{ "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 11, "nts_short": "GACCCTCCCCT", "nts_long": "c. B & i. \\-12,c. B & i. \\-11,c. B & i. \\-10,c. B & i. \\-9,c. B & i. \\-8,c. B & i. \\-7,c. B & i. \\-6,c. B & i. \\-5,c. B & i. \\-4,c. B & i. \\-3,c. B & i. \\-2" }, { "index": 2, "num_nts": 12, "nts_short": "TAGGGGAGGGTC", "nts_long": "///B/1,///B/2,///B/3,///B/4,///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12" } ], "nonStack": { "num_nts": 1, "nts_short": "a", "nts_long": "///A/6409" }, "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 23, "nts_short": "GACCCTCCCCTTAGGGGAGGGTC", "nts_long": "c. B & i. \\-12,c. B & i. \\-11,c. B & i. \\-10,c. B & i. \\-9,c. B & i. \\-8,c. B & i. \\-7,c. B & i. \\-6,c. B & i. \\-5,c. B & i. \\-4,c. B & i. \\-3,c. B & i. \\-2,///B/1,///B/2,///B/3,///B/4,///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///A/6409" } ], "dbn": { "all_chains": { "num_nts": 24, "num_chars": 25, "bseq": "GACCCTCCCCTTAGGGGAGGGTC&a", "bseqUP": "GACCCTCCCCTTAGGGGAGGGTC&A", "sstr": ".......................&.", "form": "B.B.A.BA...B.BBBBB.B..-&-" }, "chain_B": { "num_nts": 23, "num_chars": 23, "bseq": "GACCCTCCCCTTAGGGGAGGGTC", "bseqUP": "GACCCTCCCCTTAGGGGAGGGTC", "sstr": ".......................", "form": "B.B.A.BA...B.BBBBB.B..-" } }, "chains": { "chain_B": { "num_nts": 23, "bseq": "GACCCTCCCCTTAGGGGAGGGTC", "sstr": ".......................", "form": "B.B.A.BA...B.BBBBB.B..-", "helical_rise": 3.131, "helical_rise_std": 1.027, "helical_axis": [ -0.123, 0.961, 0.247 ], "point1": [ 39.713, -33.268, 27.592 ], "point2": [ 31.227, 32.998, 44.625 ], "num_chars": 67, "suite": "G!!A!!C!!C1aC1bT!!C!!C!!C!!C!!T!!T!!A!!G1[G!!G!!G!!A!!G!!G!!G!!T!!C" } }, "num_nts": 24, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": -12, "nt_name": "DG", "nt_code": "G", "nt_id": "c. B & i. \\-12", "linked_nts": [ null, "c. B & i. \\-11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -97.757, "delta": 167.715, "epsilon": 164.884, "zeta": -149.459, "epsilon_zeta": -45.656, "bb_type": "--", "chi": -78.065, "glyco_bond": "anti", "C5prime_xyz": [ -2.022, 7.103, -2.567 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.637, "Dp": 1.670, "splay_angle": 24.732, "splay_distance": 4.058, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.768, "v1": 31.623, "v2": -46.502, "v3": 46.665, "v4": -27.449, "amplitude": 48.260, "phase_angle": 195.512, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 30.426, -34.138, 27.533 ], "x_axis": [ -0.954, 0.259, 0.150 ], "y_axis": [ 0.130, -0.091, 0.987 ], "z_axis": [ 0.269, 0.962, 0.054 ], "quaternion": [ 0.044, 0.145, 0.673, 0.724 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": -11, "nt_name": "DA", "nt_code": "A", "nt_id": "c. B & i. \\-11", "linked_nts": [ "c. B & i. \\-12", "c. B & i. \\-10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 35.788, "beta": 118.138, "gamma": 13.849, "delta": 124.226, "epsilon": 171.190, "zeta": -91.061, "epsilon_zeta": -97.749, "bb_type": "BI", "chi": -96.485, "glyco_bond": "anti", "C5prime_xyz": [ -3.147, 7.833, -2.395 ], "P_xyz": [ -0.866, 9.334, -2.411 ], "form": ".", "ssZp": 2.313, "Dp": 2.289, "splay_angle": 18.085, "splay_distance": 3.271, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 173.519, "theta": -143.641, "eta_prime": -166.034, "theta_prime": -160.506, "eta_base": -120.315, "theta_base": -119.467, "v0": -30.586, "v1": 35.707, "v2": -26.480, "v3": 9.934, "v4": 12.650, "amplitude": 34.698, "phase_angle": 139.743, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ 30.550, -30.117, 28.060 ], "x_axis": [ -0.692, 0.148, 0.706 ], "y_axis": [ 0.675, -0.216, 0.706 ], "z_axis": [ 0.257, 0.965, 0.050 ], "quaternion": [ -0.188, 0.344, 0.597, 0.700 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": -10, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-10", "linked_nts": [ "c. B & i. \\-11", "c. B & i. \\-9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -65.151, "beta": -177.706, "gamma": 51.578, "delta": 128.088, "epsilon": -149.445, "zeta": -117.012, "epsilon_zeta": -32.433, "bb_type": "BI", "chi": -114.797, "glyco_bond": "anti", "C5prime_xyz": [ -3.015, 8.410, -1.827 ], "P_xyz": [ -1.120, 10.222, -1.849 ], "form": "B", "ssZp": 2.202, "Dp": 2.199, "splay_angle": 22.082, "splay_distance": 3.832, "splay_ratio": 0.192, "d22": 3.856, "d64": 3.638, "eta": 179.142, "theta": -151.156, "eta_prime": -165.084, "theta_prime": -161.856, "eta_base": -119.997, "theta_base": -107.398, "v0": -42.599, "v1": 44.287, "v2": -29.203, "v3": 5.756, "v4": 22.905, "amplitude": 44.671, "phase_angle": 130.825, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.050, "frame": { "rmsd": 0.021, "origin": [ 30.046, -26.960, 28.753 ], "x_axis": [ -0.248, -0.089, 0.965 ], "y_axis": [ 0.960, -0.158, 0.232 ], "z_axis": [ 0.132, 0.983, 0.125 ], "quaternion": [ -0.424, 0.443, 0.491, 0.619 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": -9, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-9", "linked_nts": [ "c. B & i. \\-10", "c. B & i. \\-8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -78.246, "beta": 144.319, "gamma": 73.373, "delta": 87.733, "epsilon": -171.179, "zeta": -85.314, "epsilon_zeta": -85.864, "bb_type": "BI", "chi": -153.702, "glyco_bond": "anti", "C5prime_xyz": [ -2.686, 9.039, -0.294 ], "P_xyz": [ -0.422, 10.086, -0.989 ], "form": ".", "ssZp": 3.492, "Dp": 3.491, "splay_angle": 26.055, "splay_distance": 4.282, "splay_ratio": 0.226, "d22": 4.200, "d64": 4.316, "eta": 162.578, "theta": -164.350, "eta_prime": 178.124, "theta_prime": -173.129, "eta_base": -117.655, "theta_base": -138.955, "v0": -35.897, "v1": 9.883, "v2": 18.560, "v3": -40.572, "v4": 47.230, "amplitude": 47.205, "phase_angle": 66.848, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ 30.577, -23.624, 30.563 ], "x_axis": [ 0.425, -0.199, 0.883 ], "y_axis": [ 0.887, -0.102, -0.450 ], "z_axis": [ 0.180, 0.975, 0.133 ], "quaternion": [ 0.603, -0.590, -0.291, -0.450 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": -8, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-8", "linked_nts": [ "c. B & i. \\-9", "c. B & i. \\-7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -78.415, "beta": 161.579, "gamma": 70.678, "delta": 80.451, "epsilon": -154.286, "zeta": -78.622, "epsilon_zeta": -75.664, "bb_type": "BI", "chi": -179.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.833, 8.699, 1.374 ], "P_xyz": [ 0.550, 9.369, 1.838 ], "form": "A", "ssZp": 4.124, "Dp": 4.157, "splay_angle": 17.755, "splay_distance": 2.869, "splay_ratio": 0.156, "d22": 4.767, "d64": 4.399, "eta": 172.349, "theta": -155.332, "eta_prime": 178.698, "theta_prime": -146.717, "eta_base": -136.126, "theta_base": -134.038, "v0": -17.437, "v1": -9.725, "v2": 31.457, "v3": -43.546, "v4": 37.959, "amplitude": 42.777, "phase_angle": 42.662, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.327, "filter_rmsd": 0.057, "frame": { "rmsd": 0.015, "origin": [ 30.452, -19.442, 31.472 ], "x_axis": [ 0.775, -0.371, 0.512 ], "y_axis": [ 0.459, -0.225, -0.859 ], "z_axis": [ 0.434, 0.901, -0.004 ], "quaternion": [ 0.622, -0.708, -0.031, -0.334 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": -7, "nt_name": "DT", "nt_code": "T", "nt_id": "c. B & i. \\-7", "linked_nts": [ "c. B & i. \\-8", "c. B & i. \\-6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -66.600, "beta": 179.100, "gamma": 65.085, "delta": 141.945, "epsilon": -167.361, "zeta": -111.170, "epsilon_zeta": -56.191, "bb_type": "BI", "chi": -119.121, "glyco_bond": "anti", "C5prime_xyz": [ -2.200, 8.584, -1.174 ], "P_xyz": [ 0.240, 9.381, -0.665 ], "form": ".", "ssZp": 2.131, "Dp": 2.124, "splay_angle": 16.742, "splay_distance": 2.877, "splay_ratio": 0.150, "d22": 4.272, "d64": 3.682, "eta": 170.523, "theta": -122.610, "eta_prime": -154.231, "theta_prime": -138.643, "eta_base": -135.492, "theta_base": -80.482, "v0": -25.732, "v1": 37.593, "v2": -35.041, "v3": 21.515, "v4": 2.311, "amplitude": 37.860, "phase_angle": 157.750, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.831, "filter_rmsd": 0.096, "frame": { "rmsd": 0.013, "origin": [ 30.390, -16.828, 32.655 ], "x_axis": [ 0.914, -0.396, 0.089 ], "y_axis": [ 0.179, 0.197, -0.964 ], "z_axis": [ 0.364, 0.897, 0.251 ], "quaternion": [ 0.769, -0.605, 0.089, -0.187 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": -6, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-6", "linked_nts": [ "c. B & i. \\-7", "c. B & i. \\-5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -23.399, "beta": 170.341, "gamma": 9.763, "delta": 148.623, "epsilon": -167.651, "zeta": -67.862, "epsilon_zeta": -99.788, "bb_type": "BI", "chi": -70.754, "glyco_bond": "anti", "C5prime_xyz": [ -3.106, 7.516, -2.646 ], "P_xyz": [ -1.156, 9.350, -3.160 ], "form": "B", "ssZp": 2.197, "Dp": 2.224, "splay_angle": 26.464, "splay_distance": 4.477, "splay_ratio": 0.229, "d22": 4.125, "d64": 4.006, "eta": 164.450, "theta": -141.182, "eta_prime": -164.747, "theta_prime": -179.637, "eta_base": -98.352, "theta_base": -138.565, "v0": -17.442, "v1": 36.750, "v2": -40.554, "v3": 32.404, "v4": -9.531, "amplitude": 40.749, "phase_angle": 174.391, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.058, "frame": { "rmsd": 0.015, "origin": [ 32.814, -15.365, 33.164 ], "x_axis": [ 0.871, -0.015, -0.491 ], "y_axis": [ -0.353, 0.677, -0.646 ], "z_axis": [ 0.342, 0.736, 0.584 ], "quaternion": [ 0.885, -0.390, 0.235, 0.095 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": -5, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-5", "linked_nts": [ "c. B & i. \\-6", "c. B & i. \\-4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -107.305, "beta": 21.486, "gamma": -175.717, "delta": 116.663, "epsilon": -144.713, "zeta": -44.795, "epsilon_zeta": -99.918, "bb_type": "BI", "chi": -170.668, "glyco_bond": "anti", "C5prime_xyz": [ -0.483, 7.630, 1.449 ], "P_xyz": [ -0.262, 9.693, -0.357 ], "form": "A", "ssZp": 4.005, "Dp": 4.178, "splay_angle": 19.125, "splay_distance": 3.338, "splay_ratio": 0.172, "d22": 4.274, "d64": 4.240, "eta": -163.407, "theta": 179.760, "eta_prime": 167.390, "theta_prime": -147.593, "eta_base": -143.347, "theta_base": -121.518, "v0": 37.126, "v1": -35.652, "v2": 22.643, "v3": -2.051, "v4": -21.623, "amplitude": 37.591, "phase_angle": 307.038, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.015, "origin": [ 34.373, -11.888, 35.513 ], "x_axis": [ 0.526, 0.193, -0.828 ], "y_axis": [ -0.805, 0.426, -0.412 ], "z_axis": [ 0.274, 0.884, 0.379 ], "quaternion": [ 0.763, -0.424, 0.361, 0.327 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": -4, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-4", "linked_nts": [ "c. B & i. \\-5", "c. B & i. \\-3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -70.744, "beta": -177.375, "gamma": 41.463, "delta": 139.385, "epsilon": 178.372, "zeta": -101.252, "epsilon_zeta": -80.375, "bb_type": "BI", "chi": -113.180, "glyco_bond": "anti", "C5prime_xyz": [ -2.537, 8.741, -1.243 ], "P_xyz": [ -0.286, 10.083, -0.991 ], "form": ".", "ssZp": 3.179, "Dp": 2.972, "splay_angle": 20.612, "splay_distance": 3.509, "splay_ratio": 0.185, "d22": 3.998, "d64": 3.657, "eta": 140.395, "theta": -140.193, "eta_prime": -169.870, "theta_prime": -150.143, "eta_base": -127.442, "theta_base": -104.546, "v0": -29.128, "v1": 40.845, "v2": -35.599, "v3": 19.117, "v4": 6.344, "amplitude": 40.158, "phase_angle": 152.432, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.077, "frame": { "rmsd": 0.030, "origin": [ 36.823, -9.669, 35.973 ], "x_axis": [ 0.004, 0.334, -0.943 ], "y_axis": [ -0.881, 0.447, 0.155 ], "z_axis": [ 0.473, 0.830, 0.296 ], "quaternion": [ 0.661, -0.255, 0.535, 0.460 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": -3, "nt_name": "DC", "nt_code": "C", "nt_id": "c. B & i. \\-3", "linked_nts": [ "c. B & i. \\-4", "c. B & i. \\-2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -62.643, "beta": -165.343, "gamma": 37.891, "delta": 114.481, "epsilon": -164.321, "zeta": -104.933, "epsilon_zeta": -59.388, "bb_type": "BI", "chi": -121.502, "glyco_bond": "anti", "C5prime_xyz": [ -1.903, 8.614, -1.493 ], "P_xyz": [ 0.458, 9.844, -1.232 ], "form": ".", "ssZp": 2.972, "Dp": 3.443, "splay_angle": 17.374, "splay_distance": 2.968, "splay_ratio": 0.151, "d22": 4.580, "d64": 4.334, "eta": 172.184, "theta": -161.603, "eta_prime": -177.090, "theta_prime": -161.489, "eta_base": -120.488, "theta_base": -162.961, "v0": -23.839, "v1": 18.548, "v2": -6.870, "v3": -6.656, "v4": 19.020, "amplitude": 23.158, "phase_angle": 107.258, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.059, "frame": { "rmsd": 0.011, "origin": [ 38.590, -6.829, 34.914 ], "x_axis": [ -0.644, 0.447, -0.621 ], "y_axis": [ -0.580, 0.244, 0.777 ], "z_axis": [ 0.499, 0.861, 0.102 ], "quaternion": [ 0.419, -0.050, 0.668, 0.613 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": -2, "nt_name": "DT", "nt_code": "T", "nt_id": "c. B & i. \\-2", "linked_nts": [ "c. B & i. \\-3", "///B/1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -45.982, "beta": -177.963, "gamma": 33.724, "delta": 126.966, "epsilon": -164.798, "zeta": -97.427, "epsilon_zeta": -67.370, "bb_type": "BI", "chi": -101.429, "glyco_bond": "anti", "C5prime_xyz": [ -2.587, 8.127, -2.065 ], "P_xyz": [ -0.416, 9.525, -2.474 ], "form": ".", "ssZp": 2.582, "Dp": 2.952, "splay_angle": 57.142, "splay_distance": 9.539, "splay_ratio": 0.478, "d22": 5.275, "d64": 6.038, "eta": 171.801, "theta": -144.307, "eta_prime": -174.809, "theta_prime": -135.417, "eta_base": -171.278, "theta_base": -123.341, "v0": -27.706, "v1": 29.792, "v2": -20.590, "v3": 4.904, "v4": 14.313, "amplitude": 29.943, "phase_angle": 133.445, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.030, "origin": [ 41.163, -5.378, 35.208 ], "x_axis": [ -0.734, 0.500, -0.460 ], "y_axis": [ -0.277, 0.397, 0.875 ], "z_axis": [ 0.620, 0.770, -0.153 ], "quaternion": [ 0.357, 0.074, 0.756, 0.544 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/1", "linked_nts": [ "c. B & i. \\-2", "///B/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -77.742, "beta": -139.151, "gamma": 52.756, "delta": 144.957, "epsilon": -165.071, "zeta": -89.471, "epsilon_zeta": -75.599, "bb_type": "BI", "chi": -116.358, "glyco_bond": "anti", "C5prime_xyz": [ -2.326, 8.459, -1.424 ], "P_xyz": [ -0.893, 10.017, 0.124 ], "form": "B", "ssZp": 1.384, "Dp": 1.792, "splay_angle": 21.780, "splay_distance": 3.583, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": -175.934, "theta": -116.884, "eta_prime": -160.944, "theta_prime": -124.681, "eta_base": -147.968, "theta_base": -65.804, "v0": -21.347, "v1": 36.334, "v2": -36.918, "v3": 25.597, "v4": -2.938, "amplitude": 38.113, "phase_angle": 165.613, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.019, "origin": [ 44.204, 3.644, 35.802 ], "x_axis": [ -0.870, -0.279, -0.406 ], "y_axis": [ -0.188, -0.573, 0.798 ], "z_axis": [ -0.455, 0.770, 0.446 ], "quaternion": [ -0.027, -0.253, 0.461, 0.850 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -68.418, "beta": -178.550, "gamma": 42.226, "delta": 142.901, "epsilon": -170.007, "zeta": -63.828, "epsilon_zeta": -106.179, "bb_type": "BI", "chi": -76.150, "glyco_bond": "anti", "C5prime_xyz": [ -3.277, 7.080, -2.940 ], "P_xyz": [ -1.418, 8.721, -3.789 ], "form": ".", "ssZp": 1.604, "Dp": 1.934, "splay_angle": 17.481, "splay_distance": 3.289, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 154.603, "theta": -127.206, "eta_prime": -166.382, "theta_prime": -165.217, "eta_base": -101.941, "theta_base": -138.068, "v0": -25.056, "v1": 38.734, "v2": -37.349, "v3": 23.771, "v4": 0.603, "amplitude": 39.612, "phase_angle": 160.537, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.031, "origin": [ 41.262, 4.768, 37.511 ], "x_axis": [ -0.752, -0.582, 0.310 ], "y_axis": [ 0.378, 0.005, 0.926 ], "z_axis": [ -0.540, 0.813, 0.216 ], "quaternion": [ -0.343, -0.082, 0.620, 0.701 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -97.897, "beta": 65.559, "gamma": -166.040, "delta": 89.627, "epsilon": -168.840, "zeta": -73.538, "epsilon_zeta": -95.302, "bb_type": "BI", "chi": -174.432, "glyco_bond": "anti", "C5prime_xyz": [ -2.843, 8.973, 0.229 ], "P_xyz": [ -3.304, 9.945, -2.149 ], "form": "B", "ssZp": 1.647, "Dp": 2.423, "splay_angle": 21.670, "splay_distance": 3.550, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -120.244, "theta": 128.018, "eta_prime": -147.020, "theta_prime": 168.928, "eta_base": -123.584, "theta_base": -152.642, "v0": -43.606, "v1": 25.488, "v2": 0.324, "v3": -24.754, "v4": 40.691, "amplitude": 43.716, "phase_angle": 89.575, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 38.592, 6.680, 37.681 ], "x_axis": [ -0.587, -0.573, 0.572 ], "y_axis": [ 0.552, 0.232, 0.801 ], "z_axis": [ -0.591, 0.786, 0.180 ], "quaternion": [ -0.454, -0.008, 0.640, 0.619 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -106.489, "beta": -153.331, "gamma": 71.969, "delta": 140.895, "epsilon": -169.433, "zeta": -116.060, "epsilon_zeta": -53.373, "bb_type": "BI", "chi": -100.245, "glyco_bond": "anti", "C5prime_xyz": [ -2.352, 8.036, -2.227 ], "P_xyz": [ 0.018, 9.249, -1.828 ], "form": "B", "ssZp": 1.455, "Dp": 1.612, "splay_angle": 18.713, "splay_distance": 3.307, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 157.202, "theta": -134.264, "eta_prime": -168.916, "theta_prime": -153.960, "eta_base": -133.803, "theta_base": -115.070, "v0": -22.100, "v1": 34.747, "v2": -35.418, "v3": 23.671, "v4": -1.182, "amplitude": 36.912, "phase_angle": 163.643, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.010, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 36.810, 9.662, 36.947 ], "x_axis": [ -0.203, -0.222, 0.954 ], "y_axis": [ 0.783, 0.548, 0.294 ], "z_axis": [ -0.588, 0.806, 0.062 ], "quaternion": [ 0.593, -0.216, -0.650, -0.423 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -15.117, "beta": 177.737, "gamma": -4.907, "delta": 142.615, "epsilon": 179.431, "zeta": -98.907, "epsilon_zeta": -81.662, "bb_type": "BI", "chi": -95.199, "glyco_bond": "anti", "C5prime_xyz": [ -2.115, 7.936, -2.309 ], "P_xyz": [ -0.462, 10.048, -2.140 ], "form": "B", "ssZp": 1.906, "Dp": 2.031, "splay_angle": 19.781, "splay_distance": 3.481, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 166.004, "theta": -148.459, "eta_prime": -176.314, "theta_prime": -150.655, "eta_base": -131.698, "theta_base": -108.648, "v0": -17.543, "v1": 33.277, "v2": -35.854, "v3": 26.315, "v4": -5.838, "amplitude": 36.364, "phase_angle": 170.399, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 34.421, 11.869, 37.548 ], "x_axis": [ 0.338, 0.016, 0.941 ], "y_axis": [ 0.747, 0.603, -0.279 ], "z_axis": [ -0.572, 0.797, 0.192 ], "quaternion": [ 0.730, -0.368, -0.518, -0.250 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -49.622, "beta": 171.943, "gamma": 35.189, "delta": 139.721, "epsilon": -171.219, "zeta": 179.638, "epsilon_zeta": 9.143, "bb_type": "--", "chi": -94.994, "glyco_bond": "anti", "C5prime_xyz": [ -3.453, 8.153, -1.886 ], "P_xyz": [ -1.531, 9.975, -1.992 ], "form": "B", "ssZp": 2.774, "Dp": 2.678, "splay_angle": 20.575, "splay_distance": 3.233, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 161.021, "theta": -175.963, "eta_prime": -168.528, "theta_prime": -176.316, "eta_base": -120.979, "theta_base": -138.482, "v0": -36.042, "v1": 45.618, "v2": -38.090, "v3": 19.020, "v4": 10.125, "amplitude": 44.831, "phase_angle": 148.171, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 33.046, 14.491, 39.379 ], "x_axis": [ 0.687, 0.281, 0.671 ], "y_axis": [ 0.448, 0.564, -0.694 ], "z_axis": [ -0.573, 0.777, 0.262 ], "quaternion": [ 0.792, -0.464, -0.392, -0.053 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": 15.066, "beta": 118.524, "gamma": 25.311, "delta": 151.940, "epsilon": -158.826, "zeta": -161.065, "epsilon_zeta": 2.238, "bb_type": "--", "chi": -90.426, "glyco_bond": "anti", "C5prime_xyz": [ -2.845, 8.008, -2.026 ], "P_xyz": [ -0.291, 8.680, -1.539 ], "form": "B", "ssZp": 2.212, "Dp": 2.161, "splay_angle": 24.046, "splay_distance": 4.057, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 176.055, "theta": -113.433, "eta_prime": -163.273, "theta_prime": -133.582, "eta_base": -126.509, "theta_base": -101.903, "v0": -17.317, "v1": 38.714, "v2": -43.937, "v3": 35.575, "v4": -11.668, "amplitude": 44.029, "phase_angle": 176.282, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.017, "origin": [ 31.098, 16.914, 40.264 ], "x_axis": [ 0.835, 0.516, 0.192 ], "y_axis": [ -0.053, 0.423, -0.904 ], "z_axis": [ -0.548, 0.745, 0.381 ], "quaternion": [ 0.812, -0.508, -0.228, 0.175 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 32.324, "beta": 96.971, "gamma": 6.943, "delta": 135.251, "epsilon": -177.881, "zeta": -78.075, "epsilon_zeta": -99.806, "bb_type": "BI", "chi": -74.357, "glyco_bond": "anti", "C5prime_xyz": [ -4.336, 7.428, -2.237 ], "P_xyz": [ -2.363, 9.345, -2.339 ], "form": ".", "ssZp": 2.917, "Dp": 2.800, "splay_angle": 20.271, "splay_distance": 3.470, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 153.886, "theta": -141.071, "eta_prime": -177.243, "theta_prime": -178.193, "eta_base": -134.283, "theta_base": -119.906, "v0": -28.577, "v1": 40.869, "v2": -36.917, "v3": 22.014, "v4": 3.743, "amplitude": 40.489, "phase_angle": 155.753, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 30.201, 20.636, 41.607 ], "x_axis": [ 0.748, 0.572, -0.336 ], "y_axis": [ -0.495, 0.145, -0.857 ], "z_axis": [ -0.442, 0.807, 0.392 ], "quaternion": [ 0.756, -0.550, -0.035, 0.353 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -113.941, "beta": 65.775, "gamma": 168.576, "delta": 116.658, "epsilon": -152.142, "zeta": -62.198, "epsilon_zeta": -89.945, "bb_type": "BI", "chi": -165.130, "glyco_bond": "anti", "C5prime_xyz": [ -0.773, 8.087, 1.106 ], "P_xyz": [ -0.559, 9.940, -0.883 ], "form": "B", "ssZp": 3.926, "Dp": 3.958, "splay_angle": 20.414, "splay_distance": 3.316, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -145.046, "theta": 171.788, "eta_prime": -175.698, "theta_prime": -153.258, "eta_base": -108.369, "theta_base": -121.127, "v0": 20.072, "v1": -18.427, "v2": 10.475, "v3": 0.811, "v4": -13.161, "amplitude": 20.010, "phase_angle": 301.568, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 30.478, 24.056, 42.123 ], "x_axis": [ 0.225, 0.587, -0.778 ], "y_axis": [ -0.901, -0.178, -0.395 ], "z_axis": [ -0.370, 0.790, 0.489 ], "quaternion": [ 0.620, -0.478, 0.165, 0.600 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -86.783, "beta": -169.198, "gamma": 63.010, "delta": 144.374, "epsilon": 172.369, "zeta": -126.205, "epsilon_zeta": -61.426, "bb_type": "BI", "chi": -105.865, "glyco_bond": "anti", "C5prime_xyz": [ -2.644, 8.282, -1.828 ], "P_xyz": [ -0.196, 9.275, -1.571 ], "form": ".", "ssZp": 2.479, "Dp": 2.448, "splay_angle": 24.708, "splay_distance": 3.733, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 142.270, "theta": -148.373, "eta_prime": -162.243, "theta_prime": -168.760, "eta_base": -120.588, "theta_base": -105.022, "v0": -34.836, "v1": 45.350, "v2": -38.850, "v3": 20.047, "v4": 8.935, "amplitude": 44.867, "phase_angle": 149.985, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 29.947, 27.220, 42.961 ], "x_axis": [ -0.303, 0.309, -0.902 ], "y_axis": [ -0.938, -0.262, 0.225 ], "z_axis": [ -0.167, 0.914, 0.369 ], "quaternion": [ 0.448, -0.384, 0.410, 0.695 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -33.110, "beta": 177.642, "gamma": 49.328, "delta": 130.288, "epsilon": 171.084, "zeta": -81.761, "epsilon_zeta": -107.154, "bb_type": "BI", "chi": -98.871, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 7.795, -2.409 ], "P_xyz": [ 1.249, 8.020, -2.825 ], "form": ".", "ssZp": 1.940, "Dp": 2.483, "splay_angle": 25.439, "splay_distance": 4.463, "splay_ratio": 0.221, "d22": 4.154, "d64": 4.271, "eta": -168.964, "theta": -126.303, "eta_prime": -151.156, "theta_prime": -151.134, "eta_base": -85.856, "theta_base": -141.440, "v0": -2.099, "v1": 13.929, "v2": -19.680, "v3": 18.721, "v4": -10.611, "amplitude": 20.149, "phase_angle": 192.388, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.024, "origin": [ 28.366, 30.553, 43.529 ], "x_axis": [ -0.928, 0.351, -0.122 ], "y_axis": [ -0.231, -0.288, 0.929 ], "z_axis": [ 0.291, 0.891, 0.349 ], "quaternion": [ 0.182, 0.053, 0.568, 0.801 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/12", "linked_nts": [ "///B/11", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop", "alpha": -140.836, "beta": -171.937, "gamma": 108.988, "delta": 97.457, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.543, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.960, -0.558 ], "P_xyz": [ -0.215, 10.166, -1.293 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -30.864, "v1": 15.252, "v2": 4.840, "v3": -22.562, "v4": 32.837, "amplitude": 33.337, "phase_angle": 81.651, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ 30.295, 34.388, 44.751 ], "x_axis": [ -0.995, -0.088, -0.041 ], "y_axis": [ 0.008, -0.494, 0.870 ], "z_axis": [ -0.096, 0.865, 0.492 ], "quaternion": [ -0.028, -0.040, 0.502, 0.863 ] } }, { "index": 24, "index_chain": 1, "chain_name": "A", "nt_resnum": 6409, "nt_name": "PUY", "nt_code": "a", "is_modified": true, "nt_id": "///A/6409", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": 169.632, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 156.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.580, 7.429, 2.779 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -7.553, "v1": 20.531, "v2": -24.939, "v3": 21.213, "v4": -8.836, "amplitude": 24.947, "phase_angle": 181.466, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.087, "frame": { "rmsd": 0.073, "origin": [ 57.277, 27.050, 72.577 ], "x_axis": [ -0.937, -0.044, 0.347 ], "y_axis": [ -0.298, -0.419, -0.858 ], "z_axis": [ 0.183, -0.907, 0.379 ], "quaternion": [ 0.077, 0.160, -0.534, 0.827 ] } } ], "num_hbonds": 263, "hbonds": [ { "index": 1, "atom1_serNum": 37, "atom2_serNum": 351, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/6/N", "atom2_id": "///A/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 40, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/6/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 48, "atom2_serNum": 373, "donAcc_type": "acceptable", "distance": 2.986, "atom1_id": "///A/6/OH", "atom2_id": "///A/47/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 49, "atom2_serNum": 75, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/7/N", "atom2_id": "///A/10/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 52, "atom2_serNum": 67, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/7/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 52, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 54, "atom2_serNum": 75, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///A/7/OG", "atom2_id": "///A/10/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 54, "atom2_serNum": 2257, "donAcc_type": "acceptable", "distance": 2.775, "atom1_id": "///A/7/OG", "atom2_id": "c. B & i. \\-9 & n. OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 9, "atom1_serNum": 55, "atom2_serNum": 328, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///A/8/N", "atom2_id": "///A/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 58, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/8/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 58, "atom2_serNum": 83, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 63, "atom2_serNum": 2257, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/9/N", "atom2_id": "c. B & i. \\-9 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 13, "atom1_serNum": 66, "atom2_serNum": 89, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 70, "atom2_serNum": 94, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 79, "atom2_serNum": 102, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 86, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 86, "atom2_serNum": 115, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/12/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 88, "atom2_serNum": 118, "donAcc_type": "acceptable", "distance": 2.405, "atom1_id": "///A/12/OG", "atom2_id": "///A/17/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 105, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/15/O", "atom2_id": "///A/57/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 125, "atom2_serNum": 146, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 127, "atom2_serNum": 141, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///A/18/OG", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 131, "atom2_serNum": 154, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 139, "atom2_serNum": 165, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 144, "atom2_serNum": 177, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 149, "atom2_serNum": 189, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 157, "atom2_serNum": 197, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 161, "atom2_serNum": 2277, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/23/NE", "atom2_id": "c. B & i. \\-8 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 28, "atom1_serNum": 164, "atom2_serNum": 2277, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/23/NH2", "atom2_id": "c. B & i. \\-8 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 29, "atom1_serNum": 168, "atom2_serNum": 202, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 180, "atom2_serNum": 218, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/25/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 180, "atom2_serNum": 226, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/25/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 189, "atom2_serNum": 229, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/26/N", "atom2_id": "///A/31/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 192, "atom2_serNum": 210, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/26/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 192, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/26/O", "atom2_id": "///A/32/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 195, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/26/OD1", "atom2_id": "///A/43/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 196, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/26/OD2", "atom2_id": "///A/32/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 205, "atom2_serNum": 560, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/28/O", "atom2_id": "///A/70/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 216, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/29/OD1", "atom2_id": "///A/32/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 221, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/30/O", "atom2_id": "///A/73/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 240, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/32/O", "atom2_id": "///A/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 253, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/34/N", "atom2_id": "///A/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 253, "atom2_serNum": 388, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/34/N", "atom2_id": "///A/49/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 258, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/35/N", "atom2_id": "///A/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 261, "atom2_serNum": 336, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/35/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 277, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/37/N", "atom2_id": "///A/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 280, "atom2_serNum": 307, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 284, "atom2_serNum": 285, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/37/OD2", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 284, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/37/OD2", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 324, "atom2_serNum": 2250, "donAcc_type": "acceptable", "distance": 3.103, "atom1_id": "///A/42/OH", "atom2_id": "c. B & i. \\-10 & n. O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 50, "atom1_serNum": 325, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/43/N", "atom2_id": "c. B & i. \\-8 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 51, "atom1_serNum": 335, "atom2_serNum": 2296, "donAcc_type": "standard", "distance": 2.359, "atom1_id": "///A/43/NH2", "atom2_id": "c. B & i. \\-7 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 360, "atom2_serNum": 388, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/46/N", "atom2_id": "///A/49/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 378, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/48/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 393, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/50/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 401, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/51/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 409, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 419, "atom2_serNum": 448, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 427, "atom2_serNum": 457, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 435, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 443, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 451, "atom2_serNum": 480, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 460, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 466, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 466, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/59/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 474, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/60/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 514, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/65/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 514, "atom2_serNum": 544, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 521, "atom2_serNum": 544, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/66/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 521, "atom2_serNum": 552, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 529, "atom2_serNum": 561, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 534, "atom2_serNum": 560, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///A/67/OE2", "atom2_id": "///A/70/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 538, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 547, "atom2_serNum": 571, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 599, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/76/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 599, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 604, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 612, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 617, "atom2_serNum": 643, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 622, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 630, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/81/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 630, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 641, "atom2_serNum": 673, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 646, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 657, "atom2_serNum": 691, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 669, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 676, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 676, "atom2_serNum": 711, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 680, "atom2_serNum": 707, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///A/86/OE1", "atom2_id": "///A/89/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 681, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/86/OE2", "atom2_id": "///A/89/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 681, "atom2_serNum": 719, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/86/OE2", "atom2_id": "///A/90/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 685, "atom2_serNum": 711, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/87/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 685, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 694, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 703, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 714, "atom2_serNum": 738, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 723, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 731, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 736, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 741, "atom2_serNum": 774, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 750, "atom2_serNum": 774, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/95/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 750, "atom2_serNum": 782, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 755, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/96/N", "atom2_id": "///A/96/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 758, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 766, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 777, "atom2_serNum": 801, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 785, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 791, "atom2_serNum": 815, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 796, "atom2_serNum": 822, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 804, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 813, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 818, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/104/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 818, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 825, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 833, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 839, "atom2_serNum": 865, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 847, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 854, "atom2_serNum": 884, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 863, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 868, "atom2_serNum": 900, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 875, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 3.889, "atom1_id": "///A/111/NH2", "atom2_id": "///A/194/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 879, "atom2_serNum": 909, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 887, "atom2_serNum": 909, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/113/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 887, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 899, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/114/NH2", "atom2_id": "///A/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 899, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/114/NH2", "atom2_id": "///A/271/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 903, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/115/O", "atom2_id": "///A/269/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 958, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/122/N", "atom2_id": "///A/221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 961, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/122/O", "atom2_id": "///A/235/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 978, "atom2_serNum": 1716, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/125/N", "atom2_id": "///A/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 981, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/125/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 990, "atom2_serNum": 1699, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/127/N", "atom2_id": "///A/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 993, "atom2_serNum": 1696, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/127/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1006, "atom2_serNum": 1684, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/129/N", "atom2_id": "///A/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1009, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/129/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1014, "atom2_serNum": 2163, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/129/OE2", "atom2_id": "///A/273/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1033, "atom2_serNum": 1660, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/132/N", "atom2_id": "///A/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1036, "atom2_serNum": 1657, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/132/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1044, "atom2_serNum": 1524, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/133/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1050, "atom2_serNum": 1552, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/133/NH1", "atom2_id": "///A/197/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1051, "atom2_serNum": 1542, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/133/NH2", "atom2_id": "///A/196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1051, "atom2_serNum": 1552, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///A/133/NH2", "atom2_id": "///A/197/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1052, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///A/134/N", "atom2_id": "///A/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1055, "atom2_serNum": 1643, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/134/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1060, "atom2_serNum": 1513, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/135/N", "atom2_id": "///A/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1063, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/135/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1068, "atom2_serNum": 1629, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/136/N", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1071, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/136/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1076, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/136/NE2", "atom2_id": "///A/208/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1077, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/137/N", "atom2_id": "///A/190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1080, "atom2_serNum": 1491, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/137/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1082, "atom2_serNum": 1613, "donAcc_type": "acceptable", "distance": 3.198, "atom1_id": "///A/137/OG1", "atom2_id": "///A/206/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1093, "atom2_serNum": 1473, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/139/N", "atom2_id": "///A/188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1096, "atom2_serNum": 1107, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/139/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1106, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///A/141/O", "atom2_id": "///A/146/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1110, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/142/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1115, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/143/N", "atom2_id": "///A/146/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1118, "atom2_serNum": 1143, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1122, "atom2_serNum": 2697, "donAcc_type": "acceptable", "distance": 3.550, "atom1_id": "///A/144/O", "atom2_id": "///A/6409/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 159, "atom1_serNum": 1135, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/146/N", "atom2_id": "///A/146/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1150, "atom2_serNum": 1176, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///A/148/N", "atom2_id": "///A/151/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1153, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/148/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1153, "atom2_serNum": 1176, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///A/148/O", "atom2_id": "///A/151/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1161, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/149/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1169, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/150/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1180, "atom2_serNum": 1212, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1188, "atom2_serNum": 1336, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///A/152/OH", "atom2_id": "///A/171/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1188, "atom2_serNum": 2666, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///A/152/OH", "atom2_id": "///A/6409/N", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 168, "atom1_serNum": 1192, "atom2_serNum": 1221, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1194, "atom2_serNum": 1229, "donAcc_type": "acceptable", "distance": 3.487, "atom1_id": "///A/153/OG", "atom2_id": "///A/157/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1198, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1203, "atom2_serNum": 1601, "donAcc_type": "acceptable", "distance": 3.372, "atom1_id": "///A/154/NZ", "atom2_id": "///A/204/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1203, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/154/NZ", "atom2_id": "///A/206/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1207, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/155/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1207, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1215, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1220, "atom2_serNum": 1257, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/156/NZ", "atom2_id": "///A/160/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1224, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1233, "atom2_serNum": 1263, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///A/158/O", "atom2_id": "///A/161/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1233, "atom2_serNum": 1264, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1244, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1252, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1257, "atom2_serNum": 1297, "donAcc_type": "acceptable", "distance": 3.483, "atom1_id": "///A/160/OE2", "atom2_id": "///A/166/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1275, "atom2_serNum": 1544, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///A/163/OD1", "atom2_id": "///A/196/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1276, "atom2_serNum": 1531, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/163/OD2", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1302, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 2.247, "atom1_id": "///A/167/O", "atom2_id": "///A/167/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1310, "atom2_serNum": 2061, "donAcc_type": "acceptable", "distance": 3.648, "atom1_id": "///A/168/O", "atom2_id": "///A/260/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1313, "atom2_serNum": 1315, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/168/OD1", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1321, "atom2_serNum": 2012, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/170/N", "atom2_id": "///A/255/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1324, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/170/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1333, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/171/N", "atom2_id": "///A/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1336, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/171/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1337, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/172/N", "atom2_id": "///A/253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1340, "atom2_serNum": 1992, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/172/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1342, "atom2_serNum": 1484, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/173/N", "atom2_id": "///A/189/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1345, "atom2_serNum": 1470, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/173/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1347, "atom2_serNum": 1481, "donAcc_type": "acceptable", "distance": 3.495, "atom1_id": "///A/173/OG1", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1347, "atom2_serNum": 1972, "donAcc_type": "acceptable", "distance": 2.949, "atom1_id": "///A/173/OG1", "atom2_id": "///A/250/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1349, "atom2_serNum": 1976, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/174/N", "atom2_id": "///A/251/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1352, "atom2_serNum": 1973, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/174/O", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1363, "atom2_serNum": 1404, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///A/175/O", "atom2_id": "///A/179/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1365, "atom2_serNum": 1384, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///A/175/OG", "atom2_id": "///A/177/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1380, "atom2_serNum": 1393, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/177/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1405, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/180/N", "atom2_id": "///A/184/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1410, "atom2_serNum": 1442, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///A/180/OG1", "atom2_id": "///A/184/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1415, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/181/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1417, "atom2_serNum": 1426, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///A/181/OG", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1421, "atom2_serNum": 1443, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/182/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1469, "atom2_serNum": 1806, "donAcc_type": "acceptable", "distance": 3.492, "atom1_id": "///A/187/OH", "atom2_id": "///A/229/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1469, "atom2_serNum": 2675, "donAcc_type": "acceptable", "distance": 2.365, "atom1_id": "///A/187/OH", "atom2_id": "///A/6409/O", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 210, "atom1_serNum": 1479, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 2.260, "atom1_id": "///A/188/NH1", "atom2_id": "///A/250/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1479, "atom2_serNum": 1972, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/188/NH1", "atom2_id": "///A/250/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1566, "atom2_serNum": 1568, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/199/OE1", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1599, "atom2_serNum": 1618, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/204/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1601, "atom2_serNum": 1617, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///A/204/OG1", "atom2_id": "///A/206/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1610, "atom2_serNum": 1617, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/206/N", "atom2_id": "///A/206/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1668, "atom2_serNum": 1707, "donAcc_type": "acceptable", "distance": 2.640, "atom1_id": "///A/213/O", "atom2_id": "///A/217/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1688, "atom2_serNum": 2183, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/216/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1708, "atom2_serNum": 2167, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/218/N", "atom2_id": "///A/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1711, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/218/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1719, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/220/N", "atom2_id": "///A/272/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1722, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/220/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1732, "atom2_serNum": 2134, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/222/N", "atom2_id": "///A/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1735, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/222/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1750, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/223/OD1", "atom2_id": "///A/269/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1750, "atom2_serNum": 2130, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/223/OD1", "atom2_id": "///A/269/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1752, "atom2_serNum": 2111, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/224/N", "atom2_id": "///A/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1766, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/225/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1766, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1768, "atom2_serNum": 1791, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///A/225/OG", "atom2_id": "///A/228/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1779, "atom2_serNum": 1818, "donAcc_type": "standard", "distance": 3.934, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1788, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1798, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1806, "atom2_serNum": 1999, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///A/229/OH", "atom2_id": "///A/253/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1810, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1821, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1829, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1832, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/232/OD1", "atom2_id": "///A/235/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1837, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/233/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1837, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1845, "atom2_serNum": 1876, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1854, "atom2_serNum": 1881, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1863, "atom2_serNum": 1893, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1871, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1879, "atom2_serNum": 1906, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1884, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1896, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1896, "atom2_serNum": 1930, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/240/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1904, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/241/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1941, "atom2_serNum": 2191, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/246/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1952, "atom2_serNum": 2175, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/248/N", "atom2_id": "///A/275/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1964, "atom2_serNum": 1968, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///A/249/OG", "atom2_id": "///A/250/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1964, "atom2_serNum": 2172, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///A/249/OG", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1980, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/252/N", "atom2_id": "///A/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1983, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/252/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2001, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/254/N", "atom2_id": "///A/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2004, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/254/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2017, "atom2_serNum": 2123, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/256/N", "atom2_id": "///A/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2020, "atom2_serNum": 2120, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///A/256/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2032, "atom2_serNum": 2102, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/258/N", "atom2_id": "///A/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2046, "atom2_serNum": 2062, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/259/ND1", "atom2_id": "///A/261/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2049, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/259/NE2", "atom2_id": "///A/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2067, "atom2_serNum": 2075, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///A/261/OG", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2675, "atom2_serNum": 2697, "donAcc_type": "acceptable", "distance": 2.451, "atom1_id": "///A/6409/O", "atom2_id": "///A/6409/O2'", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3q3d", "num_aaChains": 1, "aaChains": "A=277", "num_naChains": 1, "naChains": "B=23", "num_atoms": 2725, "num_waters": 28, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 9, "auxfiles": [ { "index": 1, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 2, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 3, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 4, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 5, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 6, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 7, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 8, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 9, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }