{ "num_pairs": 26, "pairs": [ { "index": 1, "nt1": "///C/4", "nt2": "///D/30", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.747, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 35.771, "chi2": -140.599, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 78.842, "C1C1_dist": 11.312, "N1N9_dist": 9.826, "C6C8_dist": 10.908, "CNNC_torsion": -21.886, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*N1[3.34]", "interBase_angle": 20.450, "planarity": 0.270, "simple_Shear": -3.740, "simple_Stretch": 1.712, "simple_Buckle": -8.464, "simple_Propeller": -18.616, "bp_simpleParams": [ -3.740, 1.712, -0.208, -8.464, -18.616, 10.793 ], "bp_params": [ -4.110, 0.153, -0.208, -0.653, -20.440, 10.966 ], "frame": { "rmsd": null, "origin": [ 30.572, 74.589, 88.119 ], "x_axis": [ 0.473, 0.691, -0.547 ], "y_axis": [ 0.767, -0.628, -0.131 ], "z_axis": [ -0.434, -0.357, -0.827 ], "quaternion": [ 0.066, 0.856, 0.426, -0.287 ] } }, { "index": 2, "nt1": "///C/6", "nt2": "///D/27", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "--", "DSSR": "--", "intra_chain": false, "chi1": 37.578, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 6.643, "chi2": -120.808, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.854, "C1C1_dist": 14.197, "N1N9_dist": 11.400, "C6C8_dist": 10.550, "CNNC_torsion": -83.319, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.40]", "interBase_angle": 49.692, "planarity": 0.571, "simple_Shear": -4.318, "simple_Stretch": 2.522, "simple_Buckle": 41.176, "simple_Propeller": -27.817, "bp_simpleParams": [ -4.318, 2.522, 1.738, 41.176, -27.817, 165.486 ], "bp_params": [ -0.096, -5.000, 1.738, 3.610, 49.560, 166.803 ], "frame": { "rmsd": null, "origin": [ 25.989, 68.711, 82.539 ], "x_axis": [ 0.946, 0.080, -0.313 ], "y_axis": [ -0.258, 0.770, -0.584 ], "z_axis": [ 0.194, 0.634, 0.749 ], "quaternion": [ 0.931, -0.327, 0.136, 0.091 ] } }, { "index": 3, "nt1": "///C/6", "nt2": "///D/28", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM+.", "intra_chain": false, "chi1": 37.578, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 21.997, "chi2": -88.795, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 12.533, "C1C1_dist": 11.567, "N1N9_dist": 8.747, "C6C8_dist": 7.587, "CNNC_torsion": -56.601, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.68]", "interBase_angle": 28.137, "planarity": 0.582, "simple_Shear": -5.810, "simple_Stretch": -0.033, "simple_Buckle": 19.984, "simple_Propeller": -19.808, "bp_simpleParams": [ -5.810, -0.033, -1.712, 19.984, -19.808, 153.872 ], "bp_params": [ 3.634, -4.534, -1.712, 3.117, 27.964, 154.612 ], "frame": { "rmsd": null, "origin": [ 24.741, 69.567, 85.012 ], "x_axis": [ 0.863, 0.044, -0.504 ], "y_axis": [ -0.340, 0.788, -0.513 ], "z_axis": [ 0.375, 0.614, 0.695 ], "quaternion": [ 0.915, -0.308, 0.240, 0.105 ] } }, { "index": 4, "nt1": "///C/9", "nt2": "///D/25", "bp": "A-T", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": false, "chi1": -92.406, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 10.890, "chi2": -86.381, "conf2": "anti", "pucker2": "----", "lambda2": 81.808, "C1C1_dist": 8.853, "N1N9_dist": 7.325, "C6C8_dist": 7.649, "CNNC_torsion": -111.913, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4'[2.87],N6(amino)-O2(carbonyl)[2.66]", "interBase_angle": 9.302, "planarity": 0.320, "simple_Shear": -7.241, "simple_Stretch": 0.900, "simple_Buckle": -9.292, "simple_Propeller": -0.433, "bp_simpleParams": [ -7.241, 0.900, 1.396, -9.292, -0.433, -21.932 ], "bp_params": [ -5.557, -4.728, 1.396, -5.962, -7.140, -21.945 ], "frame": { "rmsd": null, "origin": [ 28.202, 66.176, 75.409 ], "x_axis": [ 0.170, -0.798, 0.579 ], "y_axis": [ -0.982, -0.092, 0.162 ], "z_axis": [ -0.076, -0.596, -0.799 ], "quaternion": [ 0.264, 0.718, -0.620, 0.175 ] } }, { "index": 5, "nt1": "///C/10", "nt2": "///D/24", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW+M", "intra_chain": false, "chi1": -107.588, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 17.490, "chi2": 43.524, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 57.980, "C1C1_dist": 10.643, "N1N9_dist": 8.456, "C6C8_dist": 6.763, "CNNC_torsion": 2.054, "hbonds_num": 1, "hbonds_desc": "N4(amino)-N7[2.80]", "interBase_angle": 8.387, "planarity": 0.086, "simple_Shear": -7.337, "simple_Stretch": 3.624, "simple_Buckle": 4.742, "simple_Propeller": -6.917, "bp_simpleParams": [ -7.337, 3.624, 0.030, 4.742, -6.917, -106.166 ], "bp_params": [ -5.356, 6.187, 0.030, 1.685, -8.216, -106.302 ], "frame": { "rmsd": null, "origin": [ 28.932, 63.020, 73.955 ], "x_axis": [ -0.974, -0.032, 0.226 ], "y_axis": [ -0.188, 0.672, -0.716 ], "z_axis": [ -0.128, -0.740, -0.661 ], "quaternion": [ -0.097, -0.061, 0.909, -0.400 ] } }, { "index": 6, "nt1": "///C/11", "nt2": "///D/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.920, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.575, "chi2": -173.507, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.822, "C1C1_dist": 11.624, "N1N9_dist": 9.772, "C6C8_dist": 10.643, "CNNC_torsion": -23.172, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.52],N3-N1(imino)[3.71],N4(amino)-O6(carbonyl)[3.85]", "interBase_angle": 22.480, "planarity": 0.339, "simple_Shear": 0.196, "simple_Stretch": 0.670, "simple_Buckle": 14.381, "simple_Propeller": -17.278, "bp_simpleParams": [ 0.196, 0.670, 0.621, 14.381, -17.278, -1.441 ], "bp_params": [ 0.199, 0.668, 0.621, 14.267, -17.372, -1.447 ], "frame": { "rmsd": null, "origin": [ 27.402, 61.528, 70.980 ], "x_axis": [ -0.957, 0.207, 0.205 ], "y_axis": [ -0.007, 0.689, -0.725 ], "z_axis": [ -0.291, -0.695, -0.658 ], "quaternion": [ -0.136, 0.055, 0.909, -0.391 ] } }, { "index": 7, "nt1": "///C/12", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.423, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.447, "chi2": -134.031, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.322, "C1C1_dist": 11.290, "N1N9_dist": 9.285, "C6C8_dist": 9.971, "CNNC_torsion": -4.505, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[3.16]", "interBase_angle": 9.551, "planarity": 0.110, "simple_Shear": -0.256, "simple_Stretch": 0.067, "simple_Buckle": 7.032, "simple_Propeller": -6.462, "bp_simpleParams": [ -0.256, 0.067, 0.252, 7.032, -6.462, -11.381 ], "bp_params": [ -0.258, 0.061, 0.252, 7.188, -6.289, -11.376 ], "frame": { "rmsd": null, "origin": [ 26.547, 58.600, 69.536 ], "x_axis": [ -0.731, 0.633, -0.255 ], "y_axis": [ 0.582, 0.383, -0.718 ], "z_axis": [ -0.357, -0.673, -0.648 ], "quaternion": [ -0.031, 0.365, 0.831, -0.418 ] } }, { "index": 8, "nt1": "///C/13", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -75.874, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 41.375, "chi2": -113.077, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.994, "C1C1_dist": 11.505, "N1N9_dist": 9.432, "C6C8_dist": 10.008, "CNNC_torsion": -15.790, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.45],N3-N1(imino)[3.09],N4(amino)-O6(carbonyl)[2.64]", "interBase_angle": 14.153, "planarity": 0.197, "simple_Shear": -0.725, "simple_Stretch": 0.094, "simple_Buckle": 8.471, "simple_Propeller": -11.337, "bp_simpleParams": [ -0.725, 0.094, 0.154, 8.471, -11.337, -14.234 ], "bp_params": [ -0.730, 0.035, 0.154, 9.354, -10.621, -14.248 ], "frame": { "rmsd": null, "origin": [ 24.719, 55.997, 67.915 ], "x_axis": [ -0.430, 0.735, -0.524 ], "y_axis": [ 0.842, 0.116, -0.528 ], "z_axis": [ -0.327, -0.668, -0.668 ], "quaternion": [ 0.066, 0.530, 0.744, -0.402 ] } }, { "index": 9, "nt1": "///C/14", "nt2": "///D/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.968, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.434, "chi2": -107.782, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.493, "C1C1_dist": 10.463, "N1N9_dist": 8.598, "C6C8_dist": 9.497, "CNNC_torsion": -15.502, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.65],N1-N3(imino)[2.49]", "interBase_angle": 15.461, "planarity": 0.184, "simple_Shear": 0.264, "simple_Stretch": -0.427, "simple_Buckle": 10.338, "simple_Propeller": -11.497, "bp_simpleParams": [ 0.264, -0.427, 0.415, 10.338, -11.497, -1.092 ], "bp_params": [ 0.253, -0.434, 0.415, 10.027, -11.769, -1.093 ], "frame": { "rmsd": null, "origin": [ 25.441, 53.576, 64.815 ], "x_axis": [ 0.335, 0.523, -0.784 ], "y_axis": [ 0.884, -0.461, 0.071 ], "z_axis": [ -0.324, -0.717, -0.617 ], "quaternion": [ 0.253, 0.777, 0.453, -0.357 ] } }, { "index": 10, "nt1": "///C/15", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.704, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.164, "chi2": -107.082, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.861, "C1C1_dist": 10.629, "N1N9_dist": 8.812, "C6C8_dist": 9.647, "CNNC_torsion": -17.077, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.55],N3-N1(imino)[2.61],N4(amino)-O6(carbonyl)[2.72]", "interBase_angle": 15.095, "planarity": 0.205, "simple_Shear": 0.024, "simple_Stretch": -0.332, "simple_Buckle": 12.709, "simple_Propeller": -8.146, "bp_simpleParams": [ 0.024, -0.332, -0.010, 12.709, -8.146, -1.300 ], "bp_params": [ 0.027, -0.331, -0.010, 12.785, -8.026, -1.295 ], "frame": { "rmsd": null, "origin": [ 24.560, 51.520, 62.288 ], "x_axis": [ 0.662, 0.250, -0.706 ], "y_axis": [ 0.634, -0.689, 0.351 ], "z_axis": [ -0.399, -0.680, -0.615 ], "quaternion": [ 0.299, 0.861, 0.257, -0.321 ] } }, { "index": 11, "nt1": "///C/16", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.554, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.040, "chi2": -111.741, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.311, "C1C1_dist": 10.491, "N1N9_dist": 8.772, "C6C8_dist": 9.690, "CNNC_torsion": -19.079, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.73]", "interBase_angle": 12.894, "planarity": 0.175, "simple_Shear": 0.074, "simple_Stretch": -0.248, "simple_Buckle": 8.899, "simple_Propeller": -9.331, "bp_simpleParams": [ 0.074, -0.248, 0.404, 8.899, -9.331, -1.312 ], "bp_params": [ 0.072, -0.248, 0.404, 8.815, -9.411, -1.312 ], "frame": { "rmsd": null, "origin": [ 23.508, 48.492, 60.789 ], "x_axis": [ 0.904, -0.326, -0.275 ], "y_axis": [ 0.008, -0.632, 0.775 ], "z_axis": [ -0.427, -0.703, -0.569 ], "quaternion": [ 0.419, 0.881, -0.090, -0.199 ] } }, { "index": 12, "nt1": "///C/17", "nt2": "///D/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.729, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.140, "chi2": -123.317, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.510, "C1C1_dist": 10.386, "N1N9_dist": 8.689, "C6C8_dist": 9.687, "CNNC_torsion": -16.415, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.76]", "interBase_angle": 15.280, "planarity": 0.186, "simple_Shear": -0.085, "simple_Stretch": -0.175, "simple_Buckle": 14.508, "simple_Propeller": -4.796, "bp_simpleParams": [ -0.085, -0.175, 0.470, 14.508, -4.796, 3.205 ], "bp_params": [ -0.084, -0.176, 0.470, 14.549, -4.667, 3.182 ], "frame": { "rmsd": null, "origin": [ 22.280, 46.413, 58.853 ], "x_axis": [ 0.701, -0.672, 0.238 ], "y_axis": [ -0.535, -0.274, 0.799 ], "z_axis": [ -0.472, -0.688, -0.552 ], "quaternion": [ 0.468, 0.795, -0.380, -0.074 ] } }, { "index": 13, "nt1": "///C/18", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.025, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.856, "chi2": -109.617, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.080, "C1C1_dist": 10.728, "N1N9_dist": 8.912, "C6C8_dist": 9.799, "CNNC_torsion": 3.249, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.80],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 9.448, "planarity": 0.119, "simple_Shear": -0.237, "simple_Stretch": -0.182, "simple_Buckle": 8.278, "simple_Propeller": -4.554, "bp_simpleParams": [ -0.237, -0.182, 0.090, 8.278, -4.554, 0.038 ], "bp_params": [ -0.231, -0.189, 0.090, 8.411, -4.304, 0.037 ], "frame": { "rmsd": null, "origin": [ 21.684, 43.728, 56.229 ], "x_axis": [ 0.329, -0.751, 0.572 ], "y_axis": [ -0.817, 0.077, 0.571 ], "z_axis": [ -0.473, -0.655, -0.589 ], "quaternion": [ 0.452, 0.679, -0.578, 0.037 ] } }, { "index": 14, "nt1": "///C/19", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.105, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.515, "chi2": -119.375, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.139, "C1C1_dist": 10.524, "N1N9_dist": 8.757, "C6C8_dist": 9.686, "CNNC_torsion": -4.475, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.77],N1-N3(imino)[2.67]", "interBase_angle": 7.062, "planarity": 0.098, "simple_Shear": 0.073, "simple_Stretch": -0.275, "simple_Buckle": -4.486, "simple_Propeller": -5.453, "bp_simpleParams": [ 0.073, -0.275, -0.081, -4.486, -5.453, -1.072 ], "bp_params": [ 0.069, -0.276, -0.081, -4.565, -5.388, -1.072 ], "frame": { "rmsd": null, "origin": [ 20.648, 41.104, 53.651 ], "x_axis": [ -0.361, -0.592, 0.720 ], "y_axis": [ -0.837, 0.547, 0.030 ], "z_axis": [ -0.411, -0.592, -0.693 ], "quaternion": [ -0.351, -0.443, 0.806, -0.174 ] } }, { "index": 15, "nt1": "///C/20", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.945, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.195, "chi2": 177.318, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.595, "C1C1_dist": 10.881, "N1N9_dist": 9.000, "C6C8_dist": 9.870, "CNNC_torsion": -10.944, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 9.027, "planarity": 0.114, "simple_Shear": 0.319, "simple_Stretch": -0.143, "simple_Buckle": 6.606, "simple_Propeller": -6.153, "bp_simpleParams": [ 0.319, -0.143, -0.247, 6.606, -6.153, -0.361 ], "bp_params": [ 0.315, -0.151, -0.247, 6.454, -6.311, -0.361 ], "frame": { "rmsd": null, "origin": [ 19.468, 38.363, 52.243 ], "x_axis": [ -0.765, -0.179, 0.619 ], "y_axis": [ -0.493, 0.781, -0.383 ], "z_axis": [ -0.415, -0.598, -0.686 ], "quaternion": [ -0.287, -0.187, 0.899, -0.273 ] } }, { "index": 16, "nt1": "///C/21", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.952, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.657, "chi2": -90.024, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.980, "C1C1_dist": 10.575, "N1N9_dist": 8.757, "C6C8_dist": 9.616, "CNNC_torsion": 0.226, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.58],N3-N1(imino)[2.64],N4(amino)-O6(carbonyl)[2.56]", "interBase_angle": 13.929, "planarity": 0.210, "simple_Shear": -0.018, "simple_Stretch": -0.364, "simple_Buckle": -10.594, "simple_Propeller": -9.044, "bp_simpleParams": [ -0.018, -0.364, 0.053, -10.594, -9.044, -1.851 ], "bp_params": [ -0.017, -0.365, 0.053, -10.577, -9.064, -1.849 ], "frame": { "rmsd": null, "origin": [ 19.285, 34.912, 49.755 ], "x_axis": [ -0.878, 0.158, 0.452 ], "y_axis": [ -0.149, 0.808, -0.570 ], "z_axis": [ -0.455, -0.568, -0.686 ], "quaternion": [ -0.247, 0.002, 0.918, -0.310 ] } }, { "index": 17, "nt1": "///C/22", "nt2": "///D/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -78.734, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.701, "chi2": -87.650, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.289, "C1C1_dist": 10.612, "N1N9_dist": 8.854, "C6C8_dist": 9.711, "CNNC_torsion": 1.417, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.69],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 7.263, "planarity": 0.085, "simple_Shear": 0.016, "simple_Stretch": -0.314, "simple_Buckle": 7.117, "simple_Propeller": -1.450, "bp_simpleParams": [ 0.016, -0.314, -0.249, 7.117, -1.450, -3.363 ], "bp_params": [ 0.018, -0.314, -0.249, 7.123, -1.420, -3.357 ], "frame": { "rmsd": null, "origin": [ 18.121, 33.293, 47.472 ], "x_axis": [ -0.773, 0.566, 0.286 ], "y_axis": [ 0.173, 0.622, -0.764 ], "z_axis": [ -0.610, -0.541, -0.579 ], "quaternion": [ -0.260, 0.214, 0.862, -0.378 ] } }, { "index": 18, "nt1": "///C/23", "nt2": "///D/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.936, "chi2": -104.741, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.009, "C1C1_dist": 10.841, "N1N9_dist": 9.000, "C6C8_dist": 9.811, "CNNC_torsion": -29.446, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.85]", "interBase_angle": 18.827, "planarity": 0.260, "simple_Shear": 0.120, "simple_Stretch": -0.141, "simple_Buckle": 2.460, "simple_Propeller": -18.665, "bp_simpleParams": [ 0.120, -0.141, 0.193, 2.460, -18.665, -5.371 ], "bp_params": [ 0.118, -0.142, 0.193, 2.156, -18.703, -5.443 ], "frame": { "rmsd": null, "origin": [ 17.011, 31.462, 44.331 ], "x_axis": [ -0.407, 0.884, -0.229 ], "y_axis": [ 0.654, 0.107, -0.749 ], "z_axis": [ -0.638, -0.454, -0.622 ], "quaternion": [ -0.140, 0.526, 0.731, -0.412 ] } }, { "index": 19, "nt1": "///C/24", "nt2": "///D/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.242, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.943, "chi2": -94.246, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.607, "C1C1_dist": 10.610, "N1N9_dist": 8.881, "C6C8_dist": 9.804, "CNNC_torsion": 11.160, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.74],N4(amino)-O6(carbonyl)[2.68]", "interBase_angle": 7.441, "planarity": 0.099, "simple_Shear": -0.133, "simple_Stretch": -0.238, "simple_Buckle": -0.746, "simple_Propeller": 7.404, "bp_simpleParams": [ -0.133, -0.238, 0.036, -0.746, 7.404, -0.286 ], "bp_params": [ -0.129, -0.241, 0.036, -0.879, 7.389, -0.286 ], "frame": { "rmsd": null, "origin": [ 14.475, 30.924, 41.482 ], "x_axis": [ 0.002, 0.750, -0.661 ], "y_axis": [ 0.786, -0.410, -0.463 ], "z_axis": [ -0.619, -0.518, -0.590 ], "quaternion": [ 0.019, 0.707, 0.543, -0.452 ] } }, { "index": 20, "nt1": "///C/25", "nt2": "///D/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.217, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.835, "chi2": -104.784, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.020, "C1C1_dist": 10.280, "N1N9_dist": 8.687, "C6C8_dist": 9.826, "CNNC_torsion": -16.022, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.18],N1-N3(imino)[2.72]", "interBase_angle": 12.275, "planarity": 0.160, "simple_Shear": 0.062, "simple_Stretch": -0.115, "simple_Buckle": 3.103, "simple_Propeller": -11.876, "bp_simpleParams": [ 0.062, -0.115, -0.016, 3.103, -11.876, 9.007 ], "bp_params": [ 0.060, -0.115, -0.016, 2.970, -11.910, 9.053 ], "frame": { "rmsd": null, "origin": [ 13.212, 27.997, 39.746 ], "x_axis": [ 0.524, 0.348, -0.778 ], "y_axis": [ 0.614, -0.787, 0.062 ], "z_axis": [ -0.590, -0.510, -0.626 ], "quaternion": [ 0.167, 0.857, 0.281, -0.399 ] } }, { "index": 21, "nt1": "///C/26", "nt2": "///D/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.242, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.730, "chi2": -111.882, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.231, "C1C1_dist": 10.823, "N1N9_dist": 8.967, "C6C8_dist": 9.789, "CNNC_torsion": -6.174, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.75]", "interBase_angle": 7.400, "planarity": 0.088, "simple_Shear": 0.315, "simple_Stretch": -0.234, "simple_Buckle": 3.626, "simple_Propeller": -6.451, "bp_simpleParams": [ 0.315, -0.234, -0.180, 3.626, -6.451, -4.484 ], "bp_params": [ 0.309, -0.242, -0.180, 3.458, -6.542, -4.489 ], "frame": { "rmsd": null, "origin": [ 10.781, 26.671, 37.814 ], "x_axis": [ 0.769, -0.042, -0.638 ], "y_axis": [ 0.306, -0.852, 0.425 ], "z_axis": [ -0.562, -0.522, -0.642 ], "quaternion": [ 0.262, 0.903, 0.073, -0.332 ] } }, { "index": 22, "nt1": "///C/27", "nt2": "///D/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.730, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.916, "chi2": -96.071, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.021, "C1C1_dist": 10.077, "N1N9_dist": 8.602, "C6C8_dist": 9.709, "CNNC_torsion": 3.658, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.77]", "interBase_angle": 17.866, "planarity": 0.223, "simple_Shear": -0.543, "simple_Stretch": -0.136, "simple_Buckle": -16.849, "simple_Propeller": -5.941, "bp_simpleParams": [ -0.543, -0.136, -0.294, -16.849, -5.941, 7.118 ], "bp_params": [ -0.536, -0.162, -0.294, -16.566, -6.689, 7.056 ], "frame": { "rmsd": null, "origin": [ 9.919, 25.034, 33.934 ], "x_axis": [ 0.821, -0.512, -0.254 ], "y_axis": [ -0.233, -0.705, 0.670 ], "z_axis": [ -0.522, -0.490, -0.698 ], "quaternion": [ 0.323, 0.898, -0.208, -0.216 ] } }, { "index": 23, "nt1": "///C/28", "nt2": "///D/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.177, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.542, "chi2": -93.502, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.085, "C1C1_dist": 10.621, "N1N9_dist": 8.832, "C6C8_dist": 9.710, "CNNC_torsion": 7.262, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[2.66]", "interBase_angle": 1.369, "planarity": 0.102, "simple_Shear": -0.065, "simple_Stretch": -0.337, "simple_Buckle": 0.497, "simple_Propeller": 1.276, "bp_simpleParams": [ -0.065, -0.337, -0.449, 0.497, 1.276, -2.191 ], "bp_params": [ -0.061, -0.338, -0.449, 0.483, 1.282, -2.191 ], "frame": { "rmsd": null, "origin": [ 8.152, 24.468, 31.351 ], "x_axis": [ 0.678, -0.724, 0.128 ], "y_axis": [ -0.616, -0.464, 0.637 ], "z_axis": [ -0.402, -0.511, -0.760 ], "quaternion": [ 0.337, 0.852, -0.393, -0.080 ] } }, { "index": 24, "nt1": "///C/29", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.292, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.596, "chi2": -112.741, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.997, "C1C1_dist": 10.575, "N1N9_dist": 8.716, "C6C8_dist": 9.555, "CNNC_torsion": -9.915, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.58],N3-N1(imino)[2.64],N4(amino)-O6(carbonyl)[2.51]", "interBase_angle": 5.085, "planarity": 0.072, "simple_Shear": 0.425, "simple_Stretch": -0.458, "simple_Buckle": 1.921, "simple_Propeller": -4.708, "bp_simpleParams": [ 0.425, -0.458, -0.136, 1.921, -4.708, -2.832 ], "bp_params": [ 0.408, -0.474, -0.136, 1.739, -4.778, -2.834 ], "frame": { "rmsd": null, "origin": [ 6.813, 22.475, 28.885 ], "x_axis": [ 0.177, -0.854, 0.489 ], "y_axis": [ -0.898, 0.062, 0.435 ], "z_axis": [ -0.402, -0.516, -0.756 ], "quaternion": [ 0.348, 0.684, -0.641, 0.032 ] } }, { "index": 25, "nt1": "///C/30", "nt2": "///D/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.326, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.152, "chi2": -101.178, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.664, "C1C1_dist": 10.178, "N1N9_dist": 8.531, "C6C8_dist": 9.551, "CNNC_torsion": -10.650, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.58]", "interBase_angle": 10.659, "planarity": 0.130, "simple_Shear": -0.396, "simple_Stretch": -0.392, "simple_Buckle": 6.781, "simple_Propeller": -8.224, "bp_simpleParams": [ -0.396, -0.392, 0.250, 6.781, -8.224, 3.461 ], "bp_params": [ -0.382, -0.406, 0.250, 7.074, -7.973, 3.463 ], "frame": { "rmsd": null, "origin": [ 4.644, 20.667, 26.996 ], "x_axis": [ -0.389, -0.634, 0.668 ], "y_axis": [ -0.842, 0.539, 0.022 ], "z_axis": [ -0.374, -0.554, -0.744 ], "quaternion": [ -0.319, -0.452, 0.817, -0.163 ] } }, { "index": 26, "nt1": "///C/31", "nt2": "///D/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.698, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.375, "chi2": -97.147, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.206, "C1C1_dist": 10.544, "N1N9_dist": 8.859, "C6C8_dist": 9.759, "CNNC_torsion": -14.770, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-O2(carbonyl)[3.13],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.95]", "interBase_angle": 19.343, "planarity": 0.263, "simple_Shear": -1.048, "simple_Stretch": -0.141, "simple_Buckle": 15.015, "simple_Propeller": -12.194, "bp_simpleParams": [ -1.048, -0.141, 0.494, 15.015, -12.194, -0.187 ], "bp_params": [ -1.027, -0.253, 0.494, 16.255, -10.484, -0.186 ], "frame": { "rmsd": null, "origin": [ 3.624, 19.223, 24.419 ], "x_axis": [ -0.727, -0.373, 0.577 ], "y_axis": [ -0.600, 0.754, -0.268 ], "z_axis": [ -0.335, -0.541, -0.771 ], "quaternion": [ -0.253, -0.270, 0.902, -0.224 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "AACCACACAACACCCACACACCAG", "strand2": "TTGGTGTGTTGTGGGTGTGTGGTC", "bp_type": "...|||||||||||||||||||||", "helix_form": "x..B..BBB.B..BBBBB..BBB", "helical_rise": 3.369, "helical_rise_std": 0.818, "helical_radius": 11.374, "helical_radius_std": 5.067, "helical_axis": [ -0.535, -0.645, -0.546 ], "point1": [ 37.587, 65.789, 78.150 ], "point2": [ -3.867, 15.773, 35.867 ], "num_pairs": 24, "pairs": [ { "index": 1, "nt1": "///C/6", "nt2": "///D/27", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "--", "DSSR": "--", "bp1_params": [ -0.096, -5.000, 1.738, 3.610, 49.560, 166.803 ], "step_params": [ -3.765, -1.351, 6.793, 3.910, -6.617, -85.064 ], "heli_params": [ 1.312, -2.591, 6.830, 4.885, 2.887, -85.344 ], "bp2_params": [ -5.557, -4.728, 1.396, -5.962, -7.140, -21.945 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 6.793, "simple_Twist": 89.199, "simple_hRise": 6.727, "simple_hTwist": 89.460 }, { "index": 2, "nt1": "///C/9", "nt2": "///D/25", "bp": "A-T", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -5.557, -4.728, 1.396, -5.962, -7.140, -21.945 ], "step_params": [ 0.507, -1.635, 3.111, 4.027, 11.133, 90.082 ], "heli_params": [ -1.355, -0.282, 2.955, 7.839, -2.835, 90.690 ], "bp2_params": [ -5.356, 6.187, 0.030, 1.685, -8.216, -106.302 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.111, "simple_Twist": 32.444, "simple_hRise": 2.477, "simple_hTwist": 34.481 }, { "index": 3, "nt1": "///C/10", "nt2": "///D/24", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW+M", "bp1_params": [ -5.356, 6.187, 0.030, 1.685, -8.216, -106.302 ], "step_params": [ 0.720, 1.259, 3.365, -2.551, 9.325, 10.198 ], "heli_params": [ -5.069, -5.739, 3.150, 42.031, 11.498, 14.043 ], "bp2_params": [ 0.199, 0.668, 0.621, 14.267, -17.372, -1.447 ], "groove_widths": [ 13.608, null, 19.302, null ], "simple_Rise": 3.365, "simple_Twist": 28.364, "simple_hRise": 3.516, "simple_hTwist": 29.934 }, { "index": 4, "nt1": "///C/11", "nt2": "///D/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, 0.668, 0.621, 14.267, -17.372, -1.447 ], "step_params": [ -0.509, -0.858, 3.224, 0.862, 3.936, 38.731 ], "heli_params": [ -1.751, 0.865, 3.113, 5.915, -1.296, 38.932 ], "bp2_params": [ -0.258, 0.061, 0.252, 7.188, -6.289, -11.376 ], "groove_widths": [ 11.444, 10.918, 16.478, 16.237 ], "simple_Rise": 3.224, "simple_Twist": 40.387, "simple_hRise": 3.119, "simple_hTwist": 40.579 }, { "index": 5, "nt1": "///C/12", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.258, 0.061, 0.252, 7.188, -6.289, -11.376 ], "step_params": [ -0.077, -0.959, 3.438, -2.052, -0.362, 24.067 ], "heli_params": [ -2.171, -0.507, 3.446, -0.865, 4.908, 24.156 ], "bp2_params": [ -0.730, 0.035, 0.154, 9.354, -10.621, -14.248 ], "groove_widths": [ 12.558, 12.476, 19.169, 19.105 ], "simple_Rise": 3.438, "simple_Twist": 27.152, "simple_hRise": 3.446, "simple_hTwist": 27.231 }, { "index": 6, "nt1": "///C/13", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.730, 0.035, 0.154, 9.354, -10.621, -14.248 ], "step_params": [ 0.517, 1.980, 3.436, 0.055, -4.051, 49.223 ], "heli_params": [ 2.680, -0.614, 3.274, -4.854, -0.066, 49.379 ], "bp2_params": [ 0.253, -0.434, 0.415, 10.027, -11.769, -1.093 ], "groove_widths": [ 12.552, 12.488, 17.388, 17.387 ], "simple_Rise": 3.436, "simple_Twist": 43.373, "simple_hRise": 3.248, "simple_hTwist": 43.552 }, { "index": 7, "nt1": "///C/14", "nt2": "///D/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.253, -0.434, 0.415, 10.027, -11.769, -1.093 ], "step_params": [ 0.635, -0.010, 3.314, 4.520, -1.466, 24.974 ], "heli_params": [ 0.411, -0.103, 3.369, -3.350, -10.334, 25.416 ], "bp2_params": [ 0.027, -0.331, -0.010, 12.785, -8.026, -1.295 ], "groove_widths": [ 11.695, 11.532, 18.458, 18.429 ], "simple_Rise": 3.314, "simple_Twist": 27.230, "simple_hRise": 3.369, "simple_hTwist": 27.634 }, { "index": 8, "nt1": "///C/15", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.331, -0.010, 12.785, -8.026, -1.295 ], "step_params": [ 0.053, 0.917, 3.418, -1.969, -2.704, 44.540 ], "heli_params": [ 1.463, -0.257, 3.354, -3.561, 2.593, 44.659 ], "bp2_params": [ 0.072, -0.248, 0.404, 8.815, -9.411, -1.312 ], "groove_widths": [ 10.422, 10.284, 17.819, 17.737 ], "simple_Rise": 3.418, "simple_Twist": 43.440, "simple_hRise": 3.352, "simple_hTwist": 43.562 }, { "index": 9, "nt1": "///C/16", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.248, 0.404, 8.815, -9.411, -1.312 ], "step_params": [ 0.103, -0.249, 3.083, -1.102, -2.679, 37.950 ], "heli_params": [ -0.060, -0.291, 3.089, -4.112, 1.692, 38.056 ], "bp2_params": [ -0.084, -0.176, 0.470, 14.549, -4.667, 3.182 ], "groove_widths": [ 10.179, 10.173, 18.054, 18.051 ], "simple_Rise": 3.083, "simple_Twist": 38.889, "simple_hRise": 3.089, "simple_hTwist": 38.992 }, { "index": 10, "nt1": "///C/17", "nt2": "///D/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.084, -0.176, 0.470, 14.549, -4.667, 3.182 ], "step_params": [ 0.546, -1.148, 3.582, 1.659, -2.270, 29.220 ], "heli_params": [ -1.722, -0.680, 3.684, -4.486, -3.279, 29.352 ], "bp2_params": [ -0.231, -0.189, 0.090, 8.411, -4.304, 0.037 ], "groove_widths": [ 10.181, 10.171, 16.107, 16.065 ], "simple_Rise": 3.582, "simple_Twist": 29.968, "simple_hRise": 3.681, "simple_hTwist": 30.097 }, { "index": 11, "nt1": "///C/18", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.189, 0.090, 8.411, -4.304, 0.037 ], "step_params": [ 0.074, -0.702, 3.756, 3.830, -6.847, 41.928 ], "heli_params": [ -0.161, 0.349, 3.811, -9.469, -5.296, 42.623 ], "bp2_params": [ 0.069, -0.276, -0.081, -4.565, -5.388, -1.072 ], "groove_widths": [ 9.815, 9.786, 20.479, 20.462 ], "simple_Rise": 3.756, "simple_Twist": 39.855, "simple_hRise": 3.811, "simple_hTwist": 40.590 }, { "index": 12, "nt1": "///C/19", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.069, -0.276, -0.081, -4.565, -5.388, -1.072 ], "step_params": [ 0.813, -0.827, 3.089, 0.222, 0.571, 34.089 ], "heli_params": [ -1.495, -1.354, 3.080, 0.974, -0.379, 34.094 ], "bp2_params": [ 0.315, -0.151, -0.247, 6.454, -6.311, -0.361 ], "groove_widths": [ 10.614, 10.551, 23.956, 23.856 ], "simple_Rise": 3.089, "simple_Twist": 33.724, "simple_hRise": 3.080, "simple_hTwist": 33.729 }, { "index": 13, "nt1": "///C/20", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.315, -0.151, -0.247, 6.454, -6.311, -0.361 ], "step_params": [ -1.154, -1.539, 3.799, -2.171, 1.933, 22.560 ], "heli_params": [ -4.708, 2.021, 3.749, 4.914, 5.519, 22.745 ], "bp2_params": [ -0.017, -0.365, 0.053, -10.577, -9.064, -1.849 ], "groove_widths": [ 13.456, 13.397, 21.131, 20.756 ], "simple_Rise": 3.799, "simple_Twist": 23.740, "simple_hRise": 3.753, "simple_hTwist": 23.915 }, { "index": 14, "nt1": "///C/21", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.017, -0.365, 0.053, -10.577, -9.064, -1.849 ], "step_params": [ -0.499, 0.303, 2.975, 3.172, 10.449, 24.054 ], "heli_params": [ -1.905, 1.873, 2.775, 23.580, -7.157, 26.384 ], "bp2_params": [ 0.018, -0.314, -0.249, 7.123, -1.420, -3.357 ], "groove_widths": [ 15.523, 15.395, 17.713, 17.211 ], "simple_Rise": 2.975, "simple_Twist": 24.135, "simple_hRise": 2.777, "simple_hTwist": 26.457 }, { "index": 15, "nt1": "///C/22", "nt2": "///D/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.018, -0.314, -0.249, 7.123, -1.420, -3.357 ], "step_params": [ -0.777, 1.280, 3.494, -3.265, 4.762, 41.214 ], "heli_params": [ 1.248, 0.714, 3.662, 6.725, 4.610, 41.599 ], "bp2_params": [ 0.118, -0.142, 0.193, 2.156, -18.703, -5.443 ], "groove_widths": [ 13.800, 13.627, 17.772, 17.752 ], "simple_Rise": 3.494, "simple_Twist": 40.198, "simple_hRise": 3.665, "simple_hTwist": 40.593 }, { "index": 16, "nt1": "///C/23", "nt2": "///D/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.142, 0.193, 2.156, -18.703, -5.443 ], "step_params": [ 1.411, 0.023, 3.584, -0.225, -4.239, 35.238 ], "heli_params": [ 0.717, -2.351, 3.549, -6.970, 0.371, 35.485 ], "bp2_params": [ -0.129, -0.241, 0.036, -0.879, 7.389, -0.286 ], "groove_widths": [ 10.691, 10.621, 19.044, 19.024 ], "simple_Rise": 3.584, "simple_Twist": 36.720, "simple_hRise": 3.551, "simple_hTwist": 36.956 }, { "index": 17, "nt1": "///C/24", "nt2": "///D/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.241, 0.036, -0.879, 7.389, -0.286 ], "step_params": [ -0.718, 1.267, 3.326, -1.356, 2.297, 39.067 ], "heli_params": [ 1.607, 0.904, 3.414, 3.430, 2.025, 39.155 ], "bp2_params": [ 0.060, -0.115, -0.016, 2.970, -11.910, 9.053 ], "groove_widths": [ 11.355, 11.314, 16.207, 16.190 ], "simple_Rise": 3.326, "simple_Twist": 37.885, "simple_hRise": 3.416, "simple_hTwist": 37.975 }, { "index": 18, "nt1": "///C/25", "nt2": "///D/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.115, -0.016, 2.970, -11.910, 9.053 ], "step_params": [ -0.411, -0.530, 3.308, -1.102, 1.667, 27.749 ], "heli_params": [ -1.505, 0.588, 3.285, 3.470, 2.294, 27.820 ], "bp2_params": [ 0.309, -0.242, -0.180, 3.458, -6.542, -4.489 ], "groove_widths": [ 12.895, 12.695, 18.928, 18.889 ], "simple_Rise": 3.308, "simple_Twist": 26.997, "simple_hRise": 3.284, "simple_hTwist": 27.069 }, { "index": 19, "nt1": "///C/26", "nt2": "///D/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.242, -0.180, 3.458, -6.542, -4.489 ], "step_params": [ 1.539, -0.956, 3.898, 3.218, 2.874, 35.420 ], "heli_params": [ -2.061, -1.953, 3.931, 4.702, -5.265, 35.673 ], "bp2_params": [ -0.536, -0.162, -0.294, -16.566, -6.689, 7.056 ], "groove_widths": [ 12.435, 12.188, 19.587, 19.036 ], "simple_Rise": 3.898, "simple_Twist": 39.417, "simple_hRise": 3.930, "simple_hTwist": 39.643 }, { "index": 20, "nt1": "///C/27", "nt2": "///D/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.536, -0.162, -0.294, -16.566, -6.689, 7.056 ], "step_params": [ -0.861, -0.660, 2.990, 4.699, 6.278, 25.823 ], "heli_params": [ -2.808, 2.889, 2.566, 13.653, -10.218, 26.968 ], "bp2_params": [ -0.061, -0.338, -0.449, 0.483, 1.282, -2.191 ], "groove_widths": [ 13.038, 12.930, 20.854, 20.809 ], "simple_Rise": 2.990, "simple_Twist": 23.483, "simple_hRise": 2.513, "simple_hTwist": 24.741 }, { "index": 21, "nt1": "///C/28", "nt2": "///D/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.061, -0.338, -0.449, 0.483, 1.282, -2.191 ], "step_params": [ 0.254, 0.094, 3.431, -0.195, 0.312, 36.752 ], "heli_params": [ 0.105, -0.431, 3.431, 0.495, 0.310, 36.754 ], "bp2_params": [ 0.408, -0.474, -0.136, 1.739, -4.778, -2.834 ], "groove_widths": [ 13.069, null, 19.989, null ], "simple_Rise": 3.431, "simple_Twist": 34.235, "simple_hRise": 3.431, "simple_hTwist": 34.237 }, { "index": 22, "nt1": "///C/29", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.408, -0.474, -0.136, 1.739, -4.778, -2.834 ], "step_params": [ 0.490, 0.943, 3.227, 1.969, 1.964, 36.876 ], "heli_params": [ 1.222, -0.509, 3.292, 3.100, -3.107, 36.977 ], "bp2_params": [ -0.382, -0.406, 0.250, 7.074, -7.973, 3.463 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.227, "simple_Twist": 40.925, "simple_hRise": 3.286, "simple_hTwist": 41.015 }, { "index": 23, "nt1": "///C/30", "nt2": "///D/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.382, -0.406, 0.250, 7.074, -7.973, 3.463 ], "step_params": [ -0.322, 0.137, 3.105, 0.951, -2.681, 25.092 ], "heli_params": [ 1.052, 0.999, 3.060, -6.145, -2.180, 25.250 ], "bp2_params": [ -1.027, -0.253, 0.494, 16.255, -10.484, -0.186 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.105, "simple_Twist": 29.240, "simple_hRise": 3.069, "simple_hTwist": 29.375 }, { "index": 24, "nt1": "///C/31", "nt2": "///D/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CACACAACACCCACACACCAG", "strand2": "GTGTGTTGTGGGTGTGTGGTC", "bp_type": "|||||||||||||||||||||", "helix_form": "B..BBB.B..BBBBB..BBB", "helical_rise": 3.349, "helical_rise_std": 0.464, "helical_radius": 9.757, "helical_radius_std": 2.069, "helical_axis": [ -0.444, -0.611, -0.655 ], "point1": [ 31.962, 57.921, 70.807 ], "point2": [ 2.195, 16.965, 26.934 ], "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///C/11", "nt2": "///D/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, 0.668, 0.621, 14.267, -17.372, -1.447 ], "step_params": [ -0.509, -0.858, 3.224, 0.862, 3.936, 38.731 ], "heli_params": [ -1.751, 0.865, 3.113, 5.915, -1.296, 38.932 ], "bp2_params": [ -0.258, 0.061, 0.252, 7.188, -6.289, -11.376 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.224, "simple_Twist": 40.387, "simple_hRise": 3.119, "simple_hTwist": 40.579 }, { "index": 2, "nt1": "///C/12", "nt2": "///D/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.258, 0.061, 0.252, 7.188, -6.289, -11.376 ], "step_params": [ -0.077, -0.959, 3.438, -2.052, -0.362, 24.067 ], "heli_params": [ -2.171, -0.507, 3.446, -0.865, 4.908, 24.156 ], "bp2_params": [ -0.730, 0.035, 0.154, 9.354, -10.621, -14.248 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 27.152, "simple_hRise": 3.446, "simple_hTwist": 27.231 }, { "index": 3, "nt1": "///C/13", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.730, 0.035, 0.154, 9.354, -10.621, -14.248 ], "step_params": [ 0.517, 1.980, 3.436, 0.055, -4.051, 49.223 ], "heli_params": [ 2.680, -0.614, 3.274, -4.854, -0.066, 49.379 ], "bp2_params": [ 0.253, -0.434, 0.415, 10.027, -11.769, -1.093 ], "groove_widths": [ 12.552, null, 17.388, null ], "simple_Rise": 3.436, "simple_Twist": 43.373, "simple_hRise": 3.248, "simple_hTwist": 43.552 }, { "index": 4, "nt1": "///C/14", "nt2": "///D/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.253, -0.434, 0.415, 10.027, -11.769, -1.093 ], "step_params": [ 0.635, -0.010, 3.314, 4.520, -1.466, 24.974 ], "heli_params": [ 0.411, -0.103, 3.369, -3.350, -10.334, 25.416 ], "bp2_params": [ 0.027, -0.331, -0.010, 12.785, -8.026, -1.295 ], "groove_widths": [ 11.695, 11.532, 18.458, 18.429 ], "simple_Rise": 3.314, "simple_Twist": 27.230, "simple_hRise": 3.369, "simple_hTwist": 27.634 }, { "index": 5, "nt1": "///C/15", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.331, -0.010, 12.785, -8.026, -1.295 ], "step_params": [ 0.053, 0.917, 3.418, -1.969, -2.704, 44.540 ], "heli_params": [ 1.463, -0.257, 3.354, -3.561, 2.593, 44.659 ], "bp2_params": [ 0.072, -0.248, 0.404, 8.815, -9.411, -1.312 ], "groove_widths": [ 10.422, 10.284, 17.819, 17.737 ], "simple_Rise": 3.418, "simple_Twist": 43.440, "simple_hRise": 3.352, "simple_hTwist": 43.562 }, { "index": 6, "nt1": "///C/16", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.248, 0.404, 8.815, -9.411, -1.312 ], "step_params": [ 0.103, -0.249, 3.083, -1.102, -2.679, 37.950 ], "heli_params": [ -0.060, -0.291, 3.089, -4.112, 1.692, 38.056 ], "bp2_params": [ -0.084, -0.176, 0.470, 14.549, -4.667, 3.182 ], "groove_widths": [ 10.179, 10.173, 18.054, 18.051 ], "simple_Rise": 3.083, "simple_Twist": 38.889, "simple_hRise": 3.089, "simple_hTwist": 38.992 }, { "index": 7, "nt1": "///C/17", "nt2": "///D/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.084, -0.176, 0.470, 14.549, -4.667, 3.182 ], "step_params": [ 0.546, -1.148, 3.582, 1.659, -2.270, 29.220 ], "heli_params": [ -1.722, -0.680, 3.684, -4.486, -3.279, 29.352 ], "bp2_params": [ -0.231, -0.189, 0.090, 8.411, -4.304, 0.037 ], "groove_widths": [ 10.181, 10.171, 16.107, 16.065 ], "simple_Rise": 3.582, "simple_Twist": 29.968, "simple_hRise": 3.681, "simple_hTwist": 30.097 }, { "index": 8, "nt1": "///C/18", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.189, 0.090, 8.411, -4.304, 0.037 ], "step_params": [ 0.074, -0.702, 3.756, 3.830, -6.847, 41.928 ], "heli_params": [ -0.161, 0.349, 3.811, -9.469, -5.296, 42.623 ], "bp2_params": [ 0.069, -0.276, -0.081, -4.565, -5.388, -1.072 ], "groove_widths": [ 9.815, 9.786, 20.479, 20.462 ], "simple_Rise": 3.756, "simple_Twist": 39.855, "simple_hRise": 3.811, "simple_hTwist": 40.590 }, { "index": 9, "nt1": "///C/19", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.069, -0.276, -0.081, -4.565, -5.388, -1.072 ], "step_params": [ 0.813, -0.827, 3.089, 0.222, 0.571, 34.089 ], "heli_params": [ -1.495, -1.354, 3.080, 0.974, -0.379, 34.094 ], "bp2_params": [ 0.315, -0.151, -0.247, 6.454, -6.311, -0.361 ], "groove_widths": [ 10.614, 10.551, 23.956, 23.856 ], "simple_Rise": 3.089, "simple_Twist": 33.724, "simple_hRise": 3.080, "simple_hTwist": 33.729 }, { "index": 10, "nt1": "///C/20", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.315, -0.151, -0.247, 6.454, -6.311, -0.361 ], "step_params": [ -1.154, -1.539, 3.799, -2.171, 1.933, 22.560 ], "heli_params": [ -4.708, 2.021, 3.749, 4.914, 5.519, 22.745 ], "bp2_params": [ -0.017, -0.365, 0.053, -10.577, -9.064, -1.849 ], "groove_widths": [ 13.456, 13.397, 21.131, 20.756 ], "simple_Rise": 3.799, "simple_Twist": 23.740, "simple_hRise": 3.753, "simple_hTwist": 23.915 }, { "index": 11, "nt1": "///C/21", "nt2": "///D/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.017, -0.365, 0.053, -10.577, -9.064, -1.849 ], "step_params": [ -0.499, 0.303, 2.975, 3.172, 10.449, 24.054 ], "heli_params": [ -1.905, 1.873, 2.775, 23.580, -7.157, 26.384 ], "bp2_params": [ 0.018, -0.314, -0.249, 7.123, -1.420, -3.357 ], "groove_widths": [ 15.523, 15.395, 17.713, 17.211 ], "simple_Rise": 2.975, "simple_Twist": 24.135, "simple_hRise": 2.777, "simple_hTwist": 26.457 }, { "index": 12, "nt1": "///C/22", "nt2": "///D/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.018, -0.314, -0.249, 7.123, -1.420, -3.357 ], "step_params": [ -0.777, 1.280, 3.494, -3.265, 4.762, 41.214 ], "heli_params": [ 1.248, 0.714, 3.662, 6.725, 4.610, 41.599 ], "bp2_params": [ 0.118, -0.142, 0.193, 2.156, -18.703, -5.443 ], "groove_widths": [ 13.800, 13.627, 17.772, 17.752 ], "simple_Rise": 3.494, "simple_Twist": 40.198, "simple_hRise": 3.665, "simple_hTwist": 40.593 }, { "index": 13, "nt1": "///C/23", "nt2": "///D/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.142, 0.193, 2.156, -18.703, -5.443 ], "step_params": [ 1.411, 0.023, 3.584, -0.225, -4.239, 35.238 ], "heli_params": [ 0.717, -2.351, 3.549, -6.970, 0.371, 35.485 ], "bp2_params": [ -0.129, -0.241, 0.036, -0.879, 7.389, -0.286 ], "groove_widths": [ 10.691, 10.621, 19.044, 19.024 ], "simple_Rise": 3.584, "simple_Twist": 36.720, "simple_hRise": 3.551, "simple_hTwist": 36.956 }, { "index": 14, "nt1": "///C/24", "nt2": "///D/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.241, 0.036, -0.879, 7.389, -0.286 ], "step_params": [ -0.718, 1.267, 3.326, -1.356, 2.297, 39.067 ], "heli_params": [ 1.607, 0.904, 3.414, 3.430, 2.025, 39.155 ], "bp2_params": [ 0.060, -0.115, -0.016, 2.970, -11.910, 9.053 ], "groove_widths": [ 11.355, 11.314, 16.207, 16.190 ], "simple_Rise": 3.326, "simple_Twist": 37.885, "simple_hRise": 3.416, "simple_hTwist": 37.975 }, { "index": 15, "nt1": "///C/25", "nt2": "///D/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.115, -0.016, 2.970, -11.910, 9.053 ], "step_params": [ -0.411, -0.530, 3.308, -1.102, 1.667, 27.749 ], "heli_params": [ -1.505, 0.588, 3.285, 3.470, 2.294, 27.820 ], "bp2_params": [ 0.309, -0.242, -0.180, 3.458, -6.542, -4.489 ], "groove_widths": [ 12.895, 12.695, 18.928, 18.889 ], "simple_Rise": 3.308, "simple_Twist": 26.997, "simple_hRise": 3.284, "simple_hTwist": 27.069 }, { "index": 16, "nt1": "///C/26", "nt2": "///D/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.242, -0.180, 3.458, -6.542, -4.489 ], "step_params": [ 1.539, -0.956, 3.898, 3.218, 2.874, 35.420 ], "heli_params": [ -2.061, -1.953, 3.931, 4.702, -5.265, 35.673 ], "bp2_params": [ -0.536, -0.162, -0.294, -16.566, -6.689, 7.056 ], "groove_widths": [ 12.435, 12.188, 19.587, 19.036 ], "simple_Rise": 3.898, "simple_Twist": 39.417, "simple_hRise": 3.930, "simple_hTwist": 39.643 }, { "index": 17, "nt1": "///C/27", "nt2": "///D/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.536, -0.162, -0.294, -16.566, -6.689, 7.056 ], "step_params": [ -0.861, -0.660, 2.990, 4.699, 6.278, 25.823 ], "heli_params": [ -2.808, 2.889, 2.566, 13.653, -10.218, 26.968 ], "bp2_params": [ -0.061, -0.338, -0.449, 0.483, 1.282, -2.191 ], "groove_widths": [ 13.038, 12.930, 20.854, 20.809 ], "simple_Rise": 2.990, "simple_Twist": 23.483, "simple_hRise": 2.513, "simple_hTwist": 24.741 }, { "index": 18, "nt1": "///C/28", "nt2": "///D/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.061, -0.338, -0.449, 0.483, 1.282, -2.191 ], "step_params": [ 0.254, 0.094, 3.431, -0.195, 0.312, 36.752 ], "heli_params": [ 0.105, -0.431, 3.431, 0.495, 0.310, 36.754 ], "bp2_params": [ 0.408, -0.474, -0.136, 1.739, -4.778, -2.834 ], "groove_widths": [ 13.069, null, 19.989, null ], "simple_Rise": 3.431, "simple_Twist": 34.235, "simple_hRise": 3.431, "simple_hTwist": 34.237 }, { "index": 19, "nt1": "///C/29", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.408, -0.474, -0.136, 1.739, -4.778, -2.834 ], "step_params": [ 0.490, 0.943, 3.227, 1.969, 1.964, 36.876 ], "heli_params": [ 1.222, -0.509, 3.292, 3.100, -3.107, 36.977 ], "bp2_params": [ -0.382, -0.406, 0.250, 7.074, -7.973, 3.463 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.227, "simple_Twist": 40.925, "simple_hRise": 3.286, "simple_hTwist": 41.015 }, { "index": 20, "nt1": "///C/30", "nt2": "///D/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.382, -0.406, 0.250, 7.074, -7.973, 3.463 ], "step_params": [ -0.322, 0.137, 3.105, 0.951, -2.681, 25.092 ], "heli_params": [ 1.052, 0.999, 3.060, -6.145, -2.180, 25.250 ], "bp2_params": [ -1.027, -0.253, 0.494, 16.255, -10.484, -0.186 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.105, "simple_Twist": 29.240, "simple_hRise": 3.069, "simple_hTwist": 29.375 }, { "index": 21, "nt1": "///C/31", "nt2": "///D/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///C/5,///C/6" }, { "index": 2, "num_nts": 3, "nts_short": "ACC", "nts_long": "///C/9,///C/10,///C/11" }, { "index": 3, "num_nts": 3, "nts_short": "ACC", "nts_long": "///D/1,///D/2,///D/3" }, { "index": 4, "num_nts": 4, "nts_short": "GTGT", "nts_long": "///C/1,///C/2,///C/3,///C/4" }, { "index": 5, "num_nts": 6, "nts_short": "GGTGTT", "nts_long": "///D/23,///D/24,///D/25,///D/26,///D/27,///D/28" } ], "nonStack": { "num_nts": 3, "nts_short": "CAC", "nts_long": "///D/29,///D/30,///D/31" }, "num_ssSegments": 3, "ssSegments": [ { "index": 1, "is_broken": true, "num_nts": 8, "nts_short": "GTGTGAAC", "nts_long": "///C/1,///C/2,///C/3,///C/4,///C/5,///C/6,///C/9,///C/10" }, { "index": 2, "num_nts": 2, "nts_short": "AC", "nts_long": "///D/1,///D/2" }, { "index": 3, "num_nts": 8, "nts_short": "GTGTTCAC", "nts_long": "///D/24,///D/25,///D/26,///D/27,///D/28,///D/29,///D/30,///D/31" } ], "dbn": { "all_chains": { "num_nts": 60, "num_chars": 62, "bseq": "GTGTGA&ACCACACAACACCCACACACCAG&ACCTGGTGTGTGGGTGTTGTGTGGTGTTCAC", "sstr": "......&..(((((((((((((((((((((&..)))))))))))))))))))))........", "form": "..B..-&.....BBB.B..B.B....BBB-&.BBBB...BBBB..B.BBB..B........-" }, "chain_C": { "num_nts": 29, "num_chars": 30, "bseq": "GTGTGA&ACCACACAACACCCACACACCAG", "sstr": "......&..(((((((((((((((((((((", "form": "..B..-&.....BBB.B..B.B....BBB-" }, "chain_D": { "num_nts": 31, "num_chars": 31, "bseq": "ACCTGGTGTGTGGGTGTTGTGTGGTGTTCAC", "sstr": "..)))))))))))))))))))))........", "form": ".BBBB...BBBB..B.BBB..B........-" } }, "chains": { "chain_C": { "num_nts": 29, "bseq": "GTGTGA&ACCACACAACACCCACACACCAG", "sstr": "......&..(((((((((((((((((((((", "form": "..B..-&.....BBB.B..B.B....BBB-", "helical_rise": 3.385, "helical_rise_std": 0.847, "helical_axis": [ -0.498, -0.711, -0.496 ], "point1": [ 43.926, 81.446, 87.764 ], "point2": [ -3.330, 13.931, 40.650 ], "num_chars": 85, "suite": "G!!T!!G!!T!!G4aA..A!!C!!C!!A!!C!!A!!C!!A!!A!!C!!A!!C!!C!!C4bA!!C4bA!!C!!A!!C!!C!!A!!G" }, "chain_D": { "num_nts": 31, "bseq": "ACCTGGTGTGTGGGTGTTGTGTGGTGTTCAC", "sstr": "..)))))))))))))))))))))........", "form": ".BBBB...BBBB..B.BBB..B........-", "helical_rise": 3.265, "helical_rise_std": 0.590, "helical_axis": [ 0.324, 0.574, 0.752 ], "point1": [ 0.386, 16.350, 19.066 ], "point2": [ 32.073, 72.401, 92.583 ], "num_chars": 91, "suite": "A!!C!!C!!T!!G!!G!!T!!G!!T!!G0bT!!G!!G!!G1bT!!G!!T!!T!!G!!T!!G!!T!!G!!G!!T!!G!!T!!T!!C!!A!!C" } }, "num_nts": 60, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": 160.304, "gamma": 175.308, "delta": 124.290, "epsilon": -171.375, "zeta": -99.689, "epsilon_zeta": -71.686, "bb_type": "BI", "chi": -120.163, "glyco_bond": "anti", "C5prime_xyz": [ -2.647, 8.628, -1.681 ], "P_xyz": [ -1.853, 9.723, -3.987 ], "form": ".", "ssZp": 1.651, "Dp": 2.244, "splay_angle": 23.124, "splay_distance": 4.161, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": null, "theta": 171.388, "eta_prime": null, "theta_prime": 177.048, "eta_base": null, "theta_base": -157.478, "v0": -33.945, "v1": 38.007, "v2": -27.827, "v3": 9.227, "v4": 15.197, "amplitude": 37.621, "phase_angle": 137.702, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 34.312, 78.715, 96.127 ], "x_axis": [ -0.983, 0.179, 0.044 ], "y_axis": [ 0.113, 0.776, -0.620 ], "z_axis": [ -0.145, -0.605, -0.783 ], "quaternion": [ -0.050, 0.078, 0.941, -0.325 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -177.688, "beta": -176.844, "gamma": 142.672, "delta": 119.137, "epsilon": 172.690, "zeta": -87.860, "epsilon_zeta": -99.450, "bb_type": "BI", "chi": -135.867, "glyco_bond": "anti", "C5prime_xyz": [ -2.957, 8.861, -0.760 ], "P_xyz": [ -1.237, 10.277, -2.187 ], "form": ".", "ssZp": 2.546, "Dp": 2.747, "splay_angle": 20.199, "splay_distance": 3.980, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 154.657, "theta": -147.858, "eta_prime": 178.858, "theta_prime": -166.379, "eta_base": -154.947, "theta_base": -110.461, "v0": -40.166, "v1": 41.512, "v2": -26.974, "v3": 4.596, "v4": 22.062, "amplitude": 42.016, "phase_angle": 129.941, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.013, "origin": [ 34.058, 75.076, 94.124 ], "x_axis": [ -0.823, 0.552, -0.131 ], "y_axis": [ 0.518, 0.636, -0.572 ], "z_axis": [ -0.232, -0.539, -0.810 ], "quaternion": [ -0.028, 0.296, 0.904, -0.307 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 168.213, "beta": -174.994, "gamma": 175.838, "delta": 122.762, "epsilon": -159.507, "zeta": -80.695, "epsilon_zeta": -78.811, "bb_type": "BI", "chi": -157.793, "glyco_bond": "anti", "C5prime_xyz": [ -2.624, 8.946, 0.270 ], "P_xyz": [ -1.125, 10.766, -0.990 ], "form": "B", "ssZp": 2.157, "Dp": 2.586, "splay_angle": 17.489, "splay_distance": 2.992, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": -164.218, "theta": -147.639, "eta_prime": -155.548, "theta_prime": -151.624, "eta_base": -94.661, "theta_base": -101.622, "v0": -34.830, "v1": 36.072, "v2": -23.431, "v3": 4.008, "v4": 19.150, "amplitude": 36.478, "phase_angle": 129.966, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 30.916, 74.079, 91.894 ], "x_axis": [ -0.279, 0.780, -0.561 ], "y_axis": [ 0.926, 0.063, -0.373 ], "z_axis": [ -0.255, -0.623, -0.739 ], "quaternion": [ 0.106, 0.591, 0.721, -0.345 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,ss-non-loop", "alpha": 168.272, "beta": 173.078, "gamma": 157.412, "delta": 133.525, "epsilon": -168.919, "zeta": -124.132, "epsilon_zeta": -44.787, "bb_type": "BI", "chi": -117.747, "glyco_bond": "anti", "C5prime_xyz": [ -2.158, 8.622, -1.451 ], "P_xyz": [ -0.473, 9.315, -3.390 ], "form": ".", "ssZp": 1.746, "Dp": 1.989, "splay_angle": 23.813, "splay_distance": 4.599, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 167.174, "theta": -163.973, "eta_prime": -164.966, "theta_prime": -169.832, "eta_base": -112.446, "theta_base": -178.738, "v0": -23.048, "v1": 34.075, "v2": -31.606, "v3": 19.414, "v4": 2.025, "amplitude": 34.141, "phase_angle": 157.780, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.014, "origin": [ 29.705, 73.157, 89.319 ], "x_axis": [ 0.460, 0.554, -0.694 ], "y_axis": [ 0.729, -0.682, -0.061 ], "z_axis": [ -0.507, -0.478, -0.718 ], "quaternion": [ 0.123, 0.846, 0.379, -0.355 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": 34.767, "beta": 112.684, "gamma": -52.042, "delta": 141.988, "epsilon": -92.131, "zeta": 146.444, "epsilon_zeta": 121.425, "bb_type": "BII", "chi": -69.848, "glyco_bond": "anti", "C5prime_xyz": [ -4.451, 7.312, -2.173 ], "P_xyz": [ -4.662, 10.016, -2.228 ], "form": ".", "ssZp": 2.206, "Dp": 1.907, "splay_angle": 46.495, "splay_distance": 7.043, "splay_ratio": 0.441, "d22": null, "d64": null, "eta": 150.603, "theta": 156.569, "eta_prime": 167.314, "theta_prime": 155.547, "eta_base": 157.301, "theta_base": -107.661, "v0": -34.405, "v1": 46.853, "v2": -40.589, "v3": 22.575, "v4": 7.004, "amplitude": 45.858, "phase_angle": 152.263, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 25.152, 72.838, 88.754 ], "x_axis": [ 0.453, 0.638, -0.623 ], "y_axis": [ 0.724, -0.671, -0.160 ], "z_axis": [ -0.520, -0.378, -0.766 ], "quaternion": [ 0.064, 0.850, 0.401, -0.336 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/6", "linked_nts": [ "///C/5", null ], "nt_type": "DNA", "dbn": ".", "is_broken": true, "summary": "break,syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -62.713, "beta": 141.869, "gamma": 23.916, "delta": 74.707, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 37.578, "glyco_bond": "syn", "C5prime_xyz": [ -5.804, 4.080, 0.373 ], "P_xyz": [ -6.089, 1.414, 0.388 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -5.976, "v1": -20.767, "v2": 37.694, "v3": -42.240, "v4": 30.519, "amplitude": 42.138, "phase_angle": 26.550, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.046, "filter_rmsd": 0.046, "frame": { "rmsd": 0.020, "origin": [ 26.758, 67.334, 84.665 ], "x_axis": [ -0.155, 0.762, -0.628 ], "y_axis": [ -0.799, 0.277, 0.533 ], "z_axis": [ 0.581, 0.585, 0.566 ], "quaternion": [ 0.650, -0.020, 0.465, 0.601 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ null, "///C/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": null, "beta": 109.101, "gamma": -16.897, "delta": 107.503, "epsilon": 95.425, "zeta": -167.215, "epsilon_zeta": -97.360, "bb_type": "--", "chi": -92.406, "glyco_bond": "anti", "C5prime_xyz": [ -5.286, 6.979, -1.419 ], "P_xyz": [ -5.457, 9.539, -1.068 ], "form": ".", "ssZp": 2.923, "Dp": 3.221, "splay_angle": 24.991, "splay_distance": 3.611, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": null, "theta": 133.853, "eta_prime": null, "theta_prime": 171.076, "eta_base": null, "theta_base": -138.259, "v0": -51.804, "v1": 49.795, "v2": -27.203, "v3": -0.670, "v4": 31.269, "amplitude": 51.211, "phase_angle": 122.085, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.027, "origin": [ 29.998, 68.194, 72.860 ], "x_axis": [ 0.347, -0.806, 0.479 ], "y_axis": [ -0.928, -0.220, 0.301 ], "z_axis": [ -0.137, -0.549, -0.824 ], "quaternion": [ 0.275, 0.773, -0.561, 0.111 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": 114.099, "beta": 73.551, "gamma": 61.747, "delta": 124.799, "epsilon": 71.079, "zeta": 72.438, "epsilon_zeta": -1.359, "bb_type": "--", "chi": -107.588, "glyco_bond": "anti", "C5prime_xyz": [ -2.945, 8.564, -1.751 ], "P_xyz": [ -0.225, 8.290, -1.663 ], "form": ".", "ssZp": 0.910, "Dp": 2.160, "splay_angle": 30.834, "splay_distance": 5.232, "splay_ratio": 0.283, "d22": 3.819, "d64": 3.633, "eta": 143.776, "theta": -24.228, "eta_prime": -146.553, "theta_prime": -145.693, "eta_base": -107.392, "theta_base": -61.445, "v0": -24.781, "v1": 35.422, "v2": -32.182, "v3": 19.201, "v4": 3.239, "amplitude": 35.246, "phase_angle": 155.931, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.015, "origin": [ 30.955, 65.175, 71.127 ], "x_axis": [ -0.436, -0.581, 0.687 ], "y_axis": [ -0.898, 0.328, -0.293 ], "z_axis": [ -0.056, -0.745, -0.665 ], "quaternion": [ -0.238, -0.474, 0.779, -0.333 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end", "alpha": 177.710, "beta": 152.822, "gamma": 98.966, "delta": 117.157, "epsilon": -171.634, "zeta": -132.635, "epsilon_zeta": -38.999, "bb_type": "--", "chi": -116.920, "glyco_bond": "anti", "C5prime_xyz": [ -3.068, 8.630, -1.785 ], "P_xyz": [ -1.138, 9.537, -3.359 ], "form": ".", "ssZp": 2.212, "Dp": 2.387, "splay_angle": 19.021, "splay_distance": 3.357, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 148.471, "theta": -166.504, "eta_prime": -172.002, "theta_prime": -177.401, "eta_base": -87.357, "theta_base": -143.597, "v0": -38.440, "v1": 39.480, "v2": -25.629, "v3": 4.061, "v4": 21.489, "amplitude": 40.208, "phase_angle": 129.600, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.017, "origin": [ 27.214, 61.563, 70.554 ], "x_axis": [ -0.989, 0.085, 0.120 ], "y_axis": [ -0.046, 0.597, -0.801 ], "z_axis": [ -0.140, -0.798, -0.586 ], "quaternion": [ -0.073, 0.011, 0.891, -0.449 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 49.372, "beta": 150.419, "gamma": -56.043, "delta": 138.447, "epsilon": 52.790, "zeta": 43.275, "epsilon_zeta": 9.515, "bb_type": "--", "chi": -101.423, "glyco_bond": "anti", "C5prime_xyz": [ -1.584, 7.916, -1.929 ], "P_xyz": [ -0.136, 10.129, -1.825 ], "form": ".", "ssZp": 0.183, "Dp": 0.591, "splay_angle": 19.509, "splay_distance": 3.566, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": -167.705, "theta": -136.508, "eta_prime": -149.976, "theta_prime": -146.645, "eta_base": -123.421, "theta_base": -113.961, "v0": 2.893, "v1": 14.336, "v2": -25.117, "v3": 27.398, "v4": -19.019, "amplitude": 27.568, "phase_angle": 204.344, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.016, "origin": [ 26.614, 58.445, 69.465 ], "x_axis": [ -0.802, 0.558, -0.212 ], "y_axis": [ 0.482, 0.396, -0.781 ], "z_axis": [ -0.352, -0.729, -0.587 ], "quaternion": [ -0.042, 0.312, 0.834, -0.453 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 157.534, "beta": -126.204, "gamma": 59.631, "delta": 125.150, "epsilon": -35.891, "zeta": 95.990, "epsilon_zeta": 228.119, "bb_type": "--", "chi": -75.874, "glyco_bond": "anti", "C5prime_xyz": [ -4.058, 7.429, -2.549 ], "P_xyz": [ -2.555, 9.599, -3.364 ], "form": ".", "ssZp": 1.055, "Dp": 1.183, "splay_angle": 24.731, "splay_distance": 4.068, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 162.368, "theta": 171.233, "eta_prime": -169.037, "theta_prime": 176.199, "eta_base": -138.667, "theta_base": -109.460, "v0": -34.259, "v1": 41.962, "v2": -32.593, "v3": 14.109, "v4": 12.362, "amplitude": 40.593, "phase_angle": 143.408, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.017, "origin": [ 24.865, 55.680, 68.046 ], "x_axis": [ -0.559, 0.657, -0.506 ], "y_axis": [ 0.750, 0.141, -0.646 ], "z_axis": [ -0.353, -0.740, -0.572 ], "quaternion": [ 0.051, 0.467, 0.754, -0.460 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 170.608, "beta": -147.817, "gamma": 104.741, "delta": 125.609, "epsilon": -175.797, "zeta": -119.273, "epsilon_zeta": -56.524, "bb_type": "BI", "chi": -92.968, "glyco_bond": "anti", "C5prime_xyz": [ -2.080, 7.956, -2.496 ], "P_xyz": [ 0.535, 7.990, -2.993 ], "form": "B", "ssZp": 1.400, "Dp": 1.845, "splay_angle": 17.578, "splay_distance": 3.147, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 170.684, "theta": -125.269, "eta_prime": -166.070, "theta_prime": -149.748, "eta_base": -97.042, "theta_base": -113.264, "v0": -11.931, "v1": 20.000, "v2": -20.538, "v3": 14.178, "v4": -1.503, "amplitude": 21.206, "phase_angle": 165.582, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.022, "origin": [ 25.224, 53.593, 64.572 ], "x_axis": [ 0.288, 0.454, -0.843 ], "y_axis": [ 0.854, -0.520, 0.012 ], "z_axis": [ -0.433, -0.724, -0.538 ], "quaternion": [ 0.240, 0.766, 0.427, -0.417 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 20.382, "beta": 110.367, "gamma": 14.335, "delta": 123.417, "epsilon": -145.409, "zeta": -162.225, "epsilon_zeta": 16.816, "bb_type": "--", "chi": -85.704, "glyco_bond": "anti", "C5prime_xyz": [ -3.810, 7.685, -2.586 ], "P_xyz": [ -2.021, 9.706, -3.093 ], "form": "B", "ssZp": 1.834, "Dp": 1.839, "splay_angle": 22.379, "splay_distance": 3.763, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 175.663, "theta": 170.738, "eta_prime": -157.855, "theta_prime": 171.066, "eta_base": -121.223, "theta_base": -127.446, "v0": -29.550, "v1": 38.307, "v2": -31.033, "v3": 15.050, "v4": 8.833, "amplitude": 36.935, "phase_angle": 147.163, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.018, "origin": [ 24.466, 51.641, 62.223 ], "x_axis": [ 0.624, 0.213, -0.752 ], "y_axis": [ 0.590, -0.759, 0.275 ], "z_axis": [ -0.512, -0.615, -0.599 ], "quaternion": [ 0.258, 0.863, 0.233, -0.366 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -67.802, "beta": 146.628, "gamma": 61.627, "delta": 133.237, "epsilon": -174.630, "zeta": -96.413, "epsilon_zeta": -78.217, "bb_type": "BI", "chi": -115.554, "glyco_bond": "anti", "C5prime_xyz": [ -1.937, 8.439, -1.537 ], "P_xyz": [ 0.718, 8.474, -1.624 ], "form": "B", "ssZp": 2.091, "Dp": 2.205, "splay_angle": 18.731, "splay_distance": 3.126, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 164.888, "theta": -126.422, "eta_prime": -167.311, "theta_prime": -155.324, "eta_base": -107.483, "theta_base": -113.099, "v0": -19.259, "v1": 27.674, "v2": -25.888, "v3": 15.579, "v4": 2.059, "amplitude": 28.073, "phase_angle": 157.249, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.027, "origin": [ 23.454, 48.416, 60.568 ], "x_axis": [ 0.866, -0.373, -0.332 ], "y_axis": [ -0.018, -0.687, 0.726 ], "z_axis": [ -0.499, -0.623, -0.602 ], "quaternion": [ 0.380, 0.888, -0.110, -0.234 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.379, "beta": 179.582, "gamma": 45.790, "delta": 136.938, "epsilon": -169.113, "zeta": -88.134, "epsilon_zeta": -80.978, "bb_type": "BI", "chi": -107.729, "glyco_bond": "anti", "C5prime_xyz": [ -1.746, 8.215, -2.019 ], "P_xyz": [ 0.599, 9.394, -1.797 ], "form": ".", "ssZp": 1.517, "Dp": 1.849, "splay_angle": 19.405, "splay_distance": 3.629, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 172.440, "theta": -126.938, "eta_prime": -162.131, "theta_prime": -146.178, "eta_base": -113.103, "theta_base": -111.843, "v0": -19.229, "v1": 32.780, "v2": -34.443, "v3": 23.849, "v4": -3.038, "amplitude": 35.397, "phase_angle": 166.668, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.021, "origin": [ 22.187, 46.304, 58.643 ], "x_axis": [ 0.666, -0.709, 0.233 ], "y_axis": [ -0.611, -0.338, 0.716 ], "z_axis": [ -0.429, -0.619, -0.658 ], "quaternion": [ 0.409, 0.816, -0.404, -0.060 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.296, "beta": 162.498, "gamma": 57.111, "delta": 106.576, "epsilon": 164.593, "zeta": -98.586, "epsilon_zeta": -96.821, "bb_type": "BI", "chi": -130.025, "glyco_bond": "anti", "C5prime_xyz": [ -3.185, 8.739, -1.322 ], "P_xyz": [ -1.404, 10.547, -1.966 ], "form": "B", "ssZp": 2.861, "Dp": 2.688, "splay_angle": 23.217, "splay_distance": 3.753, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 163.194, "theta": 179.910, "eta_prime": -170.944, "theta_prime": 179.172, "eta_base": -129.302, "theta_base": -130.443, "v0": -42.449, "v1": 36.987, "v2": -17.114, "v3": -7.273, "v4": 31.511, "amplitude": 42.052, "phase_angle": 114.015, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.016, "origin": [ 21.702, 43.778, 56.083 ], "x_axis": [ 0.312, -0.775, 0.549 ], "y_axis": [ -0.850, 0.030, 0.525 ], "z_axis": [ -0.424, -0.631, -0.650 ], "quaternion": [ 0.416, 0.695, -0.585, 0.045 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.289, "beta": -172.624, "gamma": 59.722, "delta": 123.489, "epsilon": -177.469, "zeta": -79.860, "epsilon_zeta": -97.609, "bb_type": "BI", "chi": -126.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.900, 8.620, -1.207 ], "P_xyz": [ 0.482, 9.434, -0.411 ], "form": ".", "ssZp": 2.405, "Dp": 2.590, "splay_angle": 18.003, "splay_distance": 3.243, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": -179.127, "theta": -126.439, "eta_prime": -160.881, "theta_prime": -137.961, "eta_base": -108.436, "theta_base": -97.354, "v0": -27.078, "v1": 31.031, "v2": -23.013, "v3": 8.218, "v4": 11.417, "amplitude": 30.437, "phase_angle": 139.120, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.026, "origin": [ 20.767, 41.032, 53.700 ], "x_axis": [ -0.373, -0.624, 0.686 ], "y_axis": [ -0.824, 0.563, 0.065 ], "z_axis": [ -0.427, -0.541, -0.725 ], "quaternion": [ -0.341, -0.444, 0.816, -0.146 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -60.849, "beta": 173.504, "gamma": 52.713, "delta": 115.668, "epsilon": -175.150, "zeta": -100.667, "epsilon_zeta": -74.483, "bb_type": "BI", "chi": -116.945, "glyco_bond": "anti", "C5prime_xyz": [ -2.845, 8.616, -1.731 ], "P_xyz": [ -0.830, 10.240, -1.757 ], "form": ".", "ssZp": 2.115, "Dp": 2.294, "splay_angle": 24.798, "splay_distance": 4.454, "splay_ratio": 0.219, "d22": 4.543, "d64": 5.012, "eta": 173.296, "theta": -160.533, "eta_prime": -158.875, "theta_prime": -168.711, "eta_base": -108.873, "theta_base": -142.901, "v0": -36.789, "v1": 33.237, "v2": -18.877, "v3": -1.639, "v4": 23.848, "amplitude": 36.324, "phase_angle": 121.311, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.018, "origin": [ 19.436, 38.350, 52.455 ], "x_axis": [ -0.784, -0.215, 0.582 ], "y_axis": [ -0.517, 0.746, -0.420 ], "z_axis": [ -0.343, -0.631, -0.696 ], "quaternion": [ -0.258, -0.204, 0.898, -0.293 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -58.097, "beta": 179.230, "gamma": 42.759, "delta": 117.240, "epsilon": -137.917, "zeta": -100.485, "epsilon_zeta": -37.432, "bb_type": "BI", "chi": -131.952, "glyco_bond": "anti", "C5prime_xyz": [ -2.786, 8.842, -1.080 ], "P_xyz": [ -0.985, 10.564, -0.439 ], "form": "B", "ssZp": 2.340, "Dp": 2.258, "splay_angle": 16.495, "splay_distance": 2.866, "splay_ratio": 0.144, "d22": 4.347, "d64": 3.494, "eta": -175.936, "theta": -138.176, "eta_prime": -168.977, "theta_prime": -136.554, "eta_base": -140.077, "theta_base": -116.388, "v0": -36.893, "v1": 32.788, "v2": -17.152, "v3": -3.611, "v4": 25.303, "amplitude": 36.338, "phase_angle": 118.165, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.016, "origin": [ 19.308, 34.748, 49.837 ], "x_axis": [ -0.910, 0.101, 0.403 ], "y_axis": [ -0.124, 0.859, -0.497 ], "z_axis": [ -0.396, -0.502, -0.769 ], "quaternion": [ -0.212, -0.006, 0.940, -0.266 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -68.655, "beta": 170.247, "gamma": 36.251, "delta": 137.940, "epsilon": -89.743, "zeta": 159.994, "epsilon_zeta": 110.262, "bb_type": "BII", "chi": -78.734, "glyco_bond": "anti", "C5prime_xyz": [ -3.477, 7.610, -2.445 ], "P_xyz": [ -1.587, 9.121, -3.388 ], "form": ".", "ssZp": 0.978, "Dp": 0.808, "splay_angle": 22.826, "splay_distance": 4.021, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 176.016, "theta": 172.350, "eta_prime": -160.935, "theta_prime": 172.399, "eta_base": -139.800, "theta_base": -133.608, "v0": -18.242, "v1": 30.064, "v2": -29.837, "v3": 20.863, "v4": -1.891, "amplitude": 30.970, "phase_angle": 164.451, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.015, "origin": [ 18.164, 33.268, 47.666 ], "x_axis": [ -0.784, 0.542, 0.303 ], "y_axis": [ 0.112, 0.603, -0.790 ], "z_axis": [ -0.610, -0.586, -0.534 ], "quaternion": [ -0.267, 0.191, 0.855, -0.402 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.916, "beta": 142.163, "gamma": 41.615, "delta": 137.549, "epsilon": 168.292, "zeta": -73.871, "epsilon_zeta": -117.837, "bb_type": "BI", "chi": -97.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.189, 7.980, -2.394 ], "P_xyz": [ 0.399, 8.586, -2.293 ], "form": "B", "ssZp": 1.511, "Dp": 1.714, "splay_angle": 21.561, "splay_distance": 3.756, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 159.578, "theta": -112.224, "eta_prime": -164.701, "theta_prime": -145.843, "eta_base": -116.835, "theta_base": -94.946, "v0": -22.332, "v1": 36.502, "v2": -36.127, "v3": 23.835, "v4": -1.230, "amplitude": 37.757, "phase_angle": 163.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.370, "filter_rmsd": 0.044, "frame": { "rmsd": 0.025, "origin": [ 16.879, 31.463, 44.310 ], "x_axis": [ -0.536, 0.793, -0.290 ], "y_axis": [ 0.618, 0.135, -0.774 ], "z_axis": [ -0.575, -0.594, -0.563 ], "quaternion": [ -0.096, 0.472, 0.747, -0.458 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -93.016, "beta": -177.129, "gamma": 61.362, "delta": 135.777, "epsilon": -97.487, "zeta": 170.573, "epsilon_zeta": 91.940, "bb_type": "BII", "chi": -99.242, "glyco_bond": "anti", "C5prime_xyz": [ -3.131, 8.182, -2.014 ], "P_xyz": [ -1.224, 9.849, -2.434 ], "form": ".", "ssZp": 0.979, "Dp": 1.064, "splay_angle": 20.953, "splay_distance": 3.600, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": -172.859, "theta": 171.818, "eta_prime": -151.676, "theta_prime": 176.800, "eta_base": -100.938, "theta_base": -125.764, "v0": -34.276, "v1": 43.786, "v2": -35.089, "v3": 17.488, "v4": 10.013, "amplitude": 41.920, "phase_angle": 146.830, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.011, "origin": [ 14.369, 30.916, 41.570 ], "x_axis": [ 0.039, 0.783, -0.620 ], "y_axis": [ 0.790, -0.404, -0.460 ], "z_axis": [ -0.611, -0.472, -0.635 ], "quaternion": [ 0.004, 0.721, 0.546, -0.427 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -73.447, "beta": 142.167, "gamma": 48.971, "delta": 135.507, "epsilon": -162.309, "zeta": -96.010, "epsilon_zeta": -66.299, "bb_type": "BI", "chi": -99.217, "glyco_bond": "anti", "C5prime_xyz": [ -1.997, 7.984, -2.432 ], "P_xyz": [ 0.671, 8.310, -2.129 ], "form": ".", "ssZp": 1.166, "Dp": 1.779, "splay_angle": 18.046, "splay_distance": 3.280, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 167.773, "theta": -115.060, "eta_prime": -167.067, "theta_prime": -145.290, "eta_base": -114.134, "theta_base": -120.803, "v0": -23.542, "v1": 31.927, "v2": -29.286, "v3": 16.434, "v4": 4.401, "amplitude": 32.510, "phase_angle": 154.270, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.373, "filter_rmsd": 0.042, "frame": { "rmsd": 0.020, "origin": [ 13.197, 28.056, 39.724 ], "x_axis": [ 0.505, 0.230, -0.832 ], "y_axis": [ 0.560, -0.821, 0.113 ], "z_axis": [ -0.657, -0.523, -0.543 ], "quaternion": [ 0.188, 0.847, 0.233, -0.440 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -74.056, "beta": 161.238, "gamma": 58.562, "delta": 103.067, "epsilon": 155.076, "zeta": -81.746, "epsilon_zeta": -123.177, "bb_type": "BI", "chi": -115.242, "glyco_bond": "anti", "C5prime_xyz": [ -3.707, 8.338, -1.728 ], "P_xyz": [ -1.945, 10.056, -2.648 ], "form": ".", "ssZp": 2.845, "Dp": 2.725, "splay_angle": 23.577, "splay_distance": 4.126, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 156.152, "theta": -162.354, "eta_prime": -176.304, "theta_prime": -176.602, "eta_base": -146.539, "theta_base": -123.700, "v0": -45.300, "v1": 38.013, "v2": -16.360, "v3": -9.523, "v4": 34.145, "amplitude": 44.384, "phase_angle": 111.629, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.013, "origin": [ 10.913, 26.815, 37.722 ], "x_axis": [ 0.723, -0.037, -0.690 ], "y_axis": [ 0.317, -0.869, 0.379 ], "z_axis": [ -0.614, -0.493, -0.617 ], "quaternion": [ 0.243, 0.896, 0.078, -0.364 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -118.419, "beta": -149.783, "gamma": 69.171, "delta": 68.148, "epsilon": 71.807, "zeta": 60.822, "epsilon_zeta": 10.985, "bb_type": "--", "chi": -147.730, "glyco_bond": "anti", "C5prime_xyz": [ -2.665, 8.957, -0.302 ], "P_xyz": [ -0.341, 10.295, -0.200 ], "form": ".", "ssZp": 3.181, "Dp": 3.006, "splay_angle": 17.269, "splay_distance": 3.084, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": -176.294, "theta": -150.055, "eta_prime": -170.961, "theta_prime": -148.546, "eta_base": -112.493, "theta_base": -137.037, "v0": -16.700, "v1": -8.972, "v2": 29.548, "v3": -39.926, "v4": 35.452, "amplitude": 40.028, "phase_angle": 42.423, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.025, "origin": [ 9.795, 25.301, 34.051 ], "x_axis": [ 0.777, -0.581, -0.243 ], "y_axis": [ -0.200, -0.595, 0.779 ], "z_axis": [ -0.597, -0.556, -0.578 ], "quaternion": [ 0.389, 0.859, -0.227, -0.245 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 28, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -123.979, "beta": -174.435, "gamma": 46.299, "delta": 108.582, "epsilon": 174.976, "zeta": -94.238, "epsilon_zeta": -90.786, "bb_type": "BI", "chi": -110.177, "glyco_bond": "anti", "C5prime_xyz": [ -2.817, 8.295, -2.137 ], "P_xyz": [ -0.925, 10.065, -2.352 ], "form": "B", "ssZp": 2.066, "Dp": 2.167, "splay_angle": 20.944, "splay_distance": 3.639, "splay_ratio": 0.182, "d22": 4.351, "d64": 3.871, "eta": 172.578, "theta": -168.571, "eta_prime": -165.686, "theta_prime": -170.508, "eta_base": -150.070, "theta_base": -121.650, "v0": -33.391, "v1": 29.565, "v2": -14.188, "v3": -4.887, "v4": 24.255, "amplitude": 33.118, "phase_angle": 115.367, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 8.326, 24.683, 31.410 ], "x_axis": [ 0.694, -0.709, 0.124 ], "y_axis": [ -0.604, -0.480, 0.636 ], "z_axis": [ -0.392, -0.517, -0.761 ], "quaternion": [ 0.337, 0.857, -0.383, -0.078 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/29", "linked_nts": [ "///C/28", "///C/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.857, "beta": 169.550, "gamma": 46.255, "delta": 129.679, "epsilon": -157.199, "zeta": -122.817, "epsilon_zeta": -34.382, "bb_type": "BI", "chi": -113.292, "glyco_bond": "anti", "C5prime_xyz": [ -2.384, 8.569, -1.753 ], "P_xyz": [ -0.091, 9.857, -1.568 ], "form": "B", "ssZp": 2.036, "Dp": 2.196, "splay_angle": 20.943, "splay_distance": 3.557, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 178.418, "theta": -152.481, "eta_prime": -159.645, "theta_prime": -156.086, "eta_base": -109.527, "theta_base": -108.462, "v0": -27.807, "v1": 34.309, "v2": -28.405, "v3": 13.240, "v4": 8.936, "amplitude": 34.054, "phase_angle": 146.523, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.013, "origin": [ 7.089, 22.321, 28.933 ], "x_axis": [ 0.183, -0.876, 0.446 ], "y_axis": [ -0.900, 0.033, 0.434 ], "z_axis": [ -0.395, -0.481, -0.783 ], "quaternion": [ 0.329, 0.695, -0.639, 0.018 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 30, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/30", "linked_nts": [ "///C/29", "///C/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -53.963, "beta": 163.515, "gamma": 51.229, "delta": 143.783, "epsilon": -152.870, "zeta": -173.663, "epsilon_zeta": 20.793, "bb_type": "--", "chi": -95.326, "glyco_bond": "anti", "C5prime_xyz": [ -2.388, 7.994, -2.276 ], "P_xyz": [ 0.188, 8.744, -2.413 ], "form": "B", "ssZp": 1.701, "Dp": 1.849, "splay_angle": 19.144, "splay_distance": 3.259, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 171.565, "theta": -141.741, "eta_prime": -159.359, "theta_prime": -157.412, "eta_base": -111.203, "theta_base": -130.568, "v0": -16.624, "v1": 32.620, "v2": -35.550, "v3": 26.969, "v4": -6.706, "amplitude": 35.908, "phase_angle": 171.901, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.016, "origin": [ 4.842, 20.610, 26.771 ], "x_axis": [ -0.438, -0.657, 0.614 ], "y_axis": [ -0.850, 0.526, -0.044 ], "z_axis": [ -0.294, -0.541, -0.788 ], "quaternion": [ -0.274, -0.454, 0.829, -0.176 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 31, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/31", "linked_nts": [ "///C/30", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": 25.696, "beta": 83.488, "gamma": 33.652, "delta": 117.990, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -91.698, "glyco_bond": "anti", "C5prime_xyz": [ -4.003, 7.740, -2.323 ], "P_xyz": [ -1.638, 9.085, -2.571 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -35.778, "v1": 40.742, "v2": -29.281, "v3": 9.651, "v4": 16.132, "amplitude": 39.808, "phase_angle": 137.354, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 3.990, 19.185, 23.967 ], "x_axis": [ -0.749, -0.426, 0.507 ], "y_axis": [ -0.638, 0.672, -0.377 ], "z_axis": [ -0.180, -0.606, -0.775 ], "quaternion": [ -0.192, -0.298, 0.894, -0.275 ] } }, { "index": 30, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": -172.357, "gamma": -103.001, "delta": 118.387, "epsilon": 143.571, "zeta": -75.763, "epsilon_zeta": -140.666, "bb_type": "BI", "chi": -141.161, "glyco_bond": "anti", "C5prime_xyz": [ -3.196, 8.856, -0.643 ], "P_xyz": [ -4.094, 11.060, -1.837 ], "form": ".", "ssZp": 1.728, "Dp": 2.726, "splay_angle": 24.330, "splay_distance": 3.964, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": null, "theta": 155.549, "eta_prime": null, "theta_prime": -173.665, "eta_base": null, "theta_base": -109.675, "v0": -43.961, "v1": 47.019, "v2": -31.749, "v3": 7.069, "v4": 23.065, "amplitude": 47.076, "phase_angle": 132.409, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.017, "origin": [ 0.844, 14.783, 19.686 ], "x_axis": [ -0.489, 0.832, -0.262 ], "y_axis": [ -0.738, -0.234, 0.633 ], "z_axis": [ 0.465, 0.503, 0.729 ], "quaternion": [ 0.502, 0.065, 0.363, 0.783 ] } }, { "index": 31, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -142.315, "beta": -96.759, "gamma": 66.892, "delta": 125.859, "epsilon": 164.361, "zeta": -90.460, "epsilon_zeta": -105.179, "bb_type": "BI", "chi": -97.890, "glyco_bond": "anti", "C5prime_xyz": [ -2.362, 8.055, -2.480 ], "P_xyz": [ -0.290, 9.394, -1.480 ], "form": "B", "ssZp": 1.706, "Dp": 1.816, "splay_angle": 22.153, "splay_distance": 3.679, "splay_ratio": 0.193, "d22": 4.760, "d64": 3.831, "eta": 162.151, "theta": -152.297, "eta_prime": -174.458, "theta_prime": -164.796, "eta_base": -105.196, "theta_base": -112.614, "v0": -19.860, "v1": 29.472, "v2": -27.083, "v3": 16.306, "v4": 2.087, "amplitude": 29.387, "phase_angle": 157.156, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.016, "origin": [ 1.732, 18.049, 21.752 ], "x_axis": [ -0.892, 0.299, 0.341 ], "y_axis": [ -0.063, -0.827, 0.559 ], "z_axis": [ 0.448, 0.477, 0.756 ], "quaternion": [ 0.097, 0.212, 0.278, 0.932 ] } }, { "index": 32, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -53.154, "beta": -159.195, "gamma": 38.874, "delta": 142.972, "epsilon": 175.760, "zeta": -90.753, "epsilon_zeta": -93.487, "bb_type": "BI", "chi": -97.147, "glyco_bond": "anti", "C5prime_xyz": [ -1.375, 7.842, -2.168 ], "P_xyz": [ 0.832, 9.100, -1.669 ], "form": "B", "ssZp": 0.944, "Dp": 1.288, "splay_angle": 16.852, "splay_distance": 3.012, "splay_ratio": 0.148, "d22": 3.934, "d64": 3.747, "eta": -173.188, "theta": -133.647, "eta_prime": -152.023, "theta_prime": -149.400, "eta_base": -102.046, "theta_base": -110.674, "v0": 4.972, "v1": 14.678, "v2": -27.475, "v3": 31.104, "v4": -23.074, "amplitude": 31.044, "phase_angle": 207.741, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.018, "origin": [ 3.258, 19.260, 24.872 ], "x_axis": [ -0.690, -0.326, 0.646 ], "y_axis": [ 0.541, -0.826, 0.161 ], "z_axis": [ 0.481, 0.461, 0.746 ], "quaternion": [ -0.240, 0.312, 0.172, 0.903 ] } }, { "index": 33, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.272, "beta": 166.901, "gamma": 39.657, "delta": 121.304, "epsilon": -141.378, "zeta": -164.931, "epsilon_zeta": 23.553, "bb_type": "--", "chi": -101.178, "glyco_bond": "anti", "C5prime_xyz": [ -3.445, 8.008, -2.319 ], "P_xyz": [ -1.561, 9.913, -2.690 ], "form": "B", "ssZp": 1.634, "Dp": 1.873, "splay_angle": 18.687, "splay_distance": 3.257, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 171.408, "theta": 178.654, "eta_prime": -166.734, "theta_prime": 177.037, "eta_base": -126.024, "theta_base": -140.613, "v0": -38.517, "v1": 38.315, "v2": -24.687, "v3": 2.958, "v4": 22.501, "amplitude": 39.875, "phase_angle": 128.251, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.014, "origin": [ 4.445, 20.724, 27.221 ], "x_axis": [ -0.335, -0.613, 0.716 ], "y_axis": [ 0.827, -0.555, -0.088 ], "z_axis": [ 0.452, 0.562, 0.693 ], "quaternion": [ -0.448, 0.363, 0.147, 0.804 ] } }, { "index": 34, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -31.792, "beta": 125.196, "gamma": 48.568, "delta": 122.203, "epsilon": -175.956, "zeta": -89.231, "epsilon_zeta": -86.725, "bb_type": "BI", "chi": -112.741, "glyco_bond": "anti", "C5prime_xyz": [ -2.181, 8.517, -2.025 ], "P_xyz": [ 0.396, 9.060, -1.981 ], "form": "B", "ssZp": 1.436, "Dp": 1.864, "splay_angle": 19.246, "splay_distance": 3.278, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 173.707, "theta": -135.846, "eta_prime": -162.994, "theta_prime": -156.966, "eta_base": -123.408, "theta_base": -113.852, "v0": -24.569, "v1": 32.777, "v2": -28.017, "v3": 14.293, "v4": 6.372, "amplitude": 32.293, "phase_angle": 150.178, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 6.536, 22.629, 28.837 ], "x_axis": [ 0.172, -0.830, 0.530 ], "y_axis": [ 0.897, -0.091, -0.433 ], "z_axis": [ 0.408, 0.550, 0.729 ], "quaternion": [ 0.673, -0.366, -0.046, -0.642 ] } }, { "index": 35, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.887, "beta": -158.970, "gamma": 23.630, "delta": 142.971, "epsilon": 172.901, "zeta": -87.464, "epsilon_zeta": -99.635, "bb_type": "BI", "chi": -93.502, "glyco_bond": "anti", "C5prime_xyz": [ -2.002, 7.821, -2.330 ], "P_xyz": [ -0.068, 9.613, -2.197 ], "form": ".", "ssZp": 1.850, "Dp": 1.786, "splay_angle": 18.523, "splay_distance": 3.302, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 162.441, "theta": -140.640, "eta_prime": -171.849, "theta_prime": -150.470, "eta_base": -123.957, "theta_base": -107.099, "v0": -5.230, "v1": 24.573, "v2": -33.179, "v3": 31.108, "v4": -16.697, "amplitude": 33.691, "phase_angle": 189.998, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 7.979, 24.253, 31.292 ], "x_axis": [ 0.662, -0.738, 0.132 ], "y_axis": [ 0.627, 0.448, -0.638 ], "z_axis": [ 0.412, 0.505, 0.759 ], "quaternion": [ 0.847, -0.337, 0.083, -0.403 ] } }, { "index": 36, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -57.981, "beta": 178.089, "gamma": 43.170, "delta": 139.916, "epsilon": -160.537, "zeta": 169.454, "epsilon_zeta": 30.008, "bb_type": "--", "chi": -96.071, "glyco_bond": "anti", "C5prime_xyz": [ -3.268, 8.149, -1.908 ], "P_xyz": [ -1.445, 10.045, -2.170 ], "form": ".", "ssZp": 2.422, "Dp": 2.245, "splay_angle": 28.275, "splay_distance": 4.492, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 167.898, "theta": 175.906, "eta_prime": -162.752, "theta_prime": 176.337, "eta_base": -115.482, "theta_base": -150.203, "v0": -22.887, "v1": 37.938, "v2": -37.115, "v3": 25.659, "v4": -2.065, "amplitude": 38.642, "phase_angle": 163.839, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.011, "origin": [ 10.044, 24.768, 33.818 ], "x_axis": [ 0.865, -0.438, -0.244 ], "y_axis": [ 0.250, 0.799, -0.547 ], "z_axis": [ 0.434, 0.413, 0.801 ], "quaternion": [ 0.931, -0.258, 0.182, -0.185 ] } }, { "index": 37, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 19.057, "beta": 118.340, "gamma": 19.677, "delta": 138.231, "epsilon": -177.038, "zeta": -91.950, "epsilon_zeta": -85.088, "bb_type": "BI", "chi": -111.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.868, 8.457, -1.677 ], "P_xyz": [ 0.342, 9.045, -0.393 ], "form": ".", "ssZp": 1.582, "Dp": 1.941, "splay_angle": 19.484, "splay_distance": 3.478, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": -179.153, "theta": -114.686, "eta_prime": -164.315, "theta_prime": -136.462, "eta_base": -133.786, "theta_base": -97.080, "v0": -22.352, "v1": 36.808, "v2": -36.528, "v3": 25.203, "v4": -2.102, "amplitude": 37.966, "phase_angle": 164.179, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 10.649, 26.528, 37.906 ], "x_axis": [ 0.811, -0.044, -0.583 ], "y_axis": [ -0.291, 0.835, -0.467 ], "z_axis": [ 0.507, 0.549, 0.664 ], "quaternion": [ 0.910, -0.279, 0.300, 0.068 ] } }, { "index": 38, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -67.576, "beta": -176.134, "gamma": 42.961, "delta": 129.385, "epsilon": -137.708, "zeta": -129.887, "epsilon_zeta": -7.821, "bb_type": "--", "chi": -104.784, "glyco_bond": "anti", "C5prime_xyz": [ -3.076, 8.193, -2.116 ], "P_xyz": [ -1.176, 10.071, -2.182 ], "form": "B", "ssZp": 1.789, "Dp": 1.795, "splay_angle": 21.368, "splay_distance": 3.668, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 173.712, "theta": -147.821, "eta_prime": -164.260, "theta_prime": -148.029, "eta_base": -116.579, "theta_base": -102.827, "v0": -33.935, "v1": 36.731, "v2": -25.599, "v3": 6.775, "v4": 17.030, "amplitude": 36.696, "phase_angle": 134.233, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.017, "origin": [ 13.227, 27.937, 39.768 ], "x_axis": [ 0.530, 0.460, -0.713 ], "y_axis": [ -0.672, 0.740, -0.023 ], "z_axis": [ 0.516, 0.492, 0.701 ], "quaternion": [ 0.862, -0.149, 0.357, 0.328 ] } }, { "index": 39, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -52.516, "beta": 146.690, "gamma": 40.626, "delta": 143.145, "epsilon": -78.879, "zeta": 132.498, "epsilon_zeta": 148.623, "bb_type": "BII", "chi": -94.246, "glyco_bond": "anti", "C5prime_xyz": [ -3.442, 7.880, -2.163 ], "P_xyz": [ -1.168, 9.079, -2.930 ], "form": "B", "ssZp": 1.414, "Dp": 1.083, "splay_angle": 23.794, "splay_distance": 3.949, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -178.671, "theta": 166.857, "eta_prime": -151.453, "theta_prime": 159.354, "eta_base": -110.083, "theta_base": -155.840, "v0": -28.407, "v1": 39.550, "v2": -34.090, "v3": 19.472, "v4": 5.336, "amplitude": 38.314, "phase_angle": 152.843, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 14.580, 30.932, 41.394 ], "x_axis": [ -0.036, 0.714, -0.699 ], "y_axis": [ -0.781, 0.416, 0.466 ], "z_axis": [ 0.624, 0.563, 0.543 ], "quaternion": [ 0.693, -0.035, 0.477, 0.539 ] } }, { "index": 40, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -94.267, "beta": 166.936, "gamma": 58.353, "delta": 141.472, "epsilon": -165.480, "zeta": -94.503, "epsilon_zeta": -70.976, "bb_type": "BI", "chi": -104.741, "glyco_bond": "anti", "C5prime_xyz": [ -2.343, 8.156, -2.175 ], "P_xyz": [ 0.136, 9.094, -1.585 ], "form": "B", "ssZp": 1.089, "Dp": 1.806, "splay_angle": 21.786, "splay_distance": 3.590, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 179.922, "theta": -110.626, "eta_prime": -155.798, "theta_prime": -134.704, "eta_base": -119.964, "theta_base": -82.968, "v0": -23.592, "v1": 34.674, "v2": -33.097, "v3": 20.601, "v4": 1.512, "amplitude": 35.461, "phase_angle": 158.963, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.329, "filter_rmsd": 0.099, "frame": { "rmsd": 0.021, "origin": [ 17.143, 31.462, 44.351 ], "x_axis": [ -0.267, 0.951, -0.159 ], "y_axis": [ -0.680, -0.069, 0.730 ], "z_axis": [ 0.683, 0.303, 0.665 ], "quaternion": [ 0.576, 0.185, 0.365, 0.707 ] } }, { "index": 41, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -86.609, "beta": -174.690, "gamma": 55.788, "delta": 125.149, "epsilon": -171.024, "zeta": -106.292, "epsilon_zeta": -64.731, "bb_type": "BI", "chi": -87.650, "glyco_bond": "anti", "C5prime_xyz": [ -2.998, 7.464, -2.793 ], "P_xyz": [ -0.858, 8.768, -3.470 ], "form": "B", "ssZp": 1.571, "Dp": 1.994, "splay_angle": 18.354, "splay_distance": 3.198, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 156.785, "theta": -147.305, "eta_prime": -173.607, "theta_prime": -158.890, "eta_base": -116.720, "theta_base": -124.576, "v0": -31.702, "v1": 33.860, "v2": -22.627, "v3": 5.627, "v4": 15.850, "amplitude": 33.442, "phase_angle": 132.580, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 18.079, 33.318, 47.277 ], "x_axis": [ -0.759, 0.591, 0.272 ], "y_axis": [ -0.233, -0.637, 0.735 ], "z_axis": [ 0.608, 0.494, 0.621 ], "quaternion": [ 0.237, 0.253, 0.354, 0.869 ] } }, { "index": 42, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.181, "beta": 167.648, "gamma": 45.427, "delta": 130.433, "epsilon": -162.127, "zeta": -70.278, "epsilon_zeta": -91.849, "bb_type": "BI", "chi": -90.024, "glyco_bond": "anti", "C5prime_xyz": [ -3.759, 7.920, -1.975 ], "P_xyz": [ -1.853, 9.444, -3.008 ], "form": ".", "ssZp": 2.926, "Dp": 2.582, "splay_angle": 21.698, "splay_distance": 4.064, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 160.190, "theta": -133.870, "eta_prime": -176.350, "theta_prime": -169.499, "eta_base": -139.396, "theta_base": -136.832, "v0": -35.088, "v1": 41.146, "v2": -30.584, "v3": 11.807, "v4": 14.088, "amplitude": 39.827, "phase_angle": 140.167, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 19.262, 35.075, 49.673 ], "x_axis": [ -0.843, 0.217, 0.493 ], "y_axis": [ 0.180, -0.749, 0.638 ], "z_axis": [ 0.507, 0.626, 0.592 ], "quaternion": [ 0.010, 0.280, 0.354, 0.892 ] } }, { "index": 43, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -98.351, "beta": 62.120, "gamma": -177.109, "delta": 89.958, "epsilon": -141.839, "zeta": -82.681, "epsilon_zeta": -59.159, "bb_type": "BI", "chi": 177.318, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 8.636, 1.622 ], "P_xyz": [ -2.201, 10.691, -0.110 ], "form": ".", "ssZp": 3.828, "Dp": 4.169, "splay_angle": 20.838, "splay_distance": 3.370, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": -148.103, "theta": 144.005, "eta_prime": -169.968, "theta_prime": 179.164, "eta_base": -129.591, "theta_base": -147.460, "v0": -10.979, "v1": -13.398, "v2": 31.171, "v3": -37.865, "v4": 30.892, "amplitude": 37.898, "phase_angle": 34.663, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 19.500, 38.376, 52.032 ], "x_axis": [ -0.741, -0.145, 0.655 ], "y_axis": [ 0.466, -0.814, 0.347 ], "z_axis": [ 0.483, 0.562, 0.671 ], "quaternion": [ -0.170, 0.317, 0.253, 0.898 ] } }, { "index": 44, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -64.506, "beta": -179.245, "gamma": 59.049, "delta": 145.628, "epsilon": 179.029, "zeta": -150.460, "epsilon_zeta": -30.511, "bb_type": "--", "chi": -119.375, "glyco_bond": "anti", "C5prime_xyz": [ -2.081, 8.628, -1.123 ], "P_xyz": [ 0.401, 9.371, -0.400 ], "form": "B", "ssZp": 2.001, "Dp": 2.088, "splay_angle": 24.265, "splay_distance": 3.905, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 157.807, "theta": -133.935, "eta_prime": -156.059, "theta_prime": -153.566, "eta_base": -123.330, "theta_base": -106.641, "v0": -20.470, "v1": 36.087, "v2": -37.145, "v3": 26.415, "v4": -3.982, "amplitude": 38.105, "phase_angle": 167.111, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.836, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 20.528, 41.176, 53.602 ], "x_axis": [ -0.350, -0.559, 0.752 ], "y_axis": [ 0.850, -0.527, 0.004 ], "z_axis": [ 0.394, 0.640, 0.659 ], "quaternion": [ -0.442, 0.360, 0.202, 0.796 ] } }, { "index": 45, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 50.015, "beta": 123.724, "gamma": -14.462, "delta": 148.154, "epsilon": 155.091, "zeta": -85.421, "epsilon_zeta": -119.487, "bb_type": "BI", "chi": -109.617, "glyco_bond": "anti", "C5prime_xyz": [ -1.753, 8.343, -1.523 ], "P_xyz": [ 0.282, 9.438, -0.241 ], "form": ".", "ssZp": 2.105, "Dp": 1.931, "splay_angle": 23.129, "splay_distance": 3.976, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 165.815, "theta": -135.204, "eta_prime": -165.494, "theta_prime": -153.542, "eta_base": -107.896, "theta_base": -123.173, "v0": -11.473, "v1": 31.280, "v2": -38.366, "v3": 31.566, "v4": -13.136, "amplitude": 38.372, "phase_angle": 180.946, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 21.666, 43.677, 56.376 ], "x_axis": [ 0.348, -0.726, 0.593 ], "y_axis": [ 0.781, -0.125, -0.612 ], "z_axis": [ 0.519, 0.676, 0.524 ], "quaternion": [ 0.661, -0.487, -0.028, -0.570 ] } }, { "index": 46, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -83.225, "beta": -156.953, "gamma": 64.442, "delta": 120.862, "epsilon": 176.263, "zeta": -96.385, "epsilon_zeta": -87.351, "bb_type": "BI", "chi": -123.317, "glyco_bond": "anti", "C5prime_xyz": [ -2.357, 8.669, -1.569 ], "P_xyz": [ -0.287, 10.087, -0.724 ], "form": "B", "ssZp": 1.807, "Dp": 2.182, "splay_angle": 17.926, "splay_distance": 3.065, "splay_ratio": 0.158, "d22": 4.523, "d64": 4.213, "eta": 179.044, "theta": -151.307, "eta_prime": -162.763, "theta_prime": -160.280, "eta_base": -124.363, "theta_base": -118.971, "v0": -35.322, "v1": 35.504, "v2": -23.566, "v3": 3.856, "v4": 19.630, "amplitude": 36.703, "phase_angle": 129.947, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.013, "origin": [ 22.373, 46.522, 59.063 ], "x_axis": [ 0.734, -0.638, 0.234 ], "y_axis": [ 0.452, 0.201, -0.869 ], "z_axis": [ 0.507, 0.744, 0.436 ], "quaternion": [ 0.770, -0.524, 0.089, -0.354 ] } }, { "index": 47, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.842, "beta": 178.316, "gamma": 58.475, "delta": 120.163, "epsilon": -168.667, "zeta": -108.895, "epsilon_zeta": -59.772, "bb_type": "BI", "chi": -111.741, "glyco_bond": "anti", "C5prime_xyz": [ -2.473, 8.376, -1.996 ], "P_xyz": [ -0.317, 9.811, -1.668 ], "form": "B", "ssZp": 1.202, "Dp": 1.694, "splay_angle": 19.533, "splay_distance": 3.319, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -172.772, "theta": -156.568, "eta_prime": -153.629, "theta_prime": -165.015, "eta_base": -111.227, "theta_base": -109.574, "v0": -28.241, "v1": 30.857, "v2": -22.412, "v3": 6.984, "v4": 13.133, "amplitude": 30.850, "phase_angle": 136.592, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.018, "origin": [ 23.563, 48.567, 61.010 ], "x_axis": [ 0.937, -0.272, -0.221 ], "y_axis": [ -0.027, 0.572, -0.820 ], "z_axis": [ 0.349, 0.774, 0.528 ], "quaternion": [ 0.871, -0.457, 0.164, -0.070 ] } }, { "index": 48, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.569, "beta": 164.316, "gamma": 52.721, "delta": 117.855, "epsilon": -179.662, "zeta": -90.108, "epsilon_zeta": -89.553, "bb_type": "BI", "chi": -107.082, "glyco_bond": "anti", "C5prime_xyz": [ -1.985, 8.317, -2.375 ], "P_xyz": [ 0.435, 9.336, -2.304 ], "form": "B", "ssZp": 1.003, "Dp": 1.708, "splay_angle": 20.025, "splay_distance": 3.603, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 179.349, "theta": -147.581, "eta_prime": -158.471, "theta_prime": -163.066, "eta_base": -104.602, "theta_base": -129.586, "v0": -35.587, "v1": 33.346, "v2": -20.840, "v3": 0.973, "v4": 21.935, "amplitude": 35.881, "phase_angle": 125.508, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.037, "origin": [ 24.654, 51.399, 62.353 ], "x_axis": [ 0.694, 0.293, -0.658 ], "y_axis": [ -0.664, 0.613, -0.427 ], "z_axis": [ 0.279, 0.734, 0.620 ], "quaternion": [ 0.855, -0.339, 0.274, 0.280 ] } }, { "index": 49, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -60.336, "beta": 175.336, "gamma": 38.759, "delta": 124.835, "epsilon": -101.615, "zeta": -170.413, "epsilon_zeta": 68.798, "bb_type": "BII", "chi": -107.782, "glyco_bond": "anti", "C5prime_xyz": [ -2.931, 8.438, -1.866 ], "P_xyz": [ -1.016, 10.255, -2.059 ], "form": ".", "ssZp": 1.507, "Dp": 1.483, "splay_angle": 21.968, "splay_distance": 4.026, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": -173.086, "theta": -179.617, "eta_prime": -162.703, "theta_prime": -174.176, "eta_base": -129.138, "theta_base": -118.202, "v0": -31.512, "v1": 38.187, "v2": -29.379, "v3": 11.524, "v4": 12.660, "amplitude": 37.321, "phase_angle": 141.925, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.013, "origin": [ 25.658, 53.558, 65.057 ], "x_axis": [ 0.372, 0.592, -0.715 ], "y_axis": [ -0.904, 0.405, -0.135 ], "z_axis": [ 0.210, 0.697, 0.686 ], "quaternion": [ 0.785, -0.265, 0.295, 0.477 ] } }, { "index": 50, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.938, "beta": 118.619, "gamma": 77.935, "delta": 129.397, "epsilon": -179.480, "zeta": -69.557, "epsilon_zeta": -109.922, "bb_type": "BI", "chi": -113.077, "glyco_bond": "anti", "C5prime_xyz": [ -2.079, 8.544, -1.938 ], "P_xyz": [ 0.507, 8.386, -2.520 ], "form": ".", "ssZp": 1.278, "Dp": 1.928, "splay_angle": 18.950, "splay_distance": 3.594, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 158.352, "theta": -96.112, "eta_prime": -150.333, "theta_prime": -156.343, "eta_base": -101.836, "theta_base": -126.226, "v0": -31.221, "v1": 40.349, "v2": -34.220, "v3": 17.142, "v4": 8.574, "amplitude": 39.876, "phase_angle": 149.112, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 24.572, 56.315, 67.784 ], "x_axis": [ -0.290, 0.808, -0.513 ], "y_axis": [ -0.910, -0.067, 0.409 ], "z_axis": [ 0.296, 0.586, 0.755 ], "quaternion": [ 0.591, -0.075, 0.342, 0.727 ] } }, { "index": 51, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -172.635, "beta": 152.766, "gamma": 150.139, "delta": 122.856, "epsilon": -163.216, "zeta": -76.910, "epsilon_zeta": -86.306, "bb_type": "BI", "chi": -134.031, "glyco_bond": "anti", "C5prime_xyz": [ -3.142, 8.876, -0.773 ], "P_xyz": [ -2.167, 10.195, -2.943 ], "form": "B", "ssZp": 2.771, "Dp": 2.786, "splay_angle": 20.949, "splay_distance": 3.459, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 173.019, "theta": 178.878, "eta_prime": -174.125, "theta_prime": 166.922, "eta_base": -142.193, "theta_base": -134.638, "v0": -41.277, "v1": 44.408, "v2": -30.082, "v3": 6.925, "v4": 21.473, "amplitude": 44.335, "phase_angle": 132.729, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.016, "origin": [ 26.480, 58.755, 69.606 ], "x_axis": [ -0.648, 0.707, -0.283 ], "y_axis": [ -0.672, -0.355, 0.650 ], "z_axis": [ 0.359, 0.612, 0.705 ], "quaternion": [ 0.419, 0.023, 0.384, 0.823 ] } }, { "index": 52, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end", "alpha": -151.914, "beta": 101.330, "gamma": 141.222, "delta": 98.118, "epsilon": 167.937, "zeta": 19.622, "epsilon_zeta": 148.315, "bb_type": "--", "chi": -173.507, "glyco_bond": "anti", "C5prime_xyz": [ -0.922, 8.114, 1.561 ], "P_xyz": [ 0.218, 9.655, -0.284 ], "form": ".", "ssZp": 3.818, "Dp": 4.011, "splay_angle": 36.931, "splay_distance": 5.458, "splay_ratio": 0.329, "d22": null, "d64": null, "eta": -177.899, "theta": -146.922, "eta_prime": 172.664, "theta_prime": -136.512, "eta_base": -120.675, "theta_base": -56.493, "v0": 23.099, "v1": -32.705, "v2": 29.706, "v3": -16.885, "v4": -3.758, "amplitude": 32.783, "phase_angle": 334.977, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 27.589, 61.493, 71.406 ], "x_axis": [ -0.901, 0.312, 0.300 ], "y_axis": [ -0.050, -0.764, 0.644 ], "z_axis": [ 0.430, 0.565, 0.704 ], "quaternion": [ 0.099, 0.199, 0.329, 0.918 ] } }, { "index": 53, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -170.175, "beta": 149.349, "gamma": 126.870, "delta": 132.838, "epsilon": 168.606, "zeta": -72.080, "epsilon_zeta": -119.314, "bb_type": "BI", "chi": 43.524, "glyco_bond": "syn", "C5prime_xyz": [ -5.889, 4.894, 0.191 ], "P_xyz": [ -6.828, 2.774, 1.434 ], "form": ".", "ssZp": -2.064, "Dp": 2.722, "splay_angle": 20.405, "splay_distance": 3.533, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 146.112, "theta": -99.488, "eta_prime": -155.306, "theta_prime": -120.390, "eta_base": -57.646, "theta_base": -143.387, "v0": -34.604, "v1": 45.906, "v2": -38.352, "v3": 19.249, "v4": 9.423, "amplitude": 44.703, "phase_angle": 149.086, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 26.909, 60.865, 76.784 ], "x_axis": [ -0.726, 0.559, -0.402 ], "y_axis": [ 0.658, 0.393, -0.642 ], "z_axis": [ -0.201, -0.730, -0.653 ], "quaternion": [ 0.060, 0.366, 0.832, -0.412 ] } }, { "index": 54, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BII,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": 172.233, "beta": -100.639, "gamma": 79.155, "delta": 94.564, "epsilon": -90.428, "zeta": 124.969, "epsilon_zeta": 144.603, "bb_type": "BII", "chi": -86.381, "glyco_bond": "anti", "C5prime_xyz": [ -4.509, 7.434, -2.303 ], "P_xyz": [ -2.660, 9.217, -3.188 ], "form": ".", "ssZp": 0.914, "Dp": 1.422, "splay_angle": 20.112, "splay_distance": 4.007, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 152.688, "theta": 159.461, "eta_prime": -169.518, "theta_prime": 154.205, "eta_base": -178.619, "theta_base": -150.704, "v0": -36.343, "v1": 24.124, "v2": -3.487, "v3": -17.457, "v4": 33.576, "amplitude": 36.396, "phase_angle": 95.498, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.017, "origin": [ 26.406, 64.158, 77.958 ], "x_axis": [ -0.017, -0.769, 0.639 ], "y_axis": [ 1.000, -0.022, 0.000 ], "z_axis": [ 0.014, 0.639, 0.769 ], "quaternion": [ 0.658, -0.243, -0.238, -0.672 ] } }, { "index": 55, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "DNA", "dbn": ".", "summary": "non-pair-contact,ss-non-loop", "alpha": -17.721, "beta": 95.806, "gamma": -13.387, "delta": 91.659, "epsilon": 52.152, "zeta": 50.912, "epsilon_zeta": 1.239, "bb_type": "--", "chi": 91.069, "glyco_bond": "--", "C5prime_xyz": [ -4.791, 6.623, 2.508 ], "P_xyz": [ -6.803, 4.803, 2.672 ], "form": ".", "ssZp": -1.572, "Dp": 1.544, "splay_angle": 23.331, "splay_distance": 4.358, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 168.961, "theta": -132.608, "eta_prime": 173.169, "theta_prime": -145.495, "eta_base": -132.022, "theta_base": 174.507, "v0": -36.753, "v1": 25.614, "v2": -5.952, "v3": -14.772, "v4": 31.912, "amplitude": 35.929, "phase_angle": 99.536, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 28.409, 67.252, 79.530 ], "x_axis": [ -0.992, -0.044, -0.119 ], "y_axis": [ 0.057, 0.684, -0.727 ], "z_axis": [ 0.114, -0.728, -0.676 ], "quaternion": [ 0.064, 0.004, 0.915, -0.397 ] } }, { "index": 56, "index_chain": 27, "chain_name": "D", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": 79.985, "beta": -171.451, "gamma": -155.633, "delta": 125.514, "epsilon": -168.635, "zeta": -122.321, "epsilon_zeta": -46.314, "bb_type": "BI", "chi": -120.808, "glyco_bond": "anti", "C5prime_xyz": [ -3.089, 8.638, -1.376 ], "P_xyz": [ -2.979, 9.902, -3.747 ], "form": ".", "ssZp": 2.377, "Dp": 2.481, "splay_angle": 30.717, "splay_distance": 5.798, "splay_ratio": 0.281, "d22": 4.331, "d64": 5.985, "eta": -154.822, "theta": 174.291, "eta_prime": -152.412, "theta_prime": -169.287, "eta_base": 166.504, "theta_base": -149.595, "v0": -37.128, "v1": 42.084, "v2": -30.561, "v3": 10.182, "v4": 16.642, "amplitude": 41.339, "phase_angle": 137.671, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 25.220, 70.088, 80.413 ], "x_axis": [ 0.364, -0.706, 0.608 ], "y_axis": [ 0.903, 0.427, -0.045 ], "z_axis": [ -0.228, 0.565, 0.793 ], "quaternion": [ 0.804, -0.190, -0.260, -0.501 ] } }, { "index": 57, "index_chain": 28, "chain_name": "D", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,ss-non-loop", "alpha": 34.748, "beta": 111.884, "gamma": -35.744, "delta": 135.455, "epsilon": 156.875, "zeta": 171.044, "epsilon_zeta": -14.169, "bb_type": "--", "chi": -88.795, "glyco_bond": "anti", "C5prime_xyz": [ -4.572, 7.789, -1.476 ], "P_xyz": [ -4.644, 10.309, -0.509 ], "form": ".", "ssZp": 3.226, "Dp": 3.270, "splay_angle": 30.305, "splay_distance": 4.906, "splay_ratio": 0.282, "d22": 5.482, "d64": 5.730, "eta": 134.518, "theta": 142.459, "eta_prime": 163.822, "theta_prime": 153.936, "eta_base": -174.145, "theta_base": -174.395, "v0": -40.397, "v1": 51.646, "v2": -41.155, "v3": 20.527, "v4": 11.550, "amplitude": 49.215, "phase_angle": 146.742, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.015, "origin": [ 22.724, 71.799, 85.358 ], "x_axis": [ 0.542, -0.710, 0.449 ], "y_axis": [ 0.828, 0.358, -0.432 ], "z_axis": [ 0.146, 0.606, 0.782 ], "quaternion": [ 0.819, -0.317, -0.093, -0.469 ] } }, { "index": 58, "index_chain": 29, "chain_name": "D", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/29", "linked_nts": [ "///D/28", "///D/30" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop", "alpha": 62.084, "beta": 119.864, "gamma": -19.672, "delta": 81.952, "epsilon": -132.911, "zeta": -21.459, "epsilon_zeta": -111.452, "bb_type": "--", "chi": -149.580, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.950, -0.070 ], "P_xyz": [ 0.653, 9.521, 1.410 ], "form": ".", "ssZp": 4.043, "Dp": 4.630, "splay_angle": 74.824, "splay_distance": 11.578, "splay_ratio": 0.608, "d22": null, "d64": null, "eta": -167.520, "theta": -88.323, "eta_prime": 164.434, "theta_prime": -73.936, "eta_base": -176.776, "theta_base": -54.310, "v0": 4.900, "v1": -27.831, "v2": 39.183, "v3": -37.150, "v4": 20.361, "amplitude": 40.002, "phase_angle": 11.612, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.014, "origin": [ 20.596, 72.986, 89.617 ], "x_axis": [ 0.762, -0.632, -0.139 ], "y_axis": [ 0.354, 0.587, -0.728 ], "z_axis": [ 0.542, 0.506, 0.671 ], "quaternion": [ 0.869, -0.355, 0.196, -0.284 ] } }, { "index": 59, "index_chain": 30, "chain_name": "D", "nt_resnum": 30, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/30", "linked_nts": [ "///D/29", "///D/31" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-canonical,ss-non-loop", "alpha": -85.109, "beta": 137.865, "gamma": 153.617, "delta": 136.938, "epsilon": -93.842, "zeta": -117.181, "epsilon_zeta": 23.339, "bb_type": "--", "chi": -140.599, "glyco_bond": "anti", "C5prime_xyz": [ -0.965, 8.451, 0.070 ], "P_xyz": [ 0.978, 9.222, -1.703 ], "form": ".", "ssZp": 1.235, "Dp": 1.893, "splay_angle": 19.142, "splay_distance": 4.270, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": -84.551, "theta": -176.154, "eta_prime": -60.958, "theta_prime": -161.254, "eta_base": -28.595, "theta_base": -157.305, "v0": 3.848, "v1": 11.908, "v2": -22.009, "v3": 24.611, "v4": -18.158, "amplitude": 24.730, "phase_angle": 207.131, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.014, "origin": [ 31.439, 76.020, 86.919 ], "x_axis": [ 0.467, 0.800, -0.377 ], "y_axis": [ -0.813, 0.556, 0.173 ], "z_axis": [ 0.348, 0.226, 0.910 ], "quaternion": [ 0.856, -0.015, 0.211, 0.471 ] } }, { "index": 60, "index_chain": 31, "chain_name": "D", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/31", "linked_nts": [ "///D/30", null ], "nt_type": "DNA", "dbn": ".", "summary": "~C3'-endo,non-stack,non-pair-contact,ss-non-loop", "alpha": -103.997, "beta": 149.907, "gamma": 70.304, "delta": 108.061, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -61.346, "glyco_bond": "--", "C5prime_xyz": [ -3.591, 6.481, -3.250 ], "P_xyz": [ -1.832, 5.366, -4.993 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -8.352, "v1": 2.738, "v2": 3.417, "v3": -8.280, "v4": 10.520, "amplitude": 10.296, "phase_angle": 70.618, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.013, "origin": [ 29.180, 75.166, 90.441 ], "x_axis": [ 0.512, 0.843, 0.163 ], "y_axis": [ -0.564, 0.187, 0.805 ], "z_axis": [ 0.648, -0.504, 0.571 ], "quaternion": [ 0.753, 0.434, 0.161, 0.467 ] } } ], "num_hbonds": 312, "hbonds": [ { "index": 1, "atom1_serNum": 19, "atom2_serNum": 2801, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///A/360/N", "atom2_id": "///D/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2, "atom1_serNum": 27, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/360/NZ", "atom2_id": "///C/17/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 3, "atom1_serNum": 27, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/360/NZ", "atom2_id": "///D/18/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 4, "atom1_serNum": 28, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/361/N", "atom2_id": "///C/17/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 5, "atom1_serNum": 28, "atom2_serNum": 2124, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/361/N", "atom2_id": "///C/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 31, "atom2_serNum": 2110, "donAcc_type": "questionable", "distance": 3.108, "atom1_id": "///A/361/O", "atom2_id": "///C/17/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 7, "atom1_serNum": 36, "atom2_serNum": 81, "donAcc_type": "questionable", "distance": 3.335, "atom1_id": "///A/362/O", "atom2_id": "///A/367/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 36, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/362/O", "atom2_id": "///A/398/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 39, "atom2_serNum": 2103, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/363/N", "atom2_id": "///C/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 10, "atom1_serNum": 50, "atom2_serNum": 81, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/364/N", "atom2_id": "///A/367/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 53, "atom2_serNum": 83, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/364/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 55, "atom2_serNum": 72, "donAcc_type": "acceptable", "distance": 3.674, "atom1_id": "///A/364/OG1", "atom2_id": "///A/366/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 60, "atom2_serNum": 91, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/365/O", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 65, "atom2_serNum": 72, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/366/N", "atom2_id": "///A/366/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 68, "atom2_serNum": 100, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/366/O", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 77, "atom2_serNum": 111, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/367/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 81, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/367/OE1", "atom2_id": "///A/398/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 86, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/368/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 89, "atom2_serNum": 410, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/368/OD1", "atom2_id": "///A/406/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 90, "atom2_serNum": 413, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/368/OD2", "atom2_id": "///A/406/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 94, "atom2_serNum": 127, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/369/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 99, "atom2_serNum": 487, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/369/OE2", "atom2_id": "///A/414/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 99, "atom2_serNum": 488, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/369/OE2", "atom2_id": "///A/414/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 103, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/370/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 114, "atom2_serNum": 142, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 122, "atom2_serNum": 149, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 130, "atom2_serNum": 160, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 134, "atom2_serNum": 168, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/373/OD2", "atom2_id": "///A/377/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 138, "atom2_serNum": 169, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 138, "atom2_serNum": 176, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/374/O", "atom2_id": "///A/378/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 152, "atom2_serNum": 525, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/376/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 156, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/376/NE", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 156, "atom2_serNum": 509, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/376/NE", "atom2_id": "///A/417/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 159, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/376/NH2", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 172, "atom2_serNum": 191, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/378/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 175, "atom2_serNum": 200, "donAcc_type": "standard", "distance": 3.936, "atom1_id": "///A/378/OD1", "atom2_id": "///A/381/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 180, "atom2_serNum": 202, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/379/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 180, "atom2_serNum": 211, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///A/379/O", "atom2_id": "///A/382/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 194, "atom2_serNum": 220, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/381/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 194, "atom2_serNum": 225, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///A/381/O", "atom2_id": "///A/384/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 200, "atom2_serNum": 279, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/381/NH1", "atom2_id": "///A/390/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 201, "atom2_serNum": 242, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///A/381/NH2", "atom2_id": "///A/386/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 201, "atom2_serNum": 280, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/381/NH2", "atom2_id": "///A/390/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 205, "atom2_serNum": 263, "donAcc_type": "acceptable", "distance": 2.561, "atom1_id": "///A/382/O", "atom2_id": "///A/388/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 211, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/382/NH1", "atom2_id": "///A/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 212, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/382/NH2", "atom2_id": "///A/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 216, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/383/O", "atom2_id": "///A/404/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 218, "atom2_serNum": 2632, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///A/383/OG1", "atom2_id": "///D/12/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 49, "atom1_serNum": 223, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///A/384/O", "atom2_id": "///A/404/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 225, "atom2_serNum": 244, "donAcc_type": "acceptable", "distance": 3.578, "atom1_id": "///A/384/OG1", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 227, "atom2_serNum": 2612, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/385/N", "atom2_id": "///D/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 230, "atom2_serNum": 264, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/385/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 236, "atom2_serNum": 2643, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/385/NE2", "atom2_id": "///D/12/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 54, "atom1_serNum": 236, "atom2_serNum": 2646, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/385/NE2", "atom2_id": "///D/12/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 236, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/385/NE2", "atom2_id": "///D/13/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 56, "atom1_serNum": 237, "atom2_serNum": 2612, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/386/N", "atom2_id": "///D/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 57, "atom1_serNum": 240, "atom2_serNum": 272, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/386/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 242, "atom2_serNum": 2611, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///A/386/OG1", "atom2_id": "///D/11/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 59, "atom1_serNum": 247, "atom2_serNum": 281, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 255, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 267, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/389/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 267, "atom2_serNum": 294, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/389/O", "atom2_id": "///A/392/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 275, "atom2_serNum": 295, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/390/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 284, "atom2_serNum": 305, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/391/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 284, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 345, "atom2_serNum": 2125, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///A/398/ND1", "atom2_id": "///C/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 67, "atom1_serNum": 349, "atom2_serNum": 373, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///A/399/N", "atom2_id": "///A/402/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 352, "atom2_serNum": 374, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/399/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 354, "atom2_serNum": 368, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///A/399/OG1", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 354, "atom2_serNum": 1786, "donAcc_type": "acceptable", "distance": 3.819, "atom1_id": "///A/399/OG1", "atom2_id": "///A/592/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 354, "atom2_serNum": 2144, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/399/OG1", "atom2_id": "///C/19/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 72, "atom1_serNum": 356, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/400/N", "atom2_id": "///A/592/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 359, "atom2_serNum": 382, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 360, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/401/N", "atom2_id": "///A/592/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 363, "atom2_serNum": 393, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 366, "atom2_serNum": 2179, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/401/OD1", "atom2_id": "///C/20/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 77, "atom1_serNum": 367, "atom2_serNum": 1781, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/401/ND2", "atom2_id": "///A/591/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 367, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///A/401/ND2", "atom2_id": "///C/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 79, "atom1_serNum": 371, "atom2_serNum": 403, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 373, "atom2_serNum": 2125, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/402/OG", "atom2_id": "///C/18/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 377, "atom2_serNum": 414, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 385, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 391, "atom2_serNum": 2690, "donAcc_type": "standard", "distance": 3.616, "atom1_id": "///A/404/NH1", "atom2_id": "///D/14/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 84, "atom1_serNum": 392, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/404/NH2", "atom2_id": "///D/13/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 85, "atom1_serNum": 396, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 406, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 406, "atom2_serNum": 455, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/406/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 412, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/406/NH1", "atom2_id": "///C/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 417, "atom2_serNum": 455, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 417, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/407/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 417, "atom2_serNum": 468, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///A/407/O", "atom2_id": "///A/412/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 428, "atom2_serNum": 468, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///A/408/O", "atom2_id": "///A/412/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 439, "atom2_serNum": 477, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///A/409/O", "atom2_id": "///A/413/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 454, "atom2_serNum": 2083, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///A/410/OH", "atom2_id": "///C/16/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 95, "atom1_serNum": 458, "atom2_serNum": 478, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/411/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 458, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 466, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/412/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 492, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/415/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 505, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/416/OE2", "atom2_id": "///A/439/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 518, "atom2_serNum": 684, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/418/N", "atom2_id": "///A/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 521, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/418/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 537, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/420/N", "atom2_id": "///A/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 540, "atom2_serNum": 602, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/420/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 553, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/422/N", "atom2_id": "///A/426/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 556, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/422/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 559, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/422/OD1", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 559, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/422/OD1", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 605, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///A/428/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 618, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/429/NH1", "atom2_id": "///A/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 620, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/430/N", "atom2_id": "///A/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 626, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/430/OD1", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 626, "atom2_serNum": 648, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///A/430/OD1", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 639, "atom2_serNum": 655, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/432/O", "atom2_id": "///A/434/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 686, "atom2_serNum": 697, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///A/438/OG1", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 732, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/445/N", "atom2_id": "///D/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 116, "atom1_serNum": 740, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/446/N", "atom2_id": "///D/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 117, "atom1_serNum": 749, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/447/N", "atom2_id": "///C/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 118, "atom1_serNum": 752, "atom2_serNum": 2268, "donAcc_type": "questionable", "distance": 3.228, "atom1_id": "///A/447/O", "atom2_id": "///C/25/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 119, "atom1_serNum": 763, "atom2_serNum": 806, "donAcc_type": "questionable", "distance": 3.361, "atom1_id": "///A/448/O", "atom2_id": "///A/453/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 768, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/448/NZ", "atom2_id": "///D/12/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 121, "atom1_serNum": 768, "atom2_serNum": 2653, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/448/NZ", "atom2_id": "///D/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 122, "atom1_serNum": 780, "atom2_serNum": 806, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/450/N", "atom2_id": "///A/453/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 783, "atom2_serNum": 799, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/450/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 783, "atom2_serNum": 808, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 789, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/451/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 789, "atom2_serNum": 1519, "donAcc_type": "acceptable", "distance": 3.365, "atom1_id": "///A/451/O", "atom2_id": "///A/557/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 794, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/452/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 794, "atom2_serNum": 833, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///A/452/O", "atom2_id": "///A/456/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 797, "atom2_serNum": 1557, "donAcc_type": "acceptable", "distance": 2.646, "atom1_id": "///A/452/OD1", "atom2_id": "///A/561/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 797, "atom2_serNum": 1589, "donAcc_type": "standard", "distance": 3.881, "atom1_id": "///A/452/OD1", "atom2_id": "///A/565/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 802, "atom2_serNum": 835, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/453/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 806, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/453/OE1", "atom2_id": "///A/536/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 811, "atom2_serNum": 843, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 814, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/454/OD1", "atom2_id": "///A/544/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 815, "atom2_serNum": 1404, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/454/OD2", "atom2_id": "///A/544/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 815, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/454/OD2", "atom2_id": "///A/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 819, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 827, "atom2_serNum": 1566, "donAcc_type": "acceptable", "distance": 3.072, "atom1_id": "///A/455/OH", "atom2_id": "///A/562/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 831, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 838, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/457/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 846, "atom2_serNum": 868, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/458/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 851, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/459/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 859, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/460/O", "atom2_id": "///A/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 864, "atom2_serNum": 895, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/461/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 871, "atom2_serNum": 906, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/462/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 880, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 889, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 898, "atom2_serNum": 937, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 909, "atom2_serNum": 945, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 917, "atom2_serNum": 1083, "donAcc_type": "acceptable", "distance": 3.239, "atom1_id": "///A/466/OH", "atom2_id": "///A/507/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 921, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 936, "atom2_serNum": 1190, "donAcc_type": "questionable", "distance": 3.165, "atom1_id": "///A/468/OD2", "atom2_id": "///A/520/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 959, "atom2_serNum": 1023, "donAcc_type": "acceptable", "distance": 3.937, "atom1_id": "///A/471/O", "atom2_id": "///A/479/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 959, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/471/O", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 973, "atom2_serNum": 1010, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/473/N", "atom2_id": "///A/478/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 976, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 991, "atom2_serNum": 1001, "donAcc_type": "acceptable", "distance": 2.871, "atom1_id": "///A/475/O", "atom2_id": "///A/476/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1023, "atom2_serNum": 1032, "donAcc_type": "acceptable", "distance": 3.443, "atom1_id": "///A/479/OG", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1050, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/502/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1083, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/507/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1090, "atom2_serNum": 1094, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/508/O", "atom2_id": "///A/508/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1090, "atom2_serNum": 1111, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/508/O", "atom2_id": "///A/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1109, "atom2_serNum": 1138, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/510/O", "atom2_id": "///A/513/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1119, "atom2_serNum": 1135, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/512/O", "atom2_id": "///A/513/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1139, "atom2_serNum": 1498, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/514/N", "atom2_id": "///A/555/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1139, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/514/N", "atom2_id": "///A/555/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1142, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/514/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1146, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/515/N", "atom2_id": "///A/555/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1168, "atom2_serNum": 1186, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/517/NE", "atom2_id": "///A/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1181, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 3.785, "atom1_id": "///A/518/NH1", "atom2_id": "///D/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 171, "atom1_serNum": 1194, "atom2_serNum": 2464, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/521/N", "atom2_id": "///D/4/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 172, "atom1_serNum": 1205, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/522/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1207, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/523/N", "atom2_id": "///D/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 174, "atom1_serNum": 1210, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/523/O", "atom2_id": "///A/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1221, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/524/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1221, "atom2_serNum": 1264, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///A/524/O", "atom2_id": "///A/528/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1230, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/525/O", "atom2_id": "///A/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1241, "atom2_serNum": 1279, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/526/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1252, "atom2_serNum": 1284, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1257, "atom2_serNum": 1292, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/527/NZ", "atom2_id": "///A/531/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1261, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/528/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1271, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///A/529/O", "atom2_id": "///A/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1305, "atom2_serNum": 1369, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/533/O", "atom2_id": "///A/541/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1328, "atom2_serNum": 2283, "donAcc_type": "acceptable", "distance": 2.602, "atom1_id": "///A/536/ND1", "atom2_id": "///C/26/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 185, "atom1_serNum": 1335, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/537/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1337, "atom2_serNum": 1356, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///A/537/OG1", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1337, "atom2_serNum": 2302, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///A/537/OG1", "atom2_id": "///C/27/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 188, "atom1_serNum": 1342, "atom2_serNum": 1375, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/538/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1351, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/539/O", "atom2_id": "///A/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1355, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/539/ND2", "atom2_id": "///C/27/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 191, "atom1_serNum": 1359, "atom2_serNum": 1394, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/540/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1364, "atom2_serNum": 1405, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/541/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1378, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1385, "atom2_serNum": 2495, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/542/NH2", "atom2_id": "///D/5/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 195, "atom1_serNum": 1385, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/542/NH2", "atom2_id": "///D/5/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 196, "atom1_serNum": 1389, "atom2_serNum": 1427, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1392, "atom2_serNum": 1435, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/543/OD1", "atom2_id": "///A/547/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1392, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/543/OD1", "atom2_id": "///C/27/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 199, "atom1_serNum": 1393, "atom2_serNum": 1435, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/543/OD2", "atom2_id": "///A/547/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1393, "atom2_serNum": 2297, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/543/OD2", "atom2_id": "///C/26/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 201, "atom1_serNum": 1397, "atom2_serNum": 1436, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1397, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/544/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1403, "atom2_serNum": 1671, "donAcc_type": "questionable", "distance": 3.427, "atom1_id": "///A/544/NH1", "atom2_id": "///A/575/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1403, "atom2_serNum": 2262, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/544/NH1", "atom2_id": "///C/25/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 205, "atom1_serNum": 1404, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/544/NH2", "atom2_id": "///A/574/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1408, "atom2_serNum": 1455, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/545/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1425, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/546/NH1", "atom2_id": "///D/6/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 208, "atom1_serNum": 1426, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/546/NH2", "atom2_id": "///D/6/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 209, "atom1_serNum": 1435, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///A/547/NZ", "atom2_id": "///D/7/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 210, "atom1_serNum": 1439, "atom2_serNum": 1468, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1450, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1471, "atom2_serNum": 1507, "donAcc_type": "questionable", "distance": 3.360, "atom1_id": "///A/552/O", "atom2_id": "///A/556/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1483, "atom2_serNum": 1508, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/553/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1487, "atom2_serNum": 1520, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/554/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1495, "atom2_serNum": 1528, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/555/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1495, "atom2_serNum": 1533, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///A/555/O", "atom2_id": "///A/559/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1500, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/556/N", "atom2_id": "///A/556/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1503, "atom2_serNum": 1533, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///A/556/O", "atom2_id": "///A/559/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1503, "atom2_serNum": 1534, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/556/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1511, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/557/O", "atom2_id": "///A/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1519, "atom2_serNum": 1642, "donAcc_type": "acceptable", "distance": 3.235, "atom1_id": "///A/557/OH", "atom2_id": "///A/572/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1523, "atom2_serNum": 1558, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/558/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1531, "atom2_serNum": 1567, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/559/O", "atom2_id": "///A/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1537, "atom2_serNum": 1572, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/560/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1545, "atom2_serNum": 1639, "donAcc_type": "acceptable", "distance": 2.788, "atom1_id": "///A/560/OH", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1549, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/561/O", "atom2_id": "///A/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1561, "atom2_serNum": 1590, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/562/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1570, "atom2_serNum": 1595, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/563/O", "atom2_id": "///A/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1658, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/574/O", "atom2_id": "///A/575/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1671, "atom2_serNum": 2242, "donAcc_type": "standard", "distance": 3.674, "atom1_id": "///A/575/NZ", "atom2_id": "///C/24/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 231, "atom1_serNum": 1671, "atom2_serNum": 2261, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/575/NZ", "atom2_id": "///C/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 232, "atom1_serNum": 1672, "atom2_serNum": 2242, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/576/N", "atom2_id": "///C/24/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 233, "atom1_serNum": 1683, "atom2_serNum": 1695, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/577/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1688, "atom2_serNum": 2243, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/578/N", "atom2_id": "///C/24/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 235, "atom1_serNum": 1693, "atom2_serNum": 2243, "donAcc_type": "acceptable", "distance": 2.442, "atom1_id": "///A/578/OG1", "atom2_id": "///C/24/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 236, "atom1_serNum": 1693, "atom2_serNum": 2244, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///A/578/OG1", "atom2_id": "///C/24/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 237, "atom1_serNum": 1712, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/580/NH1", "atom2_id": "///D/8/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 238, "atom1_serNum": 1713, "atom2_serNum": 2559, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/580/NH2", "atom2_id": "///D/8/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 239, "atom1_serNum": 1717, "atom2_serNum": 1721, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/581/O", "atom2_id": "///A/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1728, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/583/NE", "atom2_id": "///D/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 241, "atom1_serNum": 1731, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///A/583/NH2", "atom2_id": "///D/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 242, "atom1_serNum": 1762, "atom2_serNum": 2184, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///A/588/OG1", "atom2_id": "///C/21/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 243, "atom1_serNum": 1767, "atom2_serNum": 2217, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/589/O", "atom2_id": "///C/22/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 244, "atom1_serNum": 1774, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/590/O", "atom2_id": "///C/21/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 245, "atom1_serNum": 1782, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/591/ND2", "atom2_id": "///C/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 246, "atom1_serNum": 1782, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/591/ND2", "atom2_id": "///C/20/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 247, "atom1_serNum": 1802, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/593/ND2", "atom2_id": "///C/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 248, "atom1_serNum": 1803, "atom2_serNum": 2143, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/594/N", "atom2_id": "///C/19/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 249, "atom1_serNum": 1873, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///C/3/O6", "atom2_id": "///D/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 1895, "atom2_serNum": 3024, "donAcc_type": "questionable", "distance": 3.338, "atom1_id": "///C/4/O4", "atom2_id": "///D/30/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 1916, "atom2_serNum": 3004, "donAcc_type": "questionable", "distance": 2.998, "atom1_id": "///C/5/N1", "atom2_id": "///D/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 1937, "atom2_serNum": 2964, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///C/6/N6", "atom2_id": "///D/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 1937, "atom2_serNum": 2984, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///C/6/N6", "atom2_id": "///D/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 1958, "atom2_serNum": 2912, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/9/N6", "atom2_id": "///D/25/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 1958, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///C/9/N6", "atom2_id": "///D/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 1979, "atom2_serNum": 2897, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/10/N4", "atom2_id": "///D/24/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 1995, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///C/11/O2", "atom2_id": "///D/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 1996, "atom2_serNum": 2879, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///C/11/N3", "atom2_id": "///D/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 1998, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///C/11/N4", "atom2_id": "///D/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 2017, "atom2_serNum": 2858, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///C/12/N6", "atom2_id": "///D/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 2018, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///C/12/N1", "atom2_id": "///D/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 2035, "atom2_serNum": 2839, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///C/13/O2", "atom2_id": "///D/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 2036, "atom2_serNum": 2837, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///C/13/N3", "atom2_id": "///D/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 2038, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///C/13/N4", "atom2_id": "///D/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 2057, "atom2_serNum": 2816, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///C/14/N6", "atom2_id": "///D/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 2058, "atom2_serNum": 2814, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///C/14/N1", "atom2_id": "///D/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 2075, "atom2_serNum": 2797, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///C/15/O2", "atom2_id": "///D/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 2076, "atom2_serNum": 2795, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///C/15/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 2078, "atom2_serNum": 2794, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/15/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 2097, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/16/N6", "atom2_id": "///D/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 2098, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///C/16/N1", "atom2_id": "///D/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 2118, "atom2_serNum": 2754, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/17/N6", "atom2_id": "///D/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 2119, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/17/N1", "atom2_id": "///D/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 2136, "atom2_serNum": 2735, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///C/18/O2", "atom2_id": "///D/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 2137, "atom2_serNum": 2733, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/18/N3", "atom2_id": "///D/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 276, "atom1_serNum": 2139, "atom2_serNum": 2732, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///C/18/N4", "atom2_id": "///D/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 277, "atom1_serNum": 2158, "atom2_serNum": 2712, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///C/19/N6", "atom2_id": "///D/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 278, "atom1_serNum": 2159, "atom2_serNum": 2710, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///C/19/N1", "atom2_id": "///D/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 279, "atom1_serNum": 2176, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///C/20/O2", "atom2_id": "///D/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 280, "atom1_serNum": 2177, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/20/N3", "atom2_id": "///D/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 281, "atom1_serNum": 2179, "atom2_serNum": 2690, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/20/N4", "atom2_id": "///D/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 282, "atom1_serNum": 2195, "atom2_serNum": 2671, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///C/21/O2", "atom2_id": "///D/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 283, "atom1_serNum": 2196, "atom2_serNum": 2669, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///C/21/N3", "atom2_id": "///D/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 284, "atom1_serNum": 2198, "atom2_serNum": 2668, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///C/21/N4", "atom2_id": "///D/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 285, "atom1_serNum": 2214, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///C/22/O2", "atom2_id": "///D/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 286, "atom1_serNum": 2215, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///C/22/N3", "atom2_id": "///D/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 287, "atom1_serNum": 2217, "atom2_serNum": 2646, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///C/22/N4", "atom2_id": "///D/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 288, "atom1_serNum": 2236, "atom2_serNum": 2626, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/23/N6", "atom2_id": "///D/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 289, "atom1_serNum": 2237, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///C/23/N1", "atom2_id": "///D/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 290, "atom1_serNum": 2254, "atom2_serNum": 2607, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///C/24/O2", "atom2_id": "///D/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 291, "atom1_serNum": 2255, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///C/24/N3", "atom2_id": "///D/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 292, "atom1_serNum": 2257, "atom2_serNum": 2604, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///C/24/N4", "atom2_id": "///D/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 293, "atom1_serNum": 2276, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/25/N6", "atom2_id": "///D/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 294, "atom1_serNum": 2277, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///C/25/N1", "atom2_id": "///D/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 295, "atom1_serNum": 2294, "atom2_serNum": 2565, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/26/O2", "atom2_id": "///D/8/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 296, "atom1_serNum": 2295, "atom2_serNum": 2563, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///C/26/N3", "atom2_id": "///D/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 297, "atom1_serNum": 2297, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///C/26/N4", "atom2_id": "///D/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 298, "atom1_serNum": 2316, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///C/27/N6", "atom2_id": "///D/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 299, "atom1_serNum": 2317, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///C/27/N1", "atom2_id": "///D/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 300, "atom1_serNum": 2334, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///C/28/O2", "atom2_id": "///D/6/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 301, "atom1_serNum": 2335, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///C/28/N3", "atom2_id": "///D/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 302, "atom1_serNum": 2337, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///C/28/N4", "atom2_id": "///D/6/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 303, "atom1_serNum": 2353, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///C/29/O2", "atom2_id": "///D/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 304, "atom1_serNum": 2354, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///C/29/N3", "atom2_id": "///D/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 305, "atom1_serNum": 2356, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///C/29/N4", "atom2_id": "///D/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 306, "atom1_serNum": 2375, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///C/30/N6", "atom2_id": "///D/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 307, "atom1_serNum": 2376, "atom2_serNum": 2476, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///C/30/N1", "atom2_id": "///D/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 2396, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/31/O6", "atom2_id": "///D/3/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 2397, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///C/31/N1", "atom2_id": "///D/3/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 2397, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/31/N1", "atom2_id": "///D/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 2399, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/31/N2", "atom2_id": "///D/3/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 2751, "atom2_serNum": 2764, "donAcc_type": "questionable", "distance": 3.138, "atom1_id": "///D/17/O2", "atom2_id": "///D/18/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4gfb", "num_aaChains": 1, "aaChains": "A=218", "num_naChains": 2, "naChains": "C=29,D=31", "num_atoms": 3057, "num_waters": 12, "num_metals": 1, "metals_desc": "Ca=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }