{ "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.191, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.534, "chi2": -156.448, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.423, "C1C1_dist": 10.678, "N1N9_dist": 8.881, "C6C8_dist": 9.818, "CNNC_torsion": -12.094, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.60]", "interBase_angle": 9.011, "planarity": 0.339, "simple_Shear": -0.548, "simple_Stretch": -0.197, "simple_Buckle": 7.240, "simple_Propeller": -5.365, "bp_simpleParams": [ -0.548, -0.197, 0.506, 7.240, -5.365, 1.118 ], "bp_params": [ -0.537, -0.225, 0.506, 7.504, -4.988, 1.117 ], "frame": { "rmsd": null, "origin": [ -57.080, 41.197, -4.639 ], "x_axis": [ -0.928, -0.230, 0.294 ], "y_axis": [ -0.355, 0.298, -0.886 ], "z_axis": [ 0.116, -0.926, -0.358 ], "quaternion": [ -0.055, -0.182, 0.804, -0.564 ] } }, { "index": 2, "nt1": "///C/2", "nt2": "///C/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.810, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.990, "chi2": -162.545, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.816, "C1C1_dist": 10.394, "N1N9_dist": 8.657, "C6C8_dist": 9.612, "CNNC_torsion": -10.779, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.78],N1(imino)-N3[2.61],N2(amino)-O2(carbonyl)[2.41]", "interBase_angle": 12.926, "planarity": 0.173, "simple_Shear": -0.415, "simple_Stretch": -0.410, "simple_Buckle": 4.101, "simple_Propeller": -12.259, "bp_simpleParams": [ -0.415, -0.410, 0.277, 4.101, -12.259, 1.905 ], "bp_params": [ -0.399, -0.425, 0.277, 4.544, -12.101, 1.914 ], "frame": { "rmsd": null, "origin": [ -56.969, 37.764, -4.485 ], "x_axis": [ -0.964, 0.075, -0.254 ], "y_axis": [ 0.263, 0.346, -0.900 ], "z_axis": [ 0.021, -0.935, -0.354 ], "quaternion": [ 0.084, 0.104, 0.816, -0.562 ] } }, { "index": 3, "nt1": "///C/3", "nt2": "///C/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.432, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.925, "chi2": 178.739, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.477, "C1C1_dist": 10.321, "N1N9_dist": 8.630, "C6C8_dist": 9.594, "CNNC_torsion": -8.466, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.87],N1-N3(imino)[2.71]", "interBase_angle": 12.273, "planarity": 0.152, "simple_Shear": -0.458, "simple_Stretch": -0.321, "simple_Buckle": 6.868, "simple_Propeller": -10.171, "bp_simpleParams": [ -0.458, -0.321, 0.335, 6.868, -10.171, 0.488 ], "bp_params": [ -0.443, -0.341, 0.335, 7.317, -9.853, 0.489 ], "frame": { "rmsd": null, "origin": [ -57.897, 34.419, -4.278 ], "x_axis": [ -0.706, 0.327, -0.628 ], "y_axis": [ 0.707, 0.298, -0.641 ], "z_axis": [ -0.022, -0.897, -0.442 ], "quaternion": [ 0.194, 0.331, 0.782, -0.492 ] } }, { "index": 4, "nt1": "///C/4", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.718, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.659, "chi2": -158.418, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.925, "C1C1_dist": 10.172, "N1N9_dist": 8.619, "C6C8_dist": 9.741, "CNNC_torsion": -5.064, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.67]", "interBase_angle": 7.620, "planarity": 0.092, "simple_Shear": 0.186, "simple_Stretch": -0.182, "simple_Buckle": 0.371, "simple_Propeller": -7.611, "bp_simpleParams": [ 0.186, -0.182, 0.031, 0.371, -7.611, 8.133 ], "bp_params": [ 0.181, -0.186, 0.031, 0.191, -7.617, 8.151 ], "frame": { "rmsd": null, "origin": [ -60.085, 30.981, -4.599 ], "x_axis": [ -0.280, 0.510, -0.813 ], "y_axis": [ 0.956, 0.074, -0.283 ], "z_axis": [ -0.084, -0.857, -0.508 ], "quaternion": [ 0.267, 0.537, 0.682, -0.418 ] } }, { "index": 5, "nt1": "///C/5", "nt2": "///C/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.281, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.789, "chi2": -160.350, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.922, "C1C1_dist": 10.050, "N1N9_dist": 8.715, "C6C8_dist": 9.972, "CNNC_torsion": -13.602, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.82],N1(imino)-N3[3.17],N2(amino)-O2(carbonyl)[2.62]", "interBase_angle": 16.386, "planarity": 0.221, "simple_Shear": -1.566, "simple_Stretch": 0.159, "simple_Buckle": 0.855, "simple_Propeller": -16.364, "bp_simpleParams": [ -1.566, 0.159, 0.179, 0.855, -16.364, 16.046 ], "bp_params": [ -1.572, -0.084, 0.179, 3.356, -16.039, 16.196 ], "frame": { "rmsd": null, "origin": [ -62.051, 28.985, -6.908 ], "x_axis": [ 0.137, 0.585, -0.799 ], "y_axis": [ 0.987, -0.147, 0.061 ], "z_axis": [ -0.082, -0.797, -0.598 ], "quaternion": [ 0.313, 0.686, 0.573, -0.321 ] } }, { "index": 6, "nt1": "///C/6", "nt2": "///C/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -137.805, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.616, "chi2": -167.514, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.649, "C1C1_dist": 9.834, "N1N9_dist": 8.588, "C6C8_dist": 9.981, "CNNC_torsion": -17.001, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[2.99]", "interBase_angle": 29.959, "planarity": 0.361, "simple_Shear": 0.110, "simple_Stretch": 0.365, "simple_Buckle": 17.540, "simple_Propeller": -24.287, "bp_simpleParams": [ 0.110, 0.365, -0.161, 17.540, -24.287, 24.550 ], "bp_params": [ 0.105, 0.367, -0.161, 17.779, -24.113, 24.807 ], "frame": { "rmsd": null, "origin": [ -63.062, 27.054, -9.397 ], "x_axis": [ 0.724, 0.389, -0.570 ], "y_axis": [ 0.672, -0.585, 0.454 ], "z_axis": [ -0.157, -0.712, -0.684 ], "quaternion": [ 0.337, 0.865, 0.307, -0.210 ] } }, { "index": 7, "nt1": "///C/7", "nt2": "///C/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.355, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.567, "chi2": -174.496, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.873, "C1C1_dist": 10.578, "N1N9_dist": 8.895, "C6C8_dist": 9.901, "CNNC_torsion": -10.808, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.11],N1-N3(imino)[2.87]", "interBase_angle": 10.647, "planarity": 0.154, "simple_Shear": 0.165, "simple_Stretch": -0.049, "simple_Buckle": 5.811, "simple_Propeller": -8.921, "bp_simpleParams": [ 0.165, -0.049, 0.549, 5.811, -8.921, 2.545 ], "bp_params": [ 0.164, -0.052, 0.549, 5.632, -9.035, 2.550 ], "frame": { "rmsd": null, "origin": [ -64.381, 25.103, -12.241 ], "x_axis": [ 0.979, 0.188, -0.074 ], "y_axis": [ 0.184, -0.677, 0.712 ], "z_axis": [ 0.084, -0.711, -0.698 ], "quaternion": [ 0.389, 0.916, 0.102, 0.003 ] } }, { "index": 8, "nt1": "///C/8", "nt2": "///C/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.774, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.071, "chi2": -158.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.305, "C1C1_dist": 10.069, "N1N9_dist": 8.452, "C6C8_dist": 9.386, "CNNC_torsion": -12.490, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.53],N1(imino)-O2(carbonyl)[2.40],N2(amino)-O2(carbonyl)[3.39]", "interBase_angle": 17.843, "planarity": 0.207, "simple_Shear": -2.558, "simple_Stretch": -0.278, "simple_Buckle": -11.738, "simple_Propeller": -13.439, "bp_simpleParams": [ -2.558, -0.278, -0.146, -11.738, -13.439, 1.277 ], "bp_params": [ -2.410, -0.901, -0.146, -8.047, -15.926, 1.286 ], "frame": { "rmsd": null, "origin": [ -62.191, 25.147, -16.474 ], "x_axis": [ 0.966, 0.152, 0.209 ], "y_axis": [ -0.002, -0.804, 0.594 ], "z_axis": [ 0.258, -0.574, -0.777 ], "quaternion": [ 0.310, 0.942, 0.040, 0.124 ] } }, { "index": 9, "nt1": "///C/9", "nt2": "///C/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.922, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.124, "chi2": -164.073, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.583, "C1C1_dist": 10.251, "N1N9_dist": 8.616, "C6C8_dist": 9.628, "CNNC_torsion": -2.623, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.70]", "interBase_angle": 9.672, "planarity": 0.107, "simple_Shear": -0.495, "simple_Stretch": -0.307, "simple_Buckle": -6.150, "simple_Propeller": -7.464, "bp_simpleParams": [ -0.495, -0.307, -0.131, -6.150, -7.464, 2.147 ], "bp_params": [ -0.481, -0.328, -0.131, -5.813, -7.730, 2.149 ], "frame": { "rmsd": null, "origin": [ -60.745, 24.258, -19.432 ], "x_axis": [ 0.691, -0.281, 0.666 ], "y_axis": [ -0.607, -0.725, 0.325 ], "z_axis": [ 0.391, -0.629, -0.672 ], "quaternion": [ 0.271, 0.879, -0.253, 0.301 ] } }, { "index": 10, "nt1": "///C/10", "nt2": "///C/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.858, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.769, "chi2": -173.909, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.909, "C1C1_dist": 10.759, "N1N9_dist": 9.078, "C6C8_dist": 10.125, "CNNC_torsion": -9.747, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.08],O4(carbonyl)-N6(amino)[3.39]", "interBase_angle": 15.754, "planarity": 0.187, "simple_Shear": 0.046, "simple_Stretch": 0.190, "simple_Buckle": 3.961, "simple_Propeller": -15.248, "bp_simpleParams": [ 0.046, 0.190, -0.206, 3.961, -15.248, 5.612 ], "bp_params": [ 0.046, 0.190, -0.206, 3.974, -15.244, 5.658 ], "frame": { "rmsd": null, "origin": [ -57.872, 23.576, -21.721 ], "x_axis": [ 0.305, -0.661, 0.685 ], "y_axis": [ -0.866, -0.491, -0.088 ], "z_axis": [ 0.395, -0.567, -0.723 ], "quaternion": [ 0.151, 0.794, -0.481, 0.340 ] } }, { "index": 11, "nt1": "///C/11", "nt2": "///C/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.855, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.898, "chi2": -162.251, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.327, "C1C1_dist": 10.518, "N1N9_dist": 8.806, "C6C8_dist": 9.755, "CNNC_torsion": -11.745, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[2.56]", "interBase_angle": 11.688, "planarity": 0.161, "simple_Shear": -0.319, "simple_Stretch": -0.266, "simple_Buckle": -0.595, "simple_Propeller": -11.673, "bp_simpleParams": [ -0.319, -0.266, 0.348, -0.595, -11.673, 1.868 ], "bp_params": [ -0.312, -0.274, 0.348, -0.293, -11.684, 1.877 ], "frame": { "rmsd": null, "origin": [ -54.844, 22.482, -23.823 ], "x_axis": [ -0.165, -0.716, 0.678 ], "y_axis": [ -0.933, -0.110, -0.343 ], "z_axis": [ 0.321, -0.689, -0.650 ], "quaternion": [ -0.137, -0.632, 0.653, -0.395 ] } }, { "index": 12, "nt1": "///C/12", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.082, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.798, "chi2": -170.298, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.586, "C1C1_dist": 10.666, "N1N9_dist": 8.836, "C6C8_dist": 9.699, "CNNC_torsion": -11.806, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.71],N1(imino)-N3[2.71],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 16.170, "planarity": 0.193, "simple_Shear": -0.148, "simple_Stretch": -0.320, "simple_Buckle": -5.203, "simple_Propeller": -15.310, "bp_simpleParams": [ -0.148, -0.320, 0.097, -5.203, -15.310, -2.210 ], "bp_params": [ -0.146, -0.321, 0.097, -5.069, -15.355, -2.228 ], "frame": { "rmsd": null, "origin": [ -52.576, 19.747, -24.592 ], "x_axis": [ -0.698, -0.601, 0.389 ], "y_axis": [ -0.634, 0.266, -0.726 ], "z_axis": [ 0.333, -0.753, -0.567 ], "quaternion": [ -0.018, -0.388, 0.796, -0.465 ] } }, { "index": 13, "nt1": "///C/13", "nt2": "///C/17", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -162.647, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.333, "chi2": -76.831, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 20.240, "C1C1_dist": 9.388, "N1N9_dist": 6.980, "C6C8_dist": 6.229, "CNNC_torsion": 178.578, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.93],N3(imino)-N7[2.95]", "interBase_angle": 9.154, "planarity": 0.096, "simple_Shear": 5.318, "simple_Stretch": 1.612, "simple_Buckle": -8.114, "simple_Propeller": 4.238, "bp_simpleParams": [ 5.318, 1.612, 0.548, -8.114, 4.238, -89.785 ], "bp_params": [ 4.674, -3.005, 0.548, -2.036, 8.925, -89.950 ], "frame": { "rmsd": null, "origin": [ -50.058, 16.161, -24.115 ], "x_axis": [ -0.614, 0.287, -0.735 ], "y_axis": [ 0.721, 0.584, -0.374 ], "z_axis": [ 0.322, -0.760, -0.565 ], "quaternion": [ 0.318, 0.303, 0.831, -0.341 ] } }, { "index": 14, "nt1": "///D/1", "nt2": "///D/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.401, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.483, "chi2": -149.442, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.247, "C1C1_dist": 10.692, "N1N9_dist": 8.915, "C6C8_dist": 9.843, "CNNC_torsion": -12.864, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 16.315, "planarity": 0.198, "simple_Shear": -0.376, "simple_Stretch": -0.166, "simple_Buckle": -3.838, "simple_Propeller": -15.857, "bp_simpleParams": [ -0.376, -0.166, -0.002, -3.838, -15.857, 1.640 ], "bp_params": [ -0.371, -0.178, -0.002, -3.342, -15.969, 1.655 ], "frame": { "rmsd": null, "origin": [ -14.221, -10.006, -22.345 ], "x_axis": [ 0.389, -0.688, 0.612 ], "y_axis": [ 0.853, 0.520, 0.042 ], "z_axis": [ -0.348, 0.506, 0.789 ], "quaternion": [ 0.821, -0.141, -0.292, -0.469 ] } }, { "index": 15, "nt1": "///D/2", "nt2": "///D/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.216, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.072, "chi2": -168.677, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.821, "C1C1_dist": 10.251, "N1N9_dist": 8.807, "C6C8_dist": 9.947, "CNNC_torsion": -5.480, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.92],N1(imino)-N3[3.28],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 8.669, "planarity": 0.112, "simple_Shear": -1.664, "simple_Stretch": 0.118, "simple_Buckle": 7.608, "simple_Propeller": -4.155, "bp_simpleParams": [ -1.664, 0.118, 0.507, 7.608, -4.155, 10.390 ], "bp_params": [ -1.661, -0.156, 0.507, 8.187, -2.849, 10.367 ], "frame": { "rmsd": null, "origin": [ -15.806, -9.812, -19.339 ], "x_axis": [ 0.739, -0.393, 0.547 ], "y_axis": [ 0.628, 0.696, -0.349 ], "z_axis": [ -0.243, 0.601, 0.761 ], "quaternion": [ 0.894, -0.266, -0.221, -0.286 ] } }, { "index": 16, "nt1": "///D/3", "nt2": "///D/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.307, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.122, "chi2": 170.806, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.910, "C1C1_dist": 10.746, "N1N9_dist": 8.831, "C6C8_dist": 9.652, "CNNC_torsion": -5.699, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.65],N1-N3(imino)[2.76]", "interBase_angle": 9.865, "planarity": 0.125, "simple_Shear": -0.096, "simple_Stretch": -0.279, "simple_Buckle": 2.640, "simple_Propeller": -9.506, "bp_simpleParams": [ -0.096, -0.279, -0.137, 2.640, -9.506, -4.978 ], "bp_params": [ -0.094, -0.280, -0.137, 2.705, -9.487, -4.994 ], "frame": { "rmsd": null, "origin": [ -17.622, -9.040, -16.038 ], "x_axis": [ 0.959, 0.165, 0.231 ], "y_axis": [ 0.000, 0.814, -0.581 ], "z_axis": [ -0.284, 0.557, 0.780 ], "quaternion": [ 0.942, -0.302, -0.137, 0.044 ] } }, { "index": 17, "nt1": "///D/4", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.943, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.111, "chi2": -160.585, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.456, "C1C1_dist": 10.583, "N1N9_dist": 9.006, "C6C8_dist": 10.032, "CNNC_torsion": -12.144, "hbonds_num": 3, "hbonds_desc": "N6(amino)*N3(imino)[3.34],N1*O2(carbonyl)[3.07],N1-N3(imino)[3.51]", "unusual_base2base_hbonds": 1, "interBase_angle": 23.879, "planarity": 0.282, "simple_Shear": -1.789, "simple_Stretch": 0.268, "simple_Buckle": -13.921, "simple_Propeller": -19.401, "bp_simpleParams": [ -1.789, 0.268, -0.628, -13.921, -19.401, 7.681 ], "bp_params": [ -1.809, -0.035, -0.628, -10.434, -21.478, 7.786 ], "frame": { "rmsd": null, "origin": [ -17.741, -8.331, -12.148 ], "x_axis": [ 0.919, 0.355, -0.170 ], "y_axis": [ -0.389, 0.745, -0.542 ], "z_axis": [ -0.066, 0.564, 0.823 ], "quaternion": [ 0.934, -0.296, 0.028, 0.199 ] } }, { "index": 18, "nt1": "///D/5", "nt2": "///D/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.336, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.475, "chi2": -150.088, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.703, "C1C1_dist": 10.423, "N1N9_dist": 9.295, "C6C8_dist": 10.766, "CNNC_torsion": -19.270, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 32.565, "planarity": 0.388, "simple_Shear": -0.032, "simple_Stretch": 1.202, "simple_Buckle": -21.094, "simple_Propeller": -24.810, "bp_simpleParams": [ -0.032, 1.202, 0.002, -21.094, -24.810, 28.721 ], "bp_params": [ -0.002, 1.202, 0.002, -21.636, -24.339, 28.873 ], "frame": { "rmsd": null, "origin": [ -15.534, -6.721, -9.141 ], "x_axis": [ 0.563, 0.565, -0.603 ], "y_axis": [ -0.817, 0.489, -0.305 ], "z_axis": [ 0.123, 0.665, 0.737 ], "quaternion": [ 0.835, -0.290, 0.217, 0.414 ] } }, { "index": 19, "nt1": "///D/6", "nt2": "///D/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.249, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.935, "chi2": 178.522, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.929, "C1C1_dist": 10.325, "N1N9_dist": 8.728, "C6C8_dist": 9.858, "CNNC_torsion": -23.003, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.50]", "interBase_angle": 23.445, "planarity": 0.315, "simple_Shear": -0.287, "simple_Stretch": -0.047, "simple_Buckle": -11.706, "simple_Propeller": -20.314, "bp_simpleParams": [ -0.287, -0.047, 0.973, -11.706, -20.314, 7.656 ], "bp_params": [ -0.286, -0.054, 0.973, -11.117, -20.642, 7.747 ], "frame": { "rmsd": null, "origin": [ -14.899, -5.569, -5.939 ], "x_axis": [ 0.019, 0.668, -0.744 ], "y_axis": [ -0.998, -0.034, -0.056 ], "z_axis": [ -0.063, 0.743, 0.666 ], "quaternion": [ 0.642, -0.311, 0.265, 0.648 ] } }, { "index": 20, "nt1": "///D/7", "nt2": "///D/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.544, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.311, "chi2": -157.526, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.158, "C1C1_dist": 9.880, "N1N9_dist": 8.706, "C6C8_dist": 10.212, "CNNC_torsion": -7.787, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.17]", "interBase_angle": 9.823, "planarity": 0.124, "simple_Shear": 0.288, "simple_Stretch": 0.549, "simple_Buckle": 3.303, "simple_Propeller": -9.251, "bp_simpleParams": [ 0.288, 0.549, 0.284, 3.303, -9.251, 26.851 ], "bp_params": [ 0.308, 0.537, 0.284, 2.952, -9.369, 26.929 ], "frame": { "rmsd": null, "origin": [ -13.932, -2.698, -5.142 ], "x_axis": [ -0.512, 0.514, -0.688 ], "y_axis": [ -0.857, -0.243, 0.455 ], "z_axis": [ 0.067, 0.823, 0.565 ], "quaternion": [ 0.450, -0.204, 0.420, 0.761 ] } }, { "index": 21, "nt1": "///D/8", "nt2": "///D/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.349, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.363, "chi2": -163.813, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.385, "C1C1_dist": 10.440, "N1N9_dist": 8.866, "C6C8_dist": 9.900, "CNNC_torsion": -5.507, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.08],N1(imino)-O2(carbonyl)[2.74]", "interBase_angle": 13.837, "planarity": 0.216, "simple_Shear": -2.384, "simple_Stretch": 0.215, "simple_Buckle": 5.773, "simple_Propeller": -12.576, "bp_simpleParams": [ -2.384, 0.215, -0.124, 5.773, -12.576, 6.639 ], "bp_params": [ -2.367, -0.356, -0.124, 8.574, -10.861, 6.650 ], "frame": { "rmsd": null, "origin": [ -12.640, 0.378, -5.299 ], "x_axis": [ -0.692, 0.161, -0.704 ], "y_axis": [ -0.714, -0.301, 0.632 ], "z_axis": [ -0.110, 0.940, 0.323 ], "quaternion": [ 0.288, -0.267, 0.517, 0.761 ] } }, { "index": 22, "nt1": "///D/9", "nt2": "///D/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.453, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.952, "chi2": -161.165, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.766, "C1C1_dist": 9.974, "N1N9_dist": 8.624, "C6C8_dist": 9.941, "CNNC_torsion": -1.554, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.71],N1-N3(imino)[2.92]", "interBase_angle": 11.119, "planarity": 0.128, "simple_Shear": -0.465, "simple_Stretch": 0.145, "simple_Buckle": -9.324, "simple_Propeller": -6.057, "bp_simpleParams": [ -0.465, 0.145, -0.354, -9.324, -6.057, 17.855 ], "bp_params": [ -0.471, 0.126, -0.354, -9.085, -6.410, 17.827 ], "frame": { "rmsd": null, "origin": [ -12.560, 4.408, -5.425 ], "x_axis": [ -0.966, -0.214, -0.147 ], "y_axis": [ -0.060, -0.366, 0.929 ], "z_axis": [ -0.253, 0.906, 0.340 ], "quaternion": [ -0.047, -0.122, 0.561, 0.817 ] } }, { "index": 23, "nt1": "///D/10", "nt2": "///D/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 163.674, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.023, "chi2": -175.956, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.229, "C1C1_dist": 11.351, "N1N9_dist": 9.334, "C6C8_dist": 10.015, "CNNC_torsion": -2.828, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.14],O4(carbonyl)-N6(amino)[2.72]", "interBase_angle": 4.781, "planarity": 0.064, "simple_Shear": -0.531, "simple_Stretch": 0.138, "simple_Buckle": -1.730, "simple_Propeller": -4.456, "bp_simpleParams": [ -0.531, 0.138, -0.122, -1.730, -4.456, -11.914 ], "bp_params": [ -0.538, 0.108, -0.122, -1.480, -4.546, -11.922 ], "frame": { "rmsd": null, "origin": [ -12.353, 8.342, -6.520 ], "x_axis": [ -0.918, -0.319, 0.235 ], "y_axis": [ 0.333, -0.297, 0.895 ], "z_axis": [ -0.216, 0.900, 0.379 ], "quaternion": [ -0.202, 0.006, 0.557, 0.805 ] } }, { "index": 24, "nt1": "///D/11", "nt2": "///D/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.438, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.779, "chi2": -175.035, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.290, "C1C1_dist": 10.831, "N1N9_dist": 9.130, "C6C8_dist": 10.148, "CNNC_torsion": -9.733, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.30],N1(imino)-N3[3.08],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 7.912, "planarity": 0.132, "simple_Shear": -0.011, "simple_Stretch": 0.110, "simple_Buckle": 6.414, "simple_Propeller": -4.632, "bp_simpleParams": [ -0.011, 0.110, 0.637, 6.414, -4.632, 4.161 ], "bp_params": [ -0.011, 0.110, 0.637, 6.399, -4.654, 4.158 ], "frame": { "rmsd": null, "origin": [ -14.171, 11.668, -7.194 ], "x_axis": [ -0.649, -0.429, 0.628 ], "y_axis": [ 0.749, -0.216, 0.626 ], "z_axis": [ -0.133, 0.877, 0.462 ], "quaternion": [ -0.386, 0.162, 0.493, 0.763 ] } }, { "index": 25, "nt1": "///D/12", "nt2": "///D/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.733, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.112, "chi2": -152.591, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.076, "C1C1_dist": 10.627, "N1N9_dist": 8.804, "C6C8_dist": 9.614, "CNNC_torsion": -20.229, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[2.98]", "interBase_angle": 38.817, "planarity": 0.421, "simple_Shear": -0.188, "simple_Stretch": -0.237, "simple_Buckle": -21.626, "simple_Propeller": -32.235, "bp_simpleParams": [ -0.188, -0.237, -0.466, -21.626, -32.235, -0.546 ], "bp_params": [ -0.191, -0.235, -0.466, -21.803, -32.116, -0.559 ], "frame": { "rmsd": null, "origin": [ -16.746, 15.023, -6.264 ], "x_axis": [ -0.067, -0.583, 0.809 ], "y_axis": [ 0.926, 0.266, 0.268 ], "z_axis": [ -0.371, 0.767, 0.523 ], "quaternion": [ 0.656, -0.190, -0.450, -0.575 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGAAGUAGAUGGU", "strand2": "CCUUCAUUUACCA", "bp_type": "||||||||||||.", "helix_form": "AAA.....AAAx", "helical_rise": 2.657, "helical_rise_std": 0.430, "helical_radius": 9.642, "helical_radius_std": 2.099, "helical_axis": [ 0.202, -0.792, -0.575 ], "point1": [ -61.369, 39.246, -4.820 ], "point2": [ -54.946, 14.095, -23.081 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.537, -0.225, 0.506, 7.504, -4.988, 1.117 ], "step_params": [ 0.173, -1.363, 3.151, 0.160, 5.521, 36.200 ], "heli_params": [ -2.878, -0.255, 2.920, 8.821, -0.255, 36.605 ], "bp2_params": [ -0.399, -0.425, 0.277, 4.544, -12.101, 1.914 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.151, "simple_Twist": 35.484, "simple_hRise": 2.914, "simple_hTwist": 35.897 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.399, -0.425, 0.277, 4.544, -12.101, 1.914 ], "step_params": [ 0.037, -1.781, 2.987, -3.522, 4.900, 29.759 ], "heli_params": [ -4.259, -0.686, 2.645, 9.418, 6.770, 30.351 ], "bp2_params": [ -0.443, -0.341, 0.335, 7.317, -9.853, 0.489 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.987, "simple_Twist": 30.018, "simple_hRise": 2.648, "simple_hTwist": 30.605 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.443, -0.341, 0.335, 7.317, -9.853, 0.489 ], "step_params": [ -0.137, -2.424, 3.288, 0.789, 5.619, 28.371 ], "heli_params": [ -6.017, 0.438, 2.762, 11.321, -1.590, 28.921 ], "bp2_params": [ 0.181, -0.186, 0.031, 0.191, -7.617, 8.151 ], "groove_widths": [ 16.323, null, 18.332, null ], "simple_Rise": 3.288, "simple_Twist": 24.522, "simple_hRise": 2.669, "simple_hTwist": 25.160 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.186, 0.031, 0.191, -7.617, 8.151 ], "step_params": [ 0.935, -1.650, 3.096, -0.596, 6.154, 23.706 ], "heli_params": [ -5.570, -2.368, 2.568, 14.663, 1.420, 24.488 ], "bp2_params": [ -1.572, -0.084, 0.179, 3.356, -16.039, 16.196 ], "groove_widths": [ 16.641, 14.937, 17.866, 14.885 ], "simple_Rise": 3.096, "simple_Twist": 34.088, "simple_hRise": 2.750, "simple_hTwist": 34.628 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.572, -0.084, 0.179, 3.356, -16.039, 16.196 ], "step_params": [ 0.282, -0.862, 3.181, 7.041, 4.181, 38.393 ], "heli_params": [ -1.767, 0.394, 3.077, 6.270, -10.560, 39.224 ], "bp2_params": [ 0.105, 0.367, -0.161, 17.779, -24.113, 24.807 ], "groove_widths": [ 16.955, 15.067, 17.490, 14.456 ], "simple_Rise": 3.181, "simple_Twist": 29.931, "simple_hRise": 3.022, "simple_hTwist": 31.006 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.105, 0.367, -0.161, 17.779, -24.113, 24.807 ], "step_params": [ -0.761, -1.145, 3.427, -5.696, 12.643, 32.243 ], "heli_params": [ -3.818, 0.402, 2.880, 21.564, 9.714, 35.026 ], "bp2_params": [ 0.164, -0.052, 0.549, 5.632, -9.035, 2.550 ], "groove_widths": [ 17.103, 15.440, 18.440, 16.520 ], "simple_Rise": 3.427, "simple_Twist": 30.949, "simple_hRise": 2.849, "simple_hTwist": 33.845 }, { "index": 7, "nt1": "///C/7", "nt2": "///C/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.052, 0.549, 5.632, -9.035, 2.550 ], "step_params": [ 1.853, -2.662, 3.493, 7.948, 10.884, 12.286 ], "heli_params": [ -14.099, -1.697, 1.582, 38.630, -28.209, 18.218 ], "bp2_params": [ -2.410, -0.901, -0.146, -8.047, -15.926, 1.286 ], "groove_widths": [ 16.972, 15.423, 19.253, 17.912 ], "simple_Rise": 3.493, "simple_Twist": 26.573, "simple_hRise": 2.657, "simple_hTwist": 29.741 }, { "index": 8, "nt1": "///C/8", "nt2": "///C/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.410, -0.901, -0.146, -8.047, -15.926, 1.286 ], "step_params": [ -0.011, -1.284, 3.159, -3.021, 9.736, 39.048 ], "heli_params": [ -2.877, -0.298, 2.767, 14.272, 4.428, 40.306 ], "bp2_params": [ -0.481, -0.328, -0.131, -5.813, -7.730, 2.149 ], "groove_widths": [ 16.531, 14.966, 22.122, 21.369 ], "simple_Rise": 3.159, "simple_Twist": 28.115, "simple_hRise": 2.568, "simple_hTwist": 29.871 }, { "index": 9, "nt1": "///C/9", "nt2": "///C/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.481, -0.328, -0.131, -5.813, -7.730, 2.149 ], "step_params": [ 0.193, -2.022, 3.136, 2.776, -3.677, 31.244 ], "heli_params": [ -3.035, 0.158, 3.350, -6.781, -5.120, 31.573 ], "bp2_params": [ 0.046, 0.190, -0.206, 3.974, -15.244, 5.658 ], "groove_widths": [ 16.135, 14.777, 20.764, 19.289 ], "simple_Rise": 3.136, "simple_Twist": 28.717, "simple_hRise": 3.366, "simple_hTwist": 29.077 }, { "index": 10, "nt1": "///C/10", "nt2": "///C/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, 0.190, -0.206, 3.974, -15.244, 5.658 ], "step_params": [ -0.449, -2.048, 3.224, -5.195, 7.597, 26.352 ], "heli_params": [ -5.906, -0.201, 2.584, 16.053, 10.979, 27.886 ], "bp2_params": [ -0.312, -0.274, 0.348, -0.293, -11.684, 1.877 ], "groove_widths": [ 16.025, null, 17.323, null ], "simple_Rise": 3.224, "simple_Twist": 27.746, "simple_hRise": 2.623, "simple_hTwist": 29.204 }, { "index": 11, "nt1": "///C/11", "nt2": "///C/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.312, -0.274, 0.348, -0.293, -11.684, 1.877 ], "step_params": [ 0.403, -1.704, 3.186, 3.565, 4.907, 35.688 ], "heli_params": [ -3.397, -0.175, 2.958, 7.935, -5.766, 36.183 ], "bp2_params": [ -0.146, -0.321, 0.097, -5.069, -15.355, -2.228 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.186, "simple_Twist": 34.873, "simple_hRise": 2.952, "simple_hTwist": 35.380 }, { "index": 12, "nt1": "///C/12", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.146, -0.321, 0.097, -5.069, -15.355, -2.228 ], "step_params": [ -1.691, -2.427, 3.268, 0.347, 0.649, 91.687 ], "heli_params": [ -1.704, 1.185, 3.250, 0.452, -0.242, 91.690 ], "bp2_params": [ 4.674, -3.005, 0.548, -2.036, 8.925, -89.950 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.268, "simple_Twist": 61.048, "simple_hRise": 3.236, "simple_hTwist": 61.052 }, { "index": 13, "nt1": "///C/13", "nt2": "///C/17", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 2, "num_stems": 1, "strand1": "GGAAGUAGAUGG", "strand2": "CCUUCAUUUACC", "bp_type": "||||||||||||", "helix_form": "..........A", "helical_rise": 2.564, "helical_rise_std": 0.414, "helical_radius": 10.022, "helical_radius_std": 1.031, "helical_axis": [ -0.201, 0.777, 0.596 ], "point1": [ -12.549, -11.966, -18.436 ], "point2": [ -18.182, 9.778, -1.774 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.178, -0.002, -3.342, -15.969, 1.655 ], "step_params": [ 0.815, -1.560, 2.914, -8.244, -0.546, 26.798 ], "heli_params": [ -3.111, -3.358, 2.584, -1.143, 17.273, 28.021 ], "bp2_params": [ -1.661, -0.156, 0.507, 8.187, -2.849, 10.367 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.914, "simple_Twist": 34.586, "simple_hRise": 2.679, "simple_hTwist": 35.529 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.661, -0.156, 0.507, 8.187, -2.849, 10.367 ], "step_params": [ -0.403, -1.604, 3.472, 3.363, -1.344, 39.610 ], "heli_params": [ -2.192, 1.008, 3.478, -1.978, -4.949, 39.768 ], "bp2_params": [ -0.094, -0.280, -0.137, 2.705, -9.487, -4.994 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.472, "simple_Twist": 30.705, "simple_hRise": 3.474, "simple_hTwist": 30.913 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.280, -0.137, 2.705, -9.487, -4.994 ], "step_params": [ 0.176, -1.718, 3.558, 3.571, 12.280, 22.738 ], "heli_params": [ -7.058, 0.553, 2.337, 28.442, -8.270, 26.046 ], "bp2_params": [ -1.809, -0.035, -0.628, -10.434, -21.478, 7.786 ], "groove_widths": [ 16.201, null, 19.178, null ], "simple_Rise": 3.558, "simple_Twist": 31.496, "simple_hRise": 2.721, "simple_hTwist": 33.932 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.809, -0.035, -0.628, -10.434, -21.478, 7.786 ], "step_params": [ 1.263, -1.791, 3.421, 0.938, 13.185, 32.314 ], "heli_params": [ -4.895, -1.974, 2.553, 22.549, -1.605, 34.846 ], "bp2_params": [ -0.002, 1.202, 0.002, -21.636, -24.339, 28.873 ], "groove_widths": [ 16.273, 14.644, 18.540, 15.351 ], "simple_Rise": 3.421, "simple_Twist": 21.683, "simple_hRise": 2.058, "simple_hTwist": 25.353 }, { "index": 5, "nt1": "///D/5", "nt2": "///D/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.002, 1.202, 0.002, -21.636, -24.339, 28.873 ], "step_params": [ -1.222, -0.959, 3.094, -12.013, 2.546, 33.279 ], "heli_params": [ -1.952, 0.238, 3.249, 4.269, 20.143, 35.412 ], "bp2_params": [ -0.286, -0.054, 0.973, -11.117, -20.642, 7.747 ], "groove_widths": [ 16.769, 14.991, 17.895, 14.985 ], "simple_Rise": 3.094, "simple_Twist": 35.806, "simple_hRise": 3.250, "simple_hTwist": 37.788 }, { "index": 6, "nt1": "///D/6", "nt2": "///D/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.286, -0.054, 0.973, -11.117, -20.642, 7.747 ], "step_params": [ 0.865, -1.222, 2.751, 9.082, 5.239, 31.920 ], "heli_params": [ -2.847, -0.233, 2.663, 9.220, -15.985, 33.555 ], "bp2_params": [ 0.308, 0.537, 0.284, 2.952, -9.369, 26.929 ], "groove_widths": [ 17.373, 15.454, 18.977, 16.375 ], "simple_Rise": 2.751, "simple_Twist": 28.882, "simple_hRise": 2.639, "simple_hTwist": 30.688 }, { "index": 7, "nt1": "///D/7", "nt2": "///D/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.308, 0.537, 0.284, 2.952, -9.369, 26.929 ], "step_params": [ 0.376, -2.000, 2.648, 1.452, 18.432, 13.568 ], "heli_params": [ -8.385, -0.683, -0.003, 53.862, -4.242, 22.898 ], "bp2_params": [ -2.367, -0.356, -0.124, 8.574, -10.861, 6.650 ], "groove_widths": [ 17.119, 15.204, 19.260, 17.902 ], "simple_Rise": 2.648, "simple_Twist": 28.569, "simple_hRise": 1.191, "simple_hTwist": 33.925 }, { "index": 8, "nt1": "///D/8", "nt2": "///D/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.367, -0.356, -0.124, 8.574, -10.861, 6.650 ], "step_params": [ -0.069, -1.663, 3.672, -4.923, 6.914, 42.040 ], "heli_params": [ -3.024, -0.438, 3.357, 9.521, 6.779, 42.850 ], "bp2_params": [ -0.471, 0.126, -0.354, -9.085, -6.410, 17.827 ], "groove_widths": [ 16.357, 14.530, 22.872, 22.423 ], "simple_Rise": 3.672, "simple_Twist": 31.311, "simple_hRise": 3.215, "simple_hTwist": 32.413 }, { "index": 9, "nt1": "///D/9", "nt2": "///D/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.471, 0.126, -0.354, -9.085, -6.410, 17.827 ], "step_params": [ -1.305, -2.311, 3.111, -2.501, -1.825, 22.980 ], "heli_params": [ -5.118, 2.381, 3.402, -4.554, 6.242, 23.184 ], "bp2_params": [ -0.538, 0.108, -0.122, -1.480, -4.546, -11.922 ], "groove_widths": [ 15.761, null, 21.170, null ], "simple_Rise": 3.111, "simple_Twist": 22.923, "simple_hRise": 3.403, "simple_hTwist": 23.129 }, { "index": 10, "nt1": "///D/10", "nt2": "///D/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.538, 0.108, -0.122, -1.480, -4.546, -11.922 ], "step_params": [ -0.071, -2.419, 2.993, -6.720, -1.223, 28.301 ], "heli_params": [ -4.565, -1.234, 3.029, -2.456, 13.497, 29.098 ], "bp2_params": [ -0.011, 0.110, 0.637, 6.399, -4.654, 4.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.993, "simple_Twist": 26.071, "simple_hRise": 3.024, "simple_hTwist": 26.936 }, { "index": 11, "nt1": "///D/11", "nt2": "///D/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, 0.110, 0.637, 6.399, -4.654, 4.158 ], "step_params": [ -0.221, -1.866, 3.901, 10.650, 11.215, 35.113 ], "heli_params": [ -4.403, 1.815, 3.001, 17.574, -16.689, 38.270 ], "bp2_params": [ -0.191, -0.235, -0.466, -21.803, -32.116, -0.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.901, "simple_Twist": 34.064, "simple_hRise": 2.966, "simple_hTwist": 37.316 }, { "index": 12, "nt1": "///D/12", "nt2": "///D/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGAAGUAGAUGG", "strand2": "CCUUCAUUUACC", "bp_type": "||||||||||||", "helix_form": "AAA.....AAA", "helical_rise": 2.568, "helical_rise_std": 0.325, "helical_radius": 9.918, "helical_radius_std": 0.876, "helical_axis": [ 0.191, -0.806, -0.560 ], "point1": [ -61.655, 39.264, -4.743 ], "point2": [ -56.288, 16.677, -20.451 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.537, -0.225, 0.506, 7.504, -4.988, 1.117 ], "step_params": [ 0.173, -1.363, 3.151, 0.160, 5.521, 36.200 ], "heli_params": [ -2.878, -0.255, 2.920, 8.821, -0.255, 36.605 ], "bp2_params": [ -0.399, -0.425, 0.277, 4.544, -12.101, 1.914 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.151, "simple_Twist": 35.484, "simple_hRise": 2.914, "simple_hTwist": 35.897 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.399, -0.425, 0.277, 4.544, -12.101, 1.914 ], "step_params": [ 0.037, -1.781, 2.987, -3.522, 4.900, 29.759 ], "heli_params": [ -4.259, -0.686, 2.645, 9.418, 6.770, 30.351 ], "bp2_params": [ -0.443, -0.341, 0.335, 7.317, -9.853, 0.489 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.987, "simple_Twist": 30.018, "simple_hRise": 2.648, "simple_hTwist": 30.605 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.443, -0.341, 0.335, 7.317, -9.853, 0.489 ], "step_params": [ -0.137, -2.424, 3.288, 0.789, 5.619, 28.371 ], "heli_params": [ -6.017, 0.438, 2.762, 11.321, -1.590, 28.921 ], "bp2_params": [ 0.181, -0.186, 0.031, 0.191, -7.617, 8.151 ], "groove_widths": [ 16.323, null, 18.332, null ], "simple_Rise": 3.288, "simple_Twist": 24.522, "simple_hRise": 2.669, "simple_hTwist": 25.160 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.186, 0.031, 0.191, -7.617, 8.151 ], "step_params": [ 0.935, -1.650, 3.096, -0.596, 6.154, 23.706 ], "heli_params": [ -5.570, -2.368, 2.568, 14.663, 1.420, 24.488 ], "bp2_params": [ -1.572, -0.084, 0.179, 3.356, -16.039, 16.196 ], "groove_widths": [ 16.641, 14.937, 17.866, 14.885 ], "simple_Rise": 3.096, "simple_Twist": 34.088, "simple_hRise": 2.750, "simple_hTwist": 34.628 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.572, -0.084, 0.179, 3.356, -16.039, 16.196 ], "step_params": [ 0.282, -0.862, 3.181, 7.041, 4.181, 38.393 ], "heli_params": [ -1.767, 0.394, 3.077, 6.270, -10.560, 39.224 ], "bp2_params": [ 0.105, 0.367, -0.161, 17.779, -24.113, 24.807 ], "groove_widths": [ 16.955, 15.067, 17.490, 14.456 ], "simple_Rise": 3.181, "simple_Twist": 29.931, "simple_hRise": 3.022, "simple_hTwist": 31.006 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.105, 0.367, -0.161, 17.779, -24.113, 24.807 ], "step_params": [ -0.761, -1.145, 3.427, -5.696, 12.643, 32.243 ], "heli_params": [ -3.818, 0.402, 2.880, 21.564, 9.714, 35.026 ], "bp2_params": [ 0.164, -0.052, 0.549, 5.632, -9.035, 2.550 ], "groove_widths": [ 17.103, 15.440, 18.440, 16.520 ], "simple_Rise": 3.427, "simple_Twist": 30.949, "simple_hRise": 2.849, "simple_hTwist": 33.845 }, { "index": 7, "nt1": "///C/7", "nt2": "///C/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.052, 0.549, 5.632, -9.035, 2.550 ], "step_params": [ 1.853, -2.662, 3.493, 7.948, 10.884, 12.286 ], "heli_params": [ -14.099, -1.697, 1.582, 38.630, -28.209, 18.218 ], "bp2_params": [ -2.410, -0.901, -0.146, -8.047, -15.926, 1.286 ], "groove_widths": [ 16.972, 15.423, 19.253, 17.912 ], "simple_Rise": 3.493, "simple_Twist": 26.573, "simple_hRise": 2.657, "simple_hTwist": 29.741 }, { "index": 8, "nt1": "///C/8", "nt2": "///C/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.410, -0.901, -0.146, -8.047, -15.926, 1.286 ], "step_params": [ -0.011, -1.284, 3.159, -3.021, 9.736, 39.048 ], "heli_params": [ -2.877, -0.298, 2.767, 14.272, 4.428, 40.306 ], "bp2_params": [ -0.481, -0.328, -0.131, -5.813, -7.730, 2.149 ], "groove_widths": [ 16.531, 14.966, 22.122, 21.369 ], "simple_Rise": 3.159, "simple_Twist": 28.115, "simple_hRise": 2.568, "simple_hTwist": 29.871 }, { "index": 9, "nt1": "///C/9", "nt2": "///C/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.481, -0.328, -0.131, -5.813, -7.730, 2.149 ], "step_params": [ 0.193, -2.022, 3.136, 2.776, -3.677, 31.244 ], "heli_params": [ -3.035, 0.158, 3.350, -6.781, -5.120, 31.573 ], "bp2_params": [ 0.046, 0.190, -0.206, 3.974, -15.244, 5.658 ], "groove_widths": [ 16.135, null, 20.764, null ], "simple_Rise": 3.136, "simple_Twist": 28.717, "simple_hRise": 3.366, "simple_hTwist": 29.077 }, { "index": 10, "nt1": "///C/10", "nt2": "///C/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, 0.190, -0.206, 3.974, -15.244, 5.658 ], "step_params": [ -0.449, -2.048, 3.224, -5.195, 7.597, 26.352 ], "heli_params": [ -5.906, -0.201, 2.584, 16.053, 10.979, 27.886 ], "bp2_params": [ -0.312, -0.274, 0.348, -0.293, -11.684, 1.877 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.224, "simple_Twist": 27.746, "simple_hRise": 2.623, "simple_hTwist": 29.204 }, { "index": 11, "nt1": "///C/11", "nt2": "///C/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.312, -0.274, 0.348, -0.293, -11.684, 1.877 ], "step_params": [ 0.403, -1.704, 3.186, 3.565, 4.907, 35.688 ], "heli_params": [ -3.397, -0.175, 2.958, 7.935, -5.766, 36.183 ], "bp2_params": [ -0.146, -0.321, 0.097, -5.069, -15.355, -2.228 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.186, "simple_Twist": 34.873, "simple_hRise": 2.952, "simple_hTwist": 35.380 }, { "index": 12, "nt1": "///C/12", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GGAAGUAGAUGG", "strand2": "CCUUCAUUUACC", "bp_type": "||||||||||||", "helix_form": "..........A", "helical_rise": 2.564, "helical_rise_std": 0.414, "helical_radius": 10.022, "helical_radius_std": 1.031, "helical_axis": [ -0.201, 0.777, 0.596 ], "point1": [ -12.549, -11.966, -18.436 ], "point2": [ -18.182, 9.778, -1.774 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///D/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.178, -0.002, -3.342, -15.969, 1.655 ], "step_params": [ 0.815, -1.560, 2.914, -8.244, -0.546, 26.798 ], "heli_params": [ -3.111, -3.358, 2.584, -1.143, 17.273, 28.021 ], "bp2_params": [ -1.661, -0.156, 0.507, 8.187, -2.849, 10.367 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.914, "simple_Twist": 34.586, "simple_hRise": 2.679, "simple_hTwist": 35.529 }, { "index": 2, "nt1": "///D/2", "nt2": "///D/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.661, -0.156, 0.507, 8.187, -2.849, 10.367 ], "step_params": [ -0.403, -1.604, 3.472, 3.363, -1.344, 39.610 ], "heli_params": [ -2.192, 1.008, 3.478, -1.978, -4.949, 39.768 ], "bp2_params": [ -0.094, -0.280, -0.137, 2.705, -9.487, -4.994 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.472, "simple_Twist": 30.705, "simple_hRise": 3.474, "simple_hTwist": 30.913 }, { "index": 3, "nt1": "///D/3", "nt2": "///D/29", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.280, -0.137, 2.705, -9.487, -4.994 ], "step_params": [ 0.176, -1.718, 3.558, 3.571, 12.280, 22.738 ], "heli_params": [ -7.058, 0.553, 2.337, 28.442, -8.270, 26.046 ], "bp2_params": [ -1.809, -0.035, -0.628, -10.434, -21.478, 7.786 ], "groove_widths": [ 16.201, null, 19.178, null ], "simple_Rise": 3.558, "simple_Twist": 31.496, "simple_hRise": 2.721, "simple_hTwist": 33.932 }, { "index": 4, "nt1": "///D/4", "nt2": "///D/28", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.809, -0.035, -0.628, -10.434, -21.478, 7.786 ], "step_params": [ 1.263, -1.791, 3.421, 0.938, 13.185, 32.314 ], "heli_params": [ -4.895, -1.974, 2.553, 22.549, -1.605, 34.846 ], "bp2_params": [ -0.002, 1.202, 0.002, -21.636, -24.339, 28.873 ], "groove_widths": [ 16.273, 14.644, 18.540, 15.351 ], "simple_Rise": 3.421, "simple_Twist": 21.683, "simple_hRise": 2.058, "simple_hTwist": 25.353 }, { "index": 5, "nt1": "///D/5", "nt2": "///D/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.002, 1.202, 0.002, -21.636, -24.339, 28.873 ], "step_params": [ -1.222, -0.959, 3.094, -12.013, 2.546, 33.279 ], "heli_params": [ -1.952, 0.238, 3.249, 4.269, 20.143, 35.412 ], "bp2_params": [ -0.286, -0.054, 0.973, -11.117, -20.642, 7.747 ], "groove_widths": [ 16.769, 14.991, 17.895, 14.985 ], "simple_Rise": 3.094, "simple_Twist": 35.806, "simple_hRise": 3.250, "simple_hTwist": 37.788 }, { "index": 6, "nt1": "///D/6", "nt2": "///D/26", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.286, -0.054, 0.973, -11.117, -20.642, 7.747 ], "step_params": [ 0.865, -1.222, 2.751, 9.082, 5.239, 31.920 ], "heli_params": [ -2.847, -0.233, 2.663, 9.220, -15.985, 33.555 ], "bp2_params": [ 0.308, 0.537, 0.284, 2.952, -9.369, 26.929 ], "groove_widths": [ 17.373, 15.454, 18.977, 16.375 ], "simple_Rise": 2.751, "simple_Twist": 28.882, "simple_hRise": 2.639, "simple_hTwist": 30.688 }, { "index": 7, "nt1": "///D/7", "nt2": "///D/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.308, 0.537, 0.284, 2.952, -9.369, 26.929 ], "step_params": [ 0.376, -2.000, 2.648, 1.452, 18.432, 13.568 ], "heli_params": [ -8.385, -0.683, -0.003, 53.862, -4.242, 22.898 ], "bp2_params": [ -2.367, -0.356, -0.124, 8.574, -10.861, 6.650 ], "groove_widths": [ 17.119, 15.204, 19.260, 17.902 ], "simple_Rise": 2.648, "simple_Twist": 28.569, "simple_hRise": 1.191, "simple_hTwist": 33.925 }, { "index": 8, "nt1": "///D/8", "nt2": "///D/24", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.367, -0.356, -0.124, 8.574, -10.861, 6.650 ], "step_params": [ -0.069, -1.663, 3.672, -4.923, 6.914, 42.040 ], "heli_params": [ -3.024, -0.438, 3.357, 9.521, 6.779, 42.850 ], "bp2_params": [ -0.471, 0.126, -0.354, -9.085, -6.410, 17.827 ], "groove_widths": [ 16.357, 14.530, 22.872, 22.423 ], "simple_Rise": 3.672, "simple_Twist": 31.311, "simple_hRise": 3.215, "simple_hTwist": 32.413 }, { "index": 9, "nt1": "///D/9", "nt2": "///D/23", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.471, 0.126, -0.354, -9.085, -6.410, 17.827 ], "step_params": [ -1.305, -2.311, 3.111, -2.501, -1.825, 22.980 ], "heli_params": [ -5.118, 2.381, 3.402, -4.554, 6.242, 23.184 ], "bp2_params": [ -0.538, 0.108, -0.122, -1.480, -4.546, -11.922 ], "groove_widths": [ 15.761, null, 21.170, null ], "simple_Rise": 3.111, "simple_Twist": 22.923, "simple_hRise": 3.403, "simple_hTwist": 23.129 }, { "index": 10, "nt1": "///D/10", "nt2": "///D/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.538, 0.108, -0.122, -1.480, -4.546, -11.922 ], "step_params": [ -0.071, -2.419, 2.993, -6.720, -1.223, 28.301 ], "heli_params": [ -4.565, -1.234, 3.029, -2.456, 13.497, 29.098 ], "bp2_params": [ -0.011, 0.110, 0.637, 6.399, -4.654, 4.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.993, "simple_Twist": 26.071, "simple_hRise": 3.024, "simple_hTwist": 26.936 }, { "index": 11, "nt1": "///D/11", "nt2": "///D/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, 0.110, 0.637, 6.399, -4.654, 4.158 ], "step_params": [ -0.221, -1.866, 3.901, 10.650, 11.215, 35.113 ], "heli_params": [ -4.403, 1.815, 3.001, 17.574, -16.689, 38.270 ], "bp2_params": [ -0.191, -0.235, -0.466, -21.803, -32.116, -0.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.901, "simple_Twist": 34.064, "simple_hRise": 2.966, "simple_hTwist": 37.316 }, { "index": 12, "nt1": "///D/12", "nt2": "///D/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 9, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CA", "nts_long": "///C/15,///C/16" }, { "index": 2, "num_nts": 2, "nts_short": "AC", "nts_long": "///C/17,///C/20" }, { "index": 3, "num_nts": 2, "nts_short": "Ca", "nts_long": "///C/34,///A/501" }, { "index": 4, "num_nts": 2, "nts_short": "Ca", "nts_long": "///D/34,///B/502" }, { "index": 5, "num_nts": 3, "nts_short": "GAC", "nts_long": "///C/1,///C/32,///C/33" }, { "index": 6, "num_nts": 3, "nts_short": "GUU", "nts_long": "///C/12,///C/13,///C/14" }, { "index": 7, "num_nts": 3, "nts_short": "GUU", "nts_long": "///D/12,///D/13,///D/14" }, { "index": 8, "num_nts": 3, "nts_short": "CAA", "nts_long": "///D/15,///D/16,///D/17" }, { "index": 9, "num_nts": 3, "nts_short": "CAC", "nts_long": "///D/31,///D/32,///D/33" } ], "nonStack": { "num_nts": 4, "nts_short": "GUGU", "nts_long": "///C/18,///C/19,///D/18,///D/19" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///C/16/OP2", "nt": "///C/14", "vert_dist": 2.972 }, { "index": 2, "type": "phosphate", "atom": "///D/16/OP2", "nt": "///D/14", "vert_dist": 2.928 }, { "index": 3, "type": "sugar", "atom": "///D/17/O2'", "nt": "///D/20", "vert_dist": 2.918 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 1 ], "summary": "[1] 7 [C.12 C.20] 12", "num_nts": 9, "nts_short": "GUUCAAGUC", "nts_long": "///C/12,///C/13,///C/14,///C/15,///C/16,///C/17,///C/18,///C/19,///C/20", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAAGU", "nts_long": "///C/13,///C/14,///C/15,///C/16,///C/17,///C/18,///C/19" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 2 ], "summary": "[1] 7 [D.12 D.20] 12", "num_nts": 9, "nts_short": "GUUCAAGUC", "nts_long": "///D/12,///D/13,///D/14,///D/15,///D/16,///D/17,///D/18,///D/19,///D/20", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAAGU", "nts_long": "///D/13,///D/14,///D/15,///D/16,///D/17,///D/18,///D/19" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 3, "nts_short": "ACC", "nts_long": "///C/32,///C/33,///C/34" }, { "index": 2, "num_nts": 3, "nts_short": "ACC", "nts_long": "///D/32,///D/33,///D/34" }, { "index": 3, "num_nts": 1, "nts_short": "a", "nts_long": "///A/501" }, { "index": 4, "num_nts": 1, "nts_short": "a", "nts_long": "///B/502" } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/17,///C/18" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///D/14,///D/15" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///D/17,///D/18" }, { "index": 4, "num_nts": 2, "nts_short": "UC", "nts_long": "///D/19,///D/20" } ], "dbn": { "all_chains": { "num_nts": 70, "num_chars": 73, "bseq": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC&GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC&a&a", "bseqUP": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC&GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC&A&A", "sstr": "((((((((((((.......))))))))))))...&((((((((((((.......))))))))))))...&.&.", "form": "AAAAAA.AAAAAA......AAAA.AAA.AAA..-&AAA.AA.A.AAA.......A.AAAA.AAAAA..-&-&-" }, "chain_C": { "num_nts": 34, "num_chars": 34, "bseq": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "bseqUP": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "sstr": "((((((((((((.......))))))))))))...", "form": "AAAAAA.AAAAAA......AAAA.AAA.AAA..-" }, "chain_D": { "num_nts": 34, "num_chars": 34, "bseq": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "bseqUP": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "sstr": "((((((((((((.......))))))))))))...", "form": "AAA.AA.A.AAA.......A.AAAA.AAAAA..-" } }, "chains": { "chain_C": { "num_nts": 34, "bseq": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "sstr": "((((((((((((.......))))))))))))...", "form": "AAAAAA.AAAAAA......AAAA.AAA.AAA..-", "helical_rise": 0.289, "helical_rise_std": 2.701, "helical_axis": [ 0.805, -0.022, 0.592 ], "point1": [ -53.359, 23.675, -15.161 ], "point2": [ -45.716, 23.465, -9.541 ], "num_chars": 100, "suite": "G1aG1aA1aA1aG1aU1aA!!G1aA1cU1LG!!G1aU1aU1gC1aA!!A!!G!!U2aC1aC1cA1aU1aU1aU1aA1aC1aU1cU1aC1aC1aA1aC1mC" }, "chain_D": { "num_nts": 34, "bseq": "GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACC", "sstr": "((((((((((((.......))))))))))))...", "form": "AAA.AA.A.AAA.......A.AAAA.AAAAA..-", "helical_rise": 0.299, "helical_rise_std": 2.878, "helical_axis": [ -0.927, -0.216, -0.308 ], "point1": [ -17.847, 4.958, -9.633 ], "point2": [ -26.968, 2.827, -12.661 ], "num_chars": 100, "suite": "G1aG1aA1aA1aG1aU1aA1eG!!A!!U1LG1aG1aU1aU1gC1aA!!A!!G!!U2aC1aC!!A1aU1aU!!U!!A1LC1aU!!U1aC1aC1aA1aC!!C" } }, "num_nts": 70, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 117.181, "gamma": 82.121, "delta": 77.668, "epsilon": -135.347, "zeta": -77.702, "epsilon_zeta": -57.645, "bb_type": "BI", "chi": -170.191, "glyco_bond": "anti", "C5prime_xyz": [ -1.757, 8.856, 1.114 ], "P_xyz": [ 0.378, 9.770, -0.452 ], "form": "A", "ssZp": 4.270, "Dp": 4.381, "splay_angle": 21.395, "splay_distance": 3.470, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": null, "theta": -149.711, "eta_prime": null, "theta_prime": -158.141, "eta_base": null, "theta_base": -126.172, "v0": 0.495, "v1": -26.640, "v2": 41.597, "v3": -42.756, "v4": 26.152, "amplitude": 43.755, "phase_angle": 18.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ -56.761, 40.991, -4.709 ], "x_axis": [ -0.924, -0.269, 0.271 ], "y_axis": [ -0.336, 0.240, -0.911 ], "z_axis": [ 0.180, -0.933, -0.312 ], "quaternion": [ -0.029, -0.192, 0.787, -0.586 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -68.793, "beta": 167.994, "gamma": 57.682, "delta": 77.249, "epsilon": -160.459, "zeta": -64.015, "epsilon_zeta": -96.444, "bb_type": "BI", "chi": -166.810, "glyco_bond": "anti", "C5prime_xyz": [ -1.432, 8.828, 0.926 ], "P_xyz": [ 1.100, 9.408, 0.837 ], "form": "A", "ssZp": 4.673, "Dp": 4.707, "splay_angle": 22.363, "splay_distance": 3.560, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 160.958, "theta": -149.457, "eta_prime": 173.515, "theta_prime": -148.007, "eta_base": -136.216, "theta_base": -123.888, "v0": 1.677, "v1": -28.767, "v2": 42.518, "v3": -42.561, "v4": 26.387, "amplitude": 44.321, "phase_angle": 16.396, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.839, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -56.829, 37.546, -4.292 ], "x_axis": [ -0.953, -0.020, -0.303 ], "y_axis": [ 0.282, 0.309, -0.908 ], "z_axis": [ 0.112, -0.951, -0.289 ], "quaternion": [ 0.130, 0.082, 0.799, -0.582 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -86.487, "beta": 170.356, "gamma": 66.179, "delta": 86.673, "epsilon": -146.469, "zeta": -76.694, "epsilon_zeta": -69.775, "bb_type": "BI", "chi": -173.432, "glyco_bond": "anti", "C5prime_xyz": [ -1.899, 8.566, 1.305 ], "P_xyz": [ 0.636, 9.240, 1.289 ], "form": "A", "ssZp": 4.643, "Dp": 4.608, "splay_angle": 23.879, "splay_distance": 3.950, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.644, "theta": -142.155, "eta_prime": -177.063, "theta_prime": -143.766, "eta_base": -136.862, "theta_base": -121.132, "v0": -0.855, "v1": -24.918, "v2": 40.144, "v3": -41.209, "v4": 26.395, "amplitude": 42.564, "phase_angle": 19.414, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.452, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ -57.866, 34.145, -4.103 ], "x_axis": [ -0.705, 0.249, -0.664 ], "y_axis": [ 0.710, 0.238, -0.663 ], "z_axis": [ -0.007, -0.939, -0.344 ], "quaternion": [ 0.217, 0.317, 0.756, -0.530 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.944, "beta": 168.080, "gamma": 60.015, "delta": 77.047, "epsilon": -144.676, "zeta": -78.821, "epsilon_zeta": -65.855, "bb_type": "BI", "chi": -168.718, "glyco_bond": "anti", "C5prime_xyz": [ -2.042, 8.792, 0.966 ], "P_xyz": [ 0.411, 9.642, 1.241 ], "form": "A", "ssZp": 4.467, "Dp": 4.562, "splay_angle": 21.995, "splay_distance": 3.653, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 172.361, "theta": -150.743, "eta_prime": -176.546, "theta_prime": -149.751, "eta_base": -139.605, "theta_base": -125.712, "v0": -7.525, "v1": -21.639, "v2": 40.741, "v3": -46.275, "v4": 34.033, "amplitude": 46.069, "phase_angle": 27.830, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.835, "filter_rmsd": 0.032, "frame": { "rmsd": 0.010, "origin": [ -60.201, 31.007, -4.654 ], "x_axis": [ -0.217, 0.456, -0.863 ], "y_axis": [ 0.974, 0.040, -0.223 ], "z_axis": [ -0.067, -0.889, -0.452 ], "quaternion": [ 0.305, 0.547, 0.654, -0.425 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.689, "beta": 156.614, "gamma": 60.711, "delta": 77.366, "epsilon": -155.182, "zeta": -78.090, "epsilon_zeta": -77.093, "bb_type": "BI", "chi": -170.281, "glyco_bond": "anti", "C5prime_xyz": [ -2.093, 8.816, 0.952 ], "P_xyz": [ 0.354, 9.726, 0.639 ], "form": "A", "ssZp": 4.594, "Dp": 4.612, "splay_angle": 21.985, "splay_distance": 3.352, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 160.089, "theta": -154.350, "eta_prime": 175.876, "theta_prime": -151.581, "eta_base": -144.059, "theta_base": -111.374, "v0": -7.794, "v1": -21.045, "v2": 40.356, "v3": -45.387, "v4": 33.498, "amplitude": 45.644, "phase_angle": 27.854, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.764, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -62.207, 28.459, -6.336 ], "x_axis": [ 0.259, 0.440, -0.860 ], "y_axis": [ 0.957, -0.236, 0.168 ], "z_axis": [ -0.129, -0.867, -0.482 ], "quaternion": [ 0.368, 0.703, 0.497, -0.352 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.143, "beta": -173.177, "gamma": 57.481, "delta": 83.983, "epsilon": -147.416, "zeta": -86.333, "epsilon_zeta": -61.083, "bb_type": "BI", "chi": -137.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.481, 8.641, -0.805 ], "P_xyz": [ 1.121, 8.767, -1.283 ], "form": "A", "ssZp": 3.633, "Dp": 4.670, "splay_angle": 25.106, "splay_distance": 4.040, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 173.833, "theta": -149.135, "eta_prime": -177.099, "theta_prime": -151.637, "eta_base": -127.884, "theta_base": -140.661, "v0": 5.945, "v1": -29.291, "v2": 40.221, "v3": -37.804, "v4": 20.096, "amplitude": 40.889, "phase_angle": 10.375, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ -62.888, 27.025, -9.289 ], "x_axis": [ 0.784, 0.087, -0.615 ], "y_axis": [ 0.471, -0.729, 0.497 ], "z_axis": [ -0.405, -0.679, -0.612 ], "quaternion": [ 0.333, 0.884, 0.158, -0.289 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -53.985, "beta": 162.374, "gamma": 44.392, "delta": 73.897, "epsilon": -154.130, "zeta": -8.804, "epsilon_zeta": -145.326, "bb_type": "--", "chi": -158.355, "glyco_bond": "anti", "C5prime_xyz": [ -1.503, 8.791, 0.418 ], "P_xyz": [ 1.081, 9.279, 0.144 ], "form": ".", "ssZp": 4.456, "Dp": 4.735, "splay_angle": 23.980, "splay_distance": 4.591, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 159.150, "theta": -117.416, "eta_prime": 167.537, "theta_prime": -134.655, "eta_base": -165.495, "theta_base": -134.576, "v0": 7.998, "v1": -35.440, "v2": 47.939, "v3": -44.322, "v4": 23.060, "amplitude": 48.567, "phase_angle": 9.218, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.632, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ -64.282, 24.941, -12.457 ], "x_axis": [ 0.986, 0.117, -0.115 ], "y_axis": [ 0.164, -0.715, 0.680 ], "z_axis": [ -0.002, -0.690, -0.724 ], "quaternion": [ 0.370, 0.925, 0.076, -0.032 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -141.768, "beta": 84.158, "gamma": -178.488, "delta": 90.456, "epsilon": -124.216, "zeta": -80.192, "epsilon_zeta": -44.023, "bb_type": "--", "chi": -174.774, "glyco_bond": "anti", "C5prime_xyz": [ -0.961, 8.141, 1.460 ], "P_xyz": [ -1.459, 10.639, 0.731 ], "form": "A", "ssZp": 4.732, "Dp": 4.793, "splay_angle": 24.100, "splay_distance": 3.783, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -174.398, "theta": 168.471, "eta_prime": -173.871, "theta_prime": -171.984, "eta_base": -157.082, "theta_base": -127.344, "v0": 19.333, "v1": -34.882, "v2": 36.774, "v3": -26.979, "v4": 4.960, "amplitude": 37.479, "phase_angle": 348.865, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -63.374, 25.367, -16.937 ], "x_axis": [ 0.992, 0.059, 0.109 ], "y_axis": [ -0.026, -0.762, 0.647 ], "z_axis": [ 0.121, -0.645, -0.755 ], "quaternion": [ 0.345, 0.937, 0.009, 0.062 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.874, "beta": 165.331, "gamma": 37.737, "delta": 78.579, "epsilon": 174.872, "zeta": -81.656, "epsilon_zeta": -103.472, "bb_type": "BI", "chi": -165.922, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.679, 0.815 ], "P_xyz": [ 0.949, 9.149, 1.091 ], "form": "A", "ssZp": 4.585, "Dp": 4.554, "splay_angle": 23.290, "splay_distance": 3.620, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 154.172, "theta": -148.999, "eta_prime": 176.393, "theta_prime": -151.168, "eta_base": -127.623, "theta_base": -124.329, "v0": -2.338, "v1": -23.526, "v2": 38.455, "v3": -40.809, "v4": 27.566, "amplitude": 41.398, "phase_angle": 21.738, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.340, "filter_rmsd": 0.031, "frame": { "rmsd": 0.014, "origin": [ -60.837, 24.486, -19.601 ], "x_axis": [ 0.703, -0.337, 0.626 ], "y_axis": [ -0.639, -0.686, 0.348 ], "z_axis": [ 0.312, -0.645, -0.698 ], "quaternion": [ 0.282, 0.879, -0.278, 0.267 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 175.473, "beta": -147.500, "gamma": 149.522, "delta": 81.465, "epsilon": -117.963, "zeta": -100.079, "epsilon_zeta": -17.884, "bb_type": "--", "chi": -173.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.012, 8.295, 1.464 ], "P_xyz": [ 1.207, 9.060, 0.269 ], "form": "A", "ssZp": 4.583, "Dp": 4.713, "splay_angle": 27.570, "splay_distance": 4.239, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 169.555, "theta": -154.527, "eta_prime": -177.945, "theta_prime": -153.990, "eta_base": -133.828, "theta_base": -139.151, "v0": 16.641, "v1": -37.151, "v2": 44.338, "v3": -36.049, "v4": 11.853, "amplitude": 44.379, "phase_angle": 357.529, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.017, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ -57.988, 23.572, -21.639 ], "x_axis": [ 0.315, -0.754, 0.577 ], "y_axis": [ -0.870, -0.473, -0.143 ], "z_axis": [ 0.381, -0.457, -0.804 ], "quaternion": [ 0.098, 0.805, -0.504, 0.298 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.188, "beta": 144.994, "gamma": 61.133, "delta": 79.311, "epsilon": -130.685, "zeta": -102.111, "epsilon_zeta": -28.574, "bb_type": "--", "chi": -178.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.547, 1.613 ], "P_xyz": [ 0.978, 8.988, 1.374 ], "form": "A", "ssZp": 4.717, "Dp": 4.728, "splay_angle": 22.530, "splay_distance": 3.601, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 174.855, "theta": -143.318, "eta_prime": -175.059, "theta_prime": -140.515, "eta_base": -147.718, "theta_base": -112.510, "v0": 4.158, "v1": -29.808, "v2": 42.997, "v3": -41.856, "v4": 23.608, "amplitude": 44.198, "phase_angle": 13.389, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.866, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -54.635, 22.489, -23.995 ], "x_axis": [ -0.146, -0.784, 0.603 ], "y_axis": [ -0.931, -0.096, -0.351 ], "z_axis": [ 0.333, -0.613, -0.717 ], "quaternion": [ -0.101, -0.645, 0.665, -0.363 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -24.795, "beta": 135.921, "gamma": 46.427, "delta": 79.717, "epsilon": -157.155, "zeta": -65.647, "epsilon_zeta": -91.508, "bb_type": "BI", "chi": -170.082, "glyco_bond": "anti", "C5prime_xyz": [ -2.119, 8.928, 0.863 ], "P_xyz": [ 0.533, 9.321, 0.950 ], "form": "A", "ssZp": 4.470, "Dp": 4.468, "splay_angle": 25.523, "splay_distance": 4.067, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 167.888, "theta": -132.258, "eta_prime": -172.981, "theta_prime": -136.558, "eta_base": -125.968, "theta_base": -93.843, "v0": -11.595, "v1": -16.114, "v2": 36.134, "v3": -42.984, "v4": 34.331, "amplitude": 43.187, "phase_angle": 33.208, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -52.407, 19.712, -24.531 ], "x_axis": [ -0.637, -0.701, 0.321 ], "y_axis": [ -0.662, 0.284, -0.693 ], "z_axis": [ 0.395, -0.654, -0.645 ], "quaternion": [ 0.023, -0.426, 0.801, -0.421 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -86.174, "beta": -175.445, "gamma": 62.237, "delta": 78.563, "epsilon": -137.167, "zeta": -79.963, "epsilon_zeta": -57.204, "bb_type": "BI", "chi": -162.647, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.833, 0.670 ], "P_xyz": [ 1.093, 9.321, 0.839 ], "form": "A", "ssZp": 4.444, "Dp": 4.692, "splay_angle": 25.497, "splay_distance": 4.026, "splay_ratio": 0.221, "d22": 3.820, "d64": 3.830, "eta": 163.701, "theta": -141.544, "eta_prime": 177.410, "theta_prime": -137.509, "eta_base": -120.044, "theta_base": -99.744, "v0": 1.987, "v1": -26.735, "v2": 40.631, "v3": -39.989, "v4": 23.995, "amplitude": 42.216, "phase_angle": 15.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.556, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ -52.488, 15.746, -25.427 ], "x_axis": [ -0.957, -0.178, -0.230 ], "y_axis": [ 0.055, 0.666, -0.744 ], "z_axis": [ 0.286, -0.725, -0.627 ], "quaternion": [ 0.143, -0.034, 0.901, -0.407 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -54.185, "beta": 163.758, "gamma": 50.375, "delta": 77.712, "epsilon": -131.729, "zeta": -86.051, "epsilon_zeta": -45.678, "bb_type": "BI", "chi": -161.806, "glyco_bond": "anti", "C5prime_xyz": [ -1.508, 8.793, 0.620 ], "P_xyz": [ 1.099, 9.171, 0.652 ], "form": ".", "ssZp": 4.385, "Dp": 4.717, "splay_angle": 83.968, "splay_distance": 10.655, "splay_ratio": 0.677, "d22": 10.061, "d64": 11.239, "eta": 168.780, "theta": -123.548, "eta_prime": -177.709, "theta_prime": -158.351, "eta_base": -127.076, "theta_base": 123.188, "v0": 2.909, "v1": -29.276, "v2": 43.099, "v3": -42.454, "v4": 24.998, "amplitude": 44.596, "phase_angle": 14.889, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.796, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ -53.828, 12.661, -27.638 ], "x_axis": [ -0.738, 0.455, -0.499 ], "y_axis": [ 0.673, 0.560, -0.484 ], "z_axis": [ 0.059, -0.692, -0.719 ], "quaternion": [ 0.161, 0.325, 0.868, -0.339 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": 179.627, "beta": -179.313, "gamma": 44.483, "delta": 75.800, "epsilon": -141.955, "zeta": -59.755, "epsilon_zeta": -82.200, "bb_type": "BI", "chi": 22.422, "glyco_bond": "syn", "C5prime_xyz": [ -5.883, 4.376, -0.295 ], "P_xyz": [ -6.474, 1.880, -0.930 ], "form": ".", "ssZp": -4.219, "Dp": 4.509, "splay_angle": 21.897, "splay_distance": 3.438, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 38.834, "theta": -133.589, "eta_prime": 51.902, "theta_prime": -126.475, "eta_base": 21.948, "theta_base": -149.352, "v0": -7.574, "v1": -20.223, "v2": 38.853, "v3": -43.911, "v4": 32.357, "amplitude": 44.010, "phase_angle": 28.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.508, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ -43.503, 10.043, -27.896 ], "x_axis": [ 0.213, -0.533, 0.819 ], "y_axis": [ -0.694, -0.672, -0.257 ], "z_axis": [ 0.688, -0.514, -0.513 ], "quaternion": [ 0.083, 0.774, -0.396, 0.486 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -75.674, "beta": 168.785, "gamma": 61.597, "delta": 81.881, "epsilon": -145.337, "zeta": -127.730, "epsilon_zeta": -17.607, "bb_type": "--", "chi": -149.231, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.777, -0.118 ], "P_xyz": [ 1.175, 9.111, -0.726 ], "form": ".", "ssZp": 4.076, "Dp": 4.696, "splay_angle": 48.226, "splay_distance": 7.325, "splay_ratio": 0.410, "d22": null, "d64": null, "eta": 162.074, "theta": -144.765, "eta_prime": -174.278, "theta_prime": -128.605, "eta_base": 177.713, "theta_base": -111.598, "v0": 2.985, "v1": -25.930, "v2": 37.862, "v3": -36.859, "v4": 21.592, "amplitude": 39.059, "phase_angle": 14.224, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.736, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -44.730, 10.117, -24.686 ], "x_axis": [ 0.407, 0.775, -0.485 ], "y_axis": [ -0.805, 0.053, -0.591 ], "z_axis": [ -0.432, 0.630, 0.645 ], "quaternion": [ 0.725, -0.421, 0.018, 0.544 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": 70.024, "beta": 107.247, "gamma": 30.039, "delta": 135.445, "epsilon": -123.929, "zeta": -104.454, "epsilon_zeta": -19.475, "bb_type": "--", "chi": -76.831, "glyco_bond": "--", "C5prime_xyz": [ -3.536, 7.210, -2.821 ], "P_xyz": [ -1.037, 7.848, -3.311 ], "form": ".", "ssZp": 1.154, "Dp": 1.477, "splay_angle": 103.152, "splay_distance": 15.117, "splay_ratio": 0.784, "d22": null, "d64": null, "eta": -139.015, "theta": -130.970, "eta_prime": -121.654, "theta_prime": 170.126, "eta_base": -121.230, "theta_base": 136.179, "v0": -33.382, "v1": 42.350, "v2": -35.375, "v3": 17.206, "v4": 9.937, "amplitude": 41.788, "phase_angle": 147.837, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.014, "origin": [ -47.628, 16.575, -22.804 ], "x_axis": [ 0.098, 0.563, -0.821 ], "y_axis": [ -0.929, -0.243, -0.278 ], "z_axis": [ -0.356, 0.790, 0.499 ], "quaternion": [ 0.582, -0.459, 0.200, 0.641 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -145.280, "beta": 90.158, "gamma": 8.457, "delta": 74.610, "epsilon": 179.041, "zeta": -76.703, "epsilon_zeta": -104.256, "bb_type": "BI", "chi": -111.819, "glyco_bond": "anti", "C5prime_xyz": [ -2.749, 8.328, -2.176 ], "P_xyz": [ -0.155, 8.729, -2.412 ], "form": ".", "ssZp": 2.346, "Dp": 4.257, "splay_angle": 29.884, "splay_distance": 5.088, "splay_ratio": 0.291, "d22": null, "d64": null, "eta": 15.313, "theta": -122.326, "eta_prime": 27.894, "theta_prime": -112.561, "eta_base": 43.566, "theta_base": -63.765, "v0": -13.146, "v1": -16.730, "v2": 38.005, "v3": -46.370, "v4": 37.745, "amplitude": 46.141, "phase_angle": 34.547, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -54.909, 9.348, -11.701 ], "x_axis": [ 0.638, -0.688, -0.347 ], "y_axis": [ 0.040, 0.479, -0.877 ], "z_axis": [ 0.769, 0.545, 0.333 ], "quaternion": [ 0.783, -0.454, 0.357, -0.232 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate", "alpha": -167.307, "beta": -105.651, "gamma": 131.090, "delta": 123.828, "epsilon": -113.010, "zeta": -50.334, "epsilon_zeta": -62.676, "bb_type": "--", "chi": -69.060, "glyco_bond": "--", "C5prime_xyz": [ -3.636, 6.945, -3.021 ], "P_xyz": [ -1.526, 5.978, -4.320 ], "form": ".", "ssZp": 0.251, "Dp": 1.817, "splay_angle": 82.302, "splay_distance": 13.271, "splay_ratio": 0.659, "d22": 5.790, "d64": 7.102, "eta": -166.871, "theta": -40.674, "eta_prime": -136.447, "theta_prime": -70.804, "eta_base": -94.506, "theta_base": -34.345, "v0": -27.216, "v1": 30.237, "v2": -22.365, "v3": 7.372, "v4": 12.309, "amplitude": 30.185, "phase_angle": 137.810, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ -52.501, 9.573, -16.177 ], "x_axis": [ 0.016, -0.503, -0.864 ], "y_axis": [ 0.408, 0.792, -0.454 ], "z_axis": [ 0.913, -0.346, 0.218 ], "quaternion": [ 0.712, -0.038, 0.624, -0.320 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -101.138, "beta": -158.011, "gamma": 39.583, "delta": 88.087, "epsilon": -155.174, "zeta": -74.707, "epsilon_zeta": -80.467, "bb_type": "BI", "chi": -170.298, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.723, 1.142 ], "P_xyz": [ 0.758, 9.090, 2.627 ], "form": "A", "ssZp": 4.513, "Dp": 4.496, "splay_angle": 23.913, "splay_distance": 3.685, "splay_ratio": 0.208, "d22": 4.423, "d64": 4.226, "eta": 121.697, "theta": -149.730, "eta_prime": 165.479, "theta_prime": -142.137, "eta_base": -170.634, "theta_base": -106.877, "v0": 2.650, "v1": -22.491, "v2": 32.770, "v3": -31.946, "v4": 18.443, "amplitude": 33.781, "phase_angle": 14.055, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.014, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -52.745, 19.783, -24.652 ], "x_axis": [ -0.750, -0.490, 0.444 ], "y_axis": [ 0.606, -0.241, 0.758 ], "z_axis": [ -0.264, 0.838, 0.477 ], "quaternion": [ -0.349, 0.057, 0.508, 0.786 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -77.750, "beta": -172.720, "gamma": 57.584, "delta": 89.353, "epsilon": -149.152, "zeta": -85.526, "epsilon_zeta": -63.627, "bb_type": "BI", "chi": -162.251, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.693, 0.695 ], "P_xyz": [ 1.191, 8.871, 1.209 ], "form": "A", "ssZp": 4.405, "Dp": 4.532, "splay_angle": 19.399, "splay_distance": 3.456, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 172.836, "theta": -118.872, "eta_prime": -176.236, "theta_prime": -131.492, "eta_base": -135.118, "theta_base": -113.311, "v0": 3.312, "v1": -24.477, "v2": 34.767, "v3": -34.076, "v4": 19.518, "amplitude": 35.764, "phase_angle": 13.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.648, "filter_rmsd": 0.072, "frame": { "rmsd": 0.012, "origin": [ -55.053, 22.475, -23.652 ], "x_axis": [ -0.181, -0.640, 0.746 ], "y_axis": [ 0.935, 0.123, 0.332 ], "z_axis": [ -0.304, 0.758, 0.577 ], "quaternion": [ 0.616, -0.173, -0.426, -0.639 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 116.415, "beta": -155.484, "gamma": -160.471, "delta": 90.916, "epsilon": -141.547, "zeta": -71.344, "epsilon_zeta": -70.203, "bb_type": "BI", "chi": -173.909, "glyco_bond": "anti", "C5prime_xyz": [ -1.047, 8.246, 1.417 ], "P_xyz": [ 0.257, 10.273, 0.376 ], "form": "A", "ssZp": 4.640, "Dp": 4.662, "splay_angle": 23.778, "splay_distance": 3.879, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 159.852, "theta": -168.524, "eta_prime": 174.622, "theta_prime": -161.716, "eta_base": -142.071, "theta_base": -137.474, "v0": 16.739, "v1": -35.285, "v2": 39.786, "v3": -30.706, "v4": 8.989, "amplitude": 39.987, "phase_angle": 354.250, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.033, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ -57.757, 23.579, -21.802 ], "x_axis": [ 0.296, -0.555, 0.778 ], "y_axis": [ 0.867, 0.498, 0.026 ], "z_axis": [ -0.402, 0.666, 0.628 ], "quaternion": [ 0.778, -0.206, -0.379, -0.457 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "U", "nt_code": "U", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.011, "beta": 172.288, "gamma": 62.046, "delta": 76.340, "epsilon": -138.182, "zeta": -82.445, "epsilon_zeta": -55.738, "bb_type": "BI", "chi": -164.073, "glyco_bond": "anti", "C5prime_xyz": [ -1.730, 8.832, 0.730 ], "P_xyz": [ 0.762, 9.530, 0.757 ], "form": "A", "ssZp": 4.502, "Dp": 4.712, "splay_angle": 21.432, "splay_distance": 3.390, "splay_ratio": 0.186, "d22": 3.914, "d64": 3.752, "eta": 170.601, "theta": -148.440, "eta_prime": -174.614, "theta_prime": -144.962, "eta_base": -141.347, "theta_base": -104.553, "v0": -1.606, "v1": -26.099, "v2": 41.699, "v3": -43.838, "v4": 28.903, "amplitude": 44.549, "phase_angle": 20.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.671, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -60.653, 24.031, -19.262 ], "x_axis": [ 0.673, -0.225, 0.704 ], "y_axis": [ 0.573, 0.761, -0.305 ], "z_axis": [ -0.467, 0.609, 0.641 ], "quaternion": [ 0.877, -0.261, -0.334, -0.228 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.498, "beta": 156.123, "gamma": 54.616, "delta": 79.334, "epsilon": -151.441, "zeta": -100.543, "epsilon_zeta": -50.897, "bb_type": "BI", "chi": -158.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.797, 0.443 ], "P_xyz": [ 1.000, 9.152, 0.172 ], "form": ".", "ssZp": 4.318, "Dp": 4.549, "splay_angle": 34.553, "splay_distance": 5.297, "splay_ratio": 0.297, "d22": 5.143, "d64": 5.528, "eta": 163.461, "theta": -169.861, "eta_prime": -178.931, "theta_prime": -170.447, "eta_base": -122.529, "theta_base": -160.591, "v0": 3.462, "v1": -28.136, "v2": 40.979, "v3": -40.126, "v4": 23.034, "amplitude": 42.243, "phase_angle": 14.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.728, "filter_rmsd": 0.101, "frame": { "rmsd": 0.009, "origin": [ -61.009, 24.927, -16.012 ], "x_axis": [ 0.921, 0.236, 0.311 ], "y_axis": [ -0.032, 0.839, -0.543 ], "z_axis": [ -0.389, 0.490, 0.780 ], "quaternion": [ 0.941, -0.275, -0.186, 0.071 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.343, "beta": 166.464, "gamma": 46.626, "delta": 76.059, "epsilon": -145.900, "zeta": -77.105, "epsilon_zeta": -68.796, "bb_type": "BI", "chi": -174.496, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.566, 1.367 ], "P_xyz": [ 1.144, 8.753, 1.792 ], "form": "A", "ssZp": 4.698, "Dp": 4.709, "splay_angle": 22.953, "splay_distance": 3.347, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 171.766, "theta": -147.965, "eta_prime": 171.307, "theta_prime": -144.339, "eta_base": -172.997, "theta_base": -103.230, "v0": 6.821, "v1": -34.002, "v2": 46.989, "v3": -44.090, "v4": 23.423, "amplitude": 47.782, "phase_angle": 10.456, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.379, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ -64.479, 25.265, -12.025 ], "x_axis": [ 0.965, 0.259, -0.036 ], "y_axis": [ -0.199, 0.636, -0.745 ], "z_axis": [ -0.170, 0.726, 0.666 ], "quaternion": [ 0.904, -0.407, -0.037, 0.127 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.810, "beta": 172.377, "gamma": 51.438, "delta": 81.050, "epsilon": -140.448, "zeta": -82.314, "epsilon_zeta": -58.134, "bb_type": "BI", "chi": -167.514, "glyco_bond": "anti", "C5prime_xyz": [ -0.919, 8.439, 1.041 ], "P_xyz": [ 1.712, 8.277, 1.196 ], "form": "A", "ssZp": 4.691, "Dp": 4.820, "splay_angle": 22.813, "splay_distance": 3.433, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 172.271, "theta": -143.282, "eta_prime": -176.891, "theta_prime": -140.042, "eta_base": -121.775, "theta_base": -112.190, "v0": 15.715, "v1": -37.727, "v2": 44.433, "v3": -36.320, "v4": 13.129, "amplitude": 44.452, "phase_angle": 358.327, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.041, "frame": { "rmsd": 0.012, "origin": [ -63.236, 27.084, -9.505 ], "x_axis": [ 0.567, 0.627, -0.534 ], "y_axis": [ -0.817, 0.348, -0.459 ], "z_axis": [ -0.102, 0.697, 0.710 ], "quaternion": [ 0.810, -0.357, 0.133, 0.446 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.035, "beta": 160.523, "gamma": 48.689, "delta": 80.802, "epsilon": -153.264, "zeta": -80.408, "epsilon_zeta": -72.856, "bb_type": "BI", "chi": -160.350, "glyco_bond": "anti", "C5prime_xyz": [ -1.087, 8.659, 0.635 ], "P_xyz": [ 1.558, 8.638, 0.566 ], "form": "A", "ssZp": 4.469, "Dp": 4.656, "splay_angle": 24.553, "splay_distance": 3.798, "splay_ratio": 0.214, "d22": 4.882, "d64": 4.796, "eta": 170.144, "theta": -154.536, "eta_prime": -173.943, "theta_prime": -155.826, "eta_base": -128.449, "theta_base": -153.049, "v0": 15.530, "v1": -37.876, "v2": 45.021, "v3": -37.016, "v4": 13.724, "amplitude": 45.029, "phase_angle": 358.898, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.670, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ -61.895, 29.510, -7.481 ], "x_axis": [ 0.004, 0.702, -0.712 ], "y_axis": [ -0.999, 0.026, 0.021 ], "z_axis": [ 0.033, 0.712, 0.701 ], "quaternion": [ 0.658, -0.263, 0.283, 0.646 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.623, "beta": -175.724, "gamma": 44.612, "delta": 73.239, "epsilon": -158.970, "zeta": -94.033, "epsilon_zeta": -64.936, "bb_type": "BI", "chi": -158.418, "glyco_bond": "anti", "C5prime_xyz": [ -1.231, 8.704, 0.389 ], "P_xyz": [ 1.411, 8.951, 0.423 ], "form": ".", "ssZp": 4.407, "Dp": 4.632, "splay_angle": 26.775, "splay_distance": 4.259, "splay_ratio": 0.243, "d22": 4.127, "d64": 5.149, "eta": 157.278, "theta": -144.751, "eta_prime": 162.108, "theta_prime": -146.521, "eta_base": -178.843, "theta_base": -130.099, "v0": 14.925, "v1": -42.558, "v2": 52.963, "v3": -45.147, "v4": 19.103, "amplitude": 53.009, "phase_angle": 2.377, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.707, "filter_rmsd": 0.111, "frame": { "rmsd": 0.013, "origin": [ -59.969, 30.955, -4.543 ], "x_axis": [ -0.342, 0.559, -0.756 ], "y_axis": [ -0.934, -0.115, 0.337 ], "z_axis": [ 0.101, 0.821, 0.561 ], "quaternion": [ 0.525, -0.230, 0.408, 0.710 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 29, "nt_name": "U", "nt_code": "U", "nt_id": "///C/29", "linked_nts": [ "///C/28", "///C/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 132.549, "beta": -146.255, "gamma": -152.173, "delta": 94.426, "epsilon": -119.388, "zeta": -80.928, "epsilon_zeta": -38.461, "bb_type": "--", "chi": 178.739, "glyco_bond": "anti", "C5prime_xyz": [ -0.833, 7.650, 1.873 ], "P_xyz": [ 0.960, 9.282, 1.332 ], "form": "A", "ssZp": 4.791, "Dp": 4.811, "splay_angle": 21.196, "splay_distance": 3.398, "splay_ratio": 0.190, "d22": 4.348, "d64": 4.619, "eta": -170.391, "theta": -156.064, "eta_prime": -163.610, "theta_prime": -150.174, "eta_base": -133.818, "theta_base": -126.379, "v0": 24.488, "v1": -38.176, "v2": 38.130, "v3": -24.723, "v4": 0.038, "amplitude": 40.070, "phase_angle": 342.101, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.011, "filter_rmsd": 0.113, "frame": { "rmsd": 0.014, "origin": [ -57.929, 34.692, -4.452 ], "x_axis": [ -0.707, 0.400, -0.583 ], "y_axis": [ -0.706, -0.355, 0.612 ], "z_axis": [ 0.038, 0.845, 0.534 ], "quaternion": [ 0.343, -0.169, 0.452, 0.806 ] } }, { "index": 30, "index_chain": 30, "chain_name": "C", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///C/30", "linked_nts": [ "///C/29", "///C/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.130, "beta": 154.826, "gamma": 54.181, "delta": 76.844, "epsilon": -161.600, "zeta": -65.366, "epsilon_zeta": -96.235, "bb_type": "BI", "chi": -162.545, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.787, 0.871 ], "P_xyz": [ 1.022, 9.289, 0.819 ], "form": "A", "ssZp": 4.491, "Dp": 4.591, "splay_angle": 22.111, "splay_distance": 3.435, "splay_ratio": 0.192, "d22": 4.266, "d64": 4.040, "eta": 166.169, "theta": -150.967, "eta_prime": -173.535, "theta_prime": -149.698, "eta_base": -134.945, "theta_base": -120.150, "v0": 11.171, "v1": -33.869, "v2": 41.454, "v3": -36.637, "v4": 16.550, "amplitude": 41.539, "phase_angle": 3.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.283, "filter_rmsd": 0.056, "frame": { "rmsd": 0.014, "origin": [ -57.108, 37.982, -4.678 ], "x_axis": [ -0.966, 0.166, -0.198 ], "y_axis": [ -0.248, -0.386, 0.889 ], "z_axis": [ 0.071, 0.908, 0.414 ], "quaternion": [ 0.124, -0.038, 0.540, 0.831 ] } }, { "index": 31, "index_chain": 31, "chain_name": "C", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///C/31", "linked_nts": [ "///C/30", "///C/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -69.898, "beta": -176.201, "gamma": 56.603, "delta": 88.373, "epsilon": -153.347, "zeta": -84.509, "epsilon_zeta": -68.838, "bb_type": "BI", "chi": -156.448, "glyco_bond": "anti", "C5prime_xyz": [ -1.216, 8.751, 0.393 ], "P_xyz": [ 1.297, 8.915, 0.997 ], "form": "A", "ssZp": 4.047, "Dp": 4.273, "splay_angle": 19.060, "splay_distance": 3.137, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 174.356, "theta": -146.437, "eta_prime": -171.941, "theta_prime": -146.431, "eta_base": -130.265, "theta_base": -144.118, "v0": 2.300, "v1": -23.047, "v2": 33.728, "v3": -33.827, "v4": 19.709, "amplitude": 34.950, "phase_angle": 15.193, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.066, "frame": { "rmsd": 0.012, "origin": [ -57.398, 41.403, -4.568 ], "x_axis": [ -0.928, -0.194, 0.319 ], "y_axis": [ 0.370, -0.357, 0.858 ], "z_axis": [ -0.053, 0.914, 0.402 ], "quaternion": [ -0.172, 0.081, 0.541, 0.820 ] } }, { "index": 32, "index_chain": 32, "chain_name": "C", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///C/32", "linked_nts": [ "///C/31", "///C/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -52.992, "beta": 165.159, "gamma": 49.380, "delta": 77.920, "epsilon": -148.912, "zeta": -67.583, "epsilon_zeta": -81.329, "bb_type": "BI", "chi": -144.583, "glyco_bond": "anti", "C5prime_xyz": [ -1.858, 8.894, -0.512 ], "P_xyz": [ 0.702, 9.564, -0.528 ], "form": ".", "ssZp": 3.541, "Dp": 4.335, "splay_angle": 39.201, "splay_distance": 6.316, "splay_ratio": 0.336, "d22": null, "d64": null, "eta": 171.291, "theta": -139.122, "eta_prime": -179.089, "theta_prime": -136.236, "eta_base": -167.280, "theta_base": -97.889, "v0": -5.385, "v1": -23.891, "v2": 43.016, "v3": -46.072, "v4": 32.720, "amplitude": 47.265, "phase_angle": 24.483, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.033, "frame": { "rmsd": 0.016, "origin": [ -57.388, 44.478, -5.191 ], "x_axis": [ -0.742, -0.368, 0.560 ], "y_axis": [ 0.623, -0.072, 0.779 ], "z_axis": [ -0.247, 0.927, 0.283 ], "quaternion": [ -0.342, 0.108, 0.589, 0.724 ] } }, { "index": 33, "index_chain": 33, "chain_name": "C", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///C/33", "linked_nts": [ "///C/32", "///C/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -63.396, "beta": -179.732, "gamma": 47.746, "delta": 84.427, "epsilon": -115.301, "zeta": -63.844, "epsilon_zeta": -51.457, "bb_type": "--", "chi": -176.160, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.643, 1.374 ], "P_xyz": [ 0.885, 8.774, 2.446 ], "form": ".", "ssZp": 4.502, "Dp": 4.592, "splay_angle": 57.510, "splay_distance": 8.842, "splay_ratio": 0.481, "d22": 5.087, "d64": 5.013, "eta": 178.105, "theta": -91.177, "eta_prime": -169.907, "theta_prime": -89.905, "eta_base": -124.839, "theta_base": -60.069, "v0": -0.830, "v1": -23.763, "v2": 37.012, "v3": -38.946, "v4": 25.300, "amplitude": 39.371, "phase_angle": 19.934, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.077, "frame": { "rmsd": 0.017, "origin": [ -59.869, 48.072, -0.628 ], "x_axis": [ 0.029, -0.849, 0.528 ], "y_axis": [ 0.991, -0.045, -0.126 ], "z_axis": [ 0.131, 0.527, 0.840 ], "quaternion": [ 0.675, -0.242, -0.147, -0.681 ] } }, { "index": 34, "index_chain": 34, "chain_name": "C", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///C/34", "linked_nts": [ "///C/33", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -106.551, "beta": -136.224, "gamma": 56.222, "delta": 84.900, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -160.504, "glyco_bond": "anti", "C5prime_xyz": [ -1.246, 8.788, 0.521 ], "P_xyz": [ 1.035, 8.916, 1.760 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.408, "v1": -28.247, "v2": 40.453, "v3": -37.905, "v4": 21.528, "amplitude": 41.378, "phase_angle": 12.138, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.076, "filter_rmsd": 0.058, "frame": { "rmsd": 0.015, "origin": [ -55.271, 47.317, 6.887 ], "x_axis": [ 0.294, -0.708, -0.641 ], "y_axis": [ 0.131, 0.695, -0.707 ], "z_axis": [ 0.947, 0.124, 0.297 ], "quaternion": [ 0.756, -0.275, 0.525, -0.278 ] } }, { "index": 35, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 157.985, "gamma": 56.472, "delta": 82.928, "epsilon": -157.198, "zeta": -67.862, "epsilon_zeta": -89.335, "bb_type": "BI", "chi": -166.401, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.818, 0.804 ], "P_xyz": [ 1.981, 9.113, 0.722 ], "form": "A", "ssZp": 4.427, "Dp": 4.507, "splay_angle": 22.609, "splay_distance": 3.650, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": null, "theta": -136.866, "eta_prime": null, "theta_prime": -138.549, "eta_base": null, "theta_base": -115.374, "v0": -1.239, "v1": -24.990, "v2": 40.462, "v3": -41.570, "v4": 27.235, "amplitude": 43.028, "phase_angle": 19.890, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ -14.369, -9.925, -22.463 ], "x_axis": [ 0.351, -0.603, 0.716 ], "y_axis": [ 0.859, 0.513, 0.010 ], "z_axis": [ -0.373, 0.612, 0.698 ], "quaternion": [ 0.800, -0.188, -0.340, -0.457 ] } }, { "index": 36, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -80.108, "beta": 176.808, "gamma": 63.316, "delta": 80.299, "epsilon": -159.866, "zeta": -61.792, "epsilon_zeta": -98.074, "bb_type": "BI", "chi": -167.216, "glyco_bond": "anti", "C5prime_xyz": [ -1.798, 8.744, 0.913 ], "P_xyz": [ 0.752, 9.400, 1.095 ], "form": "A", "ssZp": 4.535, "Dp": 4.567, "splay_angle": 22.800, "splay_distance": 3.728, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.313, "theta": -144.678, "eta_prime": -177.684, "theta_prime": -146.820, "eta_base": -136.107, "theta_base": -121.031, "v0": 0.281, "v1": -23.656, "v2": 36.679, "v3": -37.064, "v4": 23.584, "amplitude": 38.570, "phase_angle": 18.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.689, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -16.531, -9.387, -19.573 ], "x_axis": [ 0.784, -0.310, 0.537 ], "y_axis": [ 0.540, 0.768, -0.344 ], "z_axis": [ -0.306, 0.560, 0.770 ], "quaternion": [ 0.911, -0.248, -0.231, -0.233 ] } }, { "index": 37, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -84.888, "beta": 171.256, "gamma": 69.883, "delta": 75.998, "epsilon": -144.324, "zeta": -89.859, "epsilon_zeta": -54.465, "bb_type": "BI", "chi": -172.307, "glyco_bond": "anti", "C5prime_xyz": [ -1.765, 8.724, 1.094 ], "P_xyz": [ 0.734, 9.541, 0.986 ], "form": "A", "ssZp": 4.636, "Dp": 4.679, "splay_angle": 25.292, "splay_distance": 3.899, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 165.171, "theta": -160.339, "eta_prime": -179.866, "theta_prime": -158.411, "eta_base": -135.312, "theta_base": -134.881, "v0": -5.503, "v1": -23.911, "v2": 42.665, "v3": -47.015, "v4": 32.820, "amplitude": 47.103, "phase_angle": 25.070, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.394, "filter_rmsd": 0.035, "frame": { "rmsd": 0.007, "origin": [ -17.647, -9.200, -16.021 ], "x_axis": [ 0.931, 0.174, 0.320 ], "y_axis": [ 0.033, 0.835, -0.549 ], "z_axis": [ -0.362, 0.522, 0.772 ], "quaternion": [ 0.941, -0.285, -0.181, 0.037 ] } }, { "index": 38, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.905, "beta": 161.678, "gamma": 57.044, "delta": 75.849, "epsilon": -146.018, "zeta": -61.266, "epsilon_zeta": -84.752, "bb_type": "BI", "chi": -171.943, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.614, 1.216 ], "P_xyz": [ 1.104, 8.966, 1.058 ], "form": ".", "ssZp": 4.648, "Dp": 4.692, "splay_angle": 28.545, "splay_distance": 4.551, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": 163.453, "theta": -131.668, "eta_prime": 172.638, "theta_prime": -130.950, "eta_base": -150.443, "theta_base": -96.629, "v0": 7.563, "v1": -34.947, "v2": 48.112, "v3": -44.842, "v4": 23.361, "amplitude": 48.831, "phase_angle": 9.844, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.668, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -18.545, -8.842, -12.243 ], "x_axis": [ 0.860, 0.507, -0.061 ], "y_axis": [ -0.433, 0.661, -0.613 ], "z_axis": [ -0.270, 0.553, 0.788 ], "quaternion": [ 0.910, -0.321, -0.058, 0.258 ] } }, { "index": 39, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -78.068, "beta": -173.960, "gamma": 68.447, "delta": 79.772, "epsilon": -167.527, "zeta": -75.588, "epsilon_zeta": -91.939, "bb_type": "BI", "chi": -164.336, "glyco_bond": "anti", "C5prime_xyz": [ -1.617, 8.821, 0.743 ], "P_xyz": [ 0.935, 9.421, 0.880 ], "form": "A", "ssZp": 4.474, "Dp": 4.530, "splay_angle": 26.650, "splay_distance": 4.133, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 172.148, "theta": -161.393, "eta_prime": -169.083, "theta_prime": -163.230, "eta_base": -113.321, "theta_base": -147.961, "v0": 1.287, "v1": -27.594, "v2": 41.637, "v3": -42.210, "v4": 25.891, "amplitude": 43.543, "phase_angle": 17.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.524, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -16.026, -6.427, -9.323 ], "x_axis": [ 0.339, 0.771, -0.539 ], "y_axis": [ -0.928, 0.181, -0.324 ], "z_axis": [ -0.152, 0.611, 0.777 ], "quaternion": [ 0.758, -0.308, 0.128, 0.561 ] } }, { "index": 40, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -87.214, "beta": 179.853, "gamma": 67.507, "delta": 76.322, "epsilon": -149.291, "zeta": -69.597, "epsilon_zeta": -79.693, "bb_type": "BI", "chi": -171.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.296, 8.618, 1.180 ], "P_xyz": [ 1.329, 8.986, 1.070 ], "form": "A", "ssZp": 4.685, "Dp": 4.715, "splay_angle": 18.656, "splay_distance": 2.854, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 164.471, "theta": -143.391, "eta_prime": 170.933, "theta_prime": -141.819, "eta_base": -160.320, "theta_base": -102.667, "v0": 9.066, "v1": -35.909, "v2": 47.887, "v3": -43.555, "v4": 21.829, "amplitude": 48.344, "phase_angle": 7.884, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.379, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ -14.905, -5.302, -5.507 ], "x_axis": [ -0.068, 0.781, -0.620 ], "y_axis": [ -0.985, -0.153, -0.085 ], "z_axis": [ -0.161, 0.605, 0.780 ], "quaternion": [ 0.624, -0.276, 0.184, 0.707 ] } }, { "index": 41, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -87.733, "beta": -171.331, "gamma": 62.300, "delta": 77.457, "epsilon": -139.725, "zeta": -41.486, "epsilon_zeta": -98.239, "bb_type": "BI", "chi": -151.544, "glyco_bond": "anti", "C5prime_xyz": [ -1.054, 8.645, -0.041 ], "P_xyz": [ 1.553, 8.721, -0.569 ], "form": ".", "ssZp": 4.158, "Dp": 4.800, "splay_angle": 21.700, "splay_distance": 3.773, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.424, "theta": -131.380, "eta_prime": 172.464, "theta_prime": -148.598, "eta_base": -132.066, "theta_base": -162.727, "v0": 16.008, "v1": -41.113, "v2": 49.668, "v3": -41.317, "v4": 16.137, "amplitude": 49.668, "phase_angle": 0.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.496, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ -14.232, -2.567, -5.046 ], "x_axis": [ -0.689, 0.512, -0.513 ], "y_axis": [ -0.713, -0.351, 0.607 ], "z_axis": [ 0.130, 0.784, 0.607 ], "quaternion": [ 0.377, -0.118, 0.427, 0.813 ] } }, { "index": 42, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -135.253, "beta": 98.030, "gamma": 145.949, "delta": 87.664, "epsilon": -171.054, "zeta": -56.777, "epsilon_zeta": -114.277, "bb_type": "BI", "chi": -179.349, "glyco_bond": "anti", "C5prime_xyz": [ -0.648, 7.960, 1.521 ], "P_xyz": [ -0.392, 9.993, -0.146 ], "form": "A", "ssZp": 4.687, "Dp": 4.681, "splay_angle": 30.194, "splay_distance": 4.212, "splay_ratio": 0.262, "d22": null, "d64": null, "eta": 173.348, "theta": 178.514, "eta_prime": 173.787, "theta_prime": -164.875, "eta_base": -179.303, "theta_base": -124.670, "v0": 26.511, "v1": -44.543, "v2": 45.171, "v3": -30.461, "v4": 2.838, "amplitude": 46.807, "phase_angle": 344.806, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.022, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -11.688, 0.182, -4.598 ], "x_axis": [ -0.737, 0.237, -0.633 ], "y_axis": [ -0.676, -0.244, 0.695 ], "z_axis": [ 0.010, 0.940, 0.340 ], "quaternion": [ 0.300, -0.205, 0.537, 0.762 ] } }, { "index": 43, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -128.250, "beta": -125.021, "gamma": 70.019, "delta": 77.574, "epsilon": -129.410, "zeta": -137.568, "epsilon_zeta": 8.158, "bb_type": "--", "chi": -173.453, "glyco_bond": "anti", "C5prime_xyz": [ -1.288, 8.492, 1.314 ], "P_xyz": [ 1.237, 7.943, 2.014 ], "form": ".", "ssZp": 4.637, "Dp": 4.744, "splay_angle": 27.592, "splay_distance": 4.251, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 166.160, "theta": -150.988, "eta_prime": 176.525, "theta_prime": -152.781, "eta_base": -136.045, "theta_base": -151.845, "v0": 8.527, "v1": -33.761, "v2": 45.386, "v3": -41.329, "v4": 20.531, "amplitude": 45.829, "phase_angle": 7.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ -12.292, 4.275, -5.392 ], "x_axis": [ -0.973, -0.230, 0.015 ], "y_axis": [ 0.110, -0.406, 0.907 ], "z_axis": [ -0.202, 0.885, 0.420 ], "quaternion": [ -0.101, -0.056, 0.536, 0.837 ] } }, { "index": 44, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 95.519, "beta": -98.344, "gamma": -164.506, "delta": 91.171, "epsilon": -107.630, "zeta": -104.054, "epsilon_zeta": -3.576, "bb_type": "--", "chi": 163.674, "glyco_bond": "anti", "C5prime_xyz": [ -0.947, 7.312, 2.507 ], "P_xyz": [ 0.512, 9.084, 1.206 ], "form": "A", "ssZp": 4.736, "Dp": 4.767, "splay_angle": 28.154, "splay_distance": 4.173, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": -175.598, "theta": -158.114, "eta_prime": -172.594, "theta_prime": -152.361, "eta_base": -157.887, "theta_base": -127.223, "v0": 27.311, "v1": -42.314, "v2": 42.466, "v3": -27.558, "v4": 0.190, "amplitude": 44.593, "phase_angle": 342.234, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.013, "origin": [ -12.075, 8.357, -6.558 ], "x_axis": [ -0.956, -0.250, 0.157 ], "y_axis": [ 0.237, -0.337, 0.911 ], "z_axis": [ -0.175, 0.908, 0.381 ], "quaternion": [ -0.149, -0.006, 0.556, 0.818 ] } }, { "index": 45, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -25.422, "beta": 146.219, "gamma": 38.271, "delta": 81.111, "epsilon": -154.907, "zeta": -76.350, "epsilon_zeta": -78.558, "bb_type": "BI", "chi": -173.438, "glyco_bond": "anti", "C5prime_xyz": [ -1.588, 8.646, 1.256 ], "P_xyz": [ 1.033, 8.633, 1.577 ], "form": "A", "ssZp": 4.581, "Dp": 4.584, "splay_angle": 25.344, "splay_distance": 3.948, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 165.207, "theta": -143.887, "eta_prime": -176.322, "theta_prime": -144.254, "eta_base": -134.761, "theta_base": -122.841, "v0": 0.725, "v1": -26.737, "v2": 41.404, "v3": -41.969, "v4": 25.799, "amplitude": 43.426, "phase_angle": 17.552, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.073, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -14.168, 11.938, -7.015 ], "x_axis": [ -0.627, -0.399, 0.669 ], "y_axis": [ 0.764, -0.152, 0.626 ], "z_axis": [ -0.148, 0.904, 0.400 ], "quaternion": [ -0.394, 0.176, 0.518, 0.738 ] } }, { "index": 46, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -69.898, "beta": 171.832, "gamma": 67.896, "delta": 79.559, "epsilon": -146.903, "zeta": -69.641, "epsilon_zeta": -77.262, "bb_type": "BI", "chi": -169.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.698, 1.118 ], "P_xyz": [ 1.147, 9.091, 1.039 ], "form": "A", "ssZp": 4.558, "Dp": 4.623, "splay_angle": 24.124, "splay_distance": 3.941, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 174.170, "theta": -137.707, "eta_prime": -173.839, "theta_prime": -137.249, "eta_base": -134.824, "theta_base": -106.016, "v0": 3.976, "v1": -29.771, "v2": 43.325, "v3": -41.947, "v4": 23.838, "amplitude": 44.558, "phase_angle": 13.510, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.629, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -16.761, 14.868, -6.494 ], "x_axis": [ -0.147, -0.343, 0.928 ], "y_axis": [ 0.976, 0.100, 0.192 ], "z_axis": [ -0.159, 0.934, 0.320 ], "quaternion": [ 0.564, -0.329, -0.481, -0.585 ] } }, { "index": 47, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -62.476, "beta": 171.233, "gamma": 58.364, "delta": 76.803, "epsilon": -133.551, "zeta": -73.881, "epsilon_zeta": -59.670, "bb_type": "BI", "chi": -161.223, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.947, 0.609 ], "P_xyz": [ 0.897, 9.553, 0.573 ], "form": ".", "ssZp": 4.394, "Dp": 4.712, "splay_angle": 32.157, "splay_distance": 5.015, "splay_ratio": 0.277, "d22": 3.591, "d64": 3.625, "eta": 174.974, "theta": -133.347, "eta_prime": -171.518, "theta_prime": -127.542, "eta_base": -125.036, "theta_base": -76.640, "v0": -2.571, "v1": -25.453, "v2": 42.082, "v3": -44.567, "v4": 29.867, "amplitude": 45.293, "phase_angle": 21.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.104, "frame": { "rmsd": 0.013, "origin": [ -19.042, 16.723, -3.869 ], "x_axis": [ 0.465, -0.210, 0.860 ], "y_axis": [ 0.847, 0.387, -0.364 ], "z_axis": [ -0.256, 0.898, 0.358 ], "quaternion": [ 0.743, -0.425, -0.375, -0.356 ] } }, { "index": 48, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -59.340, "beta": 160.318, "gamma": 51.816, "delta": 79.657, "epsilon": -133.968, "zeta": -68.733, "epsilon_zeta": -65.235, "bb_type": "BI", "chi": -160.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.671, 0.660 ], "P_xyz": [ 1.276, 8.819, 0.278 ], "form": ".", "ssZp": 4.485, "Dp": 4.859, "splay_angle": 86.811, "splay_distance": 10.498, "splay_ratio": 0.699, "d22": 9.845, "d64": 10.876, "eta": 165.301, "theta": -117.411, "eta_prime": -175.079, "theta_prime": -155.711, "eta_base": -107.766, "theta_base": 119.510, "v0": 2.826, "v1": -26.576, "v2": 38.454, "v3": -38.077, "v4": 22.440, "amplitude": 39.761, "phase_angle": 14.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.793, "filter_rmsd": 0.108, "frame": { "rmsd": 0.013, "origin": [ -16.802, 19.112, -0.070 ], "x_axis": [ 0.990, 0.041, 0.136 ], "y_axis": [ 0.093, 0.538, -0.838 ], "z_axis": [ -0.107, 0.842, 0.529 ], "quaternion": [ 0.874, -0.480, -0.069, -0.015 ] } }, { "index": 49, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,syn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -163.902, "beta": 159.239, "gamma": 31.569, "delta": 81.714, "epsilon": -139.470, "zeta": -63.319, "epsilon_zeta": -76.151, "bb_type": "BI", "chi": 23.757, "glyco_bond": "syn", "C5prime_xyz": [ -5.771, 3.987, -0.131 ], "P_xyz": [ -6.027, 1.365, -0.513 ], "form": ".", "ssZp": -4.139, "Dp": 4.502, "splay_angle": 25.891, "splay_distance": 3.999, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 34.439, "theta": -130.511, "eta_prime": 50.789, "theta_prime": -125.682, "eta_base": 21.079, "theta_base": -153.007, "v0": -3.107, "v1": -22.822, "v2": 38.736, "v3": -40.820, "v4": 27.838, "amplitude": 41.873, "phase_angle": 22.320, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.182, "filter_rmsd": 0.062, "frame": { "rmsd": 0.008, "origin": [ -24.288, 24.940, -4.565 ], "x_axis": [ -0.917, -0.369, 0.152 ], "y_axis": [ 0.136, 0.069, 0.988 ], "z_axis": [ -0.376, 0.927, -0.013 ], "quaternion": [ -0.187, -0.082, 0.707, 0.677 ] } }, { "index": 50, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -74.542, "beta": 173.116, "gamma": 61.026, "delta": 88.001, "epsilon": -114.652, "zeta": -80.448, "epsilon_zeta": -34.204, "bb_type": "--", "chi": -154.830, "glyco_bond": "anti", "C5prime_xyz": [ -1.254, 8.692, 0.235 ], "P_xyz": [ 1.343, 9.055, 0.064 ], "form": ".", "ssZp": 3.985, "Dp": 4.638, "splay_angle": 20.429, "splay_distance": 3.615, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 170.240, "theta": -100.153, "eta_prime": -169.005, "theta_prime": -115.093, "eta_base": 177.791, "theta_base": 178.047, "v0": 5.021, "v1": -25.247, "v2": 34.764, "v3": -33.131, "v4": 17.607, "amplitude": 35.394, "phase_angle": 10.831, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.748, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -25.563, 21.218, -3.855 ], "x_axis": [ 0.422, 0.460, -0.781 ], "y_axis": [ 0.824, 0.166, 0.542 ], "z_axis": [ 0.379, -0.872, -0.308 ], "quaternion": [ 0.566, 0.625, 0.513, -0.161 ] } }, { "index": 51, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": 77.828, "beta": -153.982, "gamma": -97.568, "delta": 118.936, "epsilon": -7.207, "zeta": -139.058, "epsilon_zeta": 131.851, "bb_type": "--", "chi": -75.592, "glyco_bond": "--", "C5prime_xyz": [ -4.363, 6.841, -2.553 ], "P_xyz": [ -6.357, 7.000, -4.172 ], "form": ".", "ssZp": 0.822, "Dp": 1.593, "splay_angle": 89.386, "splay_distance": 11.993, "splay_ratio": 0.704, "d22": null, "d64": null, "eta": -134.924, "theta": -109.481, "eta_prime": -131.733, "theta_prime": 171.511, "eta_base": 154.974, "theta_base": 116.612, "v0": -45.581, "v1": 50.619, "v2": -34.317, "v3": 9.876, "v4": 21.480, "amplitude": 49.037, "phase_angle": 134.413, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.017, "origin": [ -27.398, 18.107, -3.689 ], "x_axis": [ -0.220, 0.463, -0.859 ], "y_axis": [ 0.943, -0.124, -0.308 ], "z_axis": [ -0.250, -0.877, -0.409 ], "quaternion": [ 0.248, 0.573, 0.613, -0.483 ] } }, { "index": 52, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": -36.425, "beta": -120.554, "gamma": 95.421, "delta": 89.722, "epsilon": -115.086, "zeta": -74.059, "epsilon_zeta": -41.027, "bb_type": "--", "chi": -153.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.220, 8.750, 0.238 ], "P_xyz": [ 1.342, 8.190, 0.524 ], "form": ".", "ssZp": 3.894, "Dp": 4.549, "splay_angle": 43.154, "splay_distance": 7.189, "splay_ratio": 0.368, "d22": null, "d64": null, "eta": -61.731, "theta": -65.656, "eta_prime": 39.757, "theta_prime": -76.169, "eta_base": 93.234, "theta_base": -80.213, "v0": 6.259, "v1": -23.953, "v2": 31.454, "v3": -28.904, "v4": 14.389, "amplitude": 31.740, "phase_angle": 7.696, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -25.681, 9.704, 4.695 ], "x_axis": [ -0.309, 0.937, 0.163 ], "y_axis": [ 0.716, 0.342, -0.609 ], "z_axis": [ -0.626, -0.072, -0.776 ], "quaternion": [ -0.253, 0.530, 0.779, -0.218 ] } }, { "index": 53, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": -137.083, "beta": -124.866, "gamma": 74.577, "delta": 131.112, "epsilon": -89.564, "zeta": -91.124, "epsilon_zeta": 1.560, "bb_type": "--", "chi": -126.486, "glyco_bond": "anti", "C5prime_xyz": [ -2.303, 8.686, -1.163 ], "P_xyz": [ -0.367, 9.745, 0.313 ], "form": ".", "ssZp": 0.648, "Dp": 0.709, "splay_angle": 89.401, "splay_distance": 13.789, "splay_ratio": 0.704, "d22": 7.715, "d64": 8.527, "eta": 149.063, "theta": -55.157, "eta_prime": -174.034, "theta_prime": -78.080, "eta_base": -156.970, "theta_base": -48.706, "v0": -30.742, "v1": 38.892, "v2": -32.099, "v3": 15.743, "v4": 9.076, "amplitude": 38.065, "phase_angle": 147.488, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.013, "origin": [ -29.118, 13.759, -0.145 ], "x_axis": [ 0.386, -0.020, 0.922 ], "y_axis": [ 0.820, -0.450, -0.354 ], "z_axis": [ 0.423, 0.893, -0.157 ], "quaternion": [ -0.441, 0.706, 0.283, 0.476 ] } }, { "index": 54, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -112.942, "beta": -171.935, "gamma": 63.573, "delta": 78.510, "epsilon": -145.055, "zeta": -82.805, "epsilon_zeta": -62.251, "bb_type": "BI", "chi": -152.591, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.891, 0.094 ], "P_xyz": [ 1.073, 9.279, -0.114 ], "form": "A", "ssZp": 4.181, "Dp": 4.662, "splay_angle": 30.828, "splay_distance": 4.755, "splay_ratio": 0.266, "d22": 3.691, "d64": 3.706, "eta": 122.867, "theta": -150.135, "eta_prime": 164.680, "theta_prime": -146.154, "eta_base": -163.052, "theta_base": -113.571, "v0": 4.185, "v1": -31.270, "v2": 45.132, "v3": -43.913, "v4": 24.941, "amplitude": 46.419, "phase_angle": 13.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.014, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ -16.730, 15.177, -6.033 ], "x_axis": [ 0.066, -0.763, 0.643 ], "y_axis": [ -0.838, -0.392, -0.379 ], "z_axis": [ 0.541, -0.514, -0.665 ], "quaternion": [ 0.046, 0.729, -0.549, 0.406 ] } }, { "index": 55, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -58.722, "beta": 168.728, "gamma": 57.478, "delta": 86.198, "epsilon": -127.943, "zeta": -92.054, "epsilon_zeta": -35.889, "bb_type": "--", "chi": -175.035, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.603, 1.439 ], "P_xyz": [ 1.224, 8.586, 2.012 ], "form": ".", "ssZp": 4.503, "Dp": 4.561, "splay_angle": 18.351, "splay_distance": 3.550, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": -179.972, "theta": -110.838, "eta_prime": -170.675, "theta_prime": -124.210, "eta_base": -130.037, "theta_base": -116.490, "v0": 3.558, "v1": -25.319, "v2": 36.425, "v3": -35.244, "v4": 19.910, "amplitude": 37.412, "phase_angle": 13.192, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.824, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -14.173, 11.398, -7.372 ], "x_axis": [ -0.671, -0.454, 0.586 ], "y_axis": [ -0.732, 0.281, -0.620 ], "z_axis": [ 0.117, -0.845, -0.521 ], "quaternion": [ -0.149, -0.377, 0.786, -0.466 ] } }, { "index": 56, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 109.333, "beta": -141.126, "gamma": -150.024, "delta": 84.620, "epsilon": -138.358, "zeta": -72.845, "epsilon_zeta": -65.514, "bb_type": "BI", "chi": -175.956, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.393, 1.432 ], "P_xyz": [ -0.690, 10.642, 0.150 ], "form": "A", "ssZp": 4.655, "Dp": 4.677, "splay_angle": 24.135, "splay_distance": 3.927, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 164.097, "theta": -177.301, "eta_prime": 177.458, "theta_prime": -165.738, "eta_base": -150.152, "theta_base": -128.217, "v0": 7.924, "v1": -29.488, "v2": 39.050, "v3": -35.459, "v4": 17.432, "amplitude": 39.372, "phase_angle": 7.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ -12.631, 8.327, -6.481 ], "x_axis": [ -0.869, -0.383, 0.313 ], "y_axis": [ -0.422, 0.247, -0.872 ], "z_axis": [ 0.256, -0.890, -0.377 ], "quaternion": [ -0.018, -0.255, 0.790, -0.558 ] } }, { "index": 57, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "U", "nt_code": "U", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.911, "beta": 171.202, "gamma": 60.709, "delta": 82.046, "epsilon": -145.578, "zeta": -71.301, "epsilon_zeta": -74.277, "bb_type": "BI", "chi": -161.165, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.875, 0.579 ], "P_xyz": [ 0.971, 9.490, 0.620 ], "form": "A", "ssZp": 4.365, "Dp": 4.552, "splay_angle": 24.802, "splay_distance": 4.075, "splay_ratio": 0.217, "d22": 4.141, "d64": 4.362, "eta": 174.485, "theta": -139.946, "eta_prime": -167.078, "theta_prime": -141.579, "eta_base": -120.306, "theta_base": -109.998, "v0": -1.014, "v1": -22.679, "v2": 36.597, "v3": -37.693, "v4": 24.473, "amplitude": 38.891, "phase_angle": 19.777, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ -12.828, 4.541, -5.458 ], "x_axis": [ -0.926, -0.216, -0.309 ], "y_axis": [ 0.229, 0.331, -0.916 ], "z_axis": [ 0.301, -0.919, -0.257 ], "quaternion": [ 0.192, 0.004, 0.793, -0.578 ] } }, { "index": 58, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.753, "beta": 164.673, "gamma": 53.456, "delta": 69.234, "epsilon": 173.587, "zeta": -76.499, "epsilon_zeta": -109.914, "bb_type": "BI", "chi": -163.813, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.860, 0.747 ], "P_xyz": [ 1.014, 9.615, 0.594 ], "form": "A", "ssZp": 4.530, "Dp": 4.557, "splay_angle": 23.469, "splay_distance": 3.487, "splay_ratio": 0.204, "d22": 4.846, "d64": 4.387, "eta": 160.482, "theta": -172.998, "eta_prime": 179.194, "theta_prime": -165.463, "eta_base": -128.128, "theta_base": -154.778, "v0": 5.004, "v1": -34.163, "v2": 48.387, "v3": -46.486, "v4": 26.572, "amplitude": 49.624, "phase_angle": 12.821, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.615, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ -13.593, 0.574, -5.999 ], "x_axis": [ -0.634, 0.094, -0.768 ], "y_axis": [ 0.739, 0.366, -0.565 ], "z_axis": [ 0.227, -0.926, -0.301 ], "quaternion": [ 0.328, 0.275, 0.758, -0.492 ] } }, { "index": 59, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -124.036, "beta": -134.795, "gamma": 82.385, "delta": 85.517, "epsilon": -157.825, "zeta": -69.209, "epsilon_zeta": -88.617, "bb_type": "BI", "chi": -157.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.440, 8.827, 0.412 ], "P_xyz": [ 1.195, 8.533, 0.687 ], "form": "A", "ssZp": 4.365, "Dp": 4.544, "splay_angle": 21.485, "splay_distance": 3.451, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 174.380, "theta": -139.611, "eta_prime": 175.326, "theta_prime": -148.543, "eta_base": -173.725, "theta_base": -136.519, "v0": -0.093, "v1": -23.042, "v2": 35.945, "v3": -36.467, "v4": 23.451, "amplitude": 37.899, "phase_angle": 18.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ -13.633, -2.828, -5.239 ], "x_axis": [ -0.301, 0.495, -0.815 ], "y_axis": [ 0.954, 0.154, -0.259 ], "z_axis": [ -0.003, -0.855, -0.518 ], "quaternion": [ 0.289, 0.516, 0.702, -0.397 ] } }, { "index": 60, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -101.597, "beta": 145.499, "gamma": 98.265, "delta": 84.809, "epsilon": -103.461, "zeta": -99.052, "epsilon_zeta": -4.409, "bb_type": "--", "chi": 178.522, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.329, 1.780 ], "P_xyz": [ 0.852, 9.263, 0.877 ], "form": ".", "ssZp": 4.644, "Dp": 4.694, "splay_angle": 18.319, "splay_distance": 2.849, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 174.950, "theta": -143.921, "eta_prime": -176.595, "theta_prime": -142.260, "eta_base": -145.957, "theta_base": -96.935, "v0": 8.109, "v1": -29.503, "v2": 38.863, "v3": -34.803, "v4": 17.000, "amplitude": 39.135, "phase_angle": 6.766, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.008, "origin": [ -14.892, -5.836, -6.370 ], "x_axis": [ 0.089, 0.520, -0.850 ], "y_axis": [ 0.995, -0.079, 0.056 ], "z_axis": [ -0.038, -0.851, -0.524 ], "quaternion": [ 0.348, 0.650, 0.583, -0.341 ] } }, { "index": 61, "index_chain": 27, "chain_name": "D", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.428, "beta": 138.726, "gamma": 59.831, "delta": 78.891, "epsilon": -146.148, "zeta": -78.152, "epsilon_zeta": -67.996, "bb_type": "BI", "chi": -150.088, "glyco_bond": "anti", "C5prime_xyz": [ -1.487, 8.886, -0.109 ], "P_xyz": [ 0.891, 8.785, -1.335 ], "form": "A", "ssZp": 4.167, "Dp": 4.708, "splay_angle": 22.310, "splay_distance": 3.716, "splay_ratio": 0.198, "d22": 4.094, "d64": 4.450, "eta": 146.894, "theta": -141.315, "eta_prime": 171.035, "theta_prime": -150.802, "eta_base": -123.813, "theta_base": -146.706, "v0": 6.229, "v1": -31.853, "v2": 44.260, "v3": -41.422, "v4": 22.201, "amplitude": 45.031, "phase_angle": 10.620, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.878, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ -15.042, -7.014, -8.959 ], "x_axis": [ 0.684, 0.256, -0.683 ], "y_axis": [ 0.618, -0.701, 0.356 ], "z_axis": [ -0.388, -0.665, -0.638 ], "quaternion": [ 0.294, 0.869, 0.251, -0.308 ] } }, { "index": 62, "index_chain": 28, "chain_name": "D", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -66.305, "beta": 165.826, "gamma": 58.141, "delta": 68.705, "epsilon": -111.280, "zeta": -134.931, "epsilon_zeta": 23.651, "bb_type": "--", "chi": -160.585, "glyco_bond": "anti", "C5prime_xyz": [ -1.807, 8.923, 0.501 ], "P_xyz": [ 0.657, 9.764, 0.122 ], "form": "A", "ssZp": 4.116, "Dp": 4.799, "splay_angle": 26.044, "splay_distance": 4.191, "splay_ratio": 0.226, "d22": 3.901, "d64": 4.445, "eta": 168.370, "theta": -157.271, "eta_prime": 173.938, "theta_prime": -161.899, "eta_base": -166.131, "theta_base": -145.557, "v0": -0.784, "v1": -29.550, "v2": 47.002, "v3": -48.436, "v4": 31.100, "amplitude": 49.813, "phase_angle": 19.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.576, "filter_rmsd": 0.104, "frame": { "rmsd": 0.010, "origin": [ -16.937, -7.819, -12.054 ], "x_axis": [ 0.936, 0.196, -0.293 ], "y_axis": [ 0.322, -0.811, 0.488 ], "z_axis": [ -0.142, -0.551, -0.822 ], "quaternion": [ 0.275, 0.945, 0.137, -0.115 ] } }, { "index": 63, "index_chain": 29, "chain_name": "D", "nt_resnum": 29, "nt_name": "U", "nt_code": "U", "nt_id": "///D/29", "linked_nts": [ "///D/28", "///D/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 82.521, "beta": -105.317, "gamma": -155.146, "delta": 95.743, "epsilon": -115.239, "zeta": -81.591, "epsilon_zeta": -33.649, "bb_type": "--", "chi": 170.806, "glyco_bond": "anti", "C5prime_xyz": [ -0.951, 7.600, 2.253 ], "P_xyz": [ 0.442, 9.388, 0.977 ], "form": "A", "ssZp": 4.699, "Dp": 4.716, "splay_angle": 27.843, "splay_distance": 4.179, "splay_ratio": 0.241, "d22": 4.261, "d64": 4.210, "eta": -179.244, "theta": -157.108, "eta_prime": -179.933, "theta_prime": -147.993, "eta_base": -154.860, "theta_base": -106.815, "v0": 23.200, "v1": -36.929, "v2": 36.915, "v3": -24.312, "v4": 0.751, "amplitude": 38.633, "phase_angle": 342.847, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.012, "origin": [ -17.596, -8.880, -16.054 ], "x_axis": [ 0.978, 0.152, 0.140 ], "y_axis": [ 0.037, -0.794, 0.606 ], "z_axis": [ 0.204, -0.588, -0.783 ], "quaternion": [ 0.317, 0.943, 0.050, 0.091 ] } }, { "index": 64, "index_chain": 30, "chain_name": "D", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///D/30", "linked_nts": [ "///D/29", "///D/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.361, "beta": 160.940, "gamma": 44.363, "delta": 86.620, "epsilon": -147.915, "zeta": -84.347, "epsilon_zeta": -63.568, "bb_type": "BI", "chi": -168.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.606, 1.110 ], "P_xyz": [ 1.300, 8.557, 1.565 ], "form": "A", "ssZp": 4.546, "Dp": 4.593, "splay_angle": 20.588, "splay_distance": 3.284, "splay_ratio": 0.180, "d22": 5.177, "d64": 5.103, "eta": 162.985, "theta": -149.941, "eta_prime": -172.103, "theta_prime": -152.479, "eta_base": -114.047, "theta_base": -149.421, "v0": 7.712, "v1": -27.906, "v2": 36.572, "v3": -33.194, "v4": 16.158, "amplitude": 36.843, "phase_angle": 6.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.186, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ -15.082, -10.236, -19.105 ], "x_axis": [ 0.683, -0.466, 0.562 ], "y_axis": [ -0.708, -0.612, 0.353 ], "z_axis": [ 0.180, -0.640, -0.747 ], "quaternion": [ 0.285, 0.872, -0.336, 0.213 ] } }, { "index": 65, "index_chain": 31, "chain_name": "D", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///D/31", "linked_nts": [ "///D/30", "///D/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -55.966, "beta": 163.578, "gamma": 52.347, "delta": 81.122, "epsilon": -146.213, "zeta": -75.172, "epsilon_zeta": -71.041, "bb_type": "BI", "chi": -149.442, "glyco_bond": "anti", "C5prime_xyz": [ -1.175, 8.822, -0.013 ], "P_xyz": [ 1.341, 9.222, -0.325 ], "form": "A", "ssZp": 4.041, "Dp": 4.623, "splay_angle": 20.553, "splay_distance": 3.445, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 176.704, "theta": -148.329, "eta_prime": -176.413, "theta_prime": -148.006, "eta_base": -162.110, "theta_base": -139.759, "v0": 4.334, "v1": -27.297, "v2": 37.805, "v3": -36.884, "v4": 20.800, "amplitude": 38.741, "phase_angle": 12.621, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.784, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -14.073, -10.087, -22.227 ], "x_axis": [ 0.423, -0.758, 0.496 ], "y_axis": [ -0.850, -0.522, -0.074 ], "z_axis": [ 0.315, -0.390, -0.865 ], "quaternion": [ 0.094, 0.838, -0.479, 0.242 ] } }, { "index": 66, "index_chain": 32, "chain_name": "D", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///D/32", "linked_nts": [ "///D/31", "///D/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -63.467, "beta": 165.257, "gamma": 52.018, "delta": 73.264, "epsilon": -130.019, "zeta": -83.733, "epsilon_zeta": -46.286, "bb_type": "BI", "chi": -140.429, "glyco_bond": "anti", "C5prime_xyz": [ -1.698, 8.906, -0.571 ], "P_xyz": [ 0.770, 9.689, -1.116 ], "form": ".", "ssZp": 3.470, "Dp": 4.639, "splay_angle": 35.956, "splay_distance": 5.795, "splay_ratio": 0.309, "d22": null, "d64": null, "eta": 165.810, "theta": -145.703, "eta_prime": 177.258, "theta_prime": -139.201, "eta_base": -163.874, "theta_base": -104.162, "v0": 6.827, "v1": -33.963, "v2": 47.086, "v3": -43.682, "v4": 23.362, "amplitude": 47.853, "phase_angle": 10.269, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.048, "frame": { "rmsd": 0.021, "origin": [ -11.957, -10.784, -24.855 ], "x_axis": [ 0.052, -0.810, 0.584 ], "y_axis": [ -0.851, -0.342, -0.398 ], "z_axis": [ 0.522, -0.476, -0.707 ], "quaternion": [ 0.027, 0.725, -0.573, 0.382 ] } }, { "index": 67, "index_chain": 33, "chain_name": "D", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///D/33", "linked_nts": [ "///D/32", "///D/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -53.559, "beta": 160.620, "gamma": 56.615, "delta": 79.868, "epsilon": -116.557, "zeta": -73.687, "epsilon_zeta": -42.871, "bb_type": "--", "chi": -167.414, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 8.825, 0.872 ], "P_xyz": [ 1.336, 9.084, 0.871 ], "form": ".", "ssZp": 4.333, "Dp": 4.655, "splay_angle": 64.343, "splay_distance": 9.874, "splay_ratio": 0.533, "d22": 4.550, "d64": 5.042, "eta": 176.772, "theta": -74.961, "eta_prime": -170.758, "theta_prime": -77.971, "eta_base": -130.207, "theta_base": -55.905, "v0": -3.326, "v1": -22.405, "v2": 38.816, "v3": -41.004, "v4": 27.760, "amplitude": 42.039, "phase_angle": 22.582, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.600, "filter_rmsd": 0.068, "frame": { "rmsd": 0.012, "origin": [ -10.539, -16.175, -26.440 ], "x_axis": [ -0.738, -0.394, 0.548 ], "y_axis": [ -0.674, 0.393, -0.626 ], "z_axis": [ 0.031, -0.831, -0.555 ], "quaternion": [ -0.158, -0.326, 0.819, -0.444 ] } }, { "index": 68, "index_chain": 34, "chain_name": "D", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///D/34", "linked_nts": [ "///D/33", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -138.059, "beta": -103.906, "gamma": 83.829, "delta": 83.758, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -156.314, "glyco_bond": "anti", "C5prime_xyz": [ -2.172, 9.086, 0.024 ], "P_xyz": [ 0.235, 9.284, 1.098 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -20.351, "v1": -3.165, "v2": 23.623, "v3": -35.889, "v4": 35.814, "amplitude": 37.312, "phase_angle": 50.720, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.011, "origin": [ -19.031, -20.546, -28.945 ], "x_axis": [ -0.260, 0.870, 0.419 ], "y_axis": [ 0.656, 0.478, -0.584 ], "z_axis": [ -0.708, 0.123, -0.695 ], "quaternion": [ -0.361, 0.489, 0.780, -0.148 ] } }, { "index": 69, "index_chain": 1, "chain_name": "A", "nt_resnum": 501, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///A/501", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 50.625, "delta": 85.444, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -177.950, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.409, 1.534 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 5.608, "v1": -26.560, "v2": 36.760, "v3": -33.729, "v4": 17.933, "amplitude": 37.302, "phase_angle": 9.776, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.058, "origin": [ -50.788, 45.180, 6.201 ], "x_axis": [ 0.281, 0.088, -0.956 ], "y_axis": [ -0.233, 0.972, 0.021 ], "z_axis": [ 0.931, 0.216, 0.294 ], "quaternion": [ 0.798, -0.061, 0.591, 0.100 ] } }, { "index": 70, "index_chain": 1, "chain_name": "B", "nt_resnum": 502, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///B/502", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 49.357, "delta": 94.891, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -167.482, "glyco_bond": "anti", "C5prime_xyz": [ -1.122, 8.481, 1.065 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.242, "v1": -21.409, "v2": 26.822, "v3": -23.288, "v4": 10.124, "amplitude": 26.867, "phase_angle": 3.300, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.066, "origin": [ -22.181, -17.434, -29.848 ], "x_axis": [ 0.383, 0.901, -0.205 ], "y_axis": [ 0.586, -0.408, -0.700 ], "z_axis": [ -0.714, 0.148, -0.684 ], "quaternion": [ -0.270, 0.787, 0.472, -0.292 ] } } ], "num_hbonds": 972, "hbonds": [ { "index": 1, "atom1_serNum": 12, "atom2_serNum": 34, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/2/O", "atom2_id": "///A/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 43, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/2/O", "atom2_id": "///A/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 21, "atom2_serNum": 51, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/3/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 28, "atom2_serNum": 59, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/4/O", "atom2_id": "///A/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 37, "atom2_serNum": 68, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 46, "atom2_serNum": 77, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 54, "atom2_serNum": 82, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 80, "atom2_serNum": 99, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/10/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 80, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 85, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/11/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 85, "atom2_serNum": 114, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 132, "atom2_serNum": 155, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/17/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 132, "atom2_serNum": 164, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 140, "atom2_serNum": 171, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 149, "atom2_serNum": 182, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 158, "atom2_serNum": 191, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 162, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/20/OE1", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 163, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 3.781, "atom1_id": "///A/20/OE2", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 167, "atom2_serNum": 191, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/21/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 167, "atom2_serNum": 195, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 174, "atom2_serNum": 206, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 194, "atom2_serNum": 220, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 198, "atom2_serNum": 229, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 204, "atom2_serNum": 399, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///A/25/NH1", "atom2_id": "///A/48/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 205, "atom2_serNum": 422, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/25/NH2", "atom2_id": "///A/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 218, "atom2_serNum": 247, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 223, "atom2_serNum": 255, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 227, "atom2_serNum": 399, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///A/28/OE1", "atom2_id": "///A/48/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 228, "atom2_serNum": 264, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///A/28/OE2", "atom2_id": "///A/32/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 232, "atom2_serNum": 266, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 241, "atom2_serNum": 277, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 245, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///A/30/OE1", "atom2_id": "///A/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 246, "atom2_serNum": 284, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/30/OE2", "atom2_id": "///A/34/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 250, "atom2_serNum": 288, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 258, "atom2_serNum": 296, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 269, "atom2_serNum": 304, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 280, "atom2_serNum": 313, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 286, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/34/NH1", "atom2_id": "///A/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 286, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/34/NH1", "atom2_id": "///A/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 287, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/34/NH2", "atom2_id": "///A/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 291, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 291, "atom2_serNum": 325, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///A/35/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 299, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/36/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 302, "atom2_serNum": 352, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///A/36/OD1", "atom2_id": "///A/42/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 335, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/41/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 340, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///A/41/OE2", "atom2_id": "///A/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 353, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/43/N", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 356, "atom2_serNum": 512, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/43/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 371, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/45/N", "atom2_id": "///A/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 381, "atom2_serNum": 400, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/46/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 381, "atom2_serNum": 405, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 382, "atom2_serNum": 8735, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/47/N", "atom2_id": "///A/501/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 53, "atom1_serNum": 385, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 385, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/47/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 387, "atom2_serNum": 8732, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///A/47/OG", "atom2_id": "///A/501/O3G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 56, "atom1_serNum": 391, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/48/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 408, "atom2_serNum": 1197, "donAcc_type": "questionable", "distance": 2.921, "atom1_id": "///A/50/O", "atom2_id": "///A/145/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 412, "atom2_serNum": 1443, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/50/NE", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 414, "atom2_serNum": 1101, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/50/NH1", "atom2_id": "///A/134/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 415, "atom2_serNum": 8746, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/50/NH2", "atom2_id": "///A/501/O3'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 61, "atom1_serNum": 427, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/52/O", "atom2_id": "///A/152/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 434, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/53/O", "atom2_id": "///A/149/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 448, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/54/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 487, "atom2_serNum": 504, "donAcc_type": "questionable", "distance": 3.231, "atom1_id": "///A/59/OE1", "atom2_id": "///A/61/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 487, "atom2_serNum": 8738, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///A/59/OE1", "atom2_id": "///A/501/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 66, "atom1_serNum": 489, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/60/N", "atom2_id": "///A/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 492, "atom2_serNum": 900, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/60/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 503, "atom2_serNum": 8738, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/61/OD1", "atom2_id": "///A/501/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 69, "atom1_serNum": 504, "atom2_serNum": 8738, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/61/OD2", "atom2_id": "///A/501/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 70, "atom1_serNum": 505, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/62/N", "atom2_id": "///A/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 508, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/62/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 523, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/64/N", "atom2_id": "///A/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 526, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/64/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 539, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/66/N", "atom2_id": "///A/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 542, "atom2_serNum": 947, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/66/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 553, "atom2_serNum": 575, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/67/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 560, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/68/O", "atom2_id": "///A/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 566, "atom2_serNum": 573, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/69/N", "atom2_id": "///A/69/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 578, "atom2_serNum": 946, "donAcc_type": "acceptable", "distance": 3.238, "atom1_id": "///A/70/O", "atom2_id": "///A/115/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 578, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/70/O", "atom2_id": "///A/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 586, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/71/N", "atom2_id": "///A/74/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 589, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 591, "atom2_serNum": 601, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/71/OG", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 591, "atom2_serNum": 610, "donAcc_type": "acceptable", "distance": 3.066, "atom1_id": "///A/71/OG", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 592, "atom2_serNum": 946, "donAcc_type": "acceptable", "distance": 3.762, "atom1_id": "///A/72/N", "atom2_id": "///A/115/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 595, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 604, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 608, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/73/OE1", "atom2_id": "///A/76/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 609, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///A/73/OE2", "atom2_id": "///A/76/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 609, "atom2_serNum": 645, "donAcc_type": "questionable", "distance": 3.184, "atom1_id": "///A/73/OE2", "atom2_id": "///A/77/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 613, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 622, "atom2_serNum": 658, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 630, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 641, "atom2_serNum": 670, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 650, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 661, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 665, "atom2_serNum": 691, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 673, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 682, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 690, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/83/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 720, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/88/N", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 727, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/88/OD2", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 731, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/89/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 746, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/91/N", "atom2_id": "///A/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 749, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/91/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 773, "atom2_serNum": 2354, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/93/NH2", "atom2_id": "///A/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 773, "atom2_serNum": 2357, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/93/NH2", "atom2_id": "///A/287/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 791, "atom2_serNum": 7981, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/96/N", "atom2_id": "///C/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 109, "atom1_serNum": 798, "atom2_serNum": 7984, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/96/OE1", "atom2_id": "///C/33/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 110, "atom1_serNum": 800, "atom2_serNum": 7981, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/97/N", "atom2_id": "///C/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 111, "atom1_serNum": 800, "atom2_serNum": 7982, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/97/N", "atom2_id": "///C/33/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 112, "atom1_serNum": 828, "atom2_serNum": 7977, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///A/99/OH", "atom2_id": "///C/33/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 113, "atom1_serNum": 829, "atom2_serNum": 911, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/100/N", "atom2_id": "///A/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 832, "atom2_serNum": 908, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/100/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 842, "atom2_serNum": 896, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/101/ND1", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 842, "atom2_serNum": 907, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/101/ND1", "atom2_id": "///A/110/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 845, "atom2_serNum": 891, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/101/NE2", "atom2_id": "///A/108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 846, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/102/N", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 849, "atom2_serNum": 893, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/102/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 857, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/104/N", "atom2_id": "///A/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 860, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/104/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 906, "atom2_serNum": 7995, "donAcc_type": "questionable", "distance": 2.978, "atom1_id": "///A/110/OD1", "atom2_id": "///C/34/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 123, "atom1_serNum": 935, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/115/N", "atom2_id": "///A/128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 938, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/115/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1014, "atom2_serNum": 1048, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/124/N", "atom2_id": "///A/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1023, "atom2_serNum": 1048, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/125/N", "atom2_id": "///A/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1028, "atom2_serNum": 1034, "donAcc_type": "acceptable", "distance": 3.178, "atom1_id": "///A/125/OG", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1037, "atom2_serNum": 1060, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/127/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1052, "atom2_serNum": 1074, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/129/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1052, "atom2_serNum": 1085, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1056, "atom2_serNum": 1816, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/129/NE", "atom2_id": "///A/221/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1059, "atom2_serNum": 1816, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/129/NH2", "atom2_id": "///A/221/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1063, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1065, "atom2_serNum": 8001, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///A/130/OG1", "atom2_id": "///C/34/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 135, "atom1_serNum": 1065, "atom2_serNum": 8744, "donAcc_type": "acceptable", "distance": 3.453, "atom1_id": "///A/130/OG1", "atom2_id": "///A/501/O4'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 136, "atom1_serNum": 1070, "atom2_serNum": 1105, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1077, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1088, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1091, "atom2_serNum": 8748, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///A/133/ND1", "atom2_id": "///A/501/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 140, "atom1_serNum": 1094, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/133/NE2", "atom2_id": "///A/218/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1098, "atom2_serNum": 1136, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1117, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/136/O", "atom2_id": "///A/140/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1131, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/137/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1131, "atom2_serNum": 1160, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1139, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 3.796, "atom1_id": "///A/138/O", "atom2_id": "///A/142/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1163, "atom2_serNum": 1181, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/141/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1177, "atom2_serNum": 1198, "donAcc_type": "standard", "distance": 2.390, "atom1_id": "///A/143/N", "atom2_id": "///A/145/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1184, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/144/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1184, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1193, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1202, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1205, "atom2_serNum": 1232, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/146/OD1", "atom2_id": "///A/149/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1210, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1214, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/147/OE1", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1219, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/148/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1226, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1237, "atom2_serNum": 1263, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1245, "atom2_serNum": 1274, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1253, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1258, "atom2_serNum": 8730, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///A/152/NZ", "atom2_id": "///A/501/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 161, "atom1_serNum": 1262, "atom2_serNum": 1291, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1266, "atom2_serNum": 1303, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/154/O", "atom2_id": "///A/158/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1277, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/155/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1277, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1277, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/155/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1285, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/156/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1303, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/158/ND2", "atom2_id": "///A/253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1311, "atom2_serNum": 1389, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/160/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1327, "atom2_serNum": 8730, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/161/OH", "atom2_id": "///A/501/O1G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 170, "atom1_serNum": 1327, "atom2_serNum": 8731, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///A/161/OH", "atom2_id": "///A/501/O2G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 171, "atom1_serNum": 1328, "atom2_serNum": 1392, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///A/162/N", "atom2_id": "///A/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1331, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/162/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1335, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/163/O", "atom2_id": "///A/229/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1337, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/164/N", "atom2_id": "///A/164/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1340, "atom2_serNum": 1367, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/164/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1340, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1346, "atom2_serNum": 7955, "donAcc_type": "acceptable", "distance": 3.499, "atom1_id": "///A/165/N", "atom2_id": "///C/32/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 178, "atom1_serNum": 1357, "atom2_serNum": 7308, "donAcc_type": "acceptable", "distance": 3.568, "atom1_id": "///A/165/OH", "atom2_id": "///C/1/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 179, "atom1_serNum": 1357, "atom2_serNum": 7939, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///A/165/OH", "atom2_id": "///C/31/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 180, "atom1_serNum": 1366, "atom2_serNum": 2381, "donAcc_type": "standard", "distance": 3.770, "atom1_id": "///A/166/NZ", "atom2_id": "///A/290/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1370, "atom2_serNum": 1915, "donAcc_type": "questionable", "distance": 2.982, "atom1_id": "///A/167/O", "atom2_id": "///A/234/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1377, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/168/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1381, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/168/NE", "atom2_id": "///A/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1381, "atom2_serNum": 2450, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/168/NE", "atom2_id": "///A/298/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1384, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/168/NH2", "atom2_id": "///A/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1403, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1405, "atom2_serNum": 1422, "donAcc_type": "acceptable", "distance": 2.756, "atom1_id": "///A/171/OG", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1409, "atom2_serNum": 1436, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1413, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1421, "atom2_serNum": 1793, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///A/173/OH", "atom2_id": "///A/218/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1425, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1433, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1439, "atom2_serNum": 1469, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1448, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1456, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1464, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1498, "atom2_serNum": 1603, "donAcc_type": "acceptable", "distance": 3.171, "atom1_id": "///A/182/OH", "atom2_id": "///A/195/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1506, "atom2_serNum": 1537, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1512, "atom2_serNum": 1537, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/185/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1512, "atom2_serNum": 1544, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1523, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1531, "atom2_serNum": 1560, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1531, "atom2_serNum": 1567, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///A/187/O", "atom2_id": "///A/191/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1540, "atom2_serNum": 1568, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1547, "atom2_serNum": 1573, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1554, "atom2_serNum": 1580, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/190/O", "atom2_id": "///A/193/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1563, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/191/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1571, "atom2_serNum": 1595, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/192/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1576, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/193/O", "atom2_id": "///A/243/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1576, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/193/O", "atom2_id": "///A/243/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1583, "atom2_serNum": 1593, "donAcc_type": "questionable", "distance": 3.322, "atom1_id": "///A/193/NH2", "atom2_id": "///A/194/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1609, "atom2_serNum": 1643, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///A/196/N", "atom2_id": "///A/199/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1612, "atom2_serNum": 1643, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///A/196/O", "atom2_id": "///A/199/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1614, "atom2_serNum": 1627, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/196/OG1", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1616, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/197/N", "atom2_id": "///B/350/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1623, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/197/NE", "atom2_id": "///B/350/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1625, "atom2_serNum": 6556, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/197/NH1", "atom2_id": "///B/350/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1630, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/198/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1630, "atom2_serNum": 1729, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/198/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1641, "atom2_serNum": 1762, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/199/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1645, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/200/N", "atom2_id": "///A/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1648, "atom2_serNum": 1709, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/200/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1652, "atom2_serNum": 1765, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/201/N", "atom2_id": "///A/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1655, "atom2_serNum": 1668, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/201/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1655, "atom2_serNum": 1780, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/201/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1660, "atom2_serNum": 1696, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/202/N", "atom2_id": "///A/207/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1663, "atom2_serNum": 1689, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1663, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/202/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1667, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/202/OD2", "atom2_id": "///A/209/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1668, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 3.999, "atom1_id": "///A/203/N", "atom2_id": "///A/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1671, "atom2_serNum": 1689, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/203/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1700, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/207/OE1", "atom2_id": "///A/209/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1754, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/214/O", "atom2_id": "///A/225/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1773, "atom2_serNum": 1852, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/216/N", "atom2_id": "///A/225/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1776, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/216/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1776, "atom2_serNum": 1838, "donAcc_type": "questionable", "distance": 3.266, "atom1_id": "///A/216/O", "atom2_id": "///A/224/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1776, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/216/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1783, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/217/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1787, "atom2_serNum": 1838, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/218/N", "atom2_id": "///A/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1790, "atom2_serNum": 1809, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/218/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1793, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/218/OD1", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1812, "atom2_serNum": 1835, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1815, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/221/OD1", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1842, "atom2_serNum": 7926, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/224/NE", "atom2_id": "///C/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 245, "atom1_serNum": 1844, "atom2_serNum": 8756, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/224/NH1", "atom2_id": "///A/501/N1", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 246, "atom1_serNum": 1845, "atom2_serNum": 7926, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/224/NH2", "atom2_id": "///C/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 247, "atom1_serNum": 1845, "atom2_serNum": 7946, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/224/NH2", "atom2_id": "///C/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 248, "atom1_serNum": 1845, "atom2_serNum": 7947, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/224/NH2", "atom2_id": "///C/32/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 249, "atom1_serNum": 1864, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/227/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1874, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/229/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1890, "atom2_serNum": 1909, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1890, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1892, "atom2_serNum": 1909, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///A/231/OG", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1896, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1904, "atom2_serNum": 1930, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1907, "atom2_serNum": 6735, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/233/OD1", "atom2_id": "///B/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1907, "atom2_serNum": 6743, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/233/OD1", "atom2_id": "///B/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1908, "atom2_serNum": 6735, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/233/OD2", "atom2_id": "///B/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1912, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1920, "atom2_serNum": 1952, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1928, "atom2_serNum": 1959, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1933, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1944, "atom2_serNum": 1977, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1955, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1962, "atom2_serNum": 1994, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1972, "atom2_serNum": 2003, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1980, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1992, "atom2_serNum": 6540, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/243/NH1", "atom2_id": "///B/349/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1993, "atom2_serNum": 6551, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/243/NH2", "atom2_id": "///B/350/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1997, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2030, "atom2_serNum": 6608, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///A/247/OE2", "atom2_id": "///B/356/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2048, "atom2_serNum": 2057, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///A/250/OG", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2052, "atom2_serNum": 2072, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/251/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2052, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/251/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2060, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/252/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2060, "atom2_serNum": 2086, "donAcc_type": "questionable", "distance": 2.914, "atom1_id": "///A/252/O", "atom2_id": "///A/255/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2107, "atom2_serNum": 8805, "donAcc_type": "acceptable", "distance": 3.400, "atom1_id": "///A/257/NZ", "atom2_id": "///B/801/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 278, "atom1_serNum": 2108, "atom2_serNum": 3645, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/258/N", "atom2_id": "///A/440/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2111, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/258/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2125, "atom2_serNum": 3633, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/260/N", "atom2_id": "///A/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2128, "atom2_serNum": 2142, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/260/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2150, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/263/N", "atom2_id": "///A/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2153, "atom2_serNum": 2186, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2169, "atom2_serNum": 2204, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/265/O", "atom2_id": "///A/268/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2169, "atom2_serNum": 2205, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2178, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2189, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2197, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2201, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/268/NE", "atom2_id": "///A/272/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2203, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/268/NH1", "atom2_id": "///A/272/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2208, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2217, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2225, "atom2_serNum": 2258, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2225, "atom2_serNum": 2262, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///A/271/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2250, "atom2_serNum": 6458, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/274/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2250, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/274/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2256, "atom2_serNum": 2745, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/274/NH1", "atom2_id": "///A/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2256, "atom2_serNum": 2746, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///A/274/NH1", "atom2_id": "///A/332/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2257, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/274/NH2", "atom2_id": "///A/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2267, "atom2_serNum": 2746, "donAcc_type": "acceptable", "distance": 2.498, "atom1_id": "///A/276/OG1", "atom2_id": "///A/332/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2269, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/277/N", "atom2_id": "///A/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2272, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///A/277/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2277, "atom2_serNum": 3469, "donAcc_type": "standard", "distance": 3.726, "atom1_id": "///A/278/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2281, "atom2_serNum": 2730, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/279/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2284, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/279/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2292, "atom2_serNum": 3458, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/280/N", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2295, "atom2_serNum": 3455, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/280/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2297, "atom2_serNum": 2714, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/281/N", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2300, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/281/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2304, "atom2_serNum": 3441, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/282/N", "atom2_id": "///A/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2307, "atom2_serNum": 3438, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/282/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2312, "atom2_serNum": 3526, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/282/NZ", "atom2_id": "///A/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2313, "atom2_serNum": 2696, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/283/N", "atom2_id": "///A/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2316, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/283/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2327, "atom2_serNum": 2344, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/284/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2327, "atom2_serNum": 3386, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///A/284/O", "atom2_id": "///A/407/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2334, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/284/NH2", "atom2_id": "///A/325/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2335, "atom2_serNum": 2676, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/285/N", "atom2_id": "///A/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2347, "atom2_serNum": 2359, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/286/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2370, "atom2_serNum": 2390, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/289/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2370, "atom2_serNum": 2398, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2377, "atom2_serNum": 2406, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2389, "atom2_serNum": 7955, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///A/291/OD2", "atom2_id": "///C/32/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 324, "atom1_serNum": 2397, "atom2_serNum": 7294, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/292/ND2", "atom2_id": "///C/1/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 325, "atom1_serNum": 2397, "atom2_serNum": 7298, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///A/292/ND2", "atom2_id": "///C/1/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 326, "atom1_serNum": 2401, "atom2_serNum": 2434, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2409, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2421, "atom2_serNum": 2451, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2428, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2432, "atom2_serNum": 3353, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/296/OE1", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2432, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/296/OE1", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2433, "atom2_serNum": 3360, "donAcc_type": "questionable", "distance": 2.996, "atom1_id": "///A/296/NE2", "atom2_id": "///A/403/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2433, "atom2_serNum": 7298, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/296/NE2", "atom2_id": "///C/1/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 334, "atom1_serNum": 2437, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2445, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2454, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2458, "atom2_serNum": 7335, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/299/NE", "atom2_id": "///C/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 338, "atom1_serNum": 2460, "atom2_serNum": 3328, "donAcc_type": "standard", "distance": 2.204, "atom1_id": "///A/299/NH1", "atom2_id": "///A/399/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2461, "atom2_serNum": 8762, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///A/299/NH2", "atom2_id": "///A/601/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 340, "atom1_serNum": 2461, "atom2_serNum": 8763, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///A/299/NH2", "atom2_id": "///A/601/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 341, "atom1_serNum": 2465, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/300/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2470, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/301/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2476, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2480, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///A/302/NE", "atom2_id": "///A/306/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2482, "atom2_serNum": 7335, "donAcc_type": "standard", "distance": 3.653, "atom1_id": "///A/302/NH1", "atom2_id": "///C/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 346, "atom1_serNum": 2483, "atom2_serNum": 8763, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///A/302/NH2", "atom2_id": "///A/601/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 347, "atom1_serNum": 2487, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2492, "atom2_serNum": 7743, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/303/NZ", "atom2_id": "///C/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 349, "atom1_serNum": 2492, "atom2_serNum": 8762, "donAcc_type": "acceptable", "distance": 2.321, "atom1_id": "///A/303/NZ", "atom2_id": "///A/601/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 350, "atom1_serNum": 2492, "atom2_serNum": 8764, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///A/303/NZ", "atom2_id": "///A/601/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 351, "atom1_serNum": 2496, "atom2_serNum": 2532, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2504, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2515, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2524, "atom2_serNum": 2560, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2535, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/308/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2543, "atom2_serNum": 2569, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/309/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2580, "atom2_serNum": 2762, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///A/313/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2591, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/314/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2603, "atom2_serNum": 2741, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/316/N", "atom2_id": "///A/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2606, "atom2_serNum": 6496, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///A/316/O", "atom2_id": "///B/343/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2614, "atom2_serNum": 2738, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///A/317/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2620, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/317/NH1", "atom2_id": "///A/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2620, "atom2_serNum": 3589, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/317/NH1", "atom2_id": "///A/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2628, "atom2_serNum": 2722, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/319/N", "atom2_id": "///A/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2631, "atom2_serNum": 2719, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/319/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2644, "atom2_serNum": 2702, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/321/N", "atom2_id": "///A/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2647, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/321/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2658, "atom2_serNum": 2685, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/323/N", "atom2_id": "///A/326/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2663, "atom2_serNum": 2682, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///A/323/OG", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2663, "atom2_serNum": 2685, "donAcc_type": "acceptable", "distance": 3.045, "atom1_id": "///A/323/OG", "atom2_id": "///A/326/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2710, "atom2_serNum": 3526, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///A/328/OH", "atom2_id": "///A/423/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2756, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/334/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2761, "atom2_serNum": 6472, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/334/NE2", "atom2_id": "///B/341/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2761, "atom2_serNum": 6828, "donAcc_type": "questionable", "distance": 2.702, "atom1_id": "///A/334/NE2", "atom2_id": "///B/380/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2788, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/338/N", "atom2_id": "///A/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2796, "atom2_serNum": 6412, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/339/N", "atom2_id": "///B/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2799, "atom2_serNum": 3172, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/339/O", "atom2_id": "///A/380/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2801, "atom2_serNum": 2816, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/339/OG", "atom2_id": "///A/341/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2802, "atom2_serNum": 5906, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/340/N", "atom2_id": "///B/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2805, "atom2_serNum": 3163, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/340/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2809, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///A/340/NE", "atom2_id": "///A/380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2820, "atom2_serNum": 3149, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/342/N", "atom2_id": "///A/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2823, "atom2_serNum": 3146, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/342/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2840, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/343/NH1", "atom2_id": "///A/370/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2840, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/343/NH1", "atom2_id": "///B/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2841, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/343/NH2", "atom2_id": "///A/370/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2842, "atom2_serNum": 3133, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/344/N", "atom2_id": "///A/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2845, "atom2_serNum": 3130, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/344/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2851, "atom2_serNum": 3154, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/344/NH1", "atom2_id": "///A/378/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2861, "atom2_serNum": 3105, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/346/N", "atom2_id": "///A/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2864, "atom2_serNum": 3100, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/346/O", "atom2_id": "///A/373/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2868, "atom2_serNum": 3102, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/347/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2875, "atom2_serNum": 2901, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/348/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2884, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/349/O", "atom2_id": "///B/243/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2895, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/350/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2895, "atom2_serNum": 5649, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/350/O", "atom2_id": "///B/243/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2899, "atom2_serNum": 5279, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/350/OE1", "atom2_id": "///B/197/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2899, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/350/OE1", "atom2_id": "///B/197/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2904, "atom2_serNum": 2929, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/351/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2904, "atom2_serNum": 2937, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2912, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2921, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 2932, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 2940, "atom2_serNum": 2973, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/355/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 2947, "atom2_serNum": 2981, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/356/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 2961, "atom2_serNum": 7615, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/357/NZ", "atom2_id": "///C/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 407, "atom1_serNum": 2965, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/358/O", "atom2_id": "///A/363/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2965, "atom2_serNum": 3016, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/358/O", "atom2_id": "///A/363/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3009, "atom2_serNum": 7277, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/363/O", "atom2_id": "///B/436/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3013, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///A/363/NE", "atom2_id": "///A/378/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3016, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/363/NH2", "atom2_id": "///A/378/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3016, "atom2_serNum": 7595, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/363/NH2", "atom2_id": "///C/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 413, "atom1_serNum": 3033, "atom2_serNum": 7261, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/366/N", "atom2_id": "///B/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3051, "atom2_serNum": 3119, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/368/N", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3054, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/368/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3065, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/369/O", "atom2_id": "///B/237/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3070, "atom2_serNum": 3094, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/370/N", "atom2_id": "///A/373/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3073, "atom2_serNum": 3091, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/370/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3073, "atom2_serNum": 3124, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///A/370/O", "atom2_id": "///A/375/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3079, "atom2_serNum": 3085, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/371/N", "atom2_id": "///A/371/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3079, "atom2_serNum": 5563, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/371/N", "atom2_id": "///B/233/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3087, "atom2_serNum": 5563, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/372/N", "atom2_id": "///B/233/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3090, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/372/O", "atom2_id": "///B/197/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3173, "atom2_serNum": 6417, "donAcc_type": "questionable", "distance": 2.876, "atom1_id": "///A/380/NH2", "atom2_id": "///B/334/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3194, "atom2_serNum": 3231, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/383/N", "atom2_id": "///A/387/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3204, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/384/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3206, "atom2_serNum": 3222, "donAcc_type": "acceptable", "distance": 3.914, "atom1_id": "///A/384/OG1", "atom2_id": "///A/386/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3211, "atom2_serNum": 3237, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/385/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3215, "atom2_serNum": 3222, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/386/N", "atom2_id": "///A/386/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3218, "atom2_serNum": 3244, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/386/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3227, "atom2_serNum": 3255, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3236, "atom2_serNum": 3261, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3240, "atom2_serNum": 3273, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3247, "atom2_serNum": 3278, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3247, "atom2_serNum": 3283, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///A/390/O", "atom2_id": "///A/394/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3258, "atom2_serNum": 3284, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3264, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///A/392/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3272, "atom2_serNum": 7742, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///A/392/OH", "atom2_id": "///C/22/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 439, "atom1_serNum": 3294, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/396/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3304, "atom2_serNum": 3332, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/397/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3321, "atom2_serNum": 7764, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///A/398/ND1", "atom2_id": "///C/23/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 442, "atom1_serNum": 3324, "atom2_serNum": 7784, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/398/NE2", "atom2_id": "///C/24/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 443, "atom1_serNum": 3330, "atom2_serNum": 7765, "donAcc_type": "acceptable", "distance": 3.463, "atom1_id": "///A/399/OG1", "atom2_id": "///C/23/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 444, "atom1_serNum": 3343, "atom2_serNum": 3368, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3344, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/402/N", "atom2_id": "///C/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 446, "atom1_serNum": 3356, "atom2_serNum": 3381, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3364, "atom2_serNum": 3381, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/404/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3364, "atom2_serNum": 3387, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3371, "atom2_serNum": 3395, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3375, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3384, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3384, "atom2_serNum": 3418, "donAcc_type": "questionable", "distance": 2.820, "atom1_id": "///A/407/O", "atom2_id": "///A/411/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3426, "atom2_serNum": 3446, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/411/OH", "atom2_id": "///A/413/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3466, "atom2_serNum": 3482, "donAcc_type": "standard", "distance": 3.802, "atom1_id": "///A/416/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3472, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///A/417/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3472, "atom2_serNum": 3499, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3476, "atom2_serNum": 3510, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3494, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/420/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3522, "atom2_serNum": 3535, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/423/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3538, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/425/O", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3545, "atom2_serNum": 3571, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/426/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3552, "atom2_serNum": 3577, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/427/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3554, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/428/N", "atom2_id": "///A/428/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3557, "atom2_serNum": 3586, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3566, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3574, "atom2_serNum": 3602, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3574, "atom2_serNum": 3606, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/430/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3605, "atom2_serNum": 6689, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/434/O", "atom2_id": "///B/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3621, "atom2_serNum": 6665, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/436/NZ", "atom2_id": "///B/363/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3622, "atom2_serNum": 8803, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///A/437/N", "atom2_id": "///B/801/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 471, "atom1_serNum": 3665, "atom2_serNum": 3697, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///B/2/N", "atom2_id": "///B/5/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3677, "atom2_serNum": 3699, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///B/3/O", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3702, "atom2_serNum": 3733, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///B/6/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3710, "atom2_serNum": 3738, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3727, "atom2_serNum": 3746, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/9/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3736, "atom2_serNum": 3755, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/10/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3736, "atom2_serNum": 3763, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3741, "atom2_serNum": 3770, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/11/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3766, "atom2_serNum": 4109, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/14/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3788, "atom2_serNum": 3820, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///B/17/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3796, "atom2_serNum": 3827, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3805, "atom2_serNum": 3838, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3819, "atom2_serNum": 4095, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/20/OE2", "atom2_id": "///B/53/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3819, "atom2_serNum": 4118, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/20/OE2", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3823, "atom2_serNum": 3847, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/21/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3823, "atom2_serNum": 3851, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3850, "atom2_serNum": 3871, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/24/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3850, "atom2_serNum": 3876, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3854, "atom2_serNum": 3885, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3860, "atom2_serNum": 4055, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///B/25/NH1", "atom2_id": "///B/48/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3861, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/25/NH2", "atom2_id": "///B/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3865, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3879, "atom2_serNum": 3911, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3883, "atom2_serNum": 4055, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/28/OE1", "atom2_id": "///B/48/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3884, "atom2_serNum": 3920, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/28/OE2", "atom2_id": "///B/32/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3888, "atom2_serNum": 3922, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3892, "atom2_serNum": 3932, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/29/OE1", "atom2_id": "///B/33/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3897, "atom2_serNum": 3933, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3902, "atom2_serNum": 3940, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/30/OE2", "atom2_id": "///B/34/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3906, "atom2_serNum": 3944, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3914, "atom2_serNum": 3952, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3914, "atom2_serNum": 4008, "donAcc_type": "acceptable", "distance": 3.670, "atom1_id": "///B/32/O", "atom2_id": "///B/42/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3925, "atom2_serNum": 3960, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3936, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3943, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 3.691, "atom1_id": "///B/34/NH2", "atom2_id": "///B/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3947, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/35/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3947, "atom2_serNum": 3977, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3947, "atom2_serNum": 3981, "donAcc_type": "standard", "distance": 3.662, "atom1_id": "///B/35/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3955, "atom2_serNum": 3977, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/36/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3958, "atom2_serNum": 4008, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///B/36/OD1", "atom2_id": "///B/42/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3991, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/41/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3996, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 3.908, "atom1_id": "///B/41/OE2", "atom2_id": "///B/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4009, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/43/N", "atom2_id": "///B/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4012, "atom2_serNum": 4168, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/43/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4027, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/45/N", "atom2_id": "///B/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4037, "atom2_serNum": 4061, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/46/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4038, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 3.881, "atom1_id": "///B/47/N", "atom2_id": "///B/61/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4038, "atom2_serNum": 8772, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///B/47/N", "atom2_id": "///B/502/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 519, "atom1_serNum": 4041, "atom2_serNum": 4061, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///B/47/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4041, "atom2_serNum": 4072, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/47/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4041, "atom2_serNum": 4080, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///B/47/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4041, "atom2_serNum": 4085, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///B/47/O", "atom2_id": "///B/52/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4043, "atom2_serNum": 4139, "donAcc_type": "acceptable", "distance": 3.849, "atom1_id": "///B/47/OG", "atom2_id": "///B/59/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4043, "atom2_serNum": 8767, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///B/47/OG", "atom2_id": "///B/502/O1G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 525, "atom1_serNum": 4043, "atom2_serNum": 8769, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///B/47/OG", "atom2_id": "///B/502/O3G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 526, "atom1_serNum": 4047, "atom2_serNum": 4072, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/48/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4068, "atom2_serNum": 5100, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/50/NE", "atom2_id": "///B/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4070, "atom2_serNum": 4757, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///B/50/NH1", "atom2_id": "///B/134/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4071, "atom2_serNum": 5100, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/50/NH2", "atom2_id": "///B/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4071, "atom2_serNum": 8783, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///B/50/NH2", "atom2_id": "///B/502/O3'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 531, "atom1_serNum": 4075, "atom2_serNum": 4888, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/51/O", "atom2_id": "///B/149/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4083, "atom2_serNum": 4914, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/52/O", "atom2_id": "///B/152/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4090, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///B/53/O", "atom2_id": "///B/149/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4090, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///B/53/O", "atom2_id": "///B/149/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4104, "atom2_serNum": 4122, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/54/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4143, "atom2_serNum": 4498, "donAcc_type": "acceptable", "distance": 3.954, "atom1_id": "///B/59/OE1", "atom2_id": "///B/101/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4144, "atom2_serNum": 4547, "donAcc_type": "questionable", "distance": 3.104, "atom1_id": "///B/59/OE2", "atom2_id": "///B/108/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4145, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///B/60/N", "atom2_id": "///B/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4148, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/60/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4159, "atom2_serNum": 8775, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///B/61/OD1", "atom2_id": "///B/502/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 541, "atom1_serNum": 4160, "atom2_serNum": 8775, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///B/61/OD2", "atom2_id": "///B/502/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 542, "atom1_serNum": 4161, "atom2_serNum": 4559, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/62/N", "atom2_id": "///B/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4164, "atom2_serNum": 4571, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/62/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4179, "atom2_serNum": 4574, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/64/N", "atom2_id": "///B/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4182, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/64/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4195, "atom2_serNum": 4588, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/66/N", "atom2_id": "///B/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4198, "atom2_serNum": 4603, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/66/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4216, "atom2_serNum": 4678, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/68/O", "atom2_id": "///B/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4234, "atom2_serNum": 4602, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///B/70/O", "atom2_id": "///B/115/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4234, "atom2_serNum": 4678, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///B/70/O", "atom2_id": "///B/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4245, "atom2_serNum": 4275, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4245, "atom2_serNum": 4602, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///B/71/O", "atom2_id": "///B/115/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4247, "atom2_serNum": 4266, "donAcc_type": "acceptable", "distance": 2.986, "atom1_id": "///B/71/OG", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4251, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4256, "atom2_serNum": 4455, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///B/72/NZ", "atom2_id": "///B/96/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4260, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/73/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4260, "atom2_serNum": 4294, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4269, "atom2_serNum": 4303, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4278, "atom2_serNum": 4314, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4286, "atom2_serNum": 4318, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4292, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/76/NH1", "atom2_id": "///B/77/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4293, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/76/NH2", "atom2_id": "///B/77/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4297, "atom2_serNum": 4326, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4306, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4317, "atom2_serNum": 4343, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4321, "atom2_serNum": 4347, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4329, "atom2_serNum": 4356, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4338, "atom2_serNum": 4361, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4346, "atom2_serNum": 4361, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/83/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4346, "atom2_serNum": 4368, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4376, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/88/N", "atom2_id": "///B/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4376, "atom2_serNum": 4509, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/88/N", "atom2_id": "///B/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4387, "atom2_serNum": 4506, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/89/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4402, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///B/91/N", "atom2_id": "///B/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4405, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/91/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4429, "atom2_serNum": 6013, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/93/NH2", "atom2_id": "///B/287/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4442, "atom2_serNum": 8702, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/95/N", "atom2_id": "///D/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 578, "atom1_serNum": 4447, "atom2_serNum": 8702, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/96/N", "atom2_id": "///D/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 579, "atom1_serNum": 4454, "atom2_serNum": 8705, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/96/OE1", "atom2_id": "///D/33/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 580, "atom1_serNum": 4456, "atom2_serNum": 8703, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/97/N", "atom2_id": "///D/33/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 581, "atom1_serNum": 4484, "atom2_serNum": 8698, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///B/99/OH", "atom2_id": "///D/33/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 582, "atom1_serNum": 4485, "atom2_serNum": 4567, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/100/N", "atom2_id": "///B/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4488, "atom2_serNum": 4564, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/100/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4498, "atom2_serNum": 4563, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///B/101/ND1", "atom2_id": "///B/110/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4502, "atom2_serNum": 4552, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/102/N", "atom2_id": "///B/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4505, "atom2_serNum": 4549, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/102/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4513, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/104/N", "atom2_id": "///B/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4516, "atom2_serNum": 4533, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/104/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4562, "atom2_serNum": 8716, "donAcc_type": "questionable", "distance": 2.864, "atom1_id": "///B/110/OD1", "atom2_id": "///D/34/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 590, "atom1_serNum": 4591, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/115/N", "atom2_id": "///B/128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4594, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/115/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4628, "atom2_serNum": 4636, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/118/NZ", "atom2_id": "///B/119/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4632, "atom2_serNum": 4645, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/119/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4670, "atom2_serNum": 4704, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/124/N", "atom2_id": "///B/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4679, "atom2_serNum": 4704, "donAcc_type": "standard", "distance": 2.514, "atom1_id": "///B/125/N", "atom2_id": "///B/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4684, "atom2_serNum": 4690, "donAcc_type": "acceptable", "distance": 3.260, "atom1_id": "///B/125/OG", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4693, "atom2_serNum": 4716, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/127/O", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4708, "atom2_serNum": 4741, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/129/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4712, "atom2_serNum": 5472, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/129/NE", "atom2_id": "///B/221/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4719, "atom2_serNum": 4751, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///B/130/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4721, "atom2_serNum": 8722, "donAcc_type": "acceptable", "distance": 2.455, "atom1_id": "///B/130/OG1", "atom2_id": "///D/34/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 602, "atom1_serNum": 4721, "atom2_serNum": 8781, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///B/130/OG1", "atom2_id": "///B/502/O4'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 603, "atom1_serNum": 4726, "atom2_serNum": 4761, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/131/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4744, "atom2_serNum": 4770, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/133/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4744, "atom2_serNum": 4784, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/133/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4747, "atom2_serNum": 8785, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/133/ND1", "atom2_id": "///B/502/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 607, "atom1_serNum": 4750, "atom2_serNum": 5450, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/133/NE2", "atom2_id": "///B/218/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4754, "atom2_serNum": 4792, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/134/O", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4819, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///B/141/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4819, "atom2_serNum": 4837, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/141/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4819, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4833, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/143/N", "atom2_id": "///B/145/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4840, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/144/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4845, "atom2_serNum": 5158, "donAcc_type": "standard", "distance": 3.965, "atom1_id": "///B/144/NZ", "atom2_id": "///B/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4861, "atom2_serNum": 4888, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///B/146/OD1", "atom2_id": "///B/149/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4870, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///B/147/OE1", "atom2_id": "///B/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4875, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/148/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4882, "atom2_serNum": 4915, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/149/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4893, "atom2_serNum": 4919, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4901, "atom2_serNum": 4930, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4909, "atom2_serNum": 4938, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4914, "atom2_serNum": 8767, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///B/152/NZ", "atom2_id": "///B/502/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 623, "atom1_serNum": 4918, "atom2_serNum": 4947, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/153/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4922, "atom2_serNum": 4959, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/154/O", "atom2_id": "///B/158/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4933, "atom2_serNum": 4964, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/155/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4959, "atom2_serNum": 5720, "donAcc_type": "standard", "distance": 3.836, "atom1_id": "///B/158/ND2", "atom2_id": "///B/253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4967, "atom2_serNum": 5045, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/160/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4983, "atom2_serNum": 8768, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///B/161/OH", "atom2_id": "///B/502/O2G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 629, "atom1_serNum": 4984, "atom2_serNum": 5048, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/162/N", "atom2_id": "///B/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4987, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/162/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4991, "atom2_serNum": 5534, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/163/O", "atom2_id": "///B/229/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4993, "atom2_serNum": 5001, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/164/N", "atom2_id": "///B/164/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4996, "atom2_serNum": 5014, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/164/O", "atom2_id": "///B/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4996, "atom2_serNum": 5023, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///B/164/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4996, "atom2_serNum": 5030, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/164/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5002, "atom2_serNum": 8676, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///B/165/N", "atom2_id": "///D/32/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 637, "atom1_serNum": 5013, "atom2_serNum": 8660, "donAcc_type": "acceptable", "distance": 2.491, "atom1_id": "///B/165/OH", "atom2_id": "///D/31/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 638, "atom1_serNum": 5033, "atom2_serNum": 5543, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///B/168/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5033, "atom2_serNum": 5548, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///B/168/O", "atom2_id": "///B/231/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5037, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/168/NE", "atom2_id": "///B/298/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5040, "atom2_serNum": 6105, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/168/NH2", "atom2_id": "///B/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5040, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/168/NH2", "atom2_id": "///B/298/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5059, "atom2_serNum": 5086, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/171/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5065, "atom2_serNum": 5092, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/172/O", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5069, "atom2_serNum": 5101, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5077, "atom2_serNum": 5449, "donAcc_type": "acceptable", "distance": 2.867, "atom1_id": "///B/173/OH", "atom2_id": "///B/218/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5081, "atom2_serNum": 5109, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5089, "atom2_serNum": 5109, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/175/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5089, "atom2_serNum": 5117, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/175/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5095, "atom2_serNum": 5117, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/176/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5095, "atom2_serNum": 5125, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/176/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5104, "atom2_serNum": 5132, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/177/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5112, "atom2_serNum": 5143, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/178/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5120, "atom2_serNum": 5155, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///B/179/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5154, "atom2_serNum": 5259, "donAcc_type": "acceptable", "distance": 3.323, "atom1_id": "///B/182/OH", "atom2_id": "///B/195/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5162, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/184/O", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5162, "atom2_serNum": 5198, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///B/184/O", "atom2_id": "///B/188/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5164, "atom2_serNum": 5184, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///B/184/OG", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5168, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/185/O", "atom2_id": "///B/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5179, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/186/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5187, "atom2_serNum": 5216, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/187/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5187, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/187/O", "atom2_id": "///B/191/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5196, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/188/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5203, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///B/189/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5210, "atom2_serNum": 5236, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/190/O", "atom2_id": "///B/193/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5219, "atom2_serNum": 5240, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/191/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5227, "atom2_serNum": 5251, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/192/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5232, "atom2_serNum": 5646, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/193/O", "atom2_id": "///B/243/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5232, "atom2_serNum": 5649, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///B/193/O", "atom2_id": "///B/243/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5265, "atom2_serNum": 5299, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///B/196/N", "atom2_id": "///B/199/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5268, "atom2_serNum": 5294, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/196/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5268, "atom2_serNum": 5299, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///B/196/O", "atom2_id": "///B/199/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5286, "atom2_serNum": 5385, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/198/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5297, "atom2_serNum": 5418, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/199/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5301, "atom2_serNum": 5368, "donAcc_type": "standard", "distance": 2.455, "atom1_id": "///B/200/N", "atom2_id": "///B/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5304, "atom2_serNum": 5365, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/200/O", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5308, "atom2_serNum": 5421, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/201/N", "atom2_id": "///B/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5311, "atom2_serNum": 5436, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/201/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5316, "atom2_serNum": 5352, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/202/N", "atom2_id": "///B/207/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5319, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/202/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5319, "atom2_serNum": 5349, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/202/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5322, "atom2_serNum": 5336, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/202/OD1", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5356, "atom2_serNum": 5374, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/207/OE1", "atom2_id": "///B/209/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5398, "atom2_serNum": 5405, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/213/N", "atom2_id": "///B/213/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5429, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/216/N", "atom2_id": "///B/225/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5432, "atom2_serNum": 5510, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///B/216/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5443, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///B/218/N", "atom2_id": "///B/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5446, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5449, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/218/OD1", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5449, "atom2_serNum": 5458, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/218/OD1", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5468, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/221/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5471, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/221/OD1", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5500, "atom2_serNum": 8647, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///B/224/NH1", "atom2_id": "///D/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 694, "atom1_serNum": 5500, "atom2_serNum": 8649, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/224/NH1", "atom2_id": "///D/31/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 695, "atom1_serNum": 5500, "atom2_serNum": 8668, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/224/NH1", "atom2_id": "///D/32/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 696, "atom1_serNum": 5501, "atom2_serNum": 8667, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/224/NH2", "atom2_id": "///D/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 697, "atom1_serNum": 5501, "atom2_serNum": 8668, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/224/NH2", "atom2_id": "///D/32/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 698, "atom1_serNum": 5501, "atom2_serNum": 8793, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///B/224/NH2", "atom2_id": "///B/502/N1", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 699, "atom1_serNum": 5505, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/225/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5520, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/227/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5530, "atom2_serNum": 5543, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/229/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5546, "atom2_serNum": 5573, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/231/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5548, "atom2_serNum": 5571, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///B/231/OG", "atom2_id": "///B/234/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5552, "atom2_serNum": 5581, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/232/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5560, "atom2_serNum": 5586, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/233/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5568, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/234/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5576, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/235/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5576, "atom2_serNum": 5608, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/235/O", "atom2_id": "///B/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5584, "atom2_serNum": 5615, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/236/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5589, "atom2_serNum": 5625, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/237/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5600, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/238/O", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5618, "atom2_serNum": 5650, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/240/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5628, "atom2_serNum": 5659, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/241/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5636, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/242/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5642, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/243/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5653, "atom2_serNum": 5687, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/244/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5704, "atom2_serNum": 5713, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///B/250/OG", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5708, "atom2_serNum": 5728, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/251/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5708, "atom2_serNum": 5739, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///B/251/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5742, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/255/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5751, "atom2_serNum": 5770, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///B/256/O", "atom2_id": "///B/258/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5806, "atom2_serNum": 5814, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/263/N", "atom2_id": "///B/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5809, "atom2_serNum": 5842, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///B/263/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5825, "atom2_serNum": 5861, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/265/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5830, "atom2_serNum": 5860, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///B/265/OE2", "atom2_id": "///B/268/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5834, "atom2_serNum": 5861, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/266/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5834, "atom2_serNum": 5870, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/266/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5845, "atom2_serNum": 5878, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///B/267/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5853, "atom2_serNum": 5885, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/268/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5859, "atom2_serNum": 5892, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/268/NH1", "atom2_id": "///B/272/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5864, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///B/269/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5873, "atom2_serNum": 5903, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/270/O", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5881, "atom2_serNum": 5914, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/271/O", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5912, "atom2_serNum": 6401, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///B/274/NH1", "atom2_id": "///B/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5912, "atom2_serNum": 6402, "donAcc_type": "standard", "distance": 2.357, "atom1_id": "///B/274/NH1", "atom2_id": "///B/332/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5913, "atom2_serNum": 7253, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///B/274/NH2", "atom2_id": "///B/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5923, "atom2_serNum": 6402, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///B/276/OG1", "atom2_id": "///B/332/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5925, "atom2_serNum": 6406, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/277/N", "atom2_id": "///B/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5928, "atom2_serNum": 6403, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/277/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5937, "atom2_serNum": 6386, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/279/N", "atom2_id": "///B/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5940, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/279/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5948, "atom2_serNum": 7114, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/280/N", "atom2_id": "///B/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5951, "atom2_serNum": 7111, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/280/O", "atom2_id": "///B/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 5953, "atom2_serNum": 6370, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/281/N", "atom2_id": "///B/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5956, "atom2_serNum": 6367, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/281/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5960, "atom2_serNum": 7097, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/282/N", "atom2_id": "///B/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5963, "atom2_serNum": 7094, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/282/O", "atom2_id": "///B/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5968, "atom2_serNum": 7102, "donAcc_type": "standard", "distance": 3.811, "atom1_id": "///B/282/NZ", "atom2_id": "///B/413/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 5968, "atom2_serNum": 7182, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/282/NZ", "atom2_id": "///B/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 5969, "atom2_serNum": 6352, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/283/N", "atom2_id": "///B/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5972, "atom2_serNum": 6349, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/283/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 5983, "atom2_serNum": 7042, "donAcc_type": "acceptable", "distance": 2.468, "atom1_id": "///B/284/O", "atom2_id": "///B/407/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 5991, "atom2_serNum": 6332, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/285/N", "atom2_id": "///B/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6003, "atom2_serNum": 6015, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/286/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6026, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/289/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6026, "atom2_serNum": 6054, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/289/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6033, "atom2_serNum": 6054, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/290/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6033, "atom2_serNum": 6062, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/290/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6045, "atom2_serNum": 8676, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/291/OD2", "atom2_id": "///D/32/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 760, "atom1_serNum": 6049, "atom2_serNum": 8019, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///B/292/O", "atom2_id": "///D/1/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 761, "atom1_serNum": 6057, "atom2_serNum": 6081, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/293/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6057, "atom2_serNum": 6090, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/293/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6065, "atom2_serNum": 6098, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/294/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6077, "atom2_serNum": 6107, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/295/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6084, "atom2_serNum": 6118, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/296/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6088, "atom2_serNum": 7009, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///B/296/OE1", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6088, "atom2_serNum": 7017, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/296/OE1", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6089, "atom2_serNum": 7016, "donAcc_type": "questionable", "distance": 2.964, "atom1_id": "///B/296/NE2", "atom2_id": "///B/403/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6089, "atom2_serNum": 8019, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///B/296/NE2", "atom2_id": "///D/1/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 770, "atom1_serNum": 6093, "atom2_serNum": 6123, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6101, "atom2_serNum": 6129, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6110, "atom2_serNum": 6140, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/299/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6116, "atom2_serNum": 6984, "donAcc_type": "standard", "distance": 2.443, "atom1_id": "///B/299/NH1", "atom2_id": "///B/399/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6116, "atom2_serNum": 6986, "donAcc_type": "acceptable", "distance": 3.217, "atom1_id": "///B/299/NH1", "atom2_id": "///B/399/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6117, "atom2_serNum": 8799, "donAcc_type": "acceptable", "distance": 3.312, "atom1_id": "///B/299/NH2", "atom2_id": "///B/603/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 776, "atom1_serNum": 6121, "atom2_serNum": 6149, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/300/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6126, "atom2_serNum": 6157, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/301/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6128, "atom2_serNum": 6283, "donAcc_type": "acceptable", "distance": 3.362, "atom1_id": "///B/301/OG", "atom2_id": "///B/318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6132, "atom2_serNum": 6168, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/302/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6136, "atom2_serNum": 6176, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/302/NE", "atom2_id": "///B/306/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6139, "atom2_serNum": 8800, "donAcc_type": "acceptable", "distance": 2.479, "atom1_id": "///B/302/NH2", "atom2_id": "///B/603/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 782, "atom1_serNum": 6143, "atom2_serNum": 6177, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/303/O", "atom2_id": "///B/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6148, "atom2_serNum": 8463, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/303/NZ", "atom2_id": "///D/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 784, "atom1_serNum": 6148, "atom2_serNum": 8464, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/303/NZ", "atom2_id": "///D/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 785, "atom1_serNum": 6148, "atom2_serNum": 8801, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///B/303/NZ", "atom2_id": "///B/603/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 786, "atom1_serNum": 6152, "atom2_serNum": 6188, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/304/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6160, "atom2_serNum": 6196, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/305/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6171, "atom2_serNum": 6205, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/306/O", "atom2_id": "///B/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6180, "atom2_serNum": 6216, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/307/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6191, "atom2_serNum": 6216, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/308/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6191, "atom2_serNum": 6225, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/308/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6191, "atom2_serNum": 6233, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/308/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6199, "atom2_serNum": 6225, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/309/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6236, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///B/313/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6236, "atom2_serNum": 6418, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/313/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6247, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/314/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6259, "atom2_serNum": 6397, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///B/316/N", "atom2_id": "///B/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6270, "atom2_serNum": 6394, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/317/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6276, "atom2_serNum": 7236, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///B/317/NH1", "atom2_id": "///B/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6276, "atom2_serNum": 7245, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/317/NH1", "atom2_id": "///B/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6284, "atom2_serNum": 6378, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/319/N", "atom2_id": "///B/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6287, "atom2_serNum": 6375, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/319/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6300, "atom2_serNum": 6358, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/321/N", "atom2_id": "///B/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6303, "atom2_serNum": 6355, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/321/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6314, "atom2_serNum": 6341, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/323/N", "atom2_id": "///B/326/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6366, "atom2_serNum": 7182, "donAcc_type": "acceptable", "distance": 2.871, "atom1_id": "///B/328/OH", "atom2_id": "///B/423/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6444, "atom2_serNum": 6853, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/338/N", "atom2_id": "///B/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6455, "atom2_serNum": 6828, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/339/O", "atom2_id": "///B/380/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6457, "atom2_serNum": 6472, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///B/339/OG", "atom2_id": "///B/341/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6461, "atom2_serNum": 6819, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/340/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6465, "atom2_serNum": 6822, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///B/340/NE", "atom2_id": "///B/380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6476, "atom2_serNum": 6805, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/342/N", "atom2_id": "///B/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6479, "atom2_serNum": 6802, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/342/O", "atom2_id": "///B/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6496, "atom2_serNum": 6733, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/343/NH1", "atom2_id": "///B/370/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6497, "atom2_serNum": 6733, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/343/NH2", "atom2_id": "///B/370/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6497, "atom2_serNum": 6734, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/343/NH2", "atom2_id": "///B/370/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6498, "atom2_serNum": 6789, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///B/344/N", "atom2_id": "///B/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6501, "atom2_serNum": 6786, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/344/O", "atom2_id": "///B/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6517, "atom2_serNum": 6761, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/346/N", "atom2_id": "///B/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6520, "atom2_serNum": 6756, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///B/346/O", "atom2_id": "///B/373/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6524, "atom2_serNum": 6758, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///B/347/O", "atom2_id": "///B/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6531, "atom2_serNum": 6557, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/348/O", "atom2_id": "///B/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6537, "atom2_serNum": 6746, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/349/N", "atom2_id": "///B/372/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6548, "atom2_serNum": 6556, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/350/N", "atom2_id": "///B/350/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6551, "atom2_serNum": 6565, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/350/O", "atom2_id": "///B/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6560, "atom2_serNum": 6585, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///B/351/O", "atom2_id": "///B/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6560, "atom2_serNum": 6593, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/351/O", "atom2_id": "///B/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6568, "atom2_serNum": 6600, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/352/O", "atom2_id": "///B/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6588, "atom2_serNum": 6618, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/354/O", "atom2_id": "///B/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6592, "atom2_serNum": 8341, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///B/354/ND2", "atom2_id": "///D/16/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 831, "atom1_serNum": 6596, "atom2_serNum": 6629, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/355/O", "atom2_id": "///B/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6603, "atom2_serNum": 6637, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///B/356/O", "atom2_id": "///B/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6612, "atom2_serNum": 6642, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///B/357/O", "atom2_id": "///B/360/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6621, "atom2_serNum": 6671, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/358/O", "atom2_id": "///B/363/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6621, "atom2_serNum": 6672, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/358/O", "atom2_id": "///B/363/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6669, "atom2_serNum": 6809, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/363/NE", "atom2_id": "///B/378/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6672, "atom2_serNum": 8316, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///B/363/NH2", "atom2_id": "///D/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 838, "atom1_serNum": 6698, "atom2_serNum": 8803, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///B/366/NH1", "atom2_id": "///B/801/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 839, "atom1_serNum": 6707, "atom2_serNum": 6775, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/368/N", "atom2_id": "///B/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6710, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/368/O", "atom2_id": "///B/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6726, "atom2_serNum": 6750, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/370/N", "atom2_id": "///B/373/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6729, "atom2_serNum": 6747, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/370/O", "atom2_id": "///B/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6729, "atom2_serNum": 6780, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///B/370/O", "atom2_id": "///B/375/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6734, "atom2_serNum": 6742, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///B/370/OE2", "atom2_id": "///B/371/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6855, "atom2_serNum": 6888, "donAcc_type": "acceptable", "distance": 3.494, "atom1_id": "///B/383/OG1", "atom2_id": "///B/387/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6860, "atom2_serNum": 6889, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/384/O", "atom2_id": "///B/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6867, "atom2_serNum": 6893, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/385/O", "atom2_id": "///B/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6871, "atom2_serNum": 6878, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/386/N", "atom2_id": "///B/386/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6874, "atom2_serNum": 6900, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/386/O", "atom2_id": "///B/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6883, "atom2_serNum": 6911, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/387/O", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6892, "atom2_serNum": 6911, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/388/O", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6892, "atom2_serNum": 6917, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/388/O", "atom2_id": "///B/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6896, "atom2_serNum": 6929, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///B/389/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6903, "atom2_serNum": 6934, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/390/O", "atom2_id": "///B/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6903, "atom2_serNum": 6939, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///B/390/O", "atom2_id": "///B/394/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6914, "atom2_serNum": 6940, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///B/391/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6914, "atom2_serNum": 6945, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///B/391/O", "atom2_id": "///B/395/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 6920, "atom2_serNum": 6945, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///B/392/O", "atom2_id": "///B/395/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 6920, "atom2_serNum": 6947, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/392/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 6928, "atom2_serNum": 8463, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///B/392/OH", "atom2_id": "///D/22/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 861, "atom1_serNum": 6950, "atom2_serNum": 6981, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/396/O", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 6953, "atom2_serNum": 8465, "donAcc_type": "acceptable", "distance": 3.300, "atom1_id": "///B/396/ND1", "atom2_id": "///D/22/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 863, "atom1_serNum": 6960, "atom2_serNum": 6988, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/397/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 6980, "atom2_serNum": 8470, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/398/NE2", "atom2_id": "///D/22/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 865, "atom1_serNum": 6984, "atom2_serNum": 6986, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///B/399/O", "atom2_id": "///B/399/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 6999, "atom2_serNum": 7024, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/401/O", "atom2_id": "///B/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7000, "atom2_serNum": 8033, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/402/N", "atom2_id": "///D/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 868, "atom1_serNum": 7012, "atom2_serNum": 7037, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/403/O", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7015, "atom2_serNum": 7036, "donAcc_type": "questionable", "distance": 3.085, "atom1_id": "///B/403/OD1", "atom2_id": "///B/406/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7020, "atom2_serNum": 7043, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/404/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7027, "atom2_serNum": 7051, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/405/O", "atom2_id": "///B/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7031, "atom2_serNum": 7062, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/406/O", "atom2_id": "///B/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7040, "atom2_serNum": 7071, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/407/O", "atom2_id": "///B/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7040, "atom2_serNum": 7074, "donAcc_type": "questionable", "distance": 3.044, "atom1_id": "///B/407/O", "atom2_id": "///B/411/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7082, "atom2_serNum": 7101, "donAcc_type": "acceptable", "distance": 2.488, "atom1_id": "///B/411/OH", "atom2_id": "///B/413/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7122, "atom2_serNum": 7138, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///B/416/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7128, "atom2_serNum": 7147, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/417/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7150, "atom2_serNum": 7175, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/420/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7178, "atom2_serNum": 7191, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///B/423/O", "atom2_id": "///B/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7194, "atom2_serNum": 7219, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/425/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7201, "atom2_serNum": 7219, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/426/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7201, "atom2_serNum": 7227, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/426/O", "atom2_id": "///B/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7208, "atom2_serNum": 7233, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/427/O", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7213, "atom2_serNum": 7242, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/428/O", "atom2_id": "///B/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7222, "atom2_serNum": 7250, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/429/O", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7230, "atom2_serNum": 7258, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/430/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7230, "atom2_serNum": 7262, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///B/430/O", "atom2_id": "///B/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7236, "atom2_serNum": 7258, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///B/431/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7305, "atom2_serNum": 7942, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/1/O6", "atom2_id": "///C/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 890, "atom1_serNum": 7306, "atom2_serNum": 7940, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/1/N1", "atom2_id": "///C/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 891, "atom1_serNum": 7308, "atom2_serNum": 7939, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///C/1/N2", "atom2_id": "///C/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 892, "atom1_serNum": 7328, "atom2_serNum": 7922, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///C/2/O6", "atom2_id": "///C/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 893, "atom1_serNum": 7329, "atom2_serNum": 7920, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///C/2/N1", "atom2_id": "///C/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 894, "atom1_serNum": 7331, "atom2_serNum": 7919, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///C/2/N2", "atom2_id": "///C/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 895, "atom1_serNum": 7351, "atom2_serNum": 7902, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/3/N6", "atom2_id": "///C/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 896, "atom1_serNum": 7352, "atom2_serNum": 7900, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///C/3/N1", "atom2_id": "///C/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 897, "atom1_serNum": 7373, "atom2_serNum": 7882, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/4/N6", "atom2_id": "///C/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 898, "atom1_serNum": 7374, "atom2_serNum": 7880, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///C/4/N1", "atom2_id": "///C/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 899, "atom1_serNum": 7396, "atom2_serNum": 7859, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/5/N1", "atom2_id": "///C/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 900, "atom1_serNum": 7396, "atom2_serNum": 7860, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/5/N1", "atom2_id": "///C/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 901, "atom1_serNum": 7398, "atom2_serNum": 7859, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///C/5/N2", "atom2_id": "///C/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 902, "atom1_serNum": 7411, "atom2_serNum": 7427, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///C/6/O2'", "atom2_id": "///C/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 903, "atom1_serNum": 7416, "atom2_serNum": 7841, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/6/N3", "atom2_id": "///C/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 904, "atom1_serNum": 7438, "atom2_serNum": 7820, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///C/7/N6", "atom2_id": "///C/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 905, "atom1_serNum": 7439, "atom2_serNum": 7818, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/7/N1", "atom2_id": "///C/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 906, "atom1_serNum": 7460, "atom2_serNum": 7798, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///C/8/O6", "atom2_id": "///C/24/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 907, "atom1_serNum": 7461, "atom2_serNum": 7797, "donAcc_type": "standard", "distance": 2.403, "atom1_id": "///C/8/N1", "atom2_id": "///C/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 908, "atom1_serNum": 7463, "atom2_serNum": 7797, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///C/8/N2", "atom2_id": "///C/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 909, "atom1_serNum": 7476, "atom2_serNum": 7491, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///C/9/O2'", "atom2_id": "///C/10/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 910, "atom1_serNum": 7476, "atom2_serNum": 7494, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///C/9/O2'", "atom2_id": "///C/10/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 911, "atom1_serNum": 7483, "atom2_serNum": 7780, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/9/N6", "atom2_id": "///C/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 912, "atom1_serNum": 7484, "atom2_serNum": 7778, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///C/9/N1", "atom2_id": "///C/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 913, "atom1_serNum": 7503, "atom2_serNum": 7759, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///C/10/N3", "atom2_id": "///C/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 914, "atom1_serNum": 7505, "atom2_serNum": 7758, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///C/10/O4", "atom2_id": "///C/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 915, "atom1_serNum": 7525, "atom2_serNum": 7738, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/11/O6", "atom2_id": "///C/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 916, "atom1_serNum": 7526, "atom2_serNum": 7736, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///C/11/N1", "atom2_id": "///C/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 917, "atom1_serNum": 7528, "atom2_serNum": 7735, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///C/11/N2", "atom2_id": "///C/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 918, "atom1_serNum": 7548, "atom2_serNum": 7718, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/12/O6", "atom2_id": "///C/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 919, "atom1_serNum": 7549, "atom2_serNum": 7716, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/12/N1", "atom2_id": "///C/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 920, "atom1_serNum": 7551, "atom2_serNum": 7715, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///C/12/N2", "atom2_id": "///C/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 921, "atom1_serNum": 7568, "atom2_serNum": 7653, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/13/O2", "atom2_id": "///C/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 922, "atom1_serNum": 7569, "atom2_serNum": 7650, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/13/N3", "atom2_id": "///C/17/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 923, "atom1_serNum": 7584, "atom2_serNum": 7628, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///C/14/O2'", "atom2_id": "///C/16/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 924, "atom1_serNum": 7588, "atom2_serNum": 7638, "donAcc_type": "questionable", "distance": 3.314, "atom1_id": "///C/14/O2", "atom2_id": "///C/17/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 925, "atom1_serNum": 7668, "atom2_serNum": 7684, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///C/18/O2'", "atom2_id": "///C/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 926, "atom1_serNum": 7682, "atom2_serNum": 7718, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/19/OP1", "atom2_id": "///C/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 927, "atom1_serNum": 7793, "atom2_serNum": 7809, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///C/24/O2'", "atom2_id": "///C/25/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 928, "atom1_serNum": 7935, "atom2_serNum": 7951, "donAcc_type": "acceptable", "distance": 3.130, "atom1_id": "///C/31/O2'", "atom2_id": "///C/32/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 929, "atom1_serNum": 7946, "atom2_serNum": 8755, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/32/OP1", "atom2_id": "///A/501/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 930, "atom1_serNum": 7969, "atom2_serNum": 8004, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///C/33/OP2", "atom2_id": "///C/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 931, "atom1_serNum": 7969, "atom2_serNum": 8755, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///C/33/OP2", "atom2_id": "///A/501/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 932, "atom1_serNum": 7995, "atom2_serNum": 8738, "donAcc_type": "acceptable", "distance": 2.607, "atom1_id": "///C/34/O3'", "atom2_id": "///A/501/O1A", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 933, "atom1_serNum": 8026, "atom2_serNum": 8663, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/1/O6", "atom2_id": "///D/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 934, "atom1_serNum": 8027, "atom2_serNum": 8661, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///D/1/N1", "atom2_id": "///D/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 935, "atom1_serNum": 8029, "atom2_serNum": 8660, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///D/1/N2", "atom2_id": "///D/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 936, "atom1_serNum": 8050, "atom2_serNum": 8640, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/2/N1", "atom2_id": "///D/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 937, "atom1_serNum": 8050, "atom2_serNum": 8641, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///D/2/N1", "atom2_id": "///D/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 938, "atom1_serNum": 8052, "atom2_serNum": 8640, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///D/2/N2", "atom2_id": "///D/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 939, "atom1_serNum": 8072, "atom2_serNum": 8623, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///D/3/N6", "atom2_id": "///D/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 940, "atom1_serNum": 8073, "atom2_serNum": 8621, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/3/N1", "atom2_id": "///D/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 941, "atom1_serNum": 8094, "atom2_serNum": 8601, "donAcc_type": "questionable", "distance": 3.340, "atom1_id": "///D/4/N6", "atom2_id": "///D/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 942, "atom1_serNum": 8095, "atom2_serNum": 8600, "donAcc_type": "questionable", "distance": 3.071, "atom1_id": "///D/4/N1", "atom2_id": "///D/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 943, "atom1_serNum": 8095, "atom2_serNum": 8601, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///D/4/N1", "atom2_id": "///D/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 944, "atom1_serNum": 8109, "atom2_serNum": 8128, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///D/5/O2'", "atom2_id": "///D/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 945, "atom1_serNum": 8116, "atom2_serNum": 8561, "donAcc_type": "standard", "distance": 3.780, "atom1_id": "///D/5/O6", "atom2_id": "///D/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 946, "atom1_serNum": 8119, "atom2_serNum": 8580, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///D/5/N2", "atom2_id": "///D/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 947, "atom1_serNum": 8137, "atom2_serNum": 8562, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///D/6/N3", "atom2_id": "///D/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 948, "atom1_serNum": 8139, "atom2_serNum": 8561, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///D/6/O4", "atom2_id": "///D/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 949, "atom1_serNum": 8160, "atom2_serNum": 8539, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///D/7/N1", "atom2_id": "///D/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 950, "atom1_serNum": 8181, "atom2_serNum": 8519, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///D/8/O6", "atom2_id": "///D/24/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 951, "atom1_serNum": 8182, "atom2_serNum": 8518, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///D/8/N1", "atom2_id": "///D/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 952, "atom1_serNum": 8204, "atom2_serNum": 8501, "donAcc_type": "standard", "distance": 3.706, "atom1_id": "///D/9/N6", "atom2_id": "///D/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 953, "atom1_serNum": 8205, "atom2_serNum": 8499, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/9/N1", "atom2_id": "///D/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 954, "atom1_serNum": 8224, "atom2_serNum": 8480, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///D/10/N3", "atom2_id": "///D/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 955, "atom1_serNum": 8226, "atom2_serNum": 8479, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/10/O4", "atom2_id": "///D/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 956, "atom1_serNum": 8246, "atom2_serNum": 8459, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///D/11/O6", "atom2_id": "///D/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 957, "atom1_serNum": 8247, "atom2_serNum": 8457, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///D/11/N1", "atom2_id": "///D/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 958, "atom1_serNum": 8249, "atom2_serNum": 8456, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///D/11/N2", "atom2_id": "///D/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 959, "atom1_serNum": 8269, "atom2_serNum": 8439, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///D/12/O6", "atom2_id": "///D/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 960, "atom1_serNum": 8270, "atom2_serNum": 8437, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///D/12/N1", "atom2_id": "///D/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 961, "atom1_serNum": 8272, "atom2_serNum": 8436, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/12/N2", "atom2_id": "///D/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 962, "atom1_serNum": 8305, "atom2_serNum": 8349, "donAcc_type": "acceptable", "distance": 2.503, "atom1_id": "///D/14/O2'", "atom2_id": "///D/16/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 963, "atom1_serNum": 8310, "atom2_serNum": 8359, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/14/N3", "atom2_id": "///D/17/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 964, "atom1_serNum": 8404, "atom2_serNum": 8439, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///D/19/OP2", "atom2_id": "///D/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 965, "atom1_serNum": 8534, "atom2_serNum": 8550, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///D/25/O2'", "atom2_id": "///D/26/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 966, "atom1_serNum": 8636, "atom2_serNum": 8652, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///D/30/O2'", "atom2_id": "///D/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 967, "atom1_serNum": 8667, "atom2_serNum": 8792, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///D/32/OP1", "atom2_id": "///B/502/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 968, "atom1_serNum": 8690, "atom2_serNum": 8725, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///D/33/OP2", "atom2_id": "///D/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 969, "atom1_serNum": 8716, "atom2_serNum": 8775, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///D/34/O3'", "atom2_id": "///B/502/O1A", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 970, "atom1_serNum": 8732, "atom2_serNum": 8735, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///A/501/O3G", "atom2_id": "///A/501/O2B", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 971, "atom1_serNum": 8734, "atom2_serNum": 8746, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///A/501/O1B", "atom2_id": "///A/501/O3'", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 972, "atom1_serNum": 8769, "atom2_serNum": 8772, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///B/502/O3G", "atom2_id": "///B/502/O2B", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3ov7", "num_aaChains": 2, "aaChains": "A=442,B=438", "num_naChains": 2, "naChains": "C=34,D=34", "num_atoms": 8853, "num_waters": 52, "num_metals": 1, "metals_desc": "Mn=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }