348, "v1": 38.943, "v2": -27.420, "v3": 7.066, "v4": 18.460, "amplitude": 39.308, "phase_angle": 134.232, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ -86.185, -57.631, -78.840 ], "x_axis": [ -0.099, -0.156, -0.983 ], "y_axis": [ -0.026, -0.987, 0.159 ], "z_axis": [ -0.995, 0.041, 0.094 ], "quaternion": [ -0.044, -0.670, 0.068, 0.738 ] } }, { "index": 63, "index_chain": 26, "chain_name": "Y", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/26", "linked_nts": [ "///Y/25", "///Y/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -114.852, "beta": 122.625, "gamma": 117.850, "delta": 81.227, "epsilon": -119.794, "zeta": -139.534, "epsilon_zeta": 19.739, "bb_type": "--", "chi": -166.815, "glyco_bond": "anti", "C5prime_xyz": [ -0.889, 8.558, 1.054 ], "P_xyz": [ 0.587, 9.687, -0.841 ], "form": ".", "ssZp": 4.503, "Dp": 4.784, "splay_angle": 27.227, "splay_distance": 4.489, "splay_ratio": 0.240, "d22": 4.504, "d64": 5.769, "eta": 164.191, "theta": -165.604, "eta_prime": 169.315, "theta_prime": -164.677, "eta_base": -112.836, "theta_base": -172.019, "v0": 15.915, "v1": -37.584, "v2": 44.301, "v3": -35.864, "v4": 12.739, "amplitude": 44.329, "phase_angle": 357.943, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.013, "origin": [ -90.872, -59.376, -80.063 ], "x_axis": [ -0.225, -0.868, -0.444 ], "y_axis": [ 0.215, -0.488, 0.846 ], "z_axis": [ -0.950, 0.095, 0.296 ], "quaternion": [ -0.382, -0.492, 0.332, 0.709 ] } }, { "index": 64, "index_chain": 27, "chain_name": "Y", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/27", "linked_nts": [ "///Y/26", "///Y/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 103.511, "beta": -80.260, "gamma": -168.797, "delta": 81.610, "epsilon": -125.925, "zeta": -63.612, "epsilon_zeta": -62.313, "bb_type": "--", "chi": 159.274, "glyco_bond": "anti", "C5prime_xyz": [ -2.527, 8.186, 2.307 ], "P_xyz": [ -1.041, 9.723, 0.719 ], "form": ".", "ssZp": 4.028, "Dp": 4.308, "splay_angle": 15.907, "splay_distance": 2.703, "splay_ratio": 0.147, "d22": 4.619, "d64": 3.664, "eta": -164.870, "theta": -152.722, "eta_prime": -154.570, "theta_prime": -145.990, "eta_base": -151.208, "theta_base": -94.880, "v0": -8.176, "v1": -19.222, "v2": 37.850, "v3": -43.567, "v4": 32.481, "amplitude": 43.344, "phase_angle": 29.162, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.012, "origin": [ -94.544, -56.827, -80.473 ], "x_axis": [ -0.188, -0.871, -0.455 ], "y_axis": [ 0.202, -0.487, 0.850 ], "z_axis": [ -0.961, 0.068, 0.267 ], "quaternion": [ -0.385, -0.508, 0.329, 0.697 ] } }, { "index": 65, "index_chain": 28, "chain_name": "Y", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/28", "linked_nts": [ "///Y/27", "///Y/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.450, "beta": -168.852, "gamma": 48.991, "delta": 144.861, "epsilon": -164.994, "zeta": -104.846, "epsilon_zeta": -60.149, "bb_type": "BI", "chi": -102.780, "glyco_bond": "anti", "C5prime_xyz": [ -2.160, 8.248, -1.917 ], "P_xyz": [ 0.156, 9.491, -1.800 ], "form": "B", "ssZp": 2.000, "Dp": 1.979, "splay_angle": 13.701, "splay_distance": 2.385, "splay_ratio": 0.120, "d22": 4.396, "d64": 3.725, "eta": 161.564, "theta": -136.823, "eta_prime": -158.228, "theta_prime": -157.286, "eta_base": -95.939, "theta_base": -112.368, "v0": -11.953, "v1": 28.258, "v2": -32.879, "v3": 26.930, "v4": -9.451, "amplitude": 32.903, "phase_angle": 177.832, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.660, "filter_rmsd": 0.119, "frame": { "rmsd": 0.018, "origin": [ -96.829, -58.057, -81.229 ], "x_axis": [ -0.064, -0.936, 0.345 ], "y_axis": [ -0.128, 0.351, 0.928 ], "z_axis": [ -0.990, 0.016, -0.143 ], "quaternion": [ 0.535, 0.426, -0.624, -0.378 ] } }, { "index": 66, "index_chain": 29, "chain_name": "Y", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/29", "linked_nts": [ "///Y/28", "///Y/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -74.023, "beta": 161.168, "gamma": 64.035, "delta": 101.136, "epsilon": -166.183, "zeta": -133.983, "epsilon_zeta": -32.200, "bb_type": "--", "chi": -119.957, "glyco_bond": "anti", "C5prime_xyz": [ -2.827, 8.425, -1.907 ], "P_xyz": [ -0.754, 9.540, -3.123 ], "form": "B", "ssZp": 2.512, "Dp": 2.924, "splay_angle": 19.021, "splay_distance": 3.277, "splay_ratio": 0.169, "d22": 4.413, "d64": 3.449, "eta": 169.877, "theta": -158.523, "eta_prime": -176.114, "theta_prime": -156.327, "eta_base": -124.247, "theta_base": -107.540, "v0": -37.369, "v1": 23.807, "v2": -2.814, "v3": -18.314, "v4": 34.883, "amplitude": 37.269, "phase_angle": 94.330, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.014, "origin": [ -99.109, -58.676, -81.554 ], "x_axis": [ -0.286, -0.593, 0.753 ], "y_axis": [ -0.353, 0.796, 0.493 ], "z_axis": [ -0.891, -0.124, -0.437 ], "quaternion": [ 0.518, 0.298, -0.794, -0.116 ] } }, { "index": 67, "index_chain": 30, "chain_name": "Y", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/30", "linked_nts": [ "///Y/29", "///Y/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 31.070, "beta": 102.609, "gamma": 13.919, "delta": 94.897, "epsilon": 96.012, "zeta": -41.169, "epsilon_zeta": -222.819, "bb_type": "--", "chi": -92.589, "glyco_bond": "anti", "C5prime_xyz": [ -3.381, 7.656, -2.716 ], "P_xyz": [ -0.992, 8.694, -3.349 ], "form": "B", "ssZp": 1.865, "Dp": 1.962, "splay_angle": 24.239, "splay_distance": 4.047, "splay_ratio": 0.210, "d22": 4.401, "d64": 4.070, "eta": 174.550, "theta": -157.111, "eta_prime": -152.463, "theta_prime": -163.876, "eta_base": -104.426, "theta_base": -138.058, "v0": -34.011, "v1": 21.548, "v2": -1.867, "v3": -17.629, "v4": 32.354, "amplitude": 34.343, "phase_angle": 93.116, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -102.337, -58.778, -81.001 ], "x_axis": [ -0.413, -0.071, 0.908 ], "y_axis": [ -0.444, 0.886, -0.133 ], "z_axis": [ -0.795, -0.458, -0.398 ], "quaternion": [ 0.518, 0.157, -0.821, 0.180 ] } }, { "index": 68, "index_chain": 31, "chain_name": "Y", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/31", "linked_nts": [ "///Y/30", "///Y/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -153.013, "beta": -101.108, "gamma": 75.367, "delta": 145.103, "epsilon": -175.092, "zeta": -165.520, "epsilon_zeta": -9.572, "bb_type": "--", "chi": -74.559, "glyco_bond": "anti", "C5prime_xyz": [ -3.899, 7.494, -2.384 ], "P_xyz": [ -1.639, 8.960, -2.597 ], "form": "B", "ssZp": 2.847, "Dp": 2.839, "splay_angle": 23.772, "splay_distance": 3.906, "splay_ratio": 0.207, "d22": 3.673, "d64": 3.169, "eta": 158.343, "theta": -142.289, "eta_prime": -179.482, "theta_prime": -154.530, "eta_base": -149.640, "theta_base": -101.895, "v0": -36.537, "v1": 50.542, "v2": -43.480, "v3": 24.399, "v4": 7.096, "amplitude": 49.036, "phase_angle": 152.461, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.057, "frame": { "rmsd": 0.012, "origin": [ -105.812, -60.180, -82.529 ], "x_axis": [ -0.460, 0.297, 0.837 ], "y_axis": [ -0.292, 0.839, -0.459 ], "z_axis": [ -0.839, -0.455, -0.299 ], "quaternion": [ 0.520, -0.002, -0.806, 0.283 ] } }, { "index": 69, "index_chain": 32, "chain_name": "Y", "nt_resnum": 32, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/32", "linked_nts": [ "///Y/31", "///Y/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 25.237, "beta": 113.575, "gamma": 16.602, "delta": 132.899, "epsilon": 175.792, "zeta": -147.971, "epsilon_zeta": -36.237, "bb_type": "--", "chi": -93.342, "glyco_bond": "anti", "C5prime_xyz": [ -3.050, 8.212, -2.311 ], "P_xyz": [ -0.561, 9.324, -2.401 ], "form": ".", "ssZp": 2.721, "Dp": 2.719, "splay_angle": 25.399, "splay_distance": 4.066, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 168.147, "theta": -179.780, "eta_prime": -170.093, "theta_prime": 178.562, "eta_base": -109.527, "theta_base": -156.377, "v0": -35.445, "v1": 44.705, "v2": -36.770, "v3": 16.804, "v4": 11.644, "amplitude": 44.111, "phase_angle": 146.470, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.016, "origin": [ -109.555, -59.702, -81.520 ], "x_axis": [ -0.301, 0.887, 0.349 ], "y_axis": [ -0.138, 0.322, -0.937 ], "z_axis": [ -0.944, -0.330, 0.025 ], "quaternion": [ 0.512, -0.296, -0.632, 0.501 ] } }, { "index": 70, "index_chain": 33, "chain_name": "Y", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/33", "linked_nts": [ "///Y/32", "///Y/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.109, "beta": 176.853, "gamma": 75.024, "delta": 158.063, "epsilon": 170.034, "zeta": -109.989, "epsilon_zeta": -79.977, "bb_type": "BI", "chi": -117.465, "glyco_bond": "anti", "C5prime_xyz": [ -1.457, 8.437, -1.212 ], "P_xyz": [ 1.159, 8.181, -0.723 ], "form": ".", "ssZp": 1.448, "Dp": 1.721, "splay_angle": 20.998, "splay_distance": 3.541, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 153.916, "theta": -84.940, "eta_prime": -164.028, "theta_prime": -136.199, "eta_base": -140.876, "theta_base": -123.651, "v0": -11.744, "v1": 32.416, "v2": -41.365, "v3": 34.764, "v4": -14.477, "amplitude": 41.398, "phase_angle": 182.285, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.017, "origin": [ -112.802, -62.064, -82.165 ], "x_axis": [ -0.024, 0.991, -0.130 ], "y_axis": [ 0.026, -0.129, -0.991 ], "z_axis": [ -0.999, -0.027, -0.023 ], "quaternion": [ 0.454, -0.531, -0.479, 0.532 ] } }, { "index": 71, "index_chain": 34, "chain_name": "Y", "nt_resnum": 34, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/34", "linked_nts": [ "///Y/33", "///Y/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -153.010, "beta": -128.505, "gamma": 105.631, "delta": 138.424, "epsilon": -92.137, "zeta": 178.146, "epsilon_zeta": 89.716, "bb_type": "BII", "chi": -94.123, "glyco_bond": "anti", "C5prime_xyz": [ -4.021, 7.879, -2.130 ], "P_xyz": [ -1.925, 9.250, -2.806 ], "form": "B", "ssZp": 1.385, "Dp": 1.794, "splay_angle": 22.139, "splay_distance": 3.806, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 174.513, "theta": -129.291, "eta_prime": -158.887, "theta_prime": -155.715, "eta_base": -138.776, "theta_base": -102.495, "v0": -44.737, "v1": 52.951, "v2": -40.422, "v3": 16.028, "v4": 17.846, "amplitude": 51.761, "phase_angle": 141.345, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.015, "origin": [ -116.084, -62.354, -80.869 ], "x_axis": [ -0.100, 0.863, -0.496 ], "y_axis": [ -0.089, -0.504, -0.859 ], "z_axis": [ -0.991, -0.041, 0.127 ], "quaternion": [ 0.362, -0.565, -0.342, 0.658 ] } }, { "index": 72, "index_chain": 35, "chain_name": "Y", "nt_resnum": 35, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/35", "linked_nts": [ "///Y/34", "///Y/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 85.838, "beta": -110.431, "gamma": 174.893, "delta": 107.156, "epsilon": -100.244, "zeta": -164.554, "epsilon_zeta": 64.310, "bb_type": "BII", "chi": -143.207, "glyco_bond": "anti", "C5prime_xyz": [ -3.678, 8.595, -0.931 ], "P_xyz": [ -2.085, 9.452, -2.855 ], "form": "B", "ssZp": 1.870, "Dp": 1.870, "splay_angle": 18.225, "splay_distance": 3.129, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": -176.909, "theta": -177.366, "eta_prime": -171.862, "theta_prime": 178.567, "eta_base": -120.208, "theta_base": -136.985, "v0": -56.790, "v1": 46.152, "v2": -18.304, "v3": -13.971, "v4": 43.571, "amplitude": 55.264, "phase_angle": 109.342, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.016, "origin": [ -119.677, -61.684, -81.930 ], "x_axis": [ 0.097, 0.374, -0.922 ], "y_axis": [ -0.041, -0.924, -0.379 ], "z_axis": [ -0.994, 0.074, -0.074 ], "quaternion": [ -0.157, 0.724, 0.115, -0.662 ] } }, { "index": 73, "index_chain": 36, "chain_name": "Y", "nt_resnum": 36, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/36", "linked_nts": [ "///Y/35", "///Y/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 74.070, "beta": -90.510, "gamma": -176.060, "delta": 81.350, "epsilon": -147.579, "zeta": -39.160, "epsilon_zeta": -108.419, "bb_type": "BI", "chi": -179.558, "glyco_bond": "anti", "C5prime_xyz": [ -3.279, 8.854, 0.561 ], "P_xyz": [ -1.698, 9.660, -1.491 ], "form": "B", "ssZp": 3.568, "Dp": 3.661, "splay_angle": 17.723, "splay_distance": 2.905, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 164.270, "theta": -153.478, "eta_prime": 176.282, "theta_prime": -173.646, "eta_base": -136.395, "theta_base": -124.616, "v0": -34.210, "v1": 4.173, "v2": 25.356, "v3": -45.766, "v4": 50.099, "amplitude": 50.454, "phase_angle": 59.831, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -122.767, -61.237, -82.130 ], "x_axis": [ 0.026, -0.124, -0.992 ], "y_axis": [ -0.114, -0.986, 0.120 ], "z_axis": [ -0.993, 0.110, -0.040 ], "quaternion": [ 0.003, 0.716, -0.083, -0.693 ] } }, { "index": 74, "index_chain": 37, "chain_name": "Y", "nt_resnum": 37, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/37", "linked_nts": [ "///Y/36", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -149.277, "beta": 89.795, "gamma": 143.093, "delta": 106.948, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -167.702, "glyco_bond": "anti", "C5prime_xyz": [ -0.880, 8.150, 1.275 ], "P_xyz": [ 0.112, 9.489, -0.825 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 21.192, "v1": -26.703, "v2": 22.364, "v3": -10.943, "v4": -6.224, "amplitude": 26.400, "phase_angle": 327.901, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ -125.390, -60.625, -83.219 ], "x_axis": [ -0.038, -0.772, -0.635 ], "y_axis": [ -0.274, -0.603, 0.749 ], "z_axis": [ -0.961, 0.202, -0.189 ], "quaternion": [ 0.207, 0.662, -0.395, -0.602 ] } } ], "num_hbonds": 1394, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 30, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/13/O", "atom2_id": "///A/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 25, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/15/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 40, "atom2_serNum": 2891, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/16/NH1", "atom2_id": "///A/376/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 41, "atom2_serNum": 2891, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/16/NH2", "atom2_id": "///A/376/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 42, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///A/17/N", "atom2_id": "///A/417/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 53, "atom2_serNum": 82, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 55, "atom2_serNum": 77, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///A/18/OG1", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 60, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/19/O", "atom2_id": "///A/23/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 60, "atom2_serNum": 99, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/19/O", "atom2_id": "///A/23/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 64, "atom2_serNum": 2875, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/19/NE", "atom2_id": "///A/374/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 66, "atom2_serNum": 2875, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/19/NH1", "atom2_id": "///A/374/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 66, "atom2_serNum": 3037, "donAcc_type": "standard", "distance": 3.918, "atom1_id": "///A/19/NH1", "atom2_id": "///A/396/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 71, "atom2_serNum": 90, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/20/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 71, "atom2_serNum": 101, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 85, "atom2_serNum": 121, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 93, "atom2_serNum": 137, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/23/O", "atom2_id": "///A/27/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 112, "atom2_serNum": 147, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 120, "atom2_serNum": 169, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///A/25/OH", "atom2_id": "///A/31/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 150, "atom2_serNum": 162, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/29/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 173, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/32/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 177, "atom2_serNum": 989, "donAcc_type": "acceptable", "distance": 2.686, "atom1_id": "///A/32/OE1", "atom2_id": "///A/133/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 178, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 3.814, "atom1_id": "///A/32/NE2", "atom2_id": "///A/328/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 179, "atom2_serNum": 442, "donAcc_type": "questionable", "distance": 3.228, "atom1_id": "///A/33/N", "atom2_id": "///A/66/NE1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 182, "atom2_serNum": 415, "donAcc_type": "questionable", "distance": 2.963, "atom1_id": "///A/33/O", "atom2_id": "///A/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 184, "atom2_serNum": 189, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///A/33/OG1", "atom2_id": "///A/34/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 186, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/34/N", "atom2_id": "///A/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 196, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///A/35/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 201, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/36/N", "atom2_id": "///A/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 204, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/36/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 209, "atom2_serNum": 382, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/37/N", "atom2_id": "///A/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 212, "atom2_serNum": 379, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/37/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 217, "atom2_serNum": 223, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///A/38/N", "atom2_id": "///A/38/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 217, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/38/N", "atom2_id": "///A/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 220, "atom2_serNum": 2458, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/38/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 232, "atom2_serNum": 2448, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/40/N", "atom2_id": "///A/318/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 235, "atom2_serNum": 1096, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/40/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 240, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/40/NZ", "atom2_id": "///A/319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 248, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/42/N", "atom2_id": "///A/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 251, "atom2_serNum": 1112, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/42/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 256, "atom2_serNum": 276, "donAcc_type": "acceptable", "distance": 3.739, "atom1_id": "///A/43/O", "atom2_id": "///A/45/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 262, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/44/N", "atom2_id": "///A/150/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 270, "atom2_serNum": 846, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/44/NZ", "atom2_id": "///A/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 270, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/44/NZ", "atom2_id": "///A/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 271, "atom2_serNum": 838, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/45/N", "atom2_id": "///A/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 276, "atom2_serNum": 319, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///A/45/OG", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 288, "atom2_serNum": 12028, "donAcc_type": "acceptable", "distance": 3.322, "atom1_id": "///A/46/OH", "atom2_id": "///Y/29/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 47, "atom1_serNum": 308, "atom2_serNum": 329, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/49/OE1", "atom2_id": "///A/51/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 309, "atom2_serNum": 326, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///A/49/OE2", "atom2_id": "///A/51/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 309, "atom2_serNum": 329, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/49/OE2", "atom2_id": "///A/51/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 313, "atom2_serNum": 330, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/50/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 328, "atom2_serNum": 10828, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/51/NH1", "atom2_id": "///X/7/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 329, "atom2_serNum": 10831, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/51/NH2", "atom2_id": "///X/7/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 53, "atom1_serNum": 330, "atom2_serNum": 10797, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/52/N", "atom2_id": "///X/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 54, "atom1_serNum": 333, "atom2_serNum": 352, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/52/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 341, "atom2_serNum": 818, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/53/N", "atom2_id": "///A/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 368, "atom2_serNum": 1529, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/56/O", "atom2_id": "///A/203/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 375, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///A/57/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 382, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/58/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 385, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/59/N", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 403, "atom2_serNum": 1519, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///A/60/OH", "atom2_id": "///A/202/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 403, "atom2_serNum": 1520, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///A/60/OH", "atom2_id": "///A/202/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 415, "atom2_serNum": 442, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/62/O", "atom2_id": "///A/66/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 423, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///A/63/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 427, "atom2_serNum": 429, "donAcc_type": "acceptable", "distance": 2.473, "atom1_id": "///A/64/O", "atom2_id": "///A/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 433, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 437, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/66/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 437, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 451, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/67/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 451, "atom2_serNum": 484, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 460, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 469, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 474, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/69/NZ", "atom2_id": "///A/328/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 478, "atom2_serNum": 510, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 483, "atom2_serNum": 561, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/70/NZ", "atom2_id": "///A/80/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 487, "atom2_serNum": 519, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 496, "atom2_serNum": 537, "donAcc_type": "questionable", "distance": 2.554, "atom1_id": "///A/72/O", "atom2_id": "///A/76/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 505, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 3.803, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 513, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/74/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 513, "atom2_serNum": 542, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 518, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/74/OE2", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 548, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/79/N", "atom2_id": "///A/82/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 551, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 553, "atom2_serNum": 579, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///A/79/OG", "atom2_id": "///A/82/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 563, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/81/N", "atom2_id": "///A/81/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 575, "atom2_serNum": 990, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/82/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 575, "atom2_serNum": 1000, "donAcc_type": "questionable", "distance": 3.022, "atom1_id": "///A/82/O", "atom2_id": "///A/135/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 594, "atom2_serNum": 747, "donAcc_type": "questionable", "distance": 3.266, "atom1_id": "///A/84/OE1", "atom2_id": "///A/104/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 603, "atom2_serNum": 970, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/86/N", "atom2_id": "///A/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 612, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/87/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 614, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/88/N", "atom2_id": "///A/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 617, "atom2_serNum": 950, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/88/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 625, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/89/N", "atom2_id": "///A/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 628, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/89/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 633, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/90/N", "atom2_id": "///A/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 636, "atom2_serNum": 937, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/90/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 640, "atom2_serNum": 890, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/91/O", "atom2_id": "///A/122/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 648, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/92/O", "atom2_id": "///A/122/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 656, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///A/93/ND2", "atom2_id": "///A/120/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 679, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/96/NE2", "atom2_id": "///A/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 692, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/98/O", "atom2_id": "///C/62/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 713, "atom2_serNum": 5276, "donAcc_type": "questionable", "distance": 3.025, "atom1_id": "///A/100/OE1", "atom2_id": "///C/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 714, "atom2_serNum": 5287, "donAcc_type": "standard", "distance": 3.843, "atom1_id": "///A/100/NE2", "atom2_id": "///C/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 718, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/101/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 726, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/102/O", "atom2_id": "///A/106/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 730, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///A/102/ND2", "atom2_id": "///A/104/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 742, "atom2_serNum": 752, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/104/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 792, "atom2_serNum": 807, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///A/110/OG1", "atom2_id": "///A/112/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 807, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 3.970, "atom1_id": "///A/112/NZ", "atom2_id": "///A/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 807, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/112/NZ", "atom2_id": "///A/201/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 811, "atom2_serNum": 813, "donAcc_type": "acceptable", "distance": 2.613, "atom1_id": "///A/113/O", "atom2_id": "///A/113/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 849, "atom2_serNum": 855, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/118/N", "atom2_id": "///A/118/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 852, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///A/118/O", "atom2_id": "///A/121/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 874, "atom2_serNum": 891, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/121/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 887, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///A/122/NE", "atom2_id": "///A/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 899, "atom2_serNum": 12007, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/123/NZ", "atom2_id": "///Y/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 116, "atom1_serNum": 910, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/125/N", "atom2_id": "///A/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 913, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/125/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 929, "atom2_serNum": 1067, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/127/N", "atom2_id": "///A/144/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 932, "atom2_serNum": 1062, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/127/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 940, "atom2_serNum": 942, "donAcc_type": "acceptable", "distance": 3.066, "atom1_id": "///A/128/O", "atom2_id": "///A/128/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 943, "atom2_serNum": 1046, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/129/N", "atom2_id": "///A/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 958, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/130/NZ", "atom2_id": "///A/138/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 958, "atom2_serNum": 5228, "donAcc_type": "acceptable", "distance": 3.247, "atom1_id": "///A/130/NZ", "atom2_id": "///C/56/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 962, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/131/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 962, "atom2_serNum": 1032, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/131/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 978, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/133/N", "atom2_id": "///A/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 981, "atom2_serNum": 1002, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/133/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 993, "atom2_serNum": 1002, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/134/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 993, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/134/O", "atom2_id": "///C/60/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1001, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/135/ND2", "atom2_id": "///A/137/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1005, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/136/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1022, "atom2_serNum": 5228, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///A/138/OD1", "atom2_id": "///C/56/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1023, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/138/OD2", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1023, "atom2_serNum": 1032, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/138/OD2", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1036, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 3.996, "atom1_id": "///A/141/N", "atom2_id": "///C/52/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1039, "atom2_serNum": 2602, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///A/141/O", "atom2_id": "///A/338/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1057, "atom2_serNum": 2500, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///A/143/O", "atom2_id": "///A/324/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1065, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/144/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1076, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///A/145/NZ", "atom2_id": "///A/321/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1084, "atom2_serNum": 4648, "donAcc_type": "acceptable", "distance": 3.514, "atom1_id": "///A/146/NE", "atom2_id": "///B/2093/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1125, "atom2_serNum": 12008, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///A/151/OG", "atom2_id": "///Y/28/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 142, "atom1_serNum": 1129, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/152/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1134, "atom2_serNum": 10872, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/152/NZ", "atom2_id": "///X/9/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 144, "atom1_serNum": 1134, "atom2_serNum": 10875, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///A/152/NZ", "atom2_id": "///X/9/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 145, "atom1_serNum": 1138, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///A/153/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1145, "atom2_serNum": 1157, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/154/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1145, "atom2_serNum": 2033, "donAcc_type": "acceptable", "distance": 2.839, "atom1_id": "///A/154/O", "atom2_id": "///A/267/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1147, "atom2_serNum": 11988, "donAcc_type": "acceptable", "distance": 3.337, "atom1_id": "///A/154/OG", "atom2_id": "///Y/27/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 149, "atom1_serNum": 1165, "atom2_serNum": 11988, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/156/NZ", "atom2_id": "///Y/27/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 150, "atom1_serNum": 1169, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///A/157/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1174, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/157/NZ", "atom2_id": "///A/263/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1178, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/158/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1182, "atom2_serNum": 2001, "donAcc_type": "questionable", "distance": 2.723, "atom1_id": "///A/158/OE1", "atom2_id": "///A/263/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1206, "atom2_serNum": 11955, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/161/NZ", "atom2_id": "///Y/25/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 155, "atom1_serNum": 1206, "atom2_serNum": 11973, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/161/NZ", "atom2_id": "///Y/26/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 156, "atom1_serNum": 1210, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 2.364, "atom1_id": "///A/162/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1231, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/165/O", "atom2_id": "///A/268/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1239, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/166/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1242, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/167/N", "atom2_id": "///A/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1245, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/167/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1255, "atom2_serNum": 1717, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/169/N", "atom2_id": "///A/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1258, "atom2_serNum": 1265, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/169/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1260, "atom2_serNum": 1569, "donAcc_type": "acceptable", "distance": 3.982, "atom1_id": "///A/169/OG", "atom2_id": "///A/208/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1260, "atom2_serNum": 1584, "donAcc_type": "acceptable", "distance": 3.637, "atom1_id": "///A/169/OG", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1260, "atom2_serNum": 1698, "donAcc_type": "acceptable", "distance": 3.416, "atom1_id": "///A/169/OG", "atom2_id": "///A/224/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1268, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/171/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1270, "atom2_serNum": 2450, "donAcc_type": "acceptable", "distance": 2.745, "atom1_id": "///A/171/OG1", "atom2_id": "///A/318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1275, "atom2_serNum": 2451, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/172/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1280, "atom2_serNum": 2464, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///A/172/NZ", "atom2_id": "///A/320/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1281, "atom2_serNum": 1547, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///A/173/N", "atom2_id": "///A/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1284, "atom2_serNum": 1544, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/173/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1288, "atom2_serNum": 2440, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/174/N", "atom2_id": "///A/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1291, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/174/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1291, "atom2_serNum": 2440, "donAcc_type": "questionable", "distance": 2.864, "atom1_id": "///A/174/O", "atom2_id": "///A/317/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1296, "atom2_serNum": 1415, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/175/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1301, "atom2_serNum": 2425, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/176/N", "atom2_id": "///A/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1304, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/176/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1312, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/177/N", "atom2_id": "///A/187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1315, "atom2_serNum": 1392, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/177/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1319, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///A/177/ND2", "atom2_id": "///A/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1319, "atom2_serNum": 2405, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/177/ND2", "atom2_id": "///A/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1327, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/178/NE", "atom2_id": "///X/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 183, "atom1_serNum": 1329, "atom2_serNum": 10803, "donAcc_type": "standard", "distance": 2.056, "atom1_id": "///A/178/NH1", "atom2_id": "///X/6/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 184, "atom1_serNum": 1329, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/178/NH1", "atom2_id": "///X/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 185, "atom1_serNum": 1330, "atom2_serNum": 1390, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///A/178/NH2", "atom2_id": "///A/186/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1331, "atom2_serNum": 1384, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///A/179/N", "atom2_id": "///A/185/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1334, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///A/179/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1334, "atom2_serNum": 1356, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/179/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1346, "atom2_serNum": 12165, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/180/NE", "atom2_id": "///Y/36/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 190, "atom1_serNum": 1349, "atom2_serNum": 12165, "donAcc_type": "standard", "distance": 2.465, "atom1_id": "///A/180/NH2", "atom2_id": "///Y/36/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 191, "atom1_serNum": 1353, "atom2_serNum": 1355, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///A/181/O", "atom2_id": "///A/181/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1353, "atom2_serNum": 10792, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/181/O", "atom2_id": "///X/5/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 193, "atom1_serNum": 1355, "atom2_serNum": 10808, "donAcc_type": "acceptable", "distance": 3.837, "atom1_id": "///A/181/OG", "atom2_id": "///X/6/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 194, "atom1_serNum": 1359, "atom2_serNum": 1379, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/182/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1359, "atom2_serNum": 1384, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///A/182/O", "atom2_id": "///A/185/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1363, "atom2_serNum": 12162, "donAcc_type": "questionable", "distance": 2.730, "atom1_id": "///A/182/OE1", "atom2_id": "///Y/35/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 197, "atom1_serNum": 1368, "atom2_serNum": 1390, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/183/O", "atom2_id": "///A/186/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1399, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/187/NE", "atom2_id": "///A/198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1401, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/187/NH1", "atom2_id": "///A/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1402, "atom2_serNum": 2232, "donAcc_type": "questionable", "distance": 2.885, "atom1_id": "///A/187/NH2", "atom2_id": "///A/290/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1403, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/188/N", "atom2_id": "///A/199/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1406, "atom2_serNum": 1423, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/188/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1418, "atom2_serNum": 1535, "donAcc_type": "standard", "distance": 3.642, "atom1_id": "///A/189/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1423, "atom2_serNum": 1479, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/190/N", "atom2_id": "///A/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1426, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/190/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1429, "atom2_serNum": 1485, "donAcc_type": "acceptable", "distance": 3.496, "atom1_id": "///A/190/ND1", "atom2_id": "///A/197/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1440, "atom2_serNum": 1460, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///A/192/N", "atom2_id": "///A/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1443, "atom2_serNum": 1457, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/192/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1496, "atom2_serNum": 1503, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///A/199/OG", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1496, "atom2_serNum": 1512, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///A/199/OG", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1542, "atom2_serNum": 1822, "donAcc_type": "acceptable", "distance": 3.267, "atom1_id": "///A/205/O", "atom2_id": "///A/239/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1555, "atom2_serNum": 1807, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/207/N", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1558, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/207/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1574, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///A/209/N", "atom2_id": "///A/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1592, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/211/N", "atom2_id": "///A/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1636, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/216/O", "atom2_id": "///A/247/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1636, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/216/O", "atom2_id": "///A/247/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1651, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///A/218/O", "atom2_id": "///A/235/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1664, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/220/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1684, "atom2_serNum": 1686, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/222/O", "atom2_id": "///A/222/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1721, "atom2_serNum": 1772, "donAcc_type": "standard", "distance": 3.896, "atom1_id": "///A/227/O", "atom2_id": "///A/232/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1733, "atom2_serNum": 2021, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/228/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1741, "atom2_serNum": 1764, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/229/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1748, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/230/N", "atom2_id": "///A/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1751, "atom2_serNum": 1996, "donAcc_type": "questionable", "distance": 2.500, "atom1_id": "///A/230/O", "atom2_id": "///A/262/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1759, "atom2_serNum": 2057, "donAcc_type": "acceptable", "distance": 2.868, "atom1_id": "///A/230/OH", "atom2_id": "///A/270/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1760, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///A/231/N", "atom2_id": "///A/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1767, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///A/232/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1780, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/234/N", "atom2_id": "///A/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1783, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///A/234/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1799, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/236/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1811, "atom2_serNum": 1844, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/238/N", "atom2_id": "///A/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1814, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1865, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/246/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1872, "atom2_serNum": 2112, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/247/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1888, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/249/N", "atom2_id": "///A/275/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1891, "atom2_serNum": 2079, "donAcc_type": "questionable", "distance": 3.277, "atom1_id": "///A/249/O", "atom2_id": "///A/273/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1891, "atom2_serNum": 2092, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/249/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1904, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/251/N", "atom2_id": "///A/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1907, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/251/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1931, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/254/N", "atom2_id": "///A/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1934, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/254/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1934, "atom2_serNum": 1962, "donAcc_type": "acceptable", "distance": 2.496, "atom1_id": "///A/254/O", "atom2_id": "///A/257/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1938, "atom2_serNum": 1939, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/254/OD2", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1947, "atom2_serNum": 10845, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/255/NZ", "atom2_id": "///X/8/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 246, "atom1_serNum": 1947, "atom2_serNum": 10860, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///A/255/NZ", "atom2_id": "///X/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 247, "atom1_serNum": 1951, "atom2_serNum": 2369, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/256/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1964, "atom2_serNum": 2355, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/258/N", "atom2_id": "///A/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1967, "atom2_serNum": 1977, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/258/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1977, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/260/N", "atom2_id": "///A/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2017, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/265/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2041, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///A/268/OE1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2043, "atom2_serNum": 2432, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/269/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2051, "atom2_serNum": 2432, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///A/270/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2054, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/270/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2069, "atom2_serNum": 2427, "donAcc_type": "acceptable", "distance": 3.226, "atom1_id": "///A/271/NZ", "atom2_id": "///A/315/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2069, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/271/NZ", "atom2_id": "///X/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 258, "atom1_serNum": 2070, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/272/N", "atom2_id": "///A/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2073, "atom2_serNum": 2400, "donAcc_type": "questionable", "distance": 3.247, "atom1_id": "///A/272/O", "atom2_id": "///A/312/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2073, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/272/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2084, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/274/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2084, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/274/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2103, "atom2_serNum": 2139, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///A/275/OH", "atom2_id": "///A/280/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2107, "atom2_serNum": 2134, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///A/276/O", "atom2_id": "///A/279/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2132, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 3.862, "atom1_id": "///A/279/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2145, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 3.618, "atom1_id": "///A/281/N", "atom2_id": "///A/295/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2154, "atom2_serNum": 2286, "donAcc_type": "standard", "distance": 3.576, "atom1_id": "///A/281/NH1", "atom2_id": "///A/297/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2164, "atom2_serNum": 2261, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/283/N", "atom2_id": "///A/294/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2167, "atom2_serNum": 2258, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/283/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2179, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///A/284/O", "atom2_id": "///A/314/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2184, "atom2_serNum": 2244, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/285/N", "atom2_id": "///A/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2187, "atom2_serNum": 2244, "donAcc_type": "questionable", "distance": 2.873, "atom1_id": "///A/285/O", "atom2_id": "///A/292/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2190, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 2.449, "atom1_id": "///A/286/N", "atom2_id": "///A/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2203, "atom2_serNum": 2225, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///A/287/OG", "atom2_id": "///A/290/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2203, "atom2_serNum": 2241, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///A/287/OG", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2283, "atom2_serNum": 2364, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/297/N", "atom2_id": "///A/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2293, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///A/298/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2319, "atom2_serNum": 2327, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/302/N", "atom2_id": "///A/302/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2383, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/309/OD1", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2388, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///A/310/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2396, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 3.844, "atom1_id": "///A/311/O", "atom2_id": "///A/314/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2464, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/320/OD1", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2506, "atom2_serNum": 3265, "donAcc_type": "acceptable", "distance": 3.772, "atom1_id": "///A/325/OG1", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2519, "atom2_serNum": 3248, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/327/N", "atom2_id": "///A/421/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2522, "atom2_serNum": 3245, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/327/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2534, "atom2_serNum": 2544, "donAcc_type": "standard", "distance": 2.104, "atom1_id": "///A/328/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2534, "atom2_serNum": 2552, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/328/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2538, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/328/OE1", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2586, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///A/336/O", "atom2_id": "///A/416/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2593, "atom2_serNum": 3264, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///A/337/O", "atom2_id": "///A/422/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2625, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/342/N", "atom2_id": "///A/362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2628, "atom2_serNum": 2763, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/342/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2639, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/344/N", "atom2_id": "///A/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2647, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///A/344/OE2", "atom2_id": "///A/362/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2648, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/345/N", "atom2_id": "///A/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2651, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/345/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2651, "atom2_serNum": 2757, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///A/345/O", "atom2_id": "///A/360/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2653, "atom2_serNum": 2669, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///A/345/OG", "atom2_id": "///A/347/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2662, "atom2_serNum": 2738, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/347/N", "atom2_id": "///A/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2665, "atom2_serNum": 2735, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/347/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2682, "atom2_serNum": 2719, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/349/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2690, "atom2_serNum": 3470, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/350/O", "atom2_id": "///B/1938/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2694, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/351/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2727, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/357/N", "atom2_id": "///A/389/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2730, "atom2_serNum": 2985, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/357/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2742, "atom2_serNum": 3976, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/358/OE1", "atom2_id": "///B/2005/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2743, "atom2_serNum": 3979, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/358/OE2", "atom2_id": "///B/2005/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2744, "atom2_serNum": 2972, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///A/359/N", "atom2_id": "///A/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2747, "atom2_serNum": 2969, "donAcc_type": "standard", "distance": 2.477, "atom1_id": "///A/359/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2759, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/361/N", "atom2_id": "///A/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2775, "atom2_serNum": 2796, "donAcc_type": "acceptable", "distance": 3.823, "atom1_id": "///A/363/O", "atom2_id": "///A/365/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2780, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/364/N", "atom2_id": "///A/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2801, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/366/O", "atom2_id": "///A/369/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2801, "atom2_serNum": 5048, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///A/366/O", "atom2_id": "///C/34/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2808, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/367/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2816, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/368/O", "atom2_id": "///A/369/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2821, "atom2_serNum": 3202, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/369/N", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2824, "atom2_serNum": 3199, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/369/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2830, "atom2_serNum": 5076, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/369/NH1", "atom2_id": "///C/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2831, "atom2_serNum": 5076, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///A/369/NH2", "atom2_id": "///C/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2832, "atom2_serNum": 2911, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///A/370/N", "atom2_id": "///A/379/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2835, "atom2_serNum": 2892, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/370/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2839, "atom2_serNum": 3187, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/371/N", "atom2_id": "///A/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2842, "atom2_serNum": 3184, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/371/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2847, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///A/371/NE1", "atom2_id": "///A/376/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2853, "atom2_serNum": 2879, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/372/N", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2856, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/372/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2864, "atom2_serNum": 3173, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/373/N", "atom2_id": "///A/411/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2895, "atom2_serNum": 2911, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///A/377/O", "atom2_id": "///A/379/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2900, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/378/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2904, "atom2_serNum": 5016, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/378/OE1", "atom2_id": "///C/31/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2905, "atom2_serNum": 5016, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/378/OE2", "atom2_id": "///C/31/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2913, "atom2_serNum": 2980, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///A/380/N", "atom2_id": "///A/388/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2916, "atom2_serNum": 2977, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/380/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2932, "atom2_serNum": 4482, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///A/381/OH", "atom2_id": "///B/2072/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2933, "atom2_serNum": 2966, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/382/N", "atom2_id": "///A/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2936, "atom2_serNum": 5038, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/382/O", "atom2_id": "///C/33/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2940, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/382/NE", "atom2_id": "///B/2005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2943, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/382/NH2", "atom2_id": "///B/2005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2944, "atom2_serNum": 2966, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/383/N", "atom2_id": "///A/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2947, "atom2_serNum": 2954, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/383/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2947, "atom2_serNum": 2963, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/383/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2947, "atom2_serNum": 2966, "donAcc_type": "questionable", "distance": 2.760, "atom1_id": "///A/383/O", "atom2_id": "///A/386/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2950, "atom2_serNum": 4481, "donAcc_type": "standard", "distance": 2.346, "atom1_id": "///A/384/N", "atom2_id": "///B/2072/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2961, "atom2_serNum": 4473, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/385/OE1", "atom2_id": "///B/2071/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2962, "atom2_serNum": 4473, "donAcc_type": "standard", "distance": 2.248, "atom1_id": "///A/385/OE2", "atom2_id": "///B/2071/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2994, "atom2_serNum": 3005, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/390/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3008, "atom2_serNum": 3328, "donAcc_type": "acceptable", "distance": 2.369, "atom1_id": "///A/392/O", "atom2_id": "///A/430/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3019, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/393/OD2", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3019, "atom2_serNum": 3033, "donAcc_type": "acceptable", "distance": 2.664, "atom1_id": "///A/393/OD2", "atom2_id": "///A/395/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3023, "atom2_serNum": 3034, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/394/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3023, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/394/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3023, "atom2_serNum": 3050, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3053, "atom2_serNum": 3073, "donAcc_type": "questionable", "distance": 2.421, "atom1_id": "///A/398/O", "atom2_id": "///A/400/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3061, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/399/N", "atom2_id": "///A/399/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3102, "atom2_serNum": 3120, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/403/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3147, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/408/N", "atom2_id": "///A/430/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3150, "atom2_serNum": 3317, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///A/408/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3163, "atom2_serNum": 3302, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/410/N", "atom2_id": "///A/428/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3166, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/410/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3177, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/412/N", "atom2_id": "///A/426/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3180, "atom2_serNum": 3276, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///A/412/O", "atom2_id": "///A/424/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3191, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/414/N", "atom2_id": "///A/422/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3194, "atom2_serNum": 3253, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/414/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3206, "atom2_serNum": 3240, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/416/N", "atom2_id": "///A/420/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3213, "atom2_serNum": 3264, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///A/416/NE", "atom2_id": "///A/422/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3215, "atom2_serNum": 3231, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/416/NH1", "atom2_id": "///A/418/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3216, "atom2_serNum": 3264, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///A/416/NH2", "atom2_id": "///A/422/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3224, "atom2_serNum": 5076, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/417/ND2", "atom2_id": "///C/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3224, "atom2_serNum": 5112, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///A/417/ND2", "atom2_id": "///C/42/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3228, "atom2_serNum": 3237, "donAcc_type": "standard", "distance": 2.439, "atom1_id": "///A/418/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3274, "atom2_serNum": 3283, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///A/424/O", "atom2_id": "///A/425/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3276, "atom2_serNum": 3284, "donAcc_type": "acceptable", "distance": 3.105, "atom1_id": "///A/424/OG1", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3281, "atom2_serNum": 3283, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///A/425/O", "atom2_id": "///A/425/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3295, "atom2_serNum": 3297, "donAcc_type": "acceptable", "distance": 2.595, "atom1_id": "///A/427/O", "atom2_id": "///A/427/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3332, "atom2_serNum": 3334, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///A/431/O", "atom2_id": "///A/431/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3343, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/433/N", "atom2_id": "///A/433/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3368, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///B/1924/NE2", "atom2_id": "///B/1960/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3369, "atom2_serNum": 3409, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///B/1925/N", "atom2_id": "///B/1930/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3372, "atom2_serNum": 3384, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/1925/O", "atom2_id": "///B/1927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3398, "atom2_serNum": 3634, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/1928/O", "atom2_id": "///B/1960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3413, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/1930/OE1", "atom2_id": "///B/1938/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3414, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///B/1930/OE2", "atom2_id": "///B/1938/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3415, "atom2_serNum": 3441, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///B/1931/N", "atom2_id": "///B/1934/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3418, "atom2_serNum": 3445, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/1931/O", "atom2_id": "///B/1935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3425, "atom2_serNum": 3453, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/1932/O", "atom2_id": "///B/1936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3430, "atom2_serNum": 3458, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/1933/O", "atom2_id": "///B/1937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3438, "atom2_serNum": 3463, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/1934/O", "atom2_id": "///B/1938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3444, "atom2_serNum": 3612, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/1934/NE2", "atom2_id": "///B/1957/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3444, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 2.296, "atom1_id": "///B/1934/NE2", "atom2_id": "///B/1963/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3448, "atom2_serNum": 3474, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/1935/O", "atom2_id": "///B/1939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3456, "atom2_serNum": 3492, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/1936/O", "atom2_id": "///B/1941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3461, "atom2_serNum": 3486, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/1937/O", "atom2_id": "///B/1940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3489, "atom2_serNum": 3503, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/1940/O", "atom2_id": "///B/1942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3495, "atom2_serNum": 3522, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/1941/O", "atom2_id": "///B/1945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3509, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/1943/N", "atom2_id": "///B/1943/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3512, "atom2_serNum": 3536, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///B/1943/O", "atom2_id": "///B/1947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3520, "atom2_serNum": 3547, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///B/1944/O", "atom2_id": "///B/1948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3525, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///B/1945/O", "atom2_id": "///B/1949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3530, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/1946/O", "atom2_id": "///B/1949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3530, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/1946/O", "atom2_id": "///B/1950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3535, "atom2_serNum": 8916, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///B/1946/NZ", "atom2_id": "///E/1950/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3539, "atom2_serNum": 3572, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/1947/O", "atom2_id": "///B/1951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3550, "atom2_serNum": 3583, "donAcc_type": "standard", "distance": 3.852, "atom1_id": "///B/1948/O", "atom2_id": "///B/1953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3570, "atom2_serNum": 8881, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///B/1950/OE1", "atom2_id": "///E/1946/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3595, "atom2_serNum": 3596, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/1954/OD2", "atom2_id": "///B/1955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3599, "atom2_serNum": 3670, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///B/1955/O", "atom2_id": "///B/1964/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3607, "atom2_serNum": 3844, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///B/1956/OD1", "atom2_id": "///B/1988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3625, "atom2_serNum": 3876, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/1958/NE2", "atom2_id": "///B/1992/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3626, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/1959/N", "atom2_id": "///B/1963/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3629, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///B/1959/O", "atom2_id": "///B/1962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3632, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/1959/OD1", "atom2_id": "///B/1962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3632, "atom2_serNum": 3654, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/1959/OD1", "atom2_id": "///B/1963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3637, "atom2_serNum": 3901, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/1960/O", "atom2_id": "///B/1994/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3645, "atom2_serNum": 3892, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/1961/O", "atom2_id": "///B/1994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3653, "atom2_serNum": 3876, "donAcc_type": "questionable", "distance": 3.077, "atom1_id": "///B/1962/O", "atom2_id": "///B/1992/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3664, "atom2_serNum": 3719, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/1963/NH2", "atom2_id": "///B/1971/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3665, "atom2_serNum": 3693, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///B/1964/N", "atom2_id": "///B/1967/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3668, "atom2_serNum": 3687, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/1964/O", "atom2_id": "///B/1967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3668, "atom2_serNum": 3697, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/1964/O", "atom2_id": "///B/1968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3675, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/1965/O", "atom2_id": "///B/1969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3682, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/1966/O", "atom2_id": "///B/1970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3690, "atom2_serNum": 3714, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/1967/O", "atom2_id": "///B/1971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3696, "atom2_serNum": 3871, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/1967/NE2", "atom2_id": "///B/1991/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3696, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/1967/NE2", "atom2_id": "///B/1997/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3700, "atom2_serNum": 3720, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/1968/O", "atom2_id": "///B/1972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3705, "atom2_serNum": 3733, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/1969/O", "atom2_id": "///B/1974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3710, "atom2_serNum": 3725, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/1970/O", "atom2_id": "///B/1973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3731, "atom2_serNum": 4933, "donAcc_type": "standard", "distance": 2.441, "atom1_id": "///B/1973/OD1", "atom2_id": "///C/22/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3731, "atom2_serNum": 4934, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///B/1973/OD1", "atom2_id": "///C/22/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3732, "atom2_serNum": 4974, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/1973/OD2", "atom2_id": "///C/26/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3736, "atom2_serNum": 3758, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/1974/O", "atom2_id": "///B/1978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3741, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/1975/O", "atom2_id": "///B/1979/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3746, "atom2_serNum": 3776, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///B/1975/NE2", "atom2_id": "///B/1979/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3746, "atom2_serNum": 4045, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/1975/NE2", "atom2_id": "///B/2014/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3750, "atom2_serNum": 3778, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///B/1976/O", "atom2_id": "///B/1980/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3754, "atom2_serNum": 3778, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/1977/O", "atom2_id": "///B/1980/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3754, "atom2_serNum": 3786, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/1977/O", "atom2_id": "///B/1981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3761, "atom2_serNum": 3786, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///B/1978/O", "atom2_id": "///B/1981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3761, "atom2_serNum": 3794, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/1978/O", "atom2_id": "///B/1982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3772, "atom2_serNum": 3802, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/1979/O", "atom2_id": "///B/1983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3776, "atom2_serNum": 4045, "donAcc_type": "questionable", "distance": 2.985, "atom1_id": "///B/1979/OE1", "atom2_id": "///B/2014/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3777, "atom2_serNum": 3811, "donAcc_type": "questionable", "distance": 3.102, "atom1_id": "///B/1979/NE2", "atom2_id": "///B/1983/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3781, "atom2_serNum": 3802, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/1980/O", "atom2_id": "///B/1983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3781, "atom2_serNum": 3813, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/1980/O", "atom2_id": "///B/1984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3789, "atom2_serNum": 3816, "donAcc_type": "questionable", "distance": 3.070, "atom1_id": "///B/1981/O", "atom2_id": "///B/1984/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3789, "atom2_serNum": 3842, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///B/1981/O", "atom2_id": "///B/1987/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3797, "atom2_serNum": 9174, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/1982/O", "atom2_id": "///E/1985/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3805, "atom2_serNum": 9167, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/1983/O", "atom2_id": "///E/1985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3816, "atom2_serNum": 9177, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///B/1984/O", "atom2_id": "///E/1985/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3820, "atom2_serNum": 3842, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///B/1984/ND2", "atom2_id": "///B/1987/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3821, "atom2_serNum": 9151, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/1985/N", "atom2_id": "///E/1983/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3828, "atom2_serNum": 9143, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/1985/NE", "atom2_id": "///E/1982/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3830, "atom2_serNum": 9419, "donAcc_type": "standard", "distance": 3.946, "atom1_id": "///B/1985/NH1", "atom2_id": "///E/2018/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3831, "atom2_serNum": 9162, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/1985/NH2", "atom2_id": "///E/1984/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3831, "atom2_serNum": 9186, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/1985/NH2", "atom2_id": "///E/1987/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3840, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/1987/O", "atom2_id": "///B/1989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3840, "atom2_serNum": 9177, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/1987/O", "atom2_id": "///E/1985/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3850, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/1988/OD1", "atom2_id": "///B/1989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3850, "atom2_serNum": 3860, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/1988/OD1", "atom2_id": "///B/1990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3867, "atom2_serNum": 4091, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/1990/OD2", "atom2_id": "///B/2021/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3882, "atom2_serNum": 4122, "donAcc_type": "standard", "distance": 2.497, "atom1_id": "///B/1992/NH1", "atom2_id": "///B/2025/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3883, "atom2_serNum": 4122, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/1992/NH2", "atom2_id": "///B/2025/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3883, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///B/1992/NH2", "atom2_id": "///B/2027/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3884, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/1993/N", "atom2_id": "///B/1997/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3887, "atom2_serNum": 3910, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///B/1993/O", "atom2_id": "///B/1996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3895, "atom2_serNum": 4141, "donAcc_type": "questionable", "distance": 3.105, "atom1_id": "///B/1994/O", "atom2_id": "///B/2027/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3905, "atom2_serNum": 4134, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/1995/O", "atom2_id": "///B/2027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3924, "atom2_serNum": 3943, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/1998/O", "atom2_id": "///B/2001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3924, "atom2_serNum": 3951, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///B/1998/O", "atom2_id": "///B/2002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3926, "atom2_serNum": 3943, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///B/1998/OG1", "atom2_id": "///B/2001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3931, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/1999/O", "atom2_id": "///B/2003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3946, "atom2_serNum": 3964, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/2001/O", "atom2_id": "///B/2004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3946, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/2001/O", "atom2_id": "///B/2005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3954, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/2002/O", "atom2_id": "///B/2005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3954, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/2002/O", "atom2_id": "///B/2006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3962, "atom2_serNum": 3993, "donAcc_type": "standard", "distance": 3.943, "atom1_id": "///B/2003/O", "atom2_id": "///B/2008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3967, "atom2_serNum": 4243, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/2004/O", "atom2_id": "///B/2041/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3972, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///B/2005/O", "atom2_id": "///B/2007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4003, "atom2_serNum": 4013, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/2009/O", "atom2_id": "///B/2011/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4003, "atom2_serNum": 4934, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/2009/O", "atom2_id": "///C/22/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4012, "atom2_serNum": 4029, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/2010/O", "atom2_id": "///B/2013/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4012, "atom2_serNum": 4038, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/2010/O", "atom2_id": "///B/2014/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4016, "atom2_serNum": 4046, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/2011/O", "atom2_id": "///B/2015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4024, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/2012/O", "atom2_id": "///B/2016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4032, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/2013/O", "atom2_id": "///B/2017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4038, "atom2_serNum": 4044, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/2014/N", "atom2_id": "///B/2014/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4041, "atom2_serNum": 4070, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/2014/O", "atom2_id": "///B/2018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4049, "atom2_serNum": 4086, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/2015/O", "atom2_id": "///B/2020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4057, "atom2_serNum": 4076, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///B/2016/O", "atom2_id": "///B/2019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4057, "atom2_serNum": 4086, "donAcc_type": "standard", "distance": 3.717, "atom1_id": "///B/2016/O", "atom2_id": "///B/2020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4073, "atom2_serNum": 9176, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///B/2018/O", "atom2_id": "///E/1985/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4089, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/2020/O", "atom2_id": "///B/2022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4097, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/2021/OD1", "atom2_id": "///B/2022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4097, "atom2_serNum": 4106, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/2021/OD1", "atom2_id": "///B/2023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4106, "atom2_serNum": 4112, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/2023/N", "atom2_id": "///B/2023/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4112, "atom2_serNum": 4320, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///B/2023/OD1", "atom2_id": "///B/2053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4113, "atom2_serNum": 4325, "donAcc_type": "questionable", "distance": 2.534, "atom1_id": "///B/2023/ND2", "atom2_id": "///B/2054/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4126, "atom2_serNum": 4157, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///B/2026/N", "atom2_id": "///B/2030/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4129, "atom2_serNum": 4150, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///B/2026/O", "atom2_id": "///B/2029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4132, "atom2_serNum": 4154, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///B/2026/OD1", "atom2_id": "///B/2030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4133, "atom2_serNum": 4200, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/2026/OD2", "atom2_id": "///B/2035/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4134, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/2027/N", "atom2_id": "///B/2027/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4137, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/2027/O", "atom2_id": "///B/2060/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4145, "atom2_serNum": 4375, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/2028/O", "atom2_id": "///B/2060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4150, "atom2_serNum": 4381, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/2029/N", "atom2_id": "///B/2060/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4153, "atom2_serNum": 4188, "donAcc_type": "acceptable", "distance": 3.989, "atom1_id": "///B/2029/O", "atom2_id": "///B/2034/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4163, "atom2_serNum": 4188, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///B/2031/N", "atom2_id": "///B/2034/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4166, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/2031/O", "atom2_id": "///B/2034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4166, "atom2_serNum": 4192, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/2031/O", "atom2_id": "///B/2035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4172, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/2032/O", "atom2_id": "///B/2036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4177, "atom2_serNum": 4211, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/2033/O", "atom2_id": "///B/2037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4185, "atom2_serNum": 4211, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///B/2034/O", "atom2_id": "///B/2037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4185, "atom2_serNum": 4216, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/2034/O", "atom2_id": "///B/2038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4191, "atom2_serNum": 4406, "donAcc_type": "standard", "distance": 2.487, "atom1_id": "///B/2034/NE2", "atom2_id": "///B/2063/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4195, "atom2_serNum": 4216, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///B/2035/O", "atom2_id": "///B/2038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4195, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/2035/O", "atom2_id": "///B/2039/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4209, "atom2_serNum": 4236, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///B/2036/O", "atom2_id": "///B/2041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4214, "atom2_serNum": 4492, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///B/2037/O", "atom2_id": "///B/2074/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4234, "atom2_serNum": 4514, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/2040/OD1", "atom2_id": "///B/2077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4234, "atom2_serNum": 4519, "donAcc_type": "acceptable", "distance": 2.881, "atom1_id": "///B/2040/OD1", "atom2_id": "///B/2077/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4235, "atom2_serNum": 4513, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/2040/ND2", "atom2_id": "///B/2076/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4239, "atom2_serNum": 4264, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/2041/O", "atom2_id": "///B/2045/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4242, "atom2_serNum": 4259, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/2041/OD1", "atom2_id": "///B/2044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4247, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/2042/O", "atom2_id": "///B/2046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4254, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/2043/O", "atom2_id": "///B/2046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4254, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/2043/O", "atom2_id": "///B/2047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4262, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/2044/O", "atom2_id": "///B/2048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4267, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/2045/O", "atom2_id": "///B/2049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4272, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/2046/O", "atom2_id": "///B/2049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4272, "atom2_serNum": 4299, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/2046/O", "atom2_id": "///B/2050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4279, "atom2_serNum": 4314, "donAcc_type": "questionable", "distance": 3.071, "atom1_id": "///B/2047/O", "atom2_id": "///B/2051/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4294, "atom2_serNum": 4319, "donAcc_type": "questionable", "distance": 2.993, "atom1_id": "///B/2049/O", "atom2_id": "///B/2052/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4311, "atom2_serNum": 4320, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/2051/O", "atom2_id": "///B/2053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4323, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/2053/O", "atom2_id": "///B/2055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4331, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/2054/OD1", "atom2_id": "///B/2055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4331, "atom2_serNum": 4342, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/2054/OD1", "atom2_id": "///B/2056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4348, "atom2_serNum": 4417, "donAcc_type": "acceptable", "distance": 3.768, "atom1_id": "///B/2056/OD1", "atom2_id": "///B/2064/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4348, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/2056/OD1", "atom2_id": "///B/2087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4366, "atom2_serNum": 4397, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///B/2058/NE2", "atom2_id": "///B/2062/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4367, "atom2_serNum": 4373, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/2059/N", "atom2_id": "///B/2059/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4370, "atom2_serNum": 4383, "donAcc_type": "standard", "distance": 2.335, "atom1_id": "///B/2059/O", "atom2_id": "///B/2061/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4370, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 2.398, "atom1_id": "///B/2059/O", "atom2_id": "///B/2062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4373, "atom2_serNum": 4403, "donAcc_type": "standard", "distance": 2.510, "atom1_id": "///B/2059/OD1", "atom2_id": "///B/2063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4374, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 2.225, "atom1_id": "///B/2059/ND2", "atom2_id": "///B/2063/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4386, "atom2_serNum": 4642, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///B/2061/O", "atom2_id": "///B/2093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4397, "atom2_serNum": 4630, "donAcc_type": "questionable", "distance": 2.488, "atom1_id": "///B/2062/O", "atom2_id": "///B/2091/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4415, "atom2_serNum": 4434, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///B/2064/O", "atom2_id": "///B/2067/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4415, "atom2_serNum": 4445, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///B/2064/O", "atom2_id": "///B/2068/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4422, "atom2_serNum": 4453, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/2065/O", "atom2_id": "///B/2069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4429, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/2066/O", "atom2_id": "///B/2070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4437, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///B/2067/O", "atom2_id": "///B/2070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4437, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/2067/O", "atom2_id": "///B/2071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4448, "atom2_serNum": 4474, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/2068/O", "atom2_id": "///B/2072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4456, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///B/2069/O", "atom2_id": "///B/2073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4456, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/2069/O", "atom2_id": "///B/2074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4461, "atom2_serNum": 4769, "donAcc_type": "acceptable", "distance": 3.406, "atom1_id": "///B/2070/O", "atom2_id": "///B/2107/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4477, "atom2_serNum": 5089, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///B/2072/O", "atom2_id": "///C/40/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4486, "atom2_serNum": 4493, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/2073/O", "atom2_id": "///B/2075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4490, "atom2_serNum": 4521, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///B/2074/O", "atom2_id": "///B/2078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4496, "atom2_serNum": 4526, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/2075/O", "atom2_id": "///B/2079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4508, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///B/2076/O", "atom2_id": "///B/2080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4517, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/2077/O", "atom2_id": "///B/2080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4517, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///B/2077/O", "atom2_id": "///B/2081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4524, "atom2_serNum": 4550, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/2078/O", "atom2_id": "///B/2082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4529, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/2079/O", "atom2_id": "///B/2083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4538, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/2080/O", "atom2_id": "///B/2083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4538, "atom2_serNum": 4566, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/2080/O", "atom2_id": "///B/2084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4545, "atom2_serNum": 4566, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/2081/O", "atom2_id": "///B/2084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4545, "atom2_serNum": 4576, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/2081/O", "atom2_id": "///B/2085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4545, "atom2_serNum": 4587, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/2081/O", "atom2_id": "///B/2086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4553, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///B/2082/O", "atom2_id": "///B/2118/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4564, "atom2_serNum": 4861, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///B/2083/OD1", "atom2_id": "///B/2117/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4590, "atom2_serNum": 4600, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/2086/O", "atom2_id": "///B/2088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4598, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/2087/OD1", "atom2_id": "///B/2089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4609, "atom2_serNum": 4820, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///B/2088/NH1", "atom2_id": "///B/2113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4609, "atom2_serNum": 4828, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/2088/NH1", "atom2_id": "///B/2114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4610, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/2088/NH2", "atom2_id": "///B/2117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4632, "atom2_serNum": 4634, "donAcc_type": "acceptable", "distance": 2.088, "atom1_id": "///B/2091/OG1", "atom2_id": "///B/2092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4632, "atom2_serNum": 4637, "donAcc_type": "acceptable", "distance": 2.615, "atom1_id": "///B/2091/OG1", "atom2_id": "///B/2092/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4632, "atom2_serNum": 4641, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///B/2091/OG1", "atom2_id": "///B/2092/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4634, "atom2_serNum": 4641, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/2092/N", "atom2_id": "///B/2092/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4634, "atom2_serNum": 4671, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/2092/N", "atom2_id": "///B/2096/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4637, "atom2_serNum": 4660, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///B/2092/O", "atom2_id": "///B/2095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4640, "atom2_serNum": 4675, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/2092/OD1", "atom2_id": "///B/2096/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4640, "atom2_serNum": 4678, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/2092/OD1", "atom2_id": "///B/2096/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4641, "atom2_serNum": 4652, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/2092/OD2", "atom2_id": "///B/2094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4641, "atom2_serNum": 4668, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///B/2092/OD2", "atom2_id": "///B/2096/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4660, "atom2_serNum": 4666, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/2095/N", "atom2_id": "///B/2095/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4679, "atom2_serNum": 4712, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/2097/N", "atom2_id": "///B/2100/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4682, "atom2_serNum": 4705, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/2097/O", "atom2_id": "///B/2100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4682, "atom2_serNum": 4713, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///B/2097/O", "atom2_id": "///B/2101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4690, "atom2_serNum": 4705, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///B/2098/O", "atom2_id": "///B/2100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4690, "atom2_serNum": 4721, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/2098/O", "atom2_id": "///B/2102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4701, "atom2_serNum": 4839, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///B/2099/NE", "atom2_id": "///B/2115/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4704, "atom2_serNum": 4839, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/2099/NH2", "atom2_id": "///B/2115/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4704, "atom2_serNum": 4840, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/2099/NH2", "atom2_id": "///B/2115/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4708, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/2100/O", "atom2_id": "///B/2104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4716, "atom2_serNum": 4744, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/2101/O", "atom2_id": "///B/2105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4724, "atom2_serNum": 4744, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/2102/O", "atom2_id": "///B/2105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4724, "atom2_serNum": 4755, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/2102/O", "atom2_id": "///B/2106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4766, "atom2_serNum": 4799, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/2107/O", "atom2_id": "///B/2111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4776, "atom2_serNum": 4806, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/2108/O", "atom2_id": "///B/2112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4782, "atom2_serNum": 5146, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///B/2108/NE2", "atom2_id": "///C/47/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4786, "atom2_serNum": 4806, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///B/2109/O", "atom2_id": "///B/2112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4786, "atom2_serNum": 4817, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/2109/O", "atom2_id": "///B/2113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4789, "atom2_serNum": 4815, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/2109/OD1", "atom2_id": "///B/2112/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4789, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 2.461, "atom1_id": "///B/2109/OD1", "atom2_id": "///B/2112/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4794, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/2110/O", "atom2_id": "///B/2114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4802, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/2111/O", "atom2_id": "///B/2114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4802, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/2111/O", "atom2_id": "///B/2115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4809, "atom2_serNum": 4841, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///B/2112/O", "atom2_id": "///B/2116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4820, "atom2_serNum": 4850, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/2113/O", "atom2_id": "///B/2117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4882, "atom2_serNum": 4895, "donAcc_type": "standard", "distance": 2.161, "atom1_id": "///C/16/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4892, "atom2_serNum": 4915, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4903, "atom2_serNum": 4935, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///C/19/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4910, "atom2_serNum": 4943, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/20/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4918, "atom2_serNum": 4954, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4922, "atom2_serNum": 4963, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///C/21/OE1", "atom2_id": "///C/25/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4923, "atom2_serNum": 4952, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///C/21/OE2", "atom2_id": "///C/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4927, "atom2_serNum": 4965, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4938, "atom2_serNum": 4976, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/23/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4946, "atom2_serNum": 4984, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4957, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///C/25/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4968, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///C/26/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4968, "atom2_serNum": 5001, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4979, "atom2_serNum": 5007, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4987, "atom2_serNum": 5018, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4996, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5004, "atom2_serNum": 5039, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5010, "atom2_serNum": 5049, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/31/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5021, "atom2_serNum": 5055, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/32/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5021, "atom2_serNum": 5060, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///C/32/O", "atom2_id": "///C/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5032, "atom2_serNum": 5055, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///C/33/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5032, "atom2_serNum": 5060, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///C/33/O", "atom2_id": "///C/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5032, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/33/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5042, "atom2_serNum": 5068, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/34/O", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5052, "atom2_serNum": 5077, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///C/35/O", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5065, "atom2_serNum": 5077, "donAcc_type": "standard", "distance": 2.510, "atom1_id": "///C/37/O", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5065, "atom2_serNum": 5082, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///C/37/O", "atom2_id": "///C/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5065, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///C/37/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5085, "atom2_serNum": 5114, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/40/O", "atom2_id": "///C/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5085, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///C/40/O", "atom2_id": "///C/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5096, "atom2_serNum": 5126, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/41/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5096, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 3.659, "atom1_id": "///C/41/O", "atom2_id": "///C/48/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5122, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5129, "atom2_serNum": 5159, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5135, "atom2_serNum": 5159, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/46/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5135, "atom2_serNum": 5167, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5162, "atom2_serNum": 5184, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/49/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5162, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5187, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5187, "atom2_serNum": 5228, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///C/52/O", "atom2_id": "///C/56/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5196, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///C/53/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5196, "atom2_serNum": 5230, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/53/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5233, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///C/57/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5233, "atom2_serNum": 5254, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///C/57/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5233, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5249, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5257, "atom2_serNum": 5273, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///C/60/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5257, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/60/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5257, "atom2_serNum": 5290, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5260, "atom2_serNum": 5271, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///C/60/ND1", "atom2_id": "///C/61/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5273, "atom2_serNum": 5305, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/62/N", "atom2_id": "///C/65/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5293, "atom2_serNum": 5321, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5357, "atom2_serNum": 5376, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///D/13/O", "atom2_id": "///D/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5371, "atom2_serNum": 8579, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/15/O", "atom2_id": "///D/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5386, "atom2_serNum": 8237, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/16/NH1", "atom2_id": "///D/376/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5387, "atom2_serNum": 8237, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///D/16/NH2", "atom2_id": "///D/376/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5388, "atom2_serNum": 8566, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///D/17/N", "atom2_id": "///D/417/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5399, "atom2_serNum": 5428, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///D/18/O", "atom2_id": "///D/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5401, "atom2_serNum": 5423, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///D/18/OG1", "atom2_id": "///D/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5406, "atom2_serNum": 5443, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///D/19/O", "atom2_id": "///D/23/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5406, "atom2_serNum": 5445, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///D/19/O", "atom2_id": "///D/23/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5410, "atom2_serNum": 8221, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/19/NE", "atom2_id": "///D/374/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5412, "atom2_serNum": 8221, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/19/NH1", "atom2_id": "///D/374/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5412, "atom2_serNum": 8383, "donAcc_type": "standard", "distance": 3.954, "atom1_id": "///D/19/NH1", "atom2_id": "///D/396/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5417, "atom2_serNum": 5436, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/20/O", "atom2_id": "///D/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5417, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///D/20/O", "atom2_id": "///D/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5431, "atom2_serNum": 5455, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///D/22/O", "atom2_id": "///D/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5431, "atom2_serNum": 5467, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///D/22/O", "atom2_id": "///D/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5439, "atom2_serNum": 5483, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///D/23/O", "atom2_id": "///D/27/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5458, "atom2_serNum": 5493, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///D/25/O", "atom2_id": "///D/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5466, "atom2_serNum": 5515, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///D/25/OH", "atom2_id": "///D/31/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5496, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/29/O", "atom2_id": "///D/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5519, "atom2_serNum": 7854, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///D/32/O", "atom2_id": "///D/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5523, "atom2_serNum": 6335, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///D/32/OE1", "atom2_id": "///D/133/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5524, "atom2_serNum": 7885, "donAcc_type": "standard", "distance": 3.817, "atom1_id": "///D/32/NE2", "atom2_id": "///D/328/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5528, "atom2_serNum": 5761, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///D/33/O", "atom2_id": "///D/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5530, "atom2_serNum": 5535, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///D/33/OG1", "atom2_id": "///D/34/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5532, "atom2_serNum": 7838, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///D/34/N", "atom2_id": "///D/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5542, "atom2_serNum": 5738, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///D/35/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5547, "atom2_serNum": 7824, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///D/36/N", "atom2_id": "///D/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5550, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/36/O", "atom2_id": "///D/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5555, "atom2_serNum": 5728, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///D/37/N", "atom2_id": "///D/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5558, "atom2_serNum": 5725, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/37/O", "atom2_id": "///D/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5563, "atom2_serNum": 5569, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///D/38/N", "atom2_id": "///D/38/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5563, "atom2_serNum": 7807, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///D/38/N", "atom2_id": "///D/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5566, "atom2_serNum": 7804, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/38/O", "atom2_id": "///D/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5578, "atom2_serNum": 7794, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/40/N", "atom2_id": "///D/318/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5581, "atom2_serNum": 6442, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/40/O", "atom2_id": "///D/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5586, "atom2_serNum": 7800, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/40/NZ", "atom2_id": "///D/319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5594, "atom2_serNum": 6445, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///D/42/N", "atom2_id": "///D/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5597, "atom2_serNum": 6458, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///D/42/O", "atom2_id": "///D/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5602, "atom2_serNum": 5622, "donAcc_type": "acceptable", "distance": 3.625, "atom1_id": "///D/43/O", "atom2_id": "///D/45/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5608, "atom2_serNum": 6461, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/44/N", "atom2_id": "///D/150/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5616, "atom2_serNum": 6192, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///D/44/NZ", "atom2_id": "///D/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5616, "atom2_serNum": 6198, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///D/44/NZ", "atom2_id": "///D/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5617, "atom2_serNum": 6184, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/45/N", "atom2_id": "///D/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5622, "atom2_serNum": 5665, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///D/45/OG", "atom2_id": "///D/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5634, "atom2_serNum": 6469, "donAcc_type": "acceptable", "distance": 3.932, "atom1_id": "///D/46/OH", "atom2_id": "///D/151/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5634, "atom2_serNum": 11281, "donAcc_type": "acceptable", "distance": 3.375, "atom1_id": "///D/46/OH", "atom2_id": "///X/29/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 713, "atom1_serNum": 5654, "atom2_serNum": 5675, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///D/49/OE1", "atom2_id": "///D/51/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5655, "atom2_serNum": 5672, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///D/49/OE2", "atom2_id": "///D/51/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5655, "atom2_serNum": 5675, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///D/49/OE2", "atom2_id": "///D/51/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5659, "atom2_serNum": 5676, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///D/50/O", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5674, "atom2_serNum": 11595, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///D/51/NH1", "atom2_id": "///Y/7/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 718, "atom1_serNum": 5676, "atom2_serNum": 11564, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///D/52/N", "atom2_id": "///Y/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 719, "atom1_serNum": 5679, "atom2_serNum": 5698, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/52/O", "atom2_id": "///D/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5687, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/53/N", "atom2_id": "///D/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5714, "atom2_serNum": 6875, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///D/56/O", "atom2_id": "///D/203/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5721, "atom2_serNum": 6140, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///D/57/O", "atom2_id": "///D/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5728, "atom2_serNum": 5738, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/58/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5731, "atom2_serNum": 6130, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/59/N", "atom2_id": "///D/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5749, "atom2_serNum": 6865, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///D/60/OH", "atom2_id": "///D/202/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5749, "atom2_serNum": 6866, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///D/60/OH", "atom2_id": "///D/202/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5761, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/62/O", "atom2_id": "///D/66/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5769, "atom2_serNum": 5776, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///D/63/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5769, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///D/63/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5773, "atom2_serNum": 5775, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///D/64/O", "atom2_id": "///D/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5779, "atom2_serNum": 5812, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5783, "atom2_serNum": 5821, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5797, "atom2_serNum": 5821, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///D/67/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5797, "atom2_serNum": 5830, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5806, "atom2_serNum": 5839, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5820, "atom2_serNum": 7885, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/69/NZ", "atom2_id": "///D/328/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5824, "atom2_serNum": 5856, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///D/70/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5829, "atom2_serNum": 5907, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///D/70/NZ", "atom2_id": "///D/80/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5833, "atom2_serNum": 5865, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///D/71/O", "atom2_id": "///D/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5842, "atom2_serNum": 5883, "donAcc_type": "questionable", "distance": 2.601, "atom1_id": "///D/72/O", "atom2_id": "///D/76/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5851, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///D/73/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5859, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///D/74/O", "atom2_id": "///D/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5859, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///D/74/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 5859, "atom2_serNum": 5888, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///D/74/O", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5864, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///D/74/OE2", "atom2_id": "///D/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5894, "atom2_serNum": 5925, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///D/79/N", "atom2_id": "///D/82/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5897, "atom2_serNum": 5927, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/79/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5899, "atom2_serNum": 5925, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///D/79/OG", "atom2_id": "///D/82/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 5909, "atom2_serNum": 5916, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/81/N", "atom2_id": "///D/81/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 5921, "atom2_serNum": 6336, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///D/82/O", "atom2_id": "///D/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5921, "atom2_serNum": 6346, "donAcc_type": "questionable", "distance": 2.993, "atom1_id": "///D/82/O", "atom2_id": "///D/135/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 5936, "atom2_serNum": 6336, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///D/84/O", "atom2_id": "///D/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 5940, "atom2_serNum": 6093, "donAcc_type": "questionable", "distance": 3.189, "atom1_id": "///D/84/OE1", "atom2_id": "///D/104/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 5949, "atom2_serNum": 6316, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///D/86/N", "atom2_id": "///D/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 5958, "atom2_serNum": 6061, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/87/O", "atom2_id": "///D/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 5960, "atom2_serNum": 6299, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///D/88/N", "atom2_id": "///D/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 5963, "atom2_serNum": 6296, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///D/88/O", "atom2_id": "///D/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 5971, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///D/89/N", "atom2_id": "///D/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 5974, "atom2_serNum": 6043, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/89/O", "atom2_id": "///D/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 5982, "atom2_serNum": 6283, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///D/90/O", "atom2_id": "///D/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 5986, "atom2_serNum": 6236, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///D/91/O", "atom2_id": "///D/122/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 5994, "atom2_serNum": 6235, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/92/O", "atom2_id": "///D/122/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6002, "atom2_serNum": 6215, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///D/93/ND2", "atom2_id": "///D/120/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6025, "atom2_serNum": 6029, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///D/96/NE2", "atom2_id": "///D/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6038, "atom2_serNum": 10629, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///D/98/O", "atom2_id": "///F/62/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6059, "atom2_serNum": 10622, "donAcc_type": "questionable", "distance": 2.934, "atom1_id": "///D/100/OE1", "atom2_id": "///F/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6060, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 3.824, "atom1_id": "///D/100/NE2", "atom2_id": "///F/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6064, "atom2_serNum": 6077, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/101/O", "atom2_id": "///D/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6072, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///D/102/O", "atom2_id": "///D/106/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6076, "atom2_serNum": 6092, "donAcc_type": "standard", "distance": 3.746, "atom1_id": "///D/102/ND2", "atom2_id": "///D/104/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6088, "atom2_serNum": 6098, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/104/O", "atom2_id": "///D/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6138, "atom2_serNum": 6153, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///D/110/OG1", "atom2_id": "///D/112/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6153, "atom2_serNum": 6846, "donAcc_type": "standard", "distance": 3.928, "atom1_id": "///D/112/NZ", "atom2_id": "///D/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6153, "atom2_serNum": 6856, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/112/NZ", "atom2_id": "///D/201/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6157, "atom2_serNum": 6159, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///D/113/O", "atom2_id": "///D/113/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6195, "atom2_serNum": 6201, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/118/N", "atom2_id": "///D/118/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6198, "atom2_serNum": 6225, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///D/118/O", "atom2_id": "///D/121/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6220, "atom2_serNum": 6237, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/121/O", "atom2_id": "///D/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6233, "atom2_serNum": 6249, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///D/122/NE", "atom2_id": "///D/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6245, "atom2_serNum": 11260, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/123/NZ", "atom2_id": "///X/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 781, "atom1_serNum": 6256, "atom2_serNum": 6437, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///D/125/N", "atom2_id": "///D/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6259, "atom2_serNum": 6434, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///D/125/O", "atom2_id": "///D/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6275, "atom2_serNum": 6413, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///D/127/N", "atom2_id": "///D/144/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6278, "atom2_serNum": 6408, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/127/O", "atom2_id": "///D/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6286, "atom2_serNum": 6288, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///D/128/O", "atom2_id": "///D/128/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6289, "atom2_serNum": 6392, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///D/129/N", "atom2_id": "///D/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6304, "atom2_serNum": 6308, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///D/130/NZ", "atom2_id": "///D/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6304, "atom2_serNum": 6369, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///D/130/NZ", "atom2_id": "///D/138/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6304, "atom2_serNum": 10574, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///D/130/NZ", "atom2_id": "///F/56/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6308, "atom2_serNum": 6370, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/131/O", "atom2_id": "///D/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6324, "atom2_serNum": 6357, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///D/133/N", "atom2_id": "///D/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6327, "atom2_serNum": 6348, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/133/O", "atom2_id": "///D/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6339, "atom2_serNum": 10609, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///D/134/O", "atom2_id": "///F/60/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6347, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/135/ND2", "atom2_id": "///D/137/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6351, "atom2_serNum": 6362, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///D/136/O", "atom2_id": "///D/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6368, "atom2_serNum": 10574, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///D/138/OD1", "atom2_id": "///F/56/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6369, "atom2_serNum": 6370, "donAcc_type": "standard", "distance": 2.555, "atom1_id": "///D/138/OD2", "atom2_id": "///D/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6369, "atom2_serNum": 6378, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/138/OD2", "atom2_id": "///D/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6382, "atom2_serNum": 10537, "donAcc_type": "standard", "distance": 3.925, "atom1_id": "///D/141/N", "atom2_id": "///F/52/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6385, "atom2_serNum": 7948, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///D/141/O", "atom2_id": "///D/338/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6403, "atom2_serNum": 7846, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///D/143/O", "atom2_id": "///D/324/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6411, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/144/O", "atom2_id": "///D/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6422, "atom2_serNum": 7815, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///D/145/NZ", "atom2_id": "///D/321/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6430, "atom2_serNum": 9994, "donAcc_type": "acceptable", "distance": 3.240, "atom1_id": "///D/146/NE", "atom2_id": "///E/2093/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6471, "atom2_serNum": 11261, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///D/151/OG", "atom2_id": "///X/28/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 806, "atom1_serNum": 6480, "atom2_serNum": 11637, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///D/152/NZ", "atom2_id": "///Y/9/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 807, "atom1_serNum": 6480, "atom2_serNum": 11640, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///D/152/NZ", "atom2_id": "///Y/9/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 808, "atom1_serNum": 6491, "atom2_serNum": 6503, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///D/154/O", "atom2_id": "///D/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6491, "atom2_serNum": 7379, "donAcc_type": "acceptable", "distance": 2.784, "atom1_id": "///D/154/O", "atom2_id": "///D/267/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6493, "atom2_serNum": 11241, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///D/154/OG", "atom2_id": "///X/27/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 811, "atom1_serNum": 6512, "atom2_serNum": 11220, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///D/157/N", "atom2_id": "///X/26/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 812, "atom1_serNum": 6515, "atom2_serNum": 6530, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///D/157/O", "atom2_id": "///D/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6520, "atom2_serNum": 7350, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///D/157/NZ", "atom2_id": "///D/263/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6524, "atom2_serNum": 6536, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///D/158/O", "atom2_id": "///D/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6528, "atom2_serNum": 7347, "donAcc_type": "questionable", "distance": 2.736, "atom1_id": "///D/158/OE1", "atom2_id": "///D/263/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6533, "atom2_serNum": 6544, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/159/O", "atom2_id": "///D/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6556, "atom2_serNum": 6566, "donAcc_type": "standard", "distance": 2.390, "atom1_id": "///D/162/O", "atom2_id": "///D/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6559, "atom2_serNum": 6574, "donAcc_type": "standard", "distance": 3.915, "atom1_id": "///D/162/OD1", "atom2_id": "///D/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6577, "atom2_serNum": 7388, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/165/O", "atom2_id": "///D/268/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6585, "atom2_serNum": 6596, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///D/166/O", "atom2_id": "///D/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6588, "atom2_serNum": 7370, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///D/167/N", "atom2_id": "///D/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6591, "atom2_serNum": 7076, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///D/167/O", "atom2_id": "///D/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6601, "atom2_serNum": 7063, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///D/169/N", "atom2_id": "///D/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6604, "atom2_serNum": 6611, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///D/169/O", "atom2_id": "///D/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6606, "atom2_serNum": 6930, "donAcc_type": "acceptable", "distance": 3.650, "atom1_id": "///D/169/OG", "atom2_id": "///D/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6606, "atom2_serNum": 7044, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///D/169/OG", "atom2_id": "///D/224/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6614, "atom2_serNum": 6912, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/171/O", "atom2_id": "///D/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6616, "atom2_serNum": 7796, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///D/171/OG1", "atom2_id": "///D/318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6621, "atom2_serNum": 7797, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/172/O", "atom2_id": "///D/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6626, "atom2_serNum": 7810, "donAcc_type": "standard", "distance": 3.969, "atom1_id": "///D/172/NZ", "atom2_id": "///D/320/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6627, "atom2_serNum": 6893, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///D/173/N", "atom2_id": "///D/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6630, "atom2_serNum": 6890, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/173/O", "atom2_id": "///D/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6634, "atom2_serNum": 7786, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/174/N", "atom2_id": "///D/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6637, "atom2_serNum": 7783, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/174/O", "atom2_id": "///D/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6642, "atom2_serNum": 6761, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///D/175/O", "atom2_id": "///D/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6647, "atom2_serNum": 7771, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///D/176/N", "atom2_id": "///D/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6650, "atom2_serNum": 7768, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///D/176/O", "atom2_id": "///D/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6658, "atom2_serNum": 6741, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///D/177/N", "atom2_id": "///D/187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6661, "atom2_serNum": 6738, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/177/O", "atom2_id": "///D/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6665, "atom2_serNum": 7734, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///D/177/ND2", "atom2_id": "///D/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6665, "atom2_serNum": 7751, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///D/177/ND2", "atom2_id": "///D/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6673, "atom2_serNum": 11584, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///D/178/NE", "atom2_id": "///Y/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 843, "atom1_serNum": 6675, "atom2_serNum": 11570, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///D/178/NH1", "atom2_id": "///Y/6/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 844, "atom1_serNum": 6675, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///D/178/NH1", "atom2_id": "///Y/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 845, "atom1_serNum": 6675, "atom2_serNum": 11584, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/178/NH1", "atom2_id": "///Y/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 846, "atom1_serNum": 6676, "atom2_serNum": 6736, "donAcc_type": "acceptable", "distance": 3.598, "atom1_id": "///D/178/NH2", "atom2_id": "///D/186/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6677, "atom2_serNum": 6730, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///D/179/N", "atom2_id": "///D/185/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6680, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///D/179/O", "atom2_id": "///D/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6680, "atom2_serNum": 6702, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///D/179/O", "atom2_id": "///D/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6695, "atom2_serNum": 11421, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///D/180/NH2", "atom2_id": "///X/36/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 851, "atom1_serNum": 6699, "atom2_serNum": 6701, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///D/181/O", "atom2_id": "///D/181/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6705, "atom2_serNum": 6725, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/182/O", "atom2_id": "///D/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6705, "atom2_serNum": 6730, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///D/182/O", "atom2_id": "///D/185/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6714, "atom2_serNum": 6736, "donAcc_type": "acceptable", "distance": 2.953, "atom1_id": "///D/183/O", "atom2_id": "///D/186/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6745, "atom2_serNum": 6835, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///D/187/NE", "atom2_id": "///D/198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6747, "atom2_serNum": 7547, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///D/187/NH1", "atom2_id": "///D/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6748, "atom2_serNum": 7578, "donAcc_type": "questionable", "distance": 2.916, "atom1_id": "///D/187/NH2", "atom2_id": "///D/290/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 6749, "atom2_serNum": 6840, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///D/188/N", "atom2_id": "///D/199/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 6752, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/188/O", "atom2_id": "///D/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 6764, "atom2_serNum": 6881, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///D/189/O", "atom2_id": "///D/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 6772, "atom2_serNum": 6822, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/190/O", "atom2_id": "///D/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 6775, "atom2_serNum": 6831, "donAcc_type": "acceptable", "distance": 3.539, "atom1_id": "///D/190/ND1", "atom2_id": "///D/197/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 6786, "atom2_serNum": 6806, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///D/192/N", "atom2_id": "///D/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 6789, "atom2_serNum": 6803, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///D/192/O", "atom2_id": "///D/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 6842, "atom2_serNum": 6849, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///D/199/OG", "atom2_id": "///D/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 6842, "atom2_serNum": 6858, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///D/199/OG", "atom2_id": "///D/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 6888, "atom2_serNum": 7168, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///D/205/O", "atom2_id": "///D/239/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 6901, "atom2_serNum": 7153, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/207/N", "atom2_id": "///D/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 6904, "atom2_serNum": 7150, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///D/207/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 6920, "atom2_serNum": 7136, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///D/209/N", "atom2_id": "///D/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 6938, "atom2_serNum": 7122, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/211/N", "atom2_id": "///D/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 6982, "atom2_serNum": 7224, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///D/216/O", "atom2_id": "///D/247/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 6982, "atom2_serNum": 7225, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/216/O", "atom2_id": "///D/247/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 6997, "atom2_serNum": 7141, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///D/218/O", "atom2_id": "///D/235/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7010, "atom2_serNum": 7027, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/220/O", "atom2_id": "///D/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7030, "atom2_serNum": 7032, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///D/222/O", "atom2_id": "///D/222/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7067, "atom2_serNum": 7118, "donAcc_type": "standard", "distance": 3.878, "atom1_id": "///D/227/O", "atom2_id": "///D/232/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7079, "atom2_serNum": 7367, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/228/O", "atom2_id": "///D/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7087, "atom2_serNum": 7110, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///D/229/O", "atom2_id": "///D/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7094, "atom2_serNum": 7355, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/230/N", "atom2_id": "///D/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7097, "atom2_serNum": 7342, "donAcc_type": "questionable", "distance": 2.534, "atom1_id": "///D/230/O", "atom2_id": "///D/262/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7105, "atom2_serNum": 7403, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///D/230/OH", "atom2_id": "///D/270/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7106, "atom2_serNum": 7245, "donAcc_type": "standard", "distance": 2.403, "atom1_id": "///D/231/N", "atom2_id": "///D/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7113, "atom2_serNum": 7242, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///D/232/O", "atom2_id": "///D/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7126, "atom2_serNum": 7229, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/234/N", "atom2_id": "///D/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7129, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///D/234/O", "atom2_id": "///D/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7145, "atom2_serNum": 7200, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///D/236/O", "atom2_id": "///D/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7157, "atom2_serNum": 7190, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///D/238/N", "atom2_id": "///D/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7160, "atom2_serNum": 7183, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///D/238/O", "atom2_id": "///D/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7211, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/246/O", "atom2_id": "///D/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7218, "atom2_serNum": 7458, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/247/O", "atom2_id": "///D/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7234, "atom2_serNum": 7441, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///D/249/N", "atom2_id": "///D/275/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7237, "atom2_serNum": 7425, "donAcc_type": "questionable", "distance": 3.193, "atom1_id": "///D/249/O", "atom2_id": "///D/273/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7237, "atom2_serNum": 7438, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///D/249/O", "atom2_id": "///D/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7250, "atom2_serNum": 7425, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///D/251/N", "atom2_id": "///D/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7253, "atom2_serNum": 7422, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/251/O", "atom2_id": "///D/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7277, "atom2_serNum": 7306, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///D/254/N", "atom2_id": "///D/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7280, "atom2_serNum": 7303, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/254/O", "atom2_id": "///D/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7280, "atom2_serNum": 7308, "donAcc_type": "acceptable", "distance": 2.515, "atom1_id": "///D/254/O", "atom2_id": "///D/257/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7284, "atom2_serNum": 7285, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///D/254/OD2", "atom2_id": "///D/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7293, "atom2_serNum": 11605, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///D/255/NZ", "atom2_id": "///Y/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 902, "atom1_serNum": 7293, "atom2_serNum": 11625, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///D/255/NZ", "atom2_id": "///Y/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 903, "atom1_serNum": 7297, "atom2_serNum": 7715, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///D/256/O", "atom2_id": "///D/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7306, "atom2_serNum": 7315, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///D/257/O", "atom2_id": "///D/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7310, "atom2_serNum": 7701, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///D/258/N", "atom2_id": "///D/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7313, "atom2_serNum": 7323, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/258/O", "atom2_id": "///D/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7323, "atom2_serNum": 7684, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///D/260/N", "atom2_id": "///D/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7363, "atom2_serNum": 7374, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/265/O", "atom2_id": "///D/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7387, "atom2_serNum": 7791, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///D/268/OE1", "atom2_id": "///D/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7389, "atom2_serNum": 7778, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///D/269/N", "atom2_id": "///D/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7397, "atom2_serNum": 7778, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///D/270/N", "atom2_id": "///D/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7400, "atom2_serNum": 7775, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///D/270/O", "atom2_id": "///D/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7415, "atom2_serNum": 7773, "donAcc_type": "acceptable", "distance": 3.279, "atom1_id": "///D/271/NZ", "atom2_id": "///D/315/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7415, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///D/271/NZ", "atom2_id": "///Y/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 915, "atom1_serNum": 7416, "atom2_serNum": 7757, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/272/N", "atom2_id": "///D/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7419, "atom2_serNum": 7746, "donAcc_type": "questionable", "distance": 3.209, "atom1_id": "///D/272/O", "atom2_id": "///D/312/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7419, "atom2_serNum": 7754, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///D/272/O", "atom2_id": "///D/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7430, "atom2_serNum": 7450, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///D/274/O", "atom2_id": "///D/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7430, "atom2_serNum": 7522, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/274/O", "atom2_id": "///D/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7449, "atom2_serNum": 7485, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///D/275/OH", "atom2_id": "///D/280/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7453, "atom2_serNum": 7480, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///D/276/O", "atom2_id": "///D/279/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7478, "atom2_serNum": 7502, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///D/279/O", "atom2_id": "///D/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7491, "atom2_serNum": 7622, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///D/281/N", "atom2_id": "///D/295/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7500, "atom2_serNum": 7632, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///D/281/NH1", "atom2_id": "///D/297/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7510, "atom2_serNum": 7607, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///D/283/N", "atom2_id": "///D/294/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7513, "atom2_serNum": 7604, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/283/O", "atom2_id": "///D/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7525, "atom2_serNum": 7762, "donAcc_type": "standard", "distance": 3.679, "atom1_id": "///D/284/O", "atom2_id": "///D/314/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7530, "atom2_serNum": 7590, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///D/285/N", "atom2_id": "///D/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7533, "atom2_serNum": 7590, "donAcc_type": "questionable", "distance": 2.847, "atom1_id": "///D/285/O", "atom2_id": "///D/292/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7536, "atom2_serNum": 7742, "donAcc_type": "standard", "distance": 2.508, "atom1_id": "///D/286/N", "atom2_id": "///D/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7549, "atom2_serNum": 7571, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///D/287/OG", "atom2_id": "///D/290/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7549, "atom2_serNum": 7587, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///D/287/OG", "atom2_id": "///D/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7639, "atom2_serNum": 7707, "donAcc_type": "standard", "distance": 3.592, "atom1_id": "///D/298/O", "atom2_id": "///D/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7665, "atom2_serNum": 7673, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///D/302/N", "atom2_id": "///D/302/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7729, "atom2_serNum": 7739, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///D/309/OD1", "atom2_id": "///D/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7734, "atom2_serNum": 7748, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///D/310/O", "atom2_id": "///D/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7742, "atom2_serNum": 7762, "donAcc_type": "standard", "distance": 3.867, "atom1_id": "///D/311/O", "atom2_id": "///D/314/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7810, "atom2_serNum": 7812, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/320/OD1", "atom2_id": "///D/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7820, "atom2_serNum": 7833, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///D/321/NZ", "atom2_id": "///D/323/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7852, "atom2_serNum": 8611, "donAcc_type": "acceptable", "distance": 3.633, "atom1_id": "///D/325/OG1", "atom2_id": "///D/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7865, "atom2_serNum": 8594, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/327/N", "atom2_id": "///D/421/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7868, "atom2_serNum": 8591, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///D/327/O", "atom2_id": "///D/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7880, "atom2_serNum": 7890, "donAcc_type": "standard", "distance": 2.091, "atom1_id": "///D/328/O", "atom2_id": "///D/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7880, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///D/328/O", "atom2_id": "///D/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7884, "atom2_serNum": 7902, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///D/328/OE1", "atom2_id": "///D/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7919, "atom2_serNum": 10548, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/334/O", "atom2_id": "///F/53/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7932, "atom2_serNum": 8562, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///D/336/O", "atom2_id": "///D/416/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7939, "atom2_serNum": 8610, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///D/337/O", "atom2_id": "///D/422/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7971, "atom2_serNum": 8112, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///D/342/N", "atom2_id": "///D/362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7974, "atom2_serNum": 8109, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/342/O", "atom2_id": "///D/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7985, "atom2_serNum": 8101, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///D/344/N", "atom2_id": "///D/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7993, "atom2_serNum": 8117, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///D/344/OE2", "atom2_id": "///D/362/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7994, "atom2_serNum": 8101, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///D/345/N", "atom2_id": "///D/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7997, "atom2_serNum": 8098, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/345/O", "atom2_id": "///D/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7997, "atom2_serNum": 8103, "donAcc_type": "acceptable", "distance": 3.091, "atom1_id": "///D/345/O", "atom2_id": "///D/360/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7999, "atom2_serNum": 8015, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///D/345/OG", "atom2_id": "///D/347/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8008, "atom2_serNum": 8084, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/347/N", "atom2_id": "///D/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8011, "atom2_serNum": 8081, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///D/347/O", "atom2_id": "///D/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8028, "atom2_serNum": 8065, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///D/349/O", "atom2_id": "///D/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8028, "atom2_serNum": 8068, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///D/349/O", "atom2_id": "///D/356/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8036, "atom2_serNum": 8816, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/350/O", "atom2_id": "///E/1938/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8040, "atom2_serNum": 8053, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///D/351/O", "atom2_id": "///D/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8044, "atom2_serNum": 8060, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/352/O", "atom2_id": "///D/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8073, "atom2_serNum": 8334, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///D/357/N", "atom2_id": "///D/389/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8076, "atom2_serNum": 8331, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///D/357/O", "atom2_id": "///D/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8088, "atom2_serNum": 9322, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/358/OE1", "atom2_id": "///E/2005/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8089, "atom2_serNum": 9325, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///D/358/OE2", "atom2_id": "///E/2005/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8090, "atom2_serNum": 8318, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///D/359/N", "atom2_id": "///D/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8093, "atom2_serNum": 8315, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///D/359/O", "atom2_id": "///D/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8105, "atom2_serNum": 8303, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///D/361/N", "atom2_id": "///D/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8116, "atom2_serNum": 9738, "donAcc_type": "standard", "distance": 3.933, "atom1_id": "///D/362/OE1", "atom2_id": "///E/2061/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8126, "atom2_serNum": 8299, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///D/364/N", "atom2_id": "///D/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8147, "atom2_serNum": 8159, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///D/366/O", "atom2_id": "///D/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8147, "atom2_serNum": 8176, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///D/366/O", "atom2_id": "///D/369/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8147, "atom2_serNum": 10394, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///D/366/O", "atom2_id": "///F/34/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8154, "atom2_serNum": 8563, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///D/367/O", "atom2_id": "///D/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8162, "atom2_serNum": 8176, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///D/368/O", "atom2_id": "///D/369/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8167, "atom2_serNum": 8548, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///D/369/N", "atom2_id": "///D/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8170, "atom2_serNum": 8545, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///D/369/O", "atom2_id": "///D/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8176, "atom2_serNum": 10422, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/369/NH1", "atom2_id": "///F/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8177, "atom2_serNum": 10422, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/369/NH2", "atom2_id": "///F/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8178, "atom2_serNum": 8257, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///D/370/N", "atom2_id": "///D/379/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8181, "atom2_serNum": 8238, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///D/370/O", "atom2_id": "///D/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8185, "atom2_serNum": 8533, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///D/371/N", "atom2_id": "///D/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8188, "atom2_serNum": 8530, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///D/371/O", "atom2_id": "///D/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8193, "atom2_serNum": 8236, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///D/371/NE1", "atom2_id": "///D/376/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8199, "atom2_serNum": 8225, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/372/N", "atom2_id": "///D/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8202, "atom2_serNum": 8222, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///D/372/O", "atom2_id": "///D/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8210, "atom2_serNum": 8519, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/373/N", "atom2_id": "///D/411/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8241, "atom2_serNum": 8257, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///D/377/O", "atom2_id": "///D/379/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8246, "atom2_serNum": 8337, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///D/378/O", "atom2_id": "///D/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8250, "atom2_serNum": 10362, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///D/378/OE1", "atom2_id": "///F/31/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8251, "atom2_serNum": 10362, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///D/378/OE2", "atom2_id": "///F/31/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8259, "atom2_serNum": 8326, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///D/380/N", "atom2_id": "///D/388/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8262, "atom2_serNum": 8323, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/380/O", "atom2_id": "///D/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8278, "atom2_serNum": 9828, "donAcc_type": "acceptable", "distance": 2.801, "atom1_id": "///D/381/OH", "atom2_id": "///E/2072/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8279, "atom2_serNum": 8312, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///D/382/N", "atom2_id": "///D/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8282, "atom2_serNum": 10384, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/382/O", "atom2_id": "///F/33/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8286, "atom2_serNum": 9318, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///D/382/NE", "atom2_id": "///E/2005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8289, "atom2_serNum": 9318, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///D/382/NH2", "atom2_id": "///E/2005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8290, "atom2_serNum": 8312, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///D/383/N", "atom2_id": "///D/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8293, "atom2_serNum": 8300, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///D/383/O", "atom2_id": "///D/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8293, "atom2_serNum": 8309, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///D/383/O", "atom2_id": "///D/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8293, "atom2_serNum": 8312, "donAcc_type": "questionable", "distance": 2.663, "atom1_id": "///D/383/O", "atom2_id": "///D/386/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8296, "atom2_serNum": 9827, "donAcc_type": "standard", "distance": 2.475, "atom1_id": "///D/384/N", "atom2_id": "///E/2072/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8307, "atom2_serNum": 9819, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/385/OE1", "atom2_id": "///E/2071/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8308, "atom2_serNum": 9819, "donAcc_type": "standard", "distance": 2.311, "atom1_id": "///D/385/OE2", "atom2_id": "///E/2071/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8340, "atom2_serNum": 8351, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///D/390/O", "atom2_id": "///D/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8354, "atom2_serNum": 8674, "donAcc_type": "acceptable", "distance": 2.497, "atom1_id": "///D/392/O", "atom2_id": "///D/430/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8365, "atom2_serNum": 8379, "donAcc_type": "acceptable", "distance": 2.528, "atom1_id": "///D/393/OD2", "atom2_id": "///D/395/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8369, "atom2_serNum": 8380, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///D/394/O", "atom2_id": "///D/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8369, "atom2_serNum": 8385, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/394/O", "atom2_id": "///D/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8369, "atom2_serNum": 8396, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///D/394/O", "atom2_id": "///D/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8399, "atom2_serNum": 8419, "donAcc_type": "questionable", "distance": 2.576, "atom1_id": "///D/398/O", "atom2_id": "///D/400/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8407, "atom2_serNum": 8415, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///D/399/N", "atom2_id": "///D/399/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8448, "atom2_serNum": 8466, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/403/O", "atom2_id": "///D/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8493, "atom2_serNum": 8666, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///D/408/N", "atom2_id": "///D/430/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8496, "atom2_serNum": 8663, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///D/408/O", "atom2_id": "///D/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8509, "atom2_serNum": 8648, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/410/N", "atom2_id": "///D/428/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8512, "atom2_serNum": 8645, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///D/410/O", "atom2_id": "///D/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8523, "atom2_serNum": 8633, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///D/412/N", "atom2_id": "///D/426/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8526, "atom2_serNum": 8622, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///D/412/O", "atom2_id": "///D/424/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8537, "atom2_serNum": 8602, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///D/414/N", "atom2_id": "///D/422/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8540, "atom2_serNum": 8599, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///D/414/O", "atom2_id": "///D/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8540, "atom2_serNum": 8602, "donAcc_type": "questionable", "distance": 3.001, "atom1_id": "///D/414/O", "atom2_id": "///D/422/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8552, "atom2_serNum": 8586, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/416/N", "atom2_id": "///D/420/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8559, "atom2_serNum": 8610, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///D/416/NE", "atom2_id": "///D/422/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8561, "atom2_serNum": 8577, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///D/416/NH1", "atom2_id": "///D/418/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8570, "atom2_serNum": 10422, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///D/417/ND2", "atom2_id": "///F/38/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8570, "atom2_serNum": 10458, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///D/417/ND2", "atom2_id": "///F/42/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8574, "atom2_serNum": 8583, "donAcc_type": "standard", "distance": 2.432, "atom1_id": "///D/418/O", "atom2_id": "///D/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8620, "atom2_serNum": 8629, "donAcc_type": "acceptable", "distance": 2.533, "atom1_id": "///D/424/O", "atom2_id": "///D/425/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8622, "atom2_serNum": 8630, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///D/424/OG1", "atom2_id": "///D/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8627, "atom2_serNum": 8629, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///D/425/O", "atom2_id": "///D/425/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8641, "atom2_serNum": 8643, "donAcc_type": "acceptable", "distance": 2.591, "atom1_id": "///D/427/O", "atom2_id": "///D/427/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8678, "atom2_serNum": 8680, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///D/431/O", "atom2_id": "///D/431/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8689, "atom2_serNum": 8697, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/433/N", "atom2_id": "///D/433/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8714, "atom2_serNum": 8986, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///E/1924/NE2", "atom2_id": "///E/1960/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8715, "atom2_serNum": 8755, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///E/1925/N", "atom2_id": "///E/1930/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8718, "atom2_serNum": 8730, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///E/1925/O", "atom2_id": "///E/1927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8744, "atom2_serNum": 8980, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///E/1928/O", "atom2_id": "///E/1960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8759, "atom2_serNum": 8818, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///E/1930/OE1", "atom2_id": "///E/1938/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8760, "atom2_serNum": 8818, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///E/1930/OE2", "atom2_id": "///E/1938/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8761, "atom2_serNum": 8787, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///E/1931/N", "atom2_id": "///E/1934/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8764, "atom2_serNum": 8791, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///E/1931/O", "atom2_id": "///E/1935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8771, "atom2_serNum": 8799, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///E/1932/O", "atom2_id": "///E/1936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8776, "atom2_serNum": 8804, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///E/1933/O", "atom2_id": "///E/1937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8784, "atom2_serNum": 8809, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///E/1934/O", "atom2_id": "///E/1938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8790, "atom2_serNum": 8958, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///E/1934/NE2", "atom2_id": "///E/1957/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8790, "atom2_serNum": 9003, "donAcc_type": "standard", "distance": 2.298, "atom1_id": "///E/1934/NE2", "atom2_id": "///E/1963/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8794, "atom2_serNum": 8820, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///E/1935/O", "atom2_id": "///E/1939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8802, "atom2_serNum": 8838, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///E/1936/O", "atom2_id": "///E/1941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8807, "atom2_serNum": 8832, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///E/1937/O", "atom2_id": "///E/1940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 8835, "atom2_serNum": 8849, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///E/1940/O", "atom2_id": "///E/1942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8841, "atom2_serNum": 8868, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///E/1941/O", "atom2_id": "///E/1945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8855, "atom2_serNum": 8861, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///E/1943/N", "atom2_id": "///E/1943/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 8858, "atom2_serNum": 8882, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///E/1943/O", "atom2_id": "///E/1947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8866, "atom2_serNum": 8893, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///E/1944/O", "atom2_id": "///E/1948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8871, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///E/1945/O", "atom2_id": "///E/1949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 8876, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///E/1946/O", "atom2_id": "///E/1949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 8876, "atom2_serNum": 8909, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///E/1946/O", "atom2_id": "///E/1950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 8885, "atom2_serNum": 8918, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/1947/O", "atom2_id": "///E/1951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 8896, "atom2_serNum": 8929, "donAcc_type": "standard", "distance": 3.829, "atom1_id": "///E/1948/O", "atom2_id": "///E/1953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 8945, "atom2_serNum": 9016, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///E/1955/O", "atom2_id": "///E/1964/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 8953, "atom2_serNum": 9190, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///E/1956/OD1", "atom2_id": "///E/1988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 8971, "atom2_serNum": 9222, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///E/1958/NE2", "atom2_id": "///E/1992/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 8972, "atom2_serNum": 8978, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///E/1959/N", "atom2_id": "///E/1959/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 8972, "atom2_serNum": 9003, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///E/1959/N", "atom2_id": "///E/1963/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 8975, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///E/1959/O", "atom2_id": "///E/1962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 8978, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///E/1959/OD1", "atom2_id": "///E/1962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 8978, "atom2_serNum": 9000, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///E/1959/OD1", "atom2_id": "///E/1963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 8983, "atom2_serNum": 9247, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///E/1960/O", "atom2_id": "///E/1994/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 8991, "atom2_serNum": 9238, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///E/1961/O", "atom2_id": "///E/1994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 8999, "atom2_serNum": 9222, "donAcc_type": "questionable", "distance": 3.134, "atom1_id": "///E/1962/O", "atom2_id": "///E/1992/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 8999, "atom2_serNum": 9238, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///E/1962/O", "atom2_id": "///E/1994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9010, "atom2_serNum": 9065, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///E/1963/NH2", "atom2_id": "///E/1971/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9011, "atom2_serNum": 9039, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///E/1964/N", "atom2_id": "///E/1967/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9014, "atom2_serNum": 9033, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///E/1964/O", "atom2_id": "///E/1967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9014, "atom2_serNum": 9043, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///E/1964/O", "atom2_id": "///E/1968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9021, "atom2_serNum": 9043, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///E/1965/O", "atom2_id": "///E/1968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9021, "atom2_serNum": 9048, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///E/1965/O", "atom2_id": "///E/1969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9028, "atom2_serNum": 9053, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///E/1966/O", "atom2_id": "///E/1970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9036, "atom2_serNum": 9060, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///E/1967/O", "atom2_id": "///E/1971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9042, "atom2_serNum": 9217, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///E/1967/NE2", "atom2_id": "///E/1991/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9042, "atom2_serNum": 9263, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///E/1967/NE2", "atom2_id": "///E/1997/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9046, "atom2_serNum": 9066, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///E/1968/O", "atom2_id": "///E/1972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9051, "atom2_serNum": 9079, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///E/1969/O", "atom2_id": "///E/1974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9056, "atom2_serNum": 9071, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///E/1970/O", "atom2_id": "///E/1973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9077, "atom2_serNum": 10279, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///E/1973/OD1", "atom2_id": "///F/22/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9077, "atom2_serNum": 10280, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///E/1973/OD1", "atom2_id": "///F/22/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9078, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///E/1973/OD2", "atom2_id": "///F/26/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9082, "atom2_serNum": 9104, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///E/1974/O", "atom2_id": "///E/1978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9087, "atom2_serNum": 9115, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///E/1975/O", "atom2_id": "///E/1979/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9092, "atom2_serNum": 9122, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///E/1975/NE2", "atom2_id": "///E/1979/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9092, "atom2_serNum": 9391, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///E/1975/NE2", "atom2_id": "///E/2014/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9096, "atom2_serNum": 9124, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///E/1976/O", "atom2_id": "///E/1980/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9100, "atom2_serNum": 9124, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///E/1977/O", "atom2_id": "///E/1980/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9100, "atom2_serNum": 9132, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///E/1977/O", "atom2_id": "///E/1981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9107, "atom2_serNum": 9132, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///E/1978/O", "atom2_id": "///E/1981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9107, "atom2_serNum": 9140, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///E/1978/O", "atom2_id": "///E/1982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9118, "atom2_serNum": 9148, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///E/1979/O", "atom2_id": "///E/1983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9123, "atom2_serNum": 9157, "donAcc_type": "questionable", "distance": 3.177, "atom1_id": "///E/1979/NE2", "atom2_id": "///E/1983/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9127, "atom2_serNum": 9148, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/1980/O", "atom2_id": "///E/1983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9127, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///E/1980/O", "atom2_id": "///E/1984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9135, "atom2_serNum": 9162, "donAcc_type": "questionable", "distance": 3.128, "atom1_id": "///E/1981/O", "atom2_id": "///E/1984/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9135, "atom2_serNum": 9188, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///E/1981/O", "atom2_id": "///E/1987/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9166, "atom2_serNum": 9188, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///E/1984/ND2", "atom2_id": "///E/1987/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9186, "atom2_serNum": 9198, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///E/1987/O", "atom2_id": "///E/1989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9196, "atom2_serNum": 9206, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///E/1988/OD1", "atom2_id": "///E/1990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9213, "atom2_serNum": 9437, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///E/1990/OD2", "atom2_id": "///E/2021/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9228, "atom2_serNum": 9468, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///E/1992/NH1", "atom2_id": "///E/2025/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9229, "atom2_serNum": 9468, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///E/1992/NH2", "atom2_id": "///E/2025/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9229, "atom2_serNum": 9486, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///E/1992/NH2", "atom2_id": "///E/2027/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9230, "atom2_serNum": 9263, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///E/1993/N", "atom2_id": "///E/1997/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9233, "atom2_serNum": 9256, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///E/1993/O", "atom2_id": "///E/1996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9241, "atom2_serNum": 9487, "donAcc_type": "questionable", "distance": 2.983, "atom1_id": "///E/1994/O", "atom2_id": "///E/2027/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9251, "atom2_serNum": 9480, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///E/1995/O", "atom2_id": "///E/2027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9270, "atom2_serNum": 9272, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///E/1998/O", "atom2_id": "///E/1998/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9270, "atom2_serNum": 9289, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///E/1998/O", "atom2_id": "///E/2001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9270, "atom2_serNum": 9297, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///E/1998/O", "atom2_id": "///E/2002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9272, "atom2_serNum": 9289, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///E/1998/OG1", "atom2_id": "///E/2001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9277, "atom2_serNum": 9305, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///E/1999/O", "atom2_id": "///E/2003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9284, "atom2_serNum": 9310, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///E/2000/O", "atom2_id": "///E/2004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9292, "atom2_serNum": 9310, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///E/2001/O", "atom2_id": "///E/2004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9292, "atom2_serNum": 9315, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///E/2001/O", "atom2_id": "///E/2005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9300, "atom2_serNum": 9315, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///E/2002/O", "atom2_id": "///E/2005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9300, "atom2_serNum": 9326, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///E/2002/O", "atom2_id": "///E/2006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9308, "atom2_serNum": 9339, "donAcc_type": "standard", "distance": 3.918, "atom1_id": "///E/2003/O", "atom2_id": "///E/2008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9313, "atom2_serNum": 9589, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///E/2004/O", "atom2_id": "///E/2041/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9318, "atom2_serNum": 9334, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///E/2005/O", "atom2_id": "///E/2007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9349, "atom2_serNum": 9359, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///E/2009/O", "atom2_id": "///E/2011/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9349, "atom2_serNum": 10280, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///E/2009/O", "atom2_id": "///F/22/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9358, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///E/2010/O", "atom2_id": "///E/2013/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9358, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///E/2010/O", "atom2_id": "///E/2014/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9362, "atom2_serNum": 9392, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///E/2011/O", "atom2_id": "///E/2015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 9370, "atom2_serNum": 9400, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/2012/O", "atom2_id": "///E/2016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9378, "atom2_serNum": 9408, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///E/2013/O", "atom2_id": "///E/2017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9384, "atom2_serNum": 9390, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///E/2014/N", "atom2_id": "///E/2014/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9387, "atom2_serNum": 9416, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///E/2014/O", "atom2_id": "///E/2018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9395, "atom2_serNum": 9422, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///E/2015/O", "atom2_id": "///E/2019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9395, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///E/2015/O", "atom2_id": "///E/2020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9403, "atom2_serNum": 9422, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///E/2016/O", "atom2_id": "///E/2019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9403, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 3.785, "atom1_id": "///E/2016/O", "atom2_id": "///E/2020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9435, "atom2_serNum": 9445, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///E/2020/O", "atom2_id": "///E/2022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9443, "atom2_serNum": 9445, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///E/2021/OD1", "atom2_id": "///E/2022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9443, "atom2_serNum": 9452, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///E/2021/OD1", "atom2_id": "///E/2023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9452, "atom2_serNum": 9458, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///E/2023/N", "atom2_id": "///E/2023/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 9458, "atom2_serNum": 9666, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///E/2023/OD1", "atom2_id": "///E/2053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 9459, "atom2_serNum": 9671, "donAcc_type": "questionable", "distance": 2.627, "atom1_id": "///E/2023/ND2", "atom2_id": "///E/2054/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 9472, "atom2_serNum": 9503, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///E/2026/N", "atom2_id": "///E/2030/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 9475, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.346, "atom1_id": "///E/2026/O", "atom2_id": "///E/2029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 9478, "atom2_serNum": 9500, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///E/2026/OD1", "atom2_id": "///E/2030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 9479, "atom2_serNum": 9546, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///E/2026/OD2", "atom2_id": "///E/2035/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 9480, "atom2_serNum": 9486, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///E/2027/N", "atom2_id": "///E/2027/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 9483, "atom2_serNum": 9728, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///E/2027/O", "atom2_id": "///E/2060/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 9491, "atom2_serNum": 9721, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///E/2028/O", "atom2_id": "///E/2060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 9509, "atom2_serNum": 9534, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///E/2031/N", "atom2_id": "///E/2034/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 9512, "atom2_serNum": 9528, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///E/2031/O", "atom2_id": "///E/2034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9512, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///E/2031/O", "atom2_id": "///E/2035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9514, "atom2_serNum": 9528, "donAcc_type": "acceptable", "distance": 3.198, "atom1_id": "///E/2031/OG", "atom2_id": "///E/2034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 9518, "atom2_serNum": 9552, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///E/2032/O", "atom2_id": "///E/2036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9523, "atom2_serNum": 9557, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///E/2033/O", "atom2_id": "///E/2037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9531, "atom2_serNum": 9557, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///E/2034/O", "atom2_id": "///E/2037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9531, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///E/2034/O", "atom2_id": "///E/2038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9537, "atom2_serNum": 9752, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///E/2034/NE2", "atom2_id": "///E/2063/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9541, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///E/2035/O", "atom2_id": "///E/2038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9541, "atom2_serNum": 9567, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///E/2035/O", "atom2_id": "///E/2039/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9555, "atom2_serNum": 9582, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///E/2036/O", "atom2_id": "///E/2041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9555, "atom2_serNum": 9865, "donAcc_type": "acceptable", "distance": 3.549, "atom1_id": "///E/2036/O", "atom2_id": "///E/2077/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9560, "atom2_serNum": 9838, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///E/2037/O", "atom2_id": "///E/2074/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 9580, "atom2_serNum": 9860, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///E/2040/OD1", "atom2_id": "///E/2077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 9580, "atom2_serNum": 9865, "donAcc_type": "acceptable", "distance": 2.991, "atom1_id": "///E/2040/OD1", "atom2_id": "///E/2077/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 9581, "atom2_serNum": 9859, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///E/2040/ND2", "atom2_id": "///E/2076/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9585, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///E/2041/O", "atom2_id": "///E/2044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9585, "atom2_serNum": 9610, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///E/2041/O", "atom2_id": "///E/2045/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9588, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///E/2041/OD1", "atom2_id": "///E/2044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9593, "atom2_serNum": 9615, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///E/2042/O", "atom2_id": "///E/2046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9600, "atom2_serNum": 9622, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///E/2043/O", "atom2_id": "///E/2047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9608, "atom2_serNum": 9629, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///E/2044/O", "atom2_id": "///E/2048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9613, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///E/2045/O", "atom2_id": "///E/2049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9618, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///E/2046/O", "atom2_id": "///E/2049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9618, "atom2_serNum": 9645, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///E/2046/O", "atom2_id": "///E/2050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9625, "atom2_serNum": 9660, "donAcc_type": "questionable", "distance": 3.028, "atom1_id": "///E/2047/O", "atom2_id": "///E/2051/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9640, "atom2_serNum": 9665, "donAcc_type": "questionable", "distance": 2.953, "atom1_id": "///E/2049/O", "atom2_id": "///E/2052/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 9669, "atom2_serNum": 9679, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///E/2053/O", "atom2_id": "///E/2055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 9677, "atom2_serNum": 9688, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///E/2054/OD1", "atom2_id": "///E/2056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 9694, "atom2_serNum": 9763, "donAcc_type": "acceptable", "distance": 3.757, "atom1_id": "///E/2056/OD1", "atom2_id": "///E/2064/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 9694, "atom2_serNum": 9938, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///E/2056/OD1", "atom2_id": "///E/2087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 9712, "atom2_serNum": 9743, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///E/2058/NE2", "atom2_id": "///E/2062/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 9713, "atom2_serNum": 9719, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///E/2059/N", "atom2_id": "///E/2059/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 9716, "atom2_serNum": 9729, "donAcc_type": "standard", "distance": 2.269, "atom1_id": "///E/2059/O", "atom2_id": "///E/2061/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 9716, "atom2_serNum": 9740, "donAcc_type": "standard", "distance": 2.312, "atom1_id": "///E/2059/O", "atom2_id": "///E/2062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 9719, "atom2_serNum": 9749, "donAcc_type": "standard", "distance": 2.328, "atom1_id": "///E/2059/OD1", "atom2_id": "///E/2063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 9720, "atom2_serNum": 9756, "donAcc_type": "standard", "distance": 2.232, "atom1_id": "///E/2059/ND2", "atom2_id": "///E/2063/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 9732, "atom2_serNum": 9988, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///E/2061/O", "atom2_id": "///E/2093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 9743, "atom2_serNum": 9976, "donAcc_type": "questionable", "distance": 2.509, "atom1_id": "///E/2062/O", "atom2_id": "///E/2091/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 9761, "atom2_serNum": 9780, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///E/2064/O", "atom2_id": "///E/2067/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 9761, "atom2_serNum": 9791, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///E/2064/O", "atom2_id": "///E/2068/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 9768, "atom2_serNum": 9799, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///E/2065/O", "atom2_id": "///E/2069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 9775, "atom2_serNum": 9804, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///E/2066/O", "atom2_id": "///E/2070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 9783, "atom2_serNum": 9809, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///E/2067/O", "atom2_id": "///E/2071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 9794, "atom2_serNum": 9820, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/2068/O", "atom2_id": "///E/2072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 9802, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///E/2069/O", "atom2_id": "///E/2073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 9802, "atom2_serNum": 9833, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///E/2069/O", "atom2_id": "///E/2074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 9807, "atom2_serNum": 10115, "donAcc_type": "acceptable", "distance": 3.455, "atom1_id": "///E/2070/O", "atom2_id": "///E/2107/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 9832, "atom2_serNum": 9839, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///E/2073/O", "atom2_id": "///E/2075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 9836, "atom2_serNum": 9867, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///E/2074/O", "atom2_id": "///E/2078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 9842, "atom2_serNum": 9872, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///E/2075/O", "atom2_id": "///E/2079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 9851, "atom2_serNum": 9859, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///E/2076/N", "atom2_id": "///E/2076/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 9854, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///E/2076/O", "atom2_id": "///E/2080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 9863, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///E/2077/O", "atom2_id": "///E/2080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 9863, "atom2_serNum": 9888, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///E/2077/O", "atom2_id": "///E/2081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 9870, "atom2_serNum": 9896, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///E/2078/O", "atom2_id": "///E/2082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 9875, "atom2_serNum": 9904, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/2079/O", "atom2_id": "///E/2083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 9884, "atom2_serNum": 9904, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///E/2080/O", "atom2_id": "///E/2083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 9884, "atom2_serNum": 9912, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///E/2080/O", "atom2_id": "///E/2084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 9891, "atom2_serNum": 9912, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///E/2081/O", "atom2_id": "///E/2084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 9891, "atom2_serNum": 9922, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///E/2081/O", "atom2_id": "///E/2085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 9891, "atom2_serNum": 9933, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///E/2081/O", "atom2_id": "///E/2086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 9899, "atom2_serNum": 10215, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///E/2082/O", "atom2_id": "///E/2118/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 9910, "atom2_serNum": 10207, "donAcc_type": "acceptable", "distance": 2.653, "atom1_id": "///E/2083/OD1", "atom2_id": "///E/2117/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 9936, "atom2_serNum": 9946, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///E/2086/O", "atom2_id": "///E/2088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 9944, "atom2_serNum": 9957, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///E/2087/OD1", "atom2_id": "///E/2089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 9955, "atom2_serNum": 10166, "donAcc_type": "standard", "distance": 3.707, "atom1_id": "///E/2088/NH1", "atom2_id": "///E/2113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 9955, "atom2_serNum": 10174, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///E/2088/NH1", "atom2_id": "///E/2114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 9955, "atom2_serNum": 10199, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///E/2088/NH1", "atom2_id": "///E/2117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 9956, "atom2_serNum": 10199, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///E/2088/NH2", "atom2_id": "///E/2117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 9956, "atom2_serNum": 10216, "donAcc_type": "questionable", "distance": 3.268, "atom1_id": "///E/2088/NH2", "atom2_id": "///E/2119/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 9978, "atom2_serNum": 9980, "donAcc_type": "acceptable", "distance": 2.192, "atom1_id": "///E/2091/OG1", "atom2_id": "///E/2092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 9978, "atom2_serNum": 9983, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///E/2091/OG1", "atom2_id": "///E/2092/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 9978, "atom2_serNum": 9987, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///E/2091/OG1", "atom2_id": "///E/2092/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 9980, "atom2_serNum": 9987, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///E/2092/N", "atom2_id": "///E/2092/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 9980, "atom2_serNum": 10017, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///E/2092/N", "atom2_id": "///E/2096/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 9986, "atom2_serNum": 10021, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///E/2092/OD1", "atom2_id": "///E/2096/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 9986, "atom2_serNum": 10024, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///E/2092/OD1", "atom2_id": "///E/2096/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 9987, "atom2_serNum": 10014, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///E/2092/OD2", "atom2_id": "///E/2096/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10006, "atom2_serNum": 10012, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///E/2095/N", "atom2_id": "///E/2095/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10025, "atom2_serNum": 10058, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///E/2097/N", "atom2_id": "///E/2100/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10028, "atom2_serNum": 10051, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///E/2097/O", "atom2_id": "///E/2100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10028, "atom2_serNum": 10059, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///E/2097/O", "atom2_id": "///E/2101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10036, "atom2_serNum": 10067, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///E/2098/O", "atom2_id": "///E/2102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10047, "atom2_serNum": 10185, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///E/2099/NE", "atom2_id": "///E/2115/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10050, "atom2_serNum": 10185, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///E/2099/NH2", "atom2_id": "///E/2115/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10050, "atom2_serNum": 10186, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///E/2099/NH2", "atom2_id": "///E/2115/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10054, "atom2_serNum": 10081, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///E/2100/O", "atom2_id": "///E/2104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10062, "atom2_serNum": 10090, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///E/2101/O", "atom2_id": "///E/2105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10070, "atom2_serNum": 10090, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///E/2102/O", "atom2_id": "///E/2105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10070, "atom2_serNum": 10101, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///E/2102/O", "atom2_id": "///E/2106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10088, "atom2_serNum": 10099, "donAcc_type": "standard", "distance": 3.930, "atom1_id": "///E/2104/OE1", "atom2_id": "///E/2105/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10112, "atom2_serNum": 10145, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///E/2107/O", "atom2_id": "///E/2111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10122, "atom2_serNum": 10152, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///E/2108/O", "atom2_id": "///E/2112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 10128, "atom2_serNum": 10492, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///E/2108/NE2", "atom2_id": "///F/47/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 10132, "atom2_serNum": 10163, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///E/2109/O", "atom2_id": "///E/2113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 10135, "atom2_serNum": 10161, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///E/2109/OD1", "atom2_id": "///E/2112/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 10135, "atom2_serNum": 10162, "donAcc_type": "standard", "distance": 2.369, "atom1_id": "///E/2109/OD1", "atom2_id": "///E/2112/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 10140, "atom2_serNum": 10171, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///E/2110/O", "atom2_id": "///E/2114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 10148, "atom2_serNum": 10171, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///E/2111/O", "atom2_id": "///E/2114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 10148, "atom2_serNum": 10179, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///E/2111/O", "atom2_id": "///E/2115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 10155, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///E/2112/O", "atom2_id": "///E/2116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 10166, "atom2_serNum": 10196, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///E/2113/O", "atom2_id": "///E/2117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 10228, "atom2_serNum": 10241, "donAcc_type": "standard", "distance": 2.209, "atom1_id": "///F/16/O", "atom2_id": "///F/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 10238, "atom2_serNum": 10261, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///F/17/O", "atom2_id": "///F/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 10249, "atom2_serNum": 10281, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///F/19/O", "atom2_id": "///F/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 10256, "atom2_serNum": 10289, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///F/20/O", "atom2_id": "///F/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 10268, "atom2_serNum": 10309, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///F/21/OE1", "atom2_id": "///F/25/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 10269, "atom2_serNum": 10298, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///F/21/OE2", "atom2_id": "///F/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 10273, "atom2_serNum": 10311, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///F/22/O", "atom2_id": "///F/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 10284, "atom2_serNum": 10322, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/23/O", "atom2_id": "///F/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 10292, "atom2_serNum": 10330, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///F/24/O", "atom2_id": "///F/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 10303, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///F/25/O", "atom2_id": "///F/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 10314, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///F/26/O", "atom2_id": "///F/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 10314, "atom2_serNum": 10347, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///F/26/O", "atom2_id": "///F/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 10325, "atom2_serNum": 10353, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///F/27/O", "atom2_id": "///F/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 10333, "atom2_serNum": 10364, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///F/28/O", "atom2_id": "///F/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 10342, "atom2_serNum": 10375, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///F/29/O", "atom2_id": "///F/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 10350, "atom2_serNum": 10385, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///F/30/O", "atom2_id": "///F/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 10356, "atom2_serNum": 10395, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/31/O", "atom2_id": "///F/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 10367, "atom2_serNum": 10401, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///F/32/O", "atom2_id": "///F/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 10367, "atom2_serNum": 10406, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///F/32/O", "atom2_id": "///F/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 10378, "atom2_serNum": 10401, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///F/33/O", "atom2_id": "///F/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 10378, "atom2_serNum": 10406, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///F/33/O", "atom2_id": "///F/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 10378, "atom2_serNum": 10408, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///F/33/O", "atom2_id": "///F/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 10388, "atom2_serNum": 10414, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/34/O", "atom2_id": "///F/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 10404, "atom2_serNum": 10423, "donAcc_type": "standard", "distance": 3.824, "atom1_id": "///F/36/O", "atom2_id": "///F/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 10411, "atom2_serNum": 10428, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///F/37/O", "atom2_id": "///F/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 10411, "atom2_serNum": 10439, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///F/37/O", "atom2_id": "///F/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 10431, "atom2_serNum": 10460, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///F/40/O", "atom2_id": "///F/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 10431, "atom2_serNum": 10465, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///F/40/O", "atom2_id": "///F/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 10442, "atom2_serNum": 10472, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///F/41/O", "atom2_id": "///F/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 10442, "atom2_serNum": 10503, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///F/41/O", "atom2_id": "///F/48/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 10468, "atom2_serNum": 10494, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/44/O", "atom2_id": "///F/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 10475, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///F/45/O", "atom2_id": "///F/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 10481, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/46/O", "atom2_id": "///F/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 10481, "atom2_serNum": 10513, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///F/46/O", "atom2_id": "///F/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 10508, "atom2_serNum": 10530, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///F/49/O", "atom2_id": "///F/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 10508, "atom2_serNum": 10539, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///F/49/O", "atom2_id": "///F/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 10533, "atom2_serNum": 10569, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///F/52/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 10533, "atom2_serNum": 10574, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///F/52/O", "atom2_id": "///F/56/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 10542, "atom2_serNum": 10559, "donAcc_type": "standard", "distance": 2.549, "atom1_id": "///F/53/O", "atom2_id": "///F/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 10542, "atom2_serNum": 10569, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///F/53/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 10542, "atom2_serNum": 10576, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///F/53/O", "atom2_id": "///F/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 10579, "atom2_serNum": 10592, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///F/57/O", "atom2_id": "///F/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 10579, "atom2_serNum": 10600, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///F/57/O", "atom2_id": "///F/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 10579, "atom2_serNum": 10610, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/57/O", "atom2_id": "///F/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 10603, "atom2_serNum": 10619, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///F/60/O", "atom2_id": "///F/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 10603, "atom2_serNum": 10630, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///F/60/O", "atom2_id": "///F/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 10603, "atom2_serNum": 10636, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///F/60/O", "atom2_id": "///F/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 10606, "atom2_serNum": 10617, "donAcc_type": "acceptable", "distance": 3.286, "atom1_id": "///F/60/ND1", "atom2_id": "///F/61/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 10619, "atom2_serNum": 10651, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///F/62/N", "atom2_id": "///F/65/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 10695, "atom2_serNum": 10715, "donAcc_type": "questionable", "distance": 2.513, "atom1_id": "///X/1/OP2", "atom2_id": "///X/2/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1311, "atom1_serNum": 10729, "atom2_serNum": 12202, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///X/2/N6", "atom2_id": "///Y/37/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1312, "atom1_serNum": 10748, "atom2_serNum": 12181, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///X/3/N3", "atom2_id": "///Y/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1313, "atom1_serNum": 10750, "atom2_serNum": 12180, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///X/3/N4", "atom2_id": "///Y/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1314, "atom1_serNum": 10767, "atom2_serNum": 12160, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///X/4/N3", "atom2_id": "///Y/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1315, "atom1_serNum": 10769, "atom2_serNum": 12140, "donAcc_type": "standard", "distance": 3.576, "atom1_id": "///X/4/O4", "atom2_id": "///Y/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1316, "atom1_serNum": 10769, "atom2_serNum": 12159, "donAcc_type": "standard", "distance": 3.749, "atom1_id": "///X/4/O4", "atom2_id": "///Y/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1317, "atom1_serNum": 10789, "atom2_serNum": 12119, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///X/5/O6", "atom2_id": "///Y/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1318, "atom1_serNum": 10789, "atom2_serNum": 12140, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///X/5/O6", "atom2_id": "///Y/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1319, "atom1_serNum": 10790, "atom2_serNum": 12138, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///X/5/N1", "atom2_id": "///Y/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1320, "atom1_serNum": 10792, "atom2_serNum": 12137, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///X/5/N2", "atom2_id": "///Y/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1321, "atom1_serNum": 10792, "atom2_serNum": 12138, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///X/5/N2", "atom2_id": "///Y/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1322, "atom1_serNum": 10809, "atom2_serNum": 12120, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///X/6/N3", "atom2_id": "///Y/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1323, "atom1_serNum": 10811, "atom2_serNum": 12100, "donAcc_type": "standard", "distance": 3.724, "atom1_id": "///X/6/O4", "atom2_id": "///Y/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1324, "atom1_serNum": 10834, "atom2_serNum": 12097, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///X/7/N2", "atom2_id": "///Y/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1325, "atom1_serNum": 10853, "atom2_serNum": 12081, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///X/8/O6", "atom2_id": "///Y/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1326, "atom1_serNum": 10854, "atom2_serNum": 12079, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///X/8/N1", "atom2_id": "///Y/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1327, "atom1_serNum": 10856, "atom2_serNum": 12078, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///X/8/N2", "atom2_id": "///Y/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1328, "atom1_serNum": 10856, "atom2_serNum": 12079, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///X/8/N2", "atom2_id": "///Y/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1329, "atom1_serNum": 10875, "atom2_serNum": 12062, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///X/9/O6", "atom2_id": "///Y/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1330, "atom1_serNum": 10876, "atom2_serNum": 12060, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///X/9/N1", "atom2_id": "///Y/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1331, "atom1_serNum": 10878, "atom2_serNum": 12059, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///X/9/N2", "atom2_id": "///Y/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1332, "atom1_serNum": 10897, "atom2_serNum": 12022, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///X/10/N6", "atom2_id": "///Y/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1333, "atom1_serNum": 10897, "atom2_serNum": 12042, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///X/10/N6", "atom2_id": "///Y/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1334, "atom1_serNum": 10898, "atom2_serNum": 12040, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///X/10/N1", "atom2_id": "///Y/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1335, "atom1_serNum": 10918, "atom2_serNum": 12002, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///X/11/N6", "atom2_id": "///Y/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1336, "atom1_serNum": 10919, "atom2_serNum": 12020, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///X/11/N1", "atom2_id": "///Y/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1337, "atom1_serNum": 10939, "atom2_serNum": 12002, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///X/12/N6", "atom2_id": "///Y/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1338, "atom1_serNum": 10940, "atom2_serNum": 12000, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///X/12/N1", "atom2_id": "///Y/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1339, "atom1_serNum": 10960, "atom2_serNum": 11981, "donAcc_type": "questionable", "distance": 2.984, "atom1_id": "///X/13/O6", "atom2_id": "///Y/26/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1340, "atom1_serNum": 10961, "atom2_serNum": 11980, "donAcc_type": "standard", "distance": 2.509, "atom1_id": "///X/13/N1", "atom2_id": "///Y/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1341, "atom1_serNum": 10963, "atom2_serNum": 11980, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///X/13/N2", "atom2_id": "///Y/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1342, "atom1_serNum": 10982, "atom2_serNum": 11963, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///X/14/N6", "atom2_id": "///Y/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1343, "atom1_serNum": 10983, "atom2_serNum": 11961, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///X/14/N1", "atom2_id": "///Y/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1344, "atom1_serNum": 11024, "atom2_serNum": 11940, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///X/16/N6", "atom2_id": "///Y/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1345, "atom1_serNum": 11048, "atom2_serNum": 11901, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///X/17/N2", "atom2_id": "///Y/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1346, "atom1_serNum": 11048, "atom2_serNum": 11902, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///X/17/N2", "atom2_id": "///Y/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1347, "atom1_serNum": 11049, "atom2_serNum": 11923, "donAcc_type": "questionable", "distance": 2.912, "atom1_id": "///X/17/N3", "atom2_id": "///Y/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1348, "atom1_serNum": 11067, "atom2_serNum": 11884, "donAcc_type": "questionable", "distance": 3.033, "atom1_id": "///X/18/O4", "atom2_id": "///Y/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1349, "atom1_serNum": 11084, "atom2_serNum": 11841, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///X/19/O2", "atom2_id": "///Y/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1350, "atom1_serNum": 11084, "atom2_serNum": 11862, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///X/19/O2", "atom2_id": "///Y/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1351, "atom1_serNum": 11104, "atom2_serNum": 11842, "donAcc_type": "questionable", "distance": 3.070, "atom1_id": "///X/20/O2", "atom2_id": "///Y/19/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1352, "atom1_serNum": 11107, "atom2_serNum": 11822, "donAcc_type": "standard", "distance": 3.832, "atom1_id": "///X/20/O4", "atom2_id": "///Y/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1353, "atom1_serNum": 11127, "atom2_serNum": 11822, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///X/21/O6", "atom2_id": "///Y/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1354, "atom1_serNum": 11128, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///X/21/N1", "atom2_id": "///Y/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1355, "atom1_serNum": 11128, "atom2_serNum": 11820, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///X/21/N1", "atom2_id": "///Y/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1356, "atom1_serNum": 11130, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///X/21/N2", "atom2_id": "///Y/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1357, "atom1_serNum": 11152, "atom2_serNum": 11801, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///X/22/N2", "atom2_id": "///Y/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1358, "atom1_serNum": 11152, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///X/22/N2", "atom2_id": "///Y/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1359, "atom1_serNum": 11152, "atom2_serNum": 11820, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///X/22/N2", "atom2_id": "///Y/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1360, "atom1_serNum": 11171, "atom2_serNum": 11782, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///X/23/N6", "atom2_id": "///Y/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1361, "atom1_serNum": 11172, "atom2_serNum": 11781, "donAcc_type": "questionable", "distance": 2.893, "atom1_id": "///X/23/N1", "atom2_id": "///Y/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1362, "atom1_serNum": 11192, "atom2_serNum": 11764, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///X/24/N6", "atom2_id": "///Y/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1363, "atom1_serNum": 11193, "atom2_serNum": 11762, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///X/24/N1", "atom2_id": "///Y/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1364, "atom1_serNum": 11214, "atom2_serNum": 11762, "donAcc_type": "standard", "distance": 3.953, "atom1_id": "///X/25/N1", "atom2_id": "///Y/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1365, "atom1_serNum": 11234, "atom2_serNum": 11722, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///X/26/N6", "atom2_id": "///Y/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1366, "atom1_serNum": 11234, "atom2_serNum": 11723, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///X/26/N6", "atom2_id": "///Y/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1367, "atom1_serNum": 11235, "atom2_serNum": 11741, "donAcc_type": "questionable", "distance": 2.757, "atom1_id": "///X/26/N1", "atom2_id": "///Y/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1368, "atom1_serNum": 11253, "atom2_serNum": 11705, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///X/27/N3", "atom2_id": "///Y/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1369, "atom1_serNum": 11255, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///X/27/O4", "atom2_id": "///Y/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1370, "atom1_serNum": 11273, "atom2_serNum": 11684, "donAcc_type": "standard", "distance": 3.945, "atom1_id": "///X/28/N3", "atom2_id": "///Y/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1371, "atom1_serNum": 11293, "atom2_serNum": 11662, "donAcc_type": "questionable", "distance": 3.046, "atom1_id": "///X/29/N3", "atom2_id": "///Y/10/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1372, "atom1_serNum": 11295, "atom2_serNum": 11640, "donAcc_type": "questionable", "distance": 3.031, "atom1_id": "///X/29/O4", "atom2_id": "///Y/9/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1373, "atom1_serNum": 11312, "atom2_serNum": 11643, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///X/30/O2", "atom2_id": "///Y/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1374, "atom1_serNum": 11312, "atom2_serNum": 11663, "donAcc_type": "questionable", "distance": 2.577, "atom1_id": "///X/30/O2", "atom2_id": "///Y/10/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1375, "atom1_serNum": 11313, "atom2_serNum": 11641, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///X/30/N3", "atom2_id": "///Y/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1376, "atom1_serNum": 11315, "atom2_serNum": 11640, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///X/30/N4", "atom2_id": "///Y/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1377, "atom1_serNum": 11334, "atom2_serNum": 11598, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///X/31/N6", "atom2_id": "///Y/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1378, "atom1_serNum": 11335, "atom2_serNum": 11620, "donAcc_type": "questionable", "distance": 2.610, "atom1_id": "///X/31/N1", "atom2_id": "///Y/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1379, "atom1_serNum": 11352, "atom2_serNum": 11599, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///X/32/O2", "atom2_id": "///Y/7/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1380, "atom1_serNum": 11352, "atom2_serNum": 11601, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///X/32/O2", "atom2_id": "///Y/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1381, "atom1_serNum": 11355, "atom2_serNum": 11578, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///X/32/N4", "atom2_id": "///Y/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1382, "atom1_serNum": 11374, "atom2_serNum": 11556, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///X/33/N6", "atom2_id": "///Y/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1383, "atom1_serNum": 11374, "atom2_serNum": 11578, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///X/33/N6", "atom2_id": "///Y/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1384, "atom1_serNum": 11375, "atom2_serNum": 11576, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///X/33/N1", "atom2_id": "///Y/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1385, "atom1_serNum": 11392, "atom2_serNum": 11559, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///X/34/O2", "atom2_id": "///Y/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1386, "atom1_serNum": 11414, "atom2_serNum": 11537, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///X/35/O6", "atom2_id": "///Y/4/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1387, "atom1_serNum": 11415, "atom2_serNum": 11535, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///X/35/N1", "atom2_id": "///Y/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1388, "atom1_serNum": 11417, "atom2_serNum": 11534, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///X/35/N2", "atom2_id": "///Y/4/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1389, "atom1_serNum": 11436, "atom2_serNum": 11517, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///X/36/N6", "atom2_id": "///Y/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1390, "atom1_serNum": 11437, "atom2_serNum": 11515, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///X/36/N1", "atom2_id": "///Y/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1391, "atom1_serNum": 11458, "atom2_serNum": 11496, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///X/37/N1", "atom2_id": "///Y/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1392, "atom1_serNum": 11460, "atom2_serNum": 11495, "donAcc_type": "standard", "distance": 2.410, "atom1_id": "///X/37/N2", "atom2_id": "///Y/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1393, "atom1_serNum": 11460, "atom2_serNum": 11496, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///X/37/N2", "atom2_id": "///Y/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1394, "atom1_serNum": 11884, "atom2_serNum": 11923, "donAcc_type": "questionable", "distance": 3.310, "atom1_id": "///Y/21/N1", "atom2_id": "///Y/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3nbn", "num_aaChains": 6, "aaChains": "A=423,B=196,C=55,D=423,E=196,F=55", "num_naChains": 2, "naChains": "X=37,Y=37", "num_atoms": 12198, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }