{ "num_pairs": 26, "pairs": [ { "index": 1, "nt1": "///M/1", "nt2": "///N/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.161, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.845, "chi2": -127.863, "conf2": "anti", "pucker2": "----", "lambda2": 55.340, "C1C1_dist": 10.681, "N1N9_dist": 8.982, "C6C8_dist": 9.907, "CNNC_torsion": -2.482, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 17.414, "planarity": 0.204, "simple_Shear": -0.309, "simple_Stretch": -0.019, "simple_Buckle": -16.431, "simple_Propeller": -5.767, "bp_simpleParams": [ -0.309, -0.019, -0.193, -16.431, -5.767, 0.128 ], "bp_params": [ -0.308, -0.026, -0.193, -16.308, -6.107, 0.127 ], "frame": { "rmsd": null, "origin": [ -3.899, 58.366, 5.189 ], "x_axis": [ -0.828, -0.335, 0.449 ], "y_axis": [ 0.265, -0.941, -0.212 ], "z_axis": [ 0.493, -0.056, 0.868 ], "quaternion": [ -0.157, 0.247, -0.070, 0.954 ] } }, { "index": 2, "nt1": "///M/2", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.890, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.711, "chi2": -101.579, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.246, "C1C1_dist": 10.793, "N1N9_dist": 8.985, "C6C8_dist": 9.802, "CNNC_torsion": 2.233, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.06],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.76]", "interBase_angle": 15.723, "planarity": 0.197, "simple_Shear": 0.239, "simple_Stretch": -0.197, "simple_Buckle": 13.043, "simple_Propeller": -8.781, "bp_simpleParams": [ 0.239, -0.197, -0.910, 13.043, -8.781, -3.762 ], "bp_params": [ 0.236, -0.201, -0.910, 12.917, -8.964, -3.750 ], "frame": { "rmsd": null, "origin": [ -2.540, 58.632, 7.469 ], "x_axis": [ -0.552, -0.781, 0.292 ], "y_axis": [ 0.745, -0.619, -0.249 ], "z_axis": [ 0.375, 0.080, 0.924 ], "quaternion": [ -0.434, 0.190, -0.048, 0.880 ] } }, { "index": 3, "nt1": "///M/3", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.781, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.682, "chi2": -117.241, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.071, "C1C1_dist": 10.994, "N1N9_dist": 9.270, "C6C8_dist": 10.219, "CNNC_torsion": -15.708, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.05],N3-N1(imino)[3.16],N4(amino)-O6(carbonyl)[3.26]", "interBase_angle": 15.510, "planarity": 0.200, "simple_Shear": -0.294, "simple_Stretch": 0.190, "simple_Buckle": 0.512, "simple_Propeller": -15.501, "bp_simpleParams": [ -0.294, 0.190, 0.260, 0.512, -15.501, 0.374 ], "bp_params": [ -0.301, 0.179, 0.260, 1.044, -15.474, 0.377 ], "frame": { "rmsd": null, "origin": [ -1.717, 58.594, 11.171 ], "x_axis": [ -0.101, -0.994, -0.050 ], "y_axis": [ 0.907, -0.071, -0.414 ], "z_axis": [ 0.408, -0.087, 0.909 ], "quaternion": [ 0.659, -0.124, 0.174, -0.721 ] } }, { "index": 4, "nt1": "///M/4", "nt2": "///N/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.087, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.672, "chi2": -98.382, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.233, "C1C1_dist": 10.886, "N1N9_dist": 9.163, "C6C8_dist": 10.080, "CNNC_torsion": -13.918, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.25],O4(carbonyl)-N6(amino)[3.33]", "interBase_angle": 16.274, "planarity": 0.221, "simple_Shear": 0.696, "simple_Stretch": 0.174, "simple_Buckle": 8.901, "simple_Propeller": -13.624, "bp_simpleParams": [ 0.696, 0.174, 0.059, 8.901, -13.624, -1.188 ], "bp_params": [ 0.705, 0.131, 0.059, 8.034, -14.153, -1.194 ], "frame": { "rmsd": null, "origin": [ -0.522, 58.257, 14.014 ], "x_axis": [ 0.414, -0.833, -0.366 ], "y_axis": [ 0.830, 0.511, -0.223 ], "z_axis": [ 0.373, -0.212, 0.903 ], "quaternion": [ 0.841, -0.004, 0.220, -0.495 ] } }, { "index": 5, "nt1": "///M/5", "nt2": "///N/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.160, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.121, "chi2": -114.191, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.305, "C1C1_dist": 10.743, "N1N9_dist": 8.972, "C6C8_dist": 9.832, "CNNC_torsion": -19.443, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[3.08]", "interBase_angle": 16.664, "planarity": 0.248, "simple_Shear": -0.522, "simple_Stretch": -0.109, "simple_Buckle": 10.347, "simple_Propeller": -13.063, "bp_simpleParams": [ -0.522, -0.109, 1.015, 10.347, -13.063, -4.771 ], "bp_params": [ -0.515, -0.137, 1.015, 11.026, -12.495, -4.778 ], "frame": { "rmsd": null, "origin": [ 1.490, 59.097, 16.816 ], "x_axis": [ 0.922, -0.315, -0.227 ], "y_axis": [ 0.296, 0.948, -0.113 ], "z_axis": [ 0.251, 0.037, 0.967 ], "quaternion": [ 0.979, -0.039, 0.122, -0.156 ] } }, { "index": 6, "nt1": "///M/6", "nt2": "///N/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.759, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.056, "chi2": -110.752, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.012, "C1C1_dist": 11.241, "N1N9_dist": 9.568, "C6C8_dist": 10.555, "CNNC_torsion": -14.756, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.30],N3-N2(amino)[3.33]", "interBase_angle": 9.948, "planarity": 0.185, "simple_Shear": -0.898, "simple_Stretch": 0.544, "simple_Buckle": -5.345, "simple_Propeller": -8.390, "bp_simpleParams": [ -0.898, 0.544, 0.839, -5.345, -8.390, 1.819 ], "bp_params": [ -0.945, 0.458, 0.839, -4.540, -8.852, 1.823 ], "frame": { "rmsd": null, "origin": [ 2.799, 58.081, 20.328 ], "x_axis": [ 0.898, 0.186, -0.399 ], "y_axis": [ -0.189, 0.982, 0.032 ], "z_axis": [ 0.397, 0.047, 0.916 ], "quaternion": [ 0.974, -0.004, 0.204, 0.096 ] } }, { "index": 7, "nt1": "///M/7", "nt2": "///N/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.995, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.979, "chi2": -98.627, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.860, "C1C1_dist": 11.067, "N1N9_dist": 9.346, "C6C8_dist": 10.257, "CNNC_torsion": -13.477, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.14],N3-N1(imino)[3.26],N4(amino)-O6(carbonyl)[3.26]", "interBase_angle": 8.709, "planarity": 0.162, "simple_Shear": -0.454, "simple_Stretch": 0.225, "simple_Buckle": -7.068, "simple_Propeller": -5.088, "bp_simpleParams": [ -0.454, 0.225, 0.787, -7.068, -5.088, -1.457 ], "bp_params": [ -0.464, 0.203, 0.787, -6.816, -5.421, -1.456 ], "frame": { "rmsd": null, "origin": [ 4.051, 58.060, 23.408 ], "x_axis": [ 0.590, 0.738, -0.328 ], "y_axis": [ -0.692, 0.671, 0.267 ], "z_axis": [ 0.417, 0.069, 0.906 ], "quaternion": [ 0.890, 0.056, 0.209, 0.402 ] } }, { "index": 8, "nt1": "///M/8", "nt2": "///N/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.804, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.500, "chi2": -97.031, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.687, "C1C1_dist": 10.686, "N1N9_dist": 9.047, "C6C8_dist": 10.039, "CNNC_torsion": 1.141, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 11.449, "planarity": 0.126, "simple_Shear": -0.206, "simple_Stretch": 0.052, "simple_Buckle": 10.700, "simple_Propeller": 4.075, "bp_simpleParams": [ -0.206, 0.052, 0.302, 10.700, 4.075, 2.943 ], "bp_params": [ -0.207, 0.049, 0.302, 10.645, 4.216, 2.933 ], "frame": { "rmsd": null, "origin": [ 4.645, 59.088, 26.442 ], "x_axis": [ 0.054, 0.991, -0.126 ], "y_axis": [ -0.877, 0.107, 0.468 ], "z_axis": [ 0.477, 0.085, 0.875 ], "quaternion": [ 0.713, 0.134, 0.212, 0.655 ] } }, { "index": 9, "nt1": "///M/9", "nt2": "///N/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.651, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.499, "chi2": -117.792, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.656, "C1C1_dist": 10.584, "N1N9_dist": 8.909, "C6C8_dist": 9.902, "CNNC_torsion": -10.583, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 16.203, "planarity": 0.247, "simple_Shear": -0.128, "simple_Stretch": -0.103, "simple_Buckle": 7.495, "simple_Propeller": -14.365, "bp_simpleParams": [ -0.128, -0.103, -0.159, 7.495, -14.365, 3.174 ], "bp_params": [ -0.127, -0.105, -0.159, 7.645, -14.286, 3.192 ], "frame": { "rmsd": null, "origin": [ 6.669, 59.444, 29.264 ], "x_axis": [ -0.454, 0.891, 0.005 ], "y_axis": [ -0.759, -0.390, 0.521 ], "z_axis": [ 0.466, 0.232, 0.854 ], "quaternion": [ 0.502, 0.144, 0.229, 0.821 ] } }, { "index": 10, "nt1": "///M/10", "nt2": "///N/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.661, "conf1": "anti", "pucker1": "----", "lambda1": 52.783, "chi2": -104.549, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.235, "C1C1_dist": 10.899, "N1N9_dist": 9.130, "C6C8_dist": 10.023, "CNNC_torsion": -10.556, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.06],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 17.412, "planarity": 0.221, "simple_Shear": -0.029, "simple_Stretch": 0.071, "simple_Buckle": 1.715, "simple_Propeller": -17.327, "bp_simpleParams": [ -0.029, 0.071, -0.154, 1.715, -17.327, -2.014 ], "bp_params": [ -0.029, 0.070, -0.154, 1.854, -17.313, -2.037 ], "frame": { "rmsd": null, "origin": [ 8.675, 60.335, 31.988 ], "x_axis": [ -0.774, 0.541, 0.329 ], "y_axis": [ -0.390, -0.817, 0.424 ], "z_axis": [ 0.499, 0.200, 0.843 ], "quaternion": [ 0.251, 0.223, 0.168, 0.927 ] } }, { "index": 11, "nt1": "///M/11", "nt2": "///N/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.073, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.154, "chi2": -113.995, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.848, "C1C1_dist": 10.740, "N1N9_dist": 8.954, "C6C8_dist": 9.848, "CNNC_torsion": -19.622, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 23.173, "planarity": 0.289, "simple_Shear": -0.131, "simple_Stretch": -0.097, "simple_Buckle": -4.656, "simple_Propeller": -22.701, "bp_simpleParams": [ -0.131, -0.097, 0.134, -4.656, -22.701, -2.391 ], "bp_params": [ -0.130, -0.099, 0.134, -4.285, -22.774, -2.437 ], "frame": { "rmsd": null, "origin": [ 10.554, 61.580, 34.610 ], "x_axis": [ -0.853, 0.008, 0.521 ], "y_axis": [ 0.097, -0.980, 0.173 ], "z_axis": [ 0.512, 0.198, 0.836 ], "quaternion": [ -0.023, 0.270, 0.097, 0.958 ] } }, { "index": 12, "nt1": "///M/12", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.807, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.178, "chi2": -113.712, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.395, "C1C1_dist": 10.754, "N1N9_dist": 9.087, "C6C8_dist": 10.077, "CNNC_torsion": -15.377, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[3.10],N4(amino)-O6(carbonyl)[3.27]", "interBase_angle": 18.807, "planarity": 0.258, "simple_Shear": 0.386, "simple_Stretch": 0.087, "simple_Buckle": -8.594, "simple_Propeller": -16.729, "bp_simpleParams": [ 0.386, 0.087, 0.275, -8.594, -16.729, 2.670 ], "bp_params": [ 0.389, 0.071, 0.275, -9.215, -16.394, 2.689 ], "frame": { "rmsd": null, "origin": [ 11.928, 62.041, 37.670 ], "x_axis": [ -0.517, -0.670, 0.532 ], "y_axis": [ 0.676, -0.702, -0.227 ], "z_axis": [ 0.525, 0.243, 0.816 ], "quaternion": [ -0.386, 0.304, 0.005, 0.871 ] } }, { "index": 13, "nt1": "///M/13", "nt2": "///N/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.768, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.569, "chi2": -95.042, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.529, "C1C1_dist": 10.860, "N1N9_dist": 9.264, "C6C8_dist": 10.317, "CNNC_torsion": -3.488, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.47],N1(imino)-N3[3.26],N2(amino)-O2(carbonyl)[2.93]", "interBase_angle": 2.488, "planarity": 0.115, "simple_Shear": -0.006, "simple_Stretch": 0.292, "simple_Buckle": -2.384, "simple_Propeller": 0.710, "bp_simpleParams": [ -0.006, 0.292, 0.419, -2.384, 0.710, 5.392 ], "bp_params": [ -0.005, 0.292, 0.419, -2.381, 0.720, 5.391 ], "frame": { "rmsd": null, "origin": [ 14.118, 62.171, 40.112 ], "x_axis": [ -0.047, -0.944, 0.326 ], "y_axis": [ 0.841, -0.214, -0.498 ], "z_axis": [ 0.539, 0.250, 0.804 ], "quaternion": [ 0.621, -0.301, 0.086, -0.719 ] } }, { "index": 14, "nt1": "///M/14", "nt2": "///N/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.247, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.012, "chi2": -90.885, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.545, "C1C1_dist": 10.857, "N1N9_dist": 9.270, "C6C8_dist": 10.334, "CNNC_torsion": -3.287, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[3.28],N4(amino)-O6(carbonyl)[3.50]", "interBase_angle": 2.544, "planarity": 0.114, "simple_Shear": 0.058, "simple_Stretch": 0.309, "simple_Buckle": 2.380, "simple_Propeller": 0.898, "bp_simpleParams": [ 0.058, 0.309, 0.408, 2.380, 0.898, 5.831 ], "bp_params": [ 0.058, 0.309, 0.408, 2.381, 0.896, 5.830 ], "frame": { "rmsd": null, "origin": [ 16.053, 62.654, 42.680 ], "x_axis": [ 0.239, -0.967, -0.086 ], "y_axis": [ 0.795, 0.246, -0.554 ], "z_axis": [ 0.557, 0.064, 0.828 ], "quaternion": [ 0.760, -0.203, 0.212, -0.579 ] } }, { "index": 15, "nt1": "///M/15", "nt2": "///N/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.771, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.174, "chi2": -102.709, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.722, "C1C1_dist": 10.832, "N1N9_dist": 9.195, "C6C8_dist": 10.215, "CNNC_torsion": -14.006, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.46],N1(imino)-N3[3.24],N2(amino)-O2(carbonyl)[2.98]", "interBase_angle": 15.556, "planarity": 0.209, "simple_Shear": -0.501, "simple_Stretch": 0.235, "simple_Buckle": 9.827, "simple_Propeller": -12.060, "bp_simpleParams": [ -0.501, 0.235, 0.444, 9.827, -12.060, 3.848 ], "bp_params": [ -0.512, 0.210, 0.444, 10.410, -11.560, 3.852 ], "frame": { "rmsd": null, "origin": [ 18.161, 63.490, 45.000 ], "x_axis": [ 0.618, -0.685, -0.387 ], "y_axis": [ 0.534, 0.726, -0.432 ], "z_axis": [ 0.577, 0.060, 0.814 ], "quaternion": [ 0.889, -0.139, 0.271, -0.343 ] } }, { "index": 16, "nt1": "///M/16", "nt2": "///N/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.441, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.645, "chi2": -130.665, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.728, "C1C1_dist": 10.759, "N1N9_dist": 9.025, "C6C8_dist": 9.968, "CNNC_torsion": -18.351, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.12],N1-N3(imino)[2.97]", "interBase_angle": 19.732, "planarity": 0.241, "simple_Shear": 0.410, "simple_Stretch": 0.048, "simple_Buckle": 9.919, "simple_Propeller": -17.058, "bp_simpleParams": [ 0.410, 0.048, 0.316, 9.919, -17.058, -0.741 ], "bp_params": [ 0.412, 0.032, 0.316, 9.195, -17.459, -0.747 ], "frame": { "rmsd": null, "origin": [ 19.695, 64.117, 47.924 ], "x_axis": [ 0.810, 0.011, -0.586 ], "y_axis": [ -0.066, 0.995, -0.072 ], "z_axis": [ 0.582, 0.097, 0.807 ], "quaternion": [ 0.950, -0.044, 0.307, 0.020 ] } }, { "index": 17, "nt1": "///M/17", "nt2": "///N/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.899, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.117, "chi2": -134.728, "conf2": "anti", "pucker2": "----", "lambda2": 49.803, "C1C1_dist": 10.696, "N1N9_dist": 8.956, "C6C8_dist": 9.851, "CNNC_torsion": -8.656, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86],N1-N3(imino)[2.85]", "interBase_angle": 13.268, "planarity": 0.163, "simple_Shear": 0.589, "simple_Stretch": -0.080, "simple_Buckle": 4.271, "simple_Propeller": -12.562, "bp_simpleParams": [ 0.589, -0.080, -0.014, 4.271, -12.562, -2.533 ], "bp_params": [ 0.583, -0.116, -0.014, 3.474, -12.805, -2.548 ], "frame": { "rmsd": null, "origin": [ 22.000, 63.818, 50.567 ], "x_axis": [ 0.660, 0.533, -0.529 ], "y_axis": [ -0.480, 0.841, 0.248 ], "z_axis": [ 0.577, 0.090, 0.811 ], "quaternion": [ 0.910, 0.043, 0.304, 0.278 ] } }, { "index": 18, "nt1": "///M/18", "nt2": "///N/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.983, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.199, "chi2": -104.286, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.569, "C1C1_dist": 10.720, "N1N9_dist": 9.228, "C6C8_dist": 10.397, "CNNC_torsion": -13.113, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[3.28],N4(amino)-O6(carbonyl)[3.74]", "interBase_angle": 14.039, "planarity": 0.184, "simple_Shear": -0.257, "simple_Stretch": 0.410, "simple_Buckle": -2.671, "simple_Propeller": -13.782, "bp_simpleParams": [ -0.257, 0.410, 0.327, -2.671, -13.782, 10.365 ], "bp_params": [ -0.270, 0.402, 0.327, -2.242, -13.859, 10.439 ], "frame": { "rmsd": null, "origin": [ 24.305, 64.622, 53.040 ], "x_axis": [ 0.315, 0.923, -0.218 ], "y_axis": [ -0.798, 0.383, 0.465 ], "z_axis": [ 0.513, 0.028, 0.858 ], "quaternion": [ 0.799, 0.137, 0.229, 0.538 ] } }, { "index": 19, "nt1": "///M/19", "nt2": "///N/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.429, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.006, "chi2": -103.159, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.400, "C1C1_dist": 10.853, "N1N9_dist": 9.331, "C6C8_dist": 10.467, "CNNC_torsion": -5.476, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[3.42],N4(amino)-O6(carbonyl)[3.79]", "interBase_angle": 7.257, "planarity": 0.110, "simple_Shear": 0.272, "simple_Stretch": 0.473, "simple_Buckle": -7.210, "simple_Propeller": 0.823, "bp_simpleParams": [ 0.272, 0.473, 0.634, -7.210, 0.823, 9.438 ], "bp_params": [ 0.282, 0.467, 0.634, -7.191, 0.977, 9.420 ], "frame": { "rmsd": null, "origin": [ 26.429, 65.067, 55.720 ], "x_axis": [ -0.200, 0.978, -0.050 ], "y_axis": [ -0.837, -0.145, 0.528 ], "z_axis": [ 0.509, 0.147, 0.848 ], "quaternion": [ 0.613, 0.155, 0.228, 0.740 ] } }, { "index": 20, "nt1": "///M/20", "nt2": "///N/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.651, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.222, "chi2": -111.739, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.969, "C1C1_dist": 11.235, "N1N9_dist": 9.706, "C6C8_dist": 10.849, "CNNC_torsion": -5.966, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.25]", "interBase_angle": 8.254, "planarity": 0.112, "simple_Shear": 0.449, "simple_Stretch": 0.871, "simple_Buckle": 7.950, "simple_Propeller": -2.222, "bp_simpleParams": [ 0.449, 0.871, 0.591, 7.950, -2.222, 9.528 ], "bp_params": [ 0.492, 0.847, 0.591, 7.830, -2.612, 9.508 ], "frame": { "rmsd": null, "origin": [ 27.186, 65.330, 58.810 ], "x_axis": [ -0.657, 0.675, 0.336 ], "y_axis": [ -0.520, -0.728, 0.447 ], "z_axis": [ 0.546, 0.119, 0.829 ], "quaternion": [ 0.333, 0.246, 0.158, 0.896 ] } }, { "index": 21, "nt1": "///M/21", "nt2": "///N/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.855, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.843, "chi2": -117.690, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.664, "C1C1_dist": 11.477, "N1N9_dist": 9.786, "C6C8_dist": 10.765, "CNNC_torsion": -9.015, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.81],N1(imino)-N3[3.71],N2(amino)-O2(carbonyl)[3.49]", "interBase_angle": 8.152, "planarity": 0.123, "simple_Shear": 0.307, "simple_Stretch": 0.737, "simple_Buckle": 6.342, "simple_Propeller": -5.122, "bp_simpleParams": [ 0.307, 0.737, 0.566, 6.342, -5.122, 1.677 ], "bp_params": [ 0.332, 0.727, 0.566, 6.165, -5.334, 1.676 ], "frame": { "rmsd": null, "origin": [ 29.460, 65.900, 61.261 ], "x_axis": [ -0.851, 0.182, 0.492 ], "y_axis": [ -0.089, -0.974, 0.208 ], "z_axis": [ 0.517, 0.133, 0.845 ], "quaternion": [ 0.071, 0.264, 0.089, 0.958 ] } }, { "index": 22, "nt1": "///M/22", "nt2": "///N/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.922, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.284, "chi2": -101.929, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.592, "C1C1_dist": 11.072, "N1N9_dist": 9.393, "C6C8_dist": 10.350, "CNNC_torsion": -13.365, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.51],O4(carbonyl)-N6(amino)[3.67]", "interBase_angle": 14.802, "planarity": 0.184, "simple_Shear": 0.721, "simple_Stretch": 0.438, "simple_Buckle": -8.525, "simple_Propeller": -12.101, "bp_simpleParams": [ 0.721, 0.438, 0.579, -8.525, -12.101, 0.035 ], "bp_params": [ 0.750, 0.385, 0.579, -9.363, -11.465, 0.035 ], "frame": { "rmsd": null, "origin": [ 30.826, 67.563, 64.512 ], "x_axis": [ -0.846, -0.362, 0.392 ], "y_axis": [ 0.396, -0.918, 0.005 ], "z_axis": [ 0.358, 0.159, 0.920 ], "quaternion": [ -0.197, 0.195, 0.043, 0.960 ] } }, { "index": 23, "nt1": "///M/23", "nt2": "///N/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.933, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.233, "chi2": -86.200, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.654, "C1C1_dist": 10.826, "N1N9_dist": 9.056, "C6C8_dist": 9.895, "CNNC_torsion": -3.815, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[3.00]", "interBase_angle": 10.950, "planarity": 0.142, "simple_Shear": -0.168, "simple_Stretch": -0.025, "simple_Buckle": -8.371, "simple_Propeller": -7.059, "bp_simpleParams": [ -0.168, -0.025, -0.041, -8.371, -7.059, -5.092 ], "bp_params": [ -0.168, -0.027, -0.041, -8.296, -7.148, -5.089 ], "frame": { "rmsd": null, "origin": [ 32.909, 67.438, 67.408 ], "x_axis": [ -0.419, -0.824, 0.381 ], "y_axis": [ 0.840, -0.511, -0.181 ], "z_axis": [ 0.344, 0.244, 0.906 ], "quaternion": [ -0.494, 0.215, 0.019, 0.842 ] } }, { "index": 24, "nt1": "///M/24", "nt2": "///N/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.193, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.593, "chi2": -121.071, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.758, "C1C1_dist": 11.326, "N1N9_dist": 9.530, "C6C8_dist": 10.391, "CNNC_torsion": -11.053, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.38],N2(amino)-O2(carbonyl)[3.42]", "interBase_angle": 12.625, "planarity": 0.160, "simple_Shear": 0.130, "simple_Stretch": 0.363, "simple_Buckle": 0.461, "simple_Propeller": -12.617, "bp_simpleParams": [ 0.130, 0.363, 0.142, 0.461, -12.617, -3.461 ], "bp_params": [ 0.136, 0.361, 0.142, 0.243, -12.623, -3.481 ], "frame": { "rmsd": null, "origin": [ 34.396, 68.519, 69.913 ], "x_axis": [ 0.116, -0.987, 0.108 ], "y_axis": [ 0.900, 0.058, -0.432 ], "z_axis": [ 0.421, 0.148, 0.895 ], "quaternion": [ 0.719, -0.202, 0.108, -0.656 ] } }, { "index": 25, "nt1": "///M/25", "nt2": "///N/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.263, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.060, "chi2": -159.499, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.474, "C1C1_dist": 10.818, "N1N9_dist": 9.048, "C6C8_dist": 9.928, "CNNC_torsion": -15.419, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[3.02]", "interBase_angle": 18.544, "planarity": 0.250, "simple_Shear": -0.098, "simple_Stretch": -0.082, "simple_Buckle": 7.191, "simple_Propeller": -17.093, "bp_simpleParams": [ -0.098, -0.082, 0.215, 7.191, -17.093, -2.491 ], "bp_params": [ -0.097, -0.083, 0.215, 7.327, -17.035, -2.513 ], "frame": { "rmsd": null, "origin": [ 34.824, 68.682, 73.059 ], "x_axis": [ 0.506, -0.809, -0.299 ], "y_axis": [ 0.681, 0.587, -0.437 ], "z_axis": [ 0.529, 0.018, 0.848 ], "quaternion": [ 0.858, -0.133, 0.241, -0.434 ] } }, { "index": 26, "nt1": "///M/26", "nt2": "///N/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.604, "conf1": "anti", "pucker1": "----", "lambda1": 53.633, "chi2": -157.391, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.685, "C1C1_dist": 10.908, "N1N9_dist": 9.149, "C6C8_dist": 10.012, "CNNC_torsion": -3.624, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.08],N3-N1(imino)[3.11],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 18.578, "planarity": 0.209, "simple_Shear": 0.236, "simple_Stretch": 0.092, "simple_Buckle": 17.054, "simple_Propeller": -7.369, "bp_simpleParams": [ 0.236, 0.092, -0.316, 17.054, -7.369, -2.347 ], "bp_params": [ 0.237, 0.088, -0.316, 16.963, -7.576, -2.327 ], "frame": { "rmsd": null, "origin": [ 36.484, 68.402, 75.960 ], "x_axis": [ 0.832, -0.341, -0.438 ], "y_axis": [ 0.246, 0.934, -0.261 ], "z_axis": [ 0.498, 0.109, 0.860 ], "quaternion": [ 0.952, -0.097, 0.246, -0.154 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GCCTACCGGTTCGCGAACCGGTAGGC", "strand2": "CGGATGGCCAAGCGCTTGGCCATCCG", "bp_type": "||||||||||||||||||||||||||", "helix_form": "..B..BBBBBBBBBBBBBBB.BB..", "helical_rise": 3.339, "helical_rise_std": 0.468, "helical_radius": 9.803, "helical_radius_std": 1.653, "helical_axis": [ 0.467, 0.103, 0.878 ], "point1": [ -3.872, 58.450, 4.392 ], "point2": [ 35.202, 67.091, 77.805 ], "num_pairs": 26, "pairs": [ { "index": 1, "nt1": "///M/1", "nt2": "///N/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, -0.026, -0.193, -16.308, -6.107, 0.127 ], "step_params": [ -0.322, -0.059, 2.647, 10.724, 1.567, 31.899 ], "heli_params": [ -0.305, 1.948, 2.411, 2.754, -18.846, 33.644 ], "bp2_params": [ 0.236, -0.201, -0.910, 12.917, -8.964, -3.750 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.647, "simple_Twist": 29.304, "simple_hRise": 2.379, "simple_hTwist": 31.203 }, { "index": 2, "nt1": "///M/2", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, -0.201, -0.910, 12.917, -8.964, -3.750 ], "step_params": [ 0.276, -0.641, 3.728, -5.412, 8.188, 34.307 ], "heli_params": [ -2.371, -1.325, 3.409, 13.541, 8.950, 35.643 ], "bp2_params": [ -0.301, 0.179, 0.260, 1.044, -15.474, 0.377 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.728, "simple_Twist": 36.914, "simple_hRise": 3.441, "simple_hTwist": 38.153 }, { "index": 3, "nt1": "///M/3", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.301, 0.179, 0.260, 1.044, -15.474, 0.377 ], "step_params": [ -0.132, 0.003, 3.099, 3.364, 6.589, 35.855 ], "heli_params": [ -0.853, 0.648, 3.028, 10.564, -5.393, 36.586 ], "bp2_params": [ 0.705, 0.131, 0.059, 8.034, -14.153, -1.194 ], "groove_widths": [ 11.812, null, 16.287, null ], "simple_Rise": 3.099, "simple_Twist": 30.987, "simple_hRise": 3.005, "simple_hTwist": 31.837 }, { "index": 4, "nt1": "///M/4", "nt2": "///N/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.705, 0.131, 0.059, 8.034, -14.153, -1.194 ], "step_params": [ 0.093, 1.518, 3.208, -6.318, -15.101, 40.841 ], "heli_params": [ 3.329, -0.668, 2.484, -20.666, 8.647, 43.869 ], "bp2_params": [ -0.515, -0.137, 1.015, 11.026, -12.495, -4.778 ], "groove_widths": [ 11.337, 11.336, 17.072, 17.005 ], "simple_Rise": 3.208, "simple_Twist": 47.169, "simple_hRise": 2.605, "simple_hTwist": 49.775 }, { "index": 5, "nt1": "///M/5", "nt2": "///N/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.515, -0.137, 1.015, 11.026, -12.495, -4.778 ], "step_params": [ 0.172, -1.165, 3.701, -1.124, 8.835, 29.433 ], "heli_params": [ -4.072, -0.564, 3.215, 16.907, 2.151, 30.722 ], "bp2_params": [ -0.945, 0.458, 0.839, -4.540, -8.852, 1.823 ], "groove_widths": [ 11.952, 11.947, 17.347, 17.341 ], "simple_Rise": 3.701, "simple_Twist": 31.150, "simple_hRise": 3.249, "simple_hTwist": 32.368 }, { "index": 6, "nt1": "///M/6", "nt2": "///N/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.945, 0.458, 0.839, -4.540, -8.852, 1.823 ], "step_params": [ -0.203, -0.131, 3.316, -0.486, 1.739, 37.107 ], "heli_params": [ -0.440, 0.253, 3.309, 2.731, 0.762, 37.150 ], "bp2_params": [ -0.464, 0.203, 0.787, -6.816, -5.421, -1.456 ], "groove_widths": [ 13.168, 13.086, 17.019, 16.912 ], "simple_Rise": 3.316, "simple_Twist": 34.621, "simple_hRise": 3.308, "simple_hTwist": 34.667 }, { "index": 7, "nt1": "///M/7", "nt2": "///N/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.464, 0.203, 0.787, -6.816, -5.421, -1.456 ], "step_params": [ 0.384, 1.085, 3.048, 3.162, 2.465, 36.390 ], "heli_params": [ 1.406, -0.199, 3.134, 3.932, -5.044, 36.603 ], "bp2_params": [ -0.207, 0.049, 0.302, 10.645, 4.216, 2.933 ], "groove_widths": [ 14.212, 14.069, 17.709, 17.156 ], "simple_Rise": 3.048, "simple_Twist": 35.199, "simple_hRise": 3.136, "simple_hTwist": 35.419 }, { "index": 8, "nt1": "///M/8", "nt2": "///N/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, 0.049, 0.302, 10.645, 4.216, 2.933 ], "step_params": [ -0.260, -0.389, 3.459, 1.319, 8.431, 29.823 ], "heli_params": [ -2.420, 0.751, 3.218, 15.974, -2.499, 30.994 ], "bp2_params": [ -0.127, -0.105, -0.159, 7.645, -14.286, 3.192 ], "groove_widths": [ 13.988, 13.902, 18.215, 17.472 ], "simple_Rise": 3.459, "simple_Twist": 29.710, "simple_hRise": 3.216, "simple_hTwist": 30.885 }, { "index": 9, "nt1": "///M/9", "nt2": "///N/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.127, -0.105, -0.159, 7.645, -14.286, 3.192 ], "step_params": [ -0.146, -0.397, 3.472, 0.224, -2.674, 33.276 ], "heli_params": [ -0.218, 0.293, 3.492, -4.660, -0.390, 33.381 ], "bp2_params": [ -0.029, 0.070, -0.154, 1.854, -17.313, -2.037 ], "groove_widths": [ 11.794, 11.774, 18.147, 17.783 ], "simple_Rise": 3.472, "simple_Twist": 32.654, "simple_hRise": 3.492, "simple_hTwist": 32.761 }, { "index": 10, "nt1": "///M/10", "nt2": "///N/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.029, 0.070, -0.154, 1.854, -17.313, -2.037 ], "step_params": [ -0.077, -0.630, 3.400, 0.145, -0.884, 33.220 ], "heli_params": [ -0.948, 0.161, 3.415, -1.546, -0.254, 33.232 ], "bp2_params": [ -0.130, -0.099, 0.134, -4.285, -22.774, -2.437 ], "groove_widths": [ 9.806, 9.805, 17.941, 17.936 ], "simple_Rise": 3.400, "simple_Twist": 33.450, "simple_hRise": 3.414, "simple_hTwist": 33.462 }, { "index": 11, "nt1": "///M/11", "nt2": "///N/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.099, 0.134, -4.285, -22.774, -2.437 ], "step_params": [ 0.536, 0.092, 3.342, 1.975, -2.134, 44.427 ], "heli_params": [ 0.322, -0.521, 3.354, -2.819, -2.608, 44.517 ], "bp2_params": [ 0.389, 0.071, 0.275, -9.215, -16.394, 2.689 ], "groove_widths": [ 10.224, 10.220, 18.353, 18.217 ], "simple_Rise": 3.342, "simple_Twist": 41.412, "simple_hRise": 3.354, "simple_hTwist": 41.509 }, { "index": 12, "nt1": "///M/12", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.389, 0.071, 0.275, -9.215, -16.394, 2.689 ], "step_params": [ 0.345, 0.756, 3.175, -0.684, -0.911, 33.824 ], "heli_params": [ 1.441, -0.699, 3.147, -1.565, 1.176, 33.842 ], "bp2_params": [ -0.005, 0.292, 0.419, -2.381, 0.720, 5.391 ], "groove_widths": [ 12.741, 12.737, 16.832, 16.794 ], "simple_Rise": 3.175, "simple_Twist": 36.371, "simple_hRise": 3.149, "simple_hTwist": 36.388 }, { "index": 13, "nt1": "///M/13", "nt2": "///N/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, 0.292, 0.419, -2.381, 0.720, 5.391 ], "step_params": [ 0.032, 0.173, 3.246, 0.054, 10.846, 27.035 ], "heli_params": [ -2.044, -0.052, 3.085, 22.104, -0.110, 29.092 ], "bp2_params": [ 0.058, 0.309, 0.408, 2.381, 0.896, 5.830 ], "groove_widths": [ 14.797, 14.789, 17.428, 17.012 ], "simple_Rise": 3.246, "simple_Twist": 26.634, "simple_hRise": 3.079, "simple_hTwist": 28.720 }, { "index": 14, "nt1": "///M/14", "nt2": "///N/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, 0.309, 0.408, 2.381, 0.896, 5.830 ], "step_params": [ -0.342, 0.684, 3.153, -1.074, 0.865, 32.507 ], "heli_params": [ 1.075, 0.429, 3.179, 1.545, 1.918, 32.536 ], "bp2_params": [ -0.512, 0.210, 0.444, 10.410, -11.560, 3.852 ], "groove_widths": [ 13.530, 13.504, 17.247, 17.125 ], "simple_Rise": 3.153, "simple_Twist": 35.838, "simple_hRise": 3.176, "simple_hTwist": 35.864 }, { "index": 15, "nt1": "///M/15", "nt2": "///N/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.512, 0.210, 0.444, 10.410, -11.560, 3.852 ], "step_params": [ -0.556, 0.179, 3.310, -2.134, -0.318, 43.988 ], "heli_params": [ 0.269, 0.538, 3.331, -0.424, 2.846, 44.038 ], "bp2_params": [ 0.412, 0.032, 0.316, 9.195, -17.459, -0.747 ], "groove_widths": [ 11.183, 11.163, 18.224, 18.219 ], "simple_Rise": 3.310, "simple_Twist": 39.151, "simple_hRise": 3.333, "simple_hTwist": 39.208 }, { "index": 16, "nt1": "///M/16", "nt2": "///N/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, 0.032, 0.316, 9.195, -17.459, -0.747 ], "step_params": [ 0.143, -0.693, 3.448, 0.259, -0.453, 31.704 ], "heli_params": [ -1.180, -0.212, 3.459, -0.829, -0.474, 31.709 ], "bp2_params": [ 0.583, -0.116, -0.014, 3.474, -12.805, -2.548 ], "groove_widths": [ 10.214, 10.208, 17.331, 17.304 ], "simple_Rise": 3.448, "simple_Twist": 30.664, "simple_hRise": 3.459, "simple_hTwist": 30.668 }, { "index": 17, "nt1": "///M/17", "nt2": "///N/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.116, -0.014, 3.474, -12.805, -2.548 ], "step_params": [ 0.836, -0.052, 3.373, -1.175, -5.676, 34.846 ], "heli_params": [ 0.778, -1.556, 3.311, -9.398, 1.945, 35.310 ], "bp2_params": [ -0.270, 0.402, 0.327, -2.242, -13.859, 10.439 ], "groove_widths": [ 11.327, 11.306, 17.179, 16.852 ], "simple_Rise": 3.373, "simple_Twist": 39.005, "simple_hRise": 3.322, "simple_hTwist": 39.417 }, { "index": 18, "nt1": "///M/18", "nt2": "///N/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.270, 0.402, 0.327, -2.242, -13.859, 10.439 ], "step_params": [ 0.200, -0.423, 3.416, -0.724, 6.847, 30.923 ], "heli_params": [ -2.079, -0.504, 3.245, 12.645, 1.337, 31.662 ], "bp2_params": [ 0.282, 0.467, 0.634, -7.191, 0.977, 9.420 ], "groove_widths": [ 12.741, 12.693, 18.331, 17.971 ], "simple_Rise": 3.416, "simple_Twist": 28.189, "simple_hRise": 3.220, "simple_hTwist": 29.001 }, { "index": 19, "nt1": "///M/19", "nt2": "///N/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.282, 0.467, 0.634, -7.191, 0.977, 9.420 ], "step_params": [ 0.343, 0.957, 3.026, 1.348, -2.533, 39.063 ], "heli_params": [ 1.706, -0.364, 2.970, -3.783, -2.013, 39.164 ], "bp2_params": [ 0.492, 0.847, 0.591, 7.830, -2.612, 9.508 ], "groove_widths": [ 13.016, 12.956, 19.141, 18.742 ], "simple_Rise": 3.026, "simple_Twist": 38.073, "simple_hRise": 2.969, "simple_hTwist": 38.177 }, { "index": 20, "nt1": "///M/20", "nt2": "///N/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.492, 0.847, 0.591, 7.830, -2.612, 9.508 ], "step_params": [ -0.473, -0.406, 3.334, -0.144, 2.065, 32.011 ], "heli_params": [ -1.112, 0.829, 3.304, 3.739, 0.261, 32.076 ], "bp2_params": [ 0.332, 0.727, 0.566, 6.165, -5.334, 1.676 ], "groove_widths": [ 12.915, 12.884, 18.747, 18.570 ], "simple_Rise": 3.334, "simple_Twist": 32.926, "simple_hRise": 3.305, "simple_hTwist": 32.989 }, { "index": 21, "nt1": "///M/21", "nt2": "///N/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.332, 0.727, 0.566, 6.165, -5.334, 1.676 ], "step_params": [ 0.114, -1.145, 3.725, 2.447, 9.900, 30.630 ], "heli_params": [ -3.979, 0.269, 3.209, 18.121, -4.478, 32.245 ], "bp2_params": [ 0.750, 0.385, 0.579, -9.363, -11.465, 0.035 ], "groove_widths": [ 12.306, 12.288, 18.215, 18.089 ], "simple_Rise": 3.725, "simple_Twist": 28.102, "simple_hRise": 3.148, "simple_hTwist": 29.860 }, { "index": 22, "nt1": "///M/22", "nt2": "///N/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.750, 0.385, 0.579, -9.363, -11.465, 0.035 ], "step_params": [ -0.169, 1.208, 3.354, 4.133, -2.848, 36.550 ], "heli_params": [ 2.299, 0.832, 3.216, -4.514, -6.552, 36.881 ], "bp2_params": [ -0.168, -0.027, -0.041, -8.296, -7.148, -5.089 ], "groove_widths": [ 12.213, 12.131, 17.050, 16.623 ], "simple_Rise": 3.354, "simple_Twist": 41.337, "simple_hRise": 3.236, "simple_hTwist": 41.628 }, { "index": 23, "nt1": "///M/23", "nt2": "///N/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.027, -0.041, -8.296, -7.148, -5.089 ], "step_params": [ -0.574, 0.256, 3.044, -5.534, 4.432, 36.061 ], "heli_params": [ -0.167, 0.194, 3.104, 7.075, 8.834, 36.729 ], "bp2_params": [ 0.136, 0.361, 0.142, 0.243, -12.623, -3.481 ], "groove_widths": [ 12.833, null, 16.318, null ], "simple_Rise": 3.044, "simple_Twist": 34.742, "simple_hRise": 3.104, "simple_hTwist": 35.437 }, { "index": 24, "nt1": "///M/24", "nt2": "///N/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, 0.361, 0.142, 0.243, -12.623, -3.481 ], "step_params": [ -0.298, -1.092, 2.970, -3.884, 9.301, 33.176 ], "heli_params": [ -3.080, -0.019, 2.596, 15.840, 6.615, 34.632 ], "bp2_params": [ -0.097, -0.083, 0.215, 7.327, -17.035, -2.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.970, "simple_Twist": 34.566, "simple_hRise": 2.616, "simple_hTwist": 35.962 }, { "index": 25, "nt1": "///M/25", "nt2": "///N/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.083, 0.215, 7.327, -17.035, -2.513 ], "step_params": [ 0.239, -0.436, 3.317, -3.032, -4.704, 33.816 ], "heli_params": [ 0.014, -0.892, 3.313, -8.019, 5.169, 34.263 ], "bp2_params": [ 0.237, 0.088, -0.316, 16.963, -7.576, -2.327 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 31.984, "simple_hRise": 3.310, "simple_hTwist": 32.457 }, { "index": 26, "nt1": "///M/26", "nt2": "///N/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCCTACCGGTTCGCGAACCGGTAGGC", "strand2": "CGGATGGCCAAGCGCTTGGCCATCCG", "bp_type": "||||||||||||||||||||||||||", "helix_form": "..B..BBBBBBBBBBBBBBB.BB..", "helical_rise": 3.339, "helical_rise_std": 0.468, "helical_radius": 9.803, "helical_radius_std": 1.653, "helical_axis": [ 0.467, 0.103, 0.878 ], "point1": [ -3.872, 58.450, 4.392 ], "point2": [ 35.202, 67.091, 77.805 ], "num_pairs": 26, "pairs": [ { "index": 1, "nt1": "///M/1", "nt2": "///N/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, -0.026, -0.193, -16.308, -6.107, 0.127 ], "step_params": [ -0.322, -0.059, 2.647, 10.724, 1.567, 31.899 ], "heli_params": [ -0.305, 1.948, 2.411, 2.754, -18.846, 33.644 ], "bp2_params": [ 0.236, -0.201, -0.910, 12.917, -8.964, -3.750 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.647, "simple_Twist": 29.304, "simple_hRise": 2.379, "simple_hTwist": 31.203 }, { "index": 2, "nt1": "///M/2", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, -0.201, -0.910, 12.917, -8.964, -3.750 ], "step_params": [ 0.276, -0.641, 3.728, -5.412, 8.188, 34.307 ], "heli_params": [ -2.371, -1.325, 3.409, 13.541, 8.950, 35.643 ], "bp2_params": [ -0.301, 0.179, 0.260, 1.044, -15.474, 0.377 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.728, "simple_Twist": 36.914, "simple_hRise": 3.441, "simple_hTwist": 38.153 }, { "index": 3, "nt1": "///M/3", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.301, 0.179, 0.260, 1.044, -15.474, 0.377 ], "step_params": [ -0.132, 0.003, 3.099, 3.364, 6.589, 35.855 ], "heli_params": [ -0.853, 0.648, 3.028, 10.564, -5.393, 36.586 ], "bp2_params": [ 0.705, 0.131, 0.059, 8.034, -14.153, -1.194 ], "groove_widths": [ 11.812, null, 16.287, null ], "simple_Rise": 3.099, "simple_Twist": 30.987, "simple_hRise": 3.005, "simple_hTwist": 31.837 }, { "index": 4, "nt1": "///M/4", "nt2": "///N/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.705, 0.131, 0.059, 8.034, -14.153, -1.194 ], "step_params": [ 0.093, 1.518, 3.208, -6.318, -15.101, 40.841 ], "heli_params": [ 3.329, -0.668, 2.484, -20.666, 8.647, 43.869 ], "bp2_params": [ -0.515, -0.137, 1.015, 11.026, -12.495, -4.778 ], "groove_widths": [ 11.337, 11.336, 17.072, 17.005 ], "simple_Rise": 3.208, "simple_Twist": 47.169, "simple_hRise": 2.605, "simple_hTwist": 49.775 }, { "index": 5, "nt1": "///M/5", "nt2": "///N/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.515, -0.137, 1.015, 11.026, -12.495, -4.778 ], "step_params": [ 0.172, -1.165, 3.701, -1.124, 8.835, 29.433 ], "heli_params": [ -4.072, -0.564, 3.215, 16.907, 2.151, 30.722 ], "bp2_params": [ -0.945, 0.458, 0.839, -4.540, -8.852, 1.823 ], "groove_widths": [ 11.952, 11.947, 17.347, 17.341 ], "simple_Rise": 3.701, "simple_Twist": 31.150, "simple_hRise": 3.249, "simple_hTwist": 32.368 }, { "index": 6, "nt1": "///M/6", "nt2": "///N/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.945, 0.458, 0.839, -4.540, -8.852, 1.823 ], "step_params": [ -0.203, -0.131, 3.316, -0.486, 1.739, 37.107 ], "heli_params": [ -0.440, 0.253, 3.309, 2.731, 0.762, 37.150 ], "bp2_params": [ -0.464, 0.203, 0.787, -6.816, -5.421, -1.456 ], "groove_widths": [ 13.168, 13.086, 17.019, 16.912 ], "simple_Rise": 3.316, "simple_Twist": 34.621, "simple_hRise": 3.308, "simple_hTwist": 34.667 }, { "index": 7, "nt1": "///M/7", "nt2": "///N/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.464, 0.203, 0.787, -6.816, -5.421, -1.456 ], "step_params": [ 0.384, 1.085, 3.048, 3.162, 2.465, 36.390 ], "heli_params": [ 1.406, -0.199, 3.134, 3.932, -5.044, 36.603 ], "bp2_params": [ -0.207, 0.049, 0.302, 10.645, 4.216, 2.933 ], "groove_widths": [ 14.212, 14.069, 17.709, 17.156 ], "simple_Rise": 3.048, "simple_Twist": 35.199, "simple_hRise": 3.136, "simple_hTwist": 35.419 }, { "index": 8, "nt1": "///M/8", "nt2": "///N/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, 0.049, 0.302, 10.645, 4.216, 2.933 ], "step_params": [ -0.260, -0.389, 3.459, 1.319, 8.431, 29.823 ], "heli_params": [ -2.420, 0.751, 3.218, 15.974, -2.499, 30.994 ], "bp2_params": [ -0.127, -0.105, -0.159, 7.645, -14.286, 3.192 ], "groove_widths": [ 13.988, 13.902, 18.215, 17.472 ], "simple_Rise": 3.459, "simple_Twist": 29.710, "simple_hRise": 3.216, "simple_hTwist": 30.885 }, { "index": 9, "nt1": "///M/9", "nt2": "///N/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.127, -0.105, -0.159, 7.645, -14.286, 3.192 ], "step_params": [ -0.146, -0.397, 3.472, 0.224, -2.674, 33.276 ], "heli_params": [ -0.218, 0.293, 3.492, -4.660, -0.390, 33.381 ], "bp2_params": [ -0.029, 0.070, -0.154, 1.854, -17.313, -2.037 ], "groove_widths": [ 11.794, 11.774, 18.147, 17.783 ], "simple_Rise": 3.472, "simple_Twist": 32.654, "simple_hRise": 3.492, "simple_hTwist": 32.761 }, { "index": 10, "nt1": "///M/10", "nt2": "///N/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.029, 0.070, -0.154, 1.854, -17.313, -2.037 ], "step_params": [ -0.077, -0.630, 3.400, 0.145, -0.884, 33.220 ], "heli_params": [ -0.948, 0.161, 3.415, -1.546, -0.254, 33.232 ], "bp2_params": [ -0.130, -0.099, 0.134, -4.285, -22.774, -2.437 ], "groove_widths": [ 9.806, 9.805, 17.941, 17.936 ], "simple_Rise": 3.400, "simple_Twist": 33.450, "simple_hRise": 3.414, "simple_hTwist": 33.462 }, { "index": 11, "nt1": "///M/11", "nt2": "///N/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.099, 0.134, -4.285, -22.774, -2.437 ], "step_params": [ 0.536, 0.092, 3.342, 1.975, -2.134, 44.427 ], "heli_params": [ 0.322, -0.521, 3.354, -2.819, -2.608, 44.517 ], "bp2_params": [ 0.389, 0.071, 0.275, -9.215, -16.394, 2.689 ], "groove_widths": [ 10.224, 10.220, 18.353, 18.217 ], "simple_Rise": 3.342, "simple_Twist": 41.412, "simple_hRise": 3.354, "simple_hTwist": 41.509 }, { "index": 12, "nt1": "///M/12", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.389, 0.071, 0.275, -9.215, -16.394, 2.689 ], "step_params": [ 0.345, 0.756, 3.175, -0.684, -0.911, 33.824 ], "heli_params": [ 1.441, -0.699, 3.147, -1.565, 1.176, 33.842 ], "bp2_params": [ -0.005, 0.292, 0.419, -2.381, 0.720, 5.391 ], "groove_widths": [ 12.741, 12.737, 16.832, 16.794 ], "simple_Rise": 3.175, "simple_Twist": 36.371, "simple_hRise": 3.149, "simple_hTwist": 36.388 }, { "index": 13, "nt1": "///M/13", "nt2": "///N/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, 0.292, 0.419, -2.381, 0.720, 5.391 ], "step_params": [ 0.032, 0.173, 3.246, 0.054, 10.846, 27.035 ], "heli_params": [ -2.044, -0.052, 3.085, 22.104, -0.110, 29.092 ], "bp2_params": [ 0.058, 0.309, 0.408, 2.381, 0.896, 5.830 ], "groove_widths": [ 14.797, 14.789, 17.428, 17.012 ], "simple_Rise": 3.246, "simple_Twist": 26.634, "simple_hRise": 3.079, "simple_hTwist": 28.720 }, { "index": 14, "nt1": "///M/14", "nt2": "///N/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, 0.309, 0.408, 2.381, 0.896, 5.830 ], "step_params": [ -0.342, 0.684, 3.153, -1.074, 0.865, 32.507 ], "heli_params": [ 1.075, 0.429, 3.179, 1.545, 1.918, 32.536 ], "bp2_params": [ -0.512, 0.210, 0.444, 10.410, -11.560, 3.852 ], "groove_widths": [ 13.530, 13.504, 17.247, 17.125 ], "simple_Rise": 3.153, "simple_Twist": 35.838, "simple_hRise": 3.176, "simple_hTwist": 35.864 }, { "index": 15, "nt1": "///M/15", "nt2": "///N/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.512, 0.210, 0.444, 10.410, -11.560, 3.852 ], "step_params": [ -0.556, 0.179, 3.310, -2.134, -0.318, 43.988 ], "heli_params": [ 0.269, 0.538, 3.331, -0.424, 2.846, 44.038 ], "bp2_params": [ 0.412, 0.032, 0.316, 9.195, -17.459, -0.747 ], "groove_widths": [ 11.183, 11.163, 18.224, 18.219 ], "simple_Rise": 3.310, "simple_Twist": 39.151, "simple_hRise": 3.333, "simple_hTwist": 39.208 }, { "index": 16, "nt1": "///M/16", "nt2": "///N/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, 0.032, 0.316, 9.195, -17.459, -0.747 ], "step_params": [ 0.143, -0.693, 3.448, 0.259, -0.453, 31.704 ], "heli_params": [ -1.180, -0.212, 3.459, -0.829, -0.474, 31.709 ], "bp2_params": [ 0.583, -0.116, -0.014, 3.474, -12.805, -2.548 ], "groove_widths": [ 10.214, 10.208, 17.331, 17.304 ], "simple_Rise": 3.448, "simple_Twist": 30.664, "simple_hRise": 3.459, "simple_hTwist": 30.668 }, { "index": 17, "nt1": "///M/17", "nt2": "///N/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.116, -0.014, 3.474, -12.805, -2.548 ], "step_params": [ 0.836, -0.052, 3.373, -1.175, -5.676, 34.846 ], "heli_params": [ 0.778, -1.556, 3.311, -9.398, 1.945, 35.310 ], "bp2_params": [ -0.270, 0.402, 0.327, -2.242, -13.859, 10.439 ], "groove_widths": [ 11.327, 11.306, 17.179, 16.852 ], "simple_Rise": 3.373, "simple_Twist": 39.005, "simple_hRise": 3.322, "simple_hTwist": 39.417 }, { "index": 18, "nt1": "///M/18", "nt2": "///N/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.270, 0.402, 0.327, -2.242, -13.859, 10.439 ], "step_params": [ 0.200, -0.423, 3.416, -0.724, 6.847, 30.923 ], "heli_params": [ -2.079, -0.504, 3.245, 12.645, 1.337, 31.662 ], "bp2_params": [ 0.282, 0.467, 0.634, -7.191, 0.977, 9.420 ], "groove_widths": [ 12.741, 12.693, 18.331, 17.971 ], "simple_Rise": 3.416, "simple_Twist": 28.189, "simple_hRise": 3.220, "simple_hTwist": 29.001 }, { "index": 19, "nt1": "///M/19", "nt2": "///N/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.282, 0.467, 0.634, -7.191, 0.977, 9.420 ], "step_params": [ 0.343, 0.957, 3.026, 1.348, -2.533, 39.063 ], "heli_params": [ 1.706, -0.364, 2.970, -3.783, -2.013, 39.164 ], "bp2_params": [ 0.492, 0.847, 0.591, 7.830, -2.612, 9.508 ], "groove_widths": [ 13.016, 12.956, 19.141, 18.742 ], "simple_Rise": 3.026, "simple_Twist": 38.073, "simple_hRise": 2.969, "simple_hTwist": 38.177 }, { "index": 20, "nt1": "///M/20", "nt2": "///N/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.492, 0.847, 0.591, 7.830, -2.612, 9.508 ], "step_params": [ -0.473, -0.406, 3.334, -0.144, 2.065, 32.011 ], "heli_params": [ -1.112, 0.829, 3.304, 3.739, 0.261, 32.076 ], "bp2_params": [ 0.332, 0.727, 0.566, 6.165, -5.334, 1.676 ], "groove_widths": [ 12.915, 12.884, 18.747, 18.570 ], "simple_Rise": 3.334, "simple_Twist": 32.926, "simple_hRise": 3.305, "simple_hTwist": 32.989 }, { "index": 21, "nt1": "///M/21", "nt2": "///N/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.332, 0.727, 0.566, 6.165, -5.334, 1.676 ], "step_params": [ 0.114, -1.145, 3.725, 2.447, 9.900, 30.630 ], "heli_params": [ -3.979, 0.269, 3.209, 18.121, -4.478, 32.245 ], "bp2_params": [ 0.750, 0.385, 0.579, -9.363, -11.465, 0.035 ], "groove_widths": [ 12.306, 12.288, 18.215, 18.089 ], "simple_Rise": 3.725, "simple_Twist": 28.102, "simple_hRise": 3.148, "simple_hTwist": 29.860 }, { "index": 22, "nt1": "///M/22", "nt2": "///N/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.750, 0.385, 0.579, -9.363, -11.465, 0.035 ], "step_params": [ -0.169, 1.208, 3.354, 4.133, -2.848, 36.550 ], "heli_params": [ 2.299, 0.832, 3.216, -4.514, -6.552, 36.881 ], "bp2_params": [ -0.168, -0.027, -0.041, -8.296, -7.148, -5.089 ], "groove_widths": [ 12.213, 12.131, 17.050, 16.623 ], "simple_Rise": 3.354, "simple_Twist": 41.337, "simple_hRise": 3.236, "simple_hTwist": 41.628 }, { "index": 23, "nt1": "///M/23", "nt2": "///N/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.027, -0.041, -8.296, -7.148, -5.089 ], "step_params": [ -0.574, 0.256, 3.044, -5.534, 4.432, 36.061 ], "heli_params": [ -0.167, 0.194, 3.104, 7.075, 8.834, 36.729 ], "bp2_params": [ 0.136, 0.361, 0.142, 0.243, -12.623, -3.481 ], "groove_widths": [ 12.833, null, 16.318, null ], "simple_Rise": 3.044, "simple_Twist": 34.742, "simple_hRise": 3.104, "simple_hTwist": 35.437 }, { "index": 24, "nt1": "///M/24", "nt2": "///N/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, 0.361, 0.142, 0.243, -12.623, -3.481 ], "step_params": [ -0.298, -1.092, 2.970, -3.884, 9.301, 33.176 ], "heli_params": [ -3.080, -0.019, 2.596, 15.840, 6.615, 34.632 ], "bp2_params": [ -0.097, -0.083, 0.215, 7.327, -17.035, -2.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.970, "simple_Twist": 34.566, "simple_hRise": 2.616, "simple_hTwist": 35.962 }, { "index": 25, "nt1": "///M/25", "nt2": "///N/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.083, 0.215, 7.327, -17.035, -2.513 ], "step_params": [ 0.239, -0.436, 3.317, -3.032, -4.704, 33.816 ], "heli_params": [ 0.014, -0.892, 3.313, -8.019, 5.169, 34.263 ], "bp2_params": [ 0.237, 0.088, -0.316, 16.963, -7.576, -2.327 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 31.984, "simple_hRise": 3.310, "simple_hTwist": 32.457 }, { "index": 26, "nt1": "///M/26", "nt2": "///N/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "FG", "nts_long": "///A/44,///M/1" }, { "index": 2, "num_nts": 2, "nts_short": "FG", "nts_long": "///D/44,///N/1" } ], "dbn": { "all_chains": { "num_nts": 52, "num_chars": 53, "bseq": "GCCTACCGGTTCGCGAACCGGTAGGC&GCCTACCGGTTCGCGAACCGGTAGGC", "sstr": "((((((((((((((((((((((((((&))))))))))))))))))))))))))", "form": ".BB..BBBBBBBBBBBBBBB.BB.B-&AAB..BBBB.BBBBBBBBBB..B.B-" }, "chain_M": { "num_nts": 26, "num_chars": 26, "bseq": "GCCTACCGGTTCGCGAACCGGTAGGC", "sstr": "((((((((((((((((((((((((((", "form": ".BB..BBBBBBBBBBBBBBB.BB.B-" }, "chain_N": { "num_nts": 26, "num_chars": 26, "bseq": "GCCTACCGGTTCGCGAACCGGTAGGC", "sstr": "))))))))))))))))))))))))))", "form": "AAB..BBBB.BBBBBBBBBB..B.B-" } }, "chains": { "chain_M": { "num_nts": 26, "bseq": "GCCTACCGGTTCGCGAACCGGTAGGC", "sstr": "((((((((((((((((((((((((((", "form": ".BB..BBBBBBBBBBBBBBB.BB.B-", "helical_rise": 3.356, "helical_rise_std": 0.489, "helical_axis": [ 0.465, 0.086, 0.881 ], "point1": [ -4.414, 59.075, 3.471 ], "point2": [ 34.644, 66.330, 77.552 ], "num_chars": 76, "suite": "G1bC!!C!!T4bA!!C!!C!!G!!G!!T1bT!!C!!G!!C4bG!!A!!A!!C!!C4bG!!G!!T4bA!!G!!G!!C" }, "chain_N": { "num_nts": 26, "bseq": "GCCTACCGGTTCGCGAACCGGTAGGC", "sstr": "))))))))))))))))))))))))))", "form": "AAB..BBBB.BBBBBBBBBB..B.B-", "helical_rise": 3.309, "helical_rise_std": 0.445, "helical_axis": [ -0.472, -0.121, -0.873 ], "point1": [ 35.756, 67.934, 77.792 ], "point2": [ -3.281, 57.891, 5.487 ], "num_chars": 76, "suite": "G!!C1bC!!T4bA!!C!!C!!G!!G!!T!!T!!C!!G!!C4bG!!A!!A!!C!!C4bG!!G!!T4bA!!G!!G!!C" } }, "num_nts": 52, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "M", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/1", "linked_nts": [ null, "///M/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 125.182, "delta": 78.439, "epsilon": -168.613, "zeta": -63.898, "epsilon_zeta": -104.715, "bb_type": "BI", "chi": -158.161, "glyco_bond": "anti", "C5prime_xyz": [ -1.258, 8.833, 0.490 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.159, "Dp": 4.211, "splay_angle": 14.417, "splay_distance": 2.290, "splay_ratio": 0.126, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 12.660, "v1": -24.465, "v2": 25.774, "v3": -19.113, "v4": 4.231, "amplitude": 26.160, "phase_angle": 350.144, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -3.823, 58.435, 5.039 ], "x_axis": [ -0.800, -0.342, 0.493 ], "y_axis": [ 0.191, -0.924, -0.332 ], "z_axis": [ 0.569, -0.171, 0.804 ], "quaternion": [ -0.142, 0.283, -0.134, 0.939 ] } }, { "index": 2, "index_chain": 2, "chain_name": "M", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/2", "linked_nts": [ "///M/1", "///M/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -89.591, "beta": -171.594, "gamma": 80.879, "delta": 132.808, "epsilon": 177.859, "zeta": -95.151, "epsilon_zeta": -86.990, "bb_type": "BI", "chi": -107.890, "glyco_bond": "anti", "C5prime_xyz": [ -2.171, 8.316, -1.892 ], "P_xyz": [ 0.420, 8.772, -2.152 ], "form": "B", "ssZp": 2.248, "Dp": 2.263, "splay_angle": 25.921, "splay_distance": 4.348, "splay_ratio": 0.224, "d22": 4.397, "d64": 4.004, "eta": 165.441, "theta": -133.413, "eta_prime": -152.031, "theta_prime": -154.087, "eta_base": -123.606, "theta_base": -116.046, "v0": -22.500, "v1": 31.359, "v2": -27.954, "v3": 15.313, "v4": 4.399, "amplitude": 31.243, "phase_angle": 153.474, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.046, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -2.851, 58.565, 7.108 ], "x_axis": [ -0.550, -0.750, 0.369 ], "y_axis": [ 0.767, -0.628, -0.133 ], "z_axis": [ 0.331, 0.210, 0.920 ], "quaternion": [ -0.431, 0.199, 0.022, 0.880 ] } }, { "index": 3, "index_chain": 3, "chain_name": "M", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/3", "linked_nts": [ "///M/2", "///M/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -76.837, "beta": -177.294, "gamma": 68.865, "delta": 133.196, "epsilon": -165.360, "zeta": -95.948, "epsilon_zeta": -69.412, "bb_type": "BI", "chi": -119.781, "glyco_bond": "anti", "C5prime_xyz": [ -2.271, 8.625, -1.433 ], "P_xyz": [ 0.148, 9.658, -1.192 ], "form": "B", "ssZp": 2.164, "Dp": 2.212, "splay_angle": 17.816, "splay_distance": 3.012, "splay_ratio": 0.155, "d22": 4.289, "d64": 3.470, "eta": 172.685, "theta": -128.295, "eta_prime": -162.094, "theta_prime": -140.341, "eta_base": -117.320, "theta_base": -101.579, "v0": -29.245, "v1": 37.043, "v2": -30.513, "v3": 14.301, "v4": 9.190, "amplitude": 36.417, "phase_angle": 146.919, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ -1.567, 58.725, 11.260 ], "x_axis": [ -0.042, -0.997, 0.071 ], "y_axis": [ 0.911, -0.068, -0.406 ], "z_axis": [ 0.410, 0.048, 0.911 ], "quaternion": [ 0.671, -0.169, 0.126, -0.711 ] } }, { "index": 4, "index_chain": 4, "chain_name": "M", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///M/4", "linked_nts": [ "///M/3", "///M/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -64.597, "beta": -177.934, "gamma": 41.413, "delta": 144.259, "epsilon": -109.885, "zeta": 168.626, "epsilon_zeta": 81.489, "bb_type": "BII", "chi": -87.087, "glyco_bond": "anti", "C5prime_xyz": [ -2.998, 7.643, -2.564 ], "P_xyz": [ -0.980, 9.286, -3.010 ], "form": ".", "ssZp": 0.939, "Dp": 1.060, "splay_angle": 23.185, "splay_distance": 4.022, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 179.911, "theta": 175.759, "eta_prime": -155.572, "theta_prime": 174.553, "eta_base": -114.154, "theta_base": -129.419, "v0": -27.227, "v1": 40.380, "v2": -37.619, "v3": 22.888, "v4": 2.556, "amplitude": 40.634, "phase_angle": 157.788, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -0.310, 57.990, 13.897 ], "x_axis": [ 0.444, -0.860, -0.250 ], "y_axis": [ 0.857, 0.489, -0.161 ], "z_axis": [ 0.261, -0.142, 0.955 ], "quaternion": [ 0.850, -0.005, 0.150, -0.505 ] } }, { "index": 5, "index_chain": 5, "chain_name": "M", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///M/5", "linked_nts": [ "///M/4", "///M/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.177, "beta": 132.051, "gamma": 45.014, "delta": 136.740, "epsilon": 178.355, "zeta": -98.932, "epsilon_zeta": -82.713, "bb_type": "BI", "chi": -102.160, "glyco_bond": "anti", "C5prime_xyz": [ -2.417, 8.111, -2.109 ], "P_xyz": [ 0.211, 8.372, -2.192 ], "form": ".", "ssZp": 2.177, "Dp": 2.201, "splay_angle": 21.812, "splay_distance": 3.820, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 158.621, "theta": -123.428, "eta_prime": -171.087, "theta_prime": -153.994, "eta_base": -117.022, "theta_base": -119.969, "v0": -23.632, "v1": 34.985, "v2": -32.538, "v3": 19.541, "v4": 2.425, "amplitude": 35.222, "phase_angle": 157.490, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.343, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 1.360, 59.132, 17.373 ], "x_axis": [ 0.928, -0.353, -0.119 ], "y_axis": [ 0.353, 0.935, -0.024 ], "z_axis": [ 0.120, -0.020, 0.993 ], "quaternion": [ 0.982, -0.001, 0.061, -0.180 ] } }, { "index": 6, "index_chain": 6, "chain_name": "M", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/6", "linked_nts": [ "///M/5", "///M/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.827, "beta": -176.441, "gamma": 39.994, "delta": 129.458, "epsilon": -179.305, "zeta": -104.426, "epsilon_zeta": -74.880, "bb_type": "BI", "chi": -116.759, "glyco_bond": "anti", "C5prime_xyz": [ -2.369, 8.557, -1.621 ], "P_xyz": [ -0.374, 10.208, -1.134 ], "form": "B", "ssZp": 2.262, "Dp": 2.289, "splay_angle": 19.670, "splay_distance": 3.332, "splay_ratio": 0.172, "d22": 4.293, "d64": 3.904, "eta": 169.228, "theta": -154.348, "eta_prime": -170.432, "theta_prime": -160.141, "eta_base": -126.669, "theta_base": -119.537, "v0": -29.561, "v1": 36.302, "v2": -29.078, "v3": 12.590, "v4": 10.494, "amplitude": 35.704, "phase_angle": 144.528, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 2.498, 58.238, 20.908 ], "x_axis": [ 0.922, 0.206, -0.327 ], "y_axis": [ -0.218, 0.976, 0.000 ], "z_axis": [ 0.319, 0.071, 0.945 ], "quaternion": [ 0.980, -0.018, 0.165, 0.108 ] } }, { "index": 7, "index_chain": 7, "chain_name": "M", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/7", "linked_nts": [ "///M/6", "///M/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.868, "beta": -177.356, "gamma": 38.645, "delta": 140.445, "epsilon": -160.929, "zeta": -108.810, "epsilon_zeta": -52.119, "bb_type": "BI", "chi": -109.995, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.397, -1.760 ], "P_xyz": [ 0.010, 9.822, -1.197 ], "form": "B", "ssZp": 1.956, "Dp": 2.043, "splay_angle": 17.888, "splay_distance": 2.993, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 175.697, "theta": -137.699, "eta_prime": -164.710, "theta_prime": -146.846, "eta_base": -119.891, "theta_base": -101.046, "v0": -23.643, "v1": 35.925, "v2": -34.083, "v3": 21.209, "v4": 1.388, "amplitude": 36.448, "phase_angle": 159.247, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 4.008, 57.984, 23.867 ], "x_axis": [ 0.617, 0.733, -0.287 ], "y_axis": [ -0.707, 0.676, 0.209 ], "z_axis": [ 0.347, 0.074, 0.935 ], "quaternion": [ 0.898, 0.038, 0.176, 0.401 ] } }, { "index": 8, "index_chain": 8, "chain_name": "M", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/8", "linked_nts": [ "///M/7", "///M/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -89.117, "beta": 175.158, "gamma": 63.743, "delta": 104.014, "epsilon": 70.614, "zeta": 20.095, "epsilon_zeta": 50.519, "bb_type": "--", "chi": -106.804, "glyco_bond": "anti", "C5prime_xyz": [ -2.450, 8.133, -2.211 ], "P_xyz": [ 0.011, 8.685, -3.030 ], "form": "B", "ssZp": 1.248, "Dp": 1.165, "splay_angle": 19.242, "splay_distance": 3.286, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 171.830, "theta": -152.979, "eta_prime": -157.573, "theta_prime": -169.742, "eta_base": -112.157, "theta_base": -129.589, "v0": -20.348, "v1": 16.603, "v2": -7.114, "v3": -4.531, "v4": 15.781, "amplitude": 19.920, "phase_angle": 110.924, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 4.690, 59.001, 26.599 ], "x_axis": [ 0.013, 0.990, -0.143 ], "y_axis": [ -0.830, 0.091, 0.551 ], "z_axis": [ 0.558, 0.112, 0.822 ], "quaternion": [ 0.694, 0.158, 0.253, 0.655 ] } }, { "index": 9, "index_chain": 9, "chain_name": "M", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/9", "linked_nts": [ "///M/8", "///M/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -142.475, "beta": -130.811, "gamma": 46.371, "delta": 140.784, "epsilon": -171.202, "zeta": -125.607, "epsilon_zeta": -45.594, "bb_type": "BI", "chi": -88.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.659, 7.710, -2.604 ], "P_xyz": [ -0.847, 9.634, -2.323 ], "form": "B", "ssZp": 1.878, "Dp": 2.118, "splay_angle": 20.366, "splay_distance": 3.490, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 163.202, "theta": -157.842, "eta_prime": -176.643, "theta_prime": -169.303, "eta_base": -135.197, "theta_base": -129.069, "v0": -24.961, "v1": 36.771, "v2": -34.162, "v3": 20.492, "v4": 2.642, "amplitude": 37.018, "phase_angle": 157.346, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 6.700, 59.389, 29.169 ], "x_axis": [ -0.409, 0.904, 0.125 ], "y_axis": [ -0.713, -0.403, 0.573 ], "z_axis": [ 0.569, 0.145, 0.810 ], "quaternion": [ 0.499, 0.214, 0.222, 0.810 ] } }, { "index": 10, "index_chain": 10, "chain_name": "M", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///M/10", "linked_nts": [ "///M/9", "///M/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.205, "beta": 146.368, "gamma": 64.818, "delta": 98.666, "epsilon": 178.206, "zeta": -94.543, "epsilon_zeta": -87.251, "bb_type": "BI", "chi": -136.661, "glyco_bond": "anti", "C5prime_xyz": [ -2.749, 8.805, -1.044 ], "P_xyz": [ -0.421, 9.809, -1.767 ], "form": "B", "ssZp": 3.189, "Dp": 3.078, "splay_angle": 21.395, "splay_distance": 3.621, "splay_ratio": 0.187, "d22": 4.357, "d64": 4.319, "eta": 172.129, "theta": -159.776, "eta_prime": -175.057, "theta_prime": -167.311, "eta_base": -128.853, "theta_base": -130.782, "v0": -35.837, "v1": 22.613, "v2": -1.854, "v3": -19.012, "v4": 34.620, "amplitude": 36.464, "phase_angle": 92.915, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 8.634, 60.283, 31.933 ], "x_axis": [ -0.683, 0.580, 0.444 ], "y_axis": [ -0.393, -0.804, 0.446 ], "z_axis": [ 0.616, 0.129, 0.777 ], "quaternion": [ 0.269, 0.293, 0.159, 0.903 ] } }, { "index": 11, "index_chain": 11, "chain_name": "M", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///M/11", "linked_nts": [ "///M/10", "///M/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.137, "beta": 164.236, "gamma": 52.330, "delta": 123.572, "epsilon": -174.342, "zeta": -94.078, "epsilon_zeta": -80.264, "bb_type": "BI", "chi": -130.073, "glyco_bond": "anti", "C5prime_xyz": [ -2.373, 8.731, -1.083 ], "P_xyz": [ -0.020, 9.866, -0.623 ], "form": "B", "ssZp": 2.428, "Dp": 2.442, "splay_angle": 21.045, "splay_distance": 3.509, "splay_ratio": 0.183, "d22": 4.478, "d64": 3.834, "eta": -179.090, "theta": -138.701, "eta_prime": -153.572, "theta_prime": -147.624, "eta_base": -110.599, "theta_base": -93.678, "v0": -31.318, "v1": 33.979, "v2": -23.761, "v3": 6.133, "v4": 15.693, "amplitude": 34.003, "phase_angle": 134.332, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 10.639, 61.641, 34.624 ], "x_axis": [ -0.737, 0.064, 0.673 ], "y_axis": [ 0.059, -0.986, 0.158 ], "z_axis": [ 0.674, 0.156, 0.722 ], "quaternion": [ 0.001, 0.363, 0.085, 0.928 ] } }, { "index": 12, "index_chain": 12, "chain_name": "M", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/12", "linked_nts": [ "///M/11", "///M/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.457, "beta": -175.593, "gamma": 31.917, "delta": 135.689, "epsilon": -175.931, "zeta": -105.869, "epsilon_zeta": -70.061, "bb_type": "BI", "chi": -101.807, "glyco_bond": "anti", "C5prime_xyz": [ -2.034, 8.120, -2.134 ], "P_xyz": [ 0.163, 9.553, -1.822 ], "form": "B", "ssZp": 1.890, "Dp": 2.094, "splay_angle": 20.066, "splay_distance": 3.377, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 173.005, "theta": -148.453, "eta_prime": -160.106, "theta_prime": -154.389, "eta_base": -99.296, "theta_base": -112.368, "v0": -16.461, "v1": 28.167, "v2": -28.640, "v3": 19.578, "v4": -2.078, "amplitude": 29.597, "phase_angle": 165.392, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 11.924, 61.919, 37.878 ], "x_axis": [ -0.418, -0.649, 0.635 ], "y_axis": [ 0.638, -0.708, -0.303 ], "z_axis": [ 0.646, 0.279, 0.711 ], "quaternion": [ -0.382, 0.380, -0.007, 0.842 ] } }, { "index": 13, "index_chain": 13, "chain_name": "M", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/13", "linked_nts": [ "///M/12", "///M/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.338, "beta": -178.647, "gamma": 32.052, "delta": 142.987, "epsilon": -171.326, "zeta": -111.841, "epsilon_zeta": -59.485, "bb_type": "BI", "chi": -90.768, "glyco_bond": "anti", "C5prime_xyz": [ -2.190, 7.735, -2.465 ], "P_xyz": [ 0.096, 9.048, -2.443 ], "form": "B", "ssZp": 1.644, "Dp": 1.927, "splay_angle": 18.911, "splay_distance": 3.245, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 172.960, "theta": -141.481, "eta_prime": -163.073, "theta_prime": -153.368, "eta_base": -119.229, "theta_base": -121.616, "v0": -12.890, "v1": 28.198, "v2": -31.978, "v3": 25.123, "v4": -7.827, "amplitude": 32.087, "phase_angle": 175.273, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 14.353, 62.195, 40.207 ], "x_axis": [ -0.012, -0.955, 0.296 ], "y_axis": [ 0.831, -0.174, -0.529 ], "z_axis": [ 0.557, 0.240, 0.795 ], "quaternion": [ 0.634, -0.303, 0.103, -0.704 ] } }, { "index": 14, "index_chain": 14, "chain_name": "M", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/14", "linked_nts": [ "///M/13", "///M/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -44.062, "beta": 168.629, "gamma": 34.011, "delta": 140.679, "epsilon": -146.505, "zeta": -168.821, "epsilon_zeta": 22.316, "bb_type": "--", "chi": -94.247, "glyco_bond": "anti", "C5prime_xyz": [ -2.812, 7.961, -2.353 ], "P_xyz": [ -0.675, 9.494, -2.601 ], "form": "B", "ssZp": 1.790, "Dp": 1.869, "splay_angle": 19.234, "splay_distance": 3.295, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 171.385, "theta": -174.953, "eta_prime": -167.591, "theta_prime": 179.981, "eta_base": -133.561, "theta_base": -138.815, "v0": -28.441, "v1": 39.833, "v2": -35.642, "v3": 20.126, "v4": 5.042, "amplitude": 39.611, "phase_angle": 154.132, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 16.296, 62.677, 42.761 ], "x_axis": [ 0.275, -0.954, -0.120 ], "y_axis": [ 0.794, 0.296, -0.532 ], "z_axis": [ 0.543, 0.051, 0.838 ], "quaternion": [ 0.776, -0.188, 0.213, -0.563 ] } }, { "index": 15, "index_chain": 15, "chain_name": "M", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/15", "linked_nts": [ "///M/14", "///M/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.449, "beta": 127.110, "gamma": 50.310, "delta": 134.570, "epsilon": -168.987, "zeta": -127.031, "epsilon_zeta": -41.955, "bb_type": "BI", "chi": -110.771, "glyco_bond": "anti", "C5prime_xyz": [ -2.605, 8.413, -1.820 ], "P_xyz": [ 0.008, 8.840, -1.840 ], "form": "B", "ssZp": 2.164, "Dp": 2.210, "splay_angle": 20.006, "splay_distance": 3.246, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 164.465, "theta": -143.398, "eta_prime": -167.965, "theta_prime": -165.869, "eta_base": -126.707, "theta_base": -117.539, "v0": -32.034, "v1": 40.743, "v2": -33.686, "v3": 15.929, "v4": 9.884, "amplitude": 40.061, "phase_angle": 147.232, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.017, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 18.187, 63.754, 45.234 ], "x_axis": [ 0.689, -0.654, -0.313 ], "y_axis": [ 0.559, 0.754, -0.345 ], "z_axis": [ 0.461, 0.063, 0.885 ], "quaternion": [ 0.912, -0.112, 0.212, -0.332 ] } }, { "index": 16, "index_chain": 16, "chain_name": "M", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///M/16", "linked_nts": [ "///M/15", "///M/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.625, "beta": 166.876, "gamma": 54.583, "delta": 140.041, "epsilon": -169.968, "zeta": -113.524, "epsilon_zeta": -56.443, "bb_type": "BI", "chi": -109.441, "glyco_bond": "anti", "C5prime_xyz": [ -2.012, 8.284, -1.736 ], "P_xyz": [ 0.532, 8.932, -1.499 ], "form": "B", "ssZp": 1.939, "Dp": 2.045, "splay_angle": 19.054, "splay_distance": 3.353, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 170.354, "theta": -124.611, "eta_prime": -165.172, "theta_prime": -144.219, "eta_base": -112.370, "theta_base": -107.686, "v0": -18.860, "v1": 31.948, "v2": -32.257, "v3": 22.026, "v4": -2.126, "amplitude": 33.399, "phase_angle": 164.970, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 19.952, 64.151, 47.930 ], "x_axis": [ 0.890, 0.013, -0.456 ], "y_axis": [ -0.018, 1.000, -0.007 ], "z_axis": [ 0.456, 0.014, 0.890 ], "quaternion": [ 0.972, -0.005, 0.235, 0.008 ] } }, { "index": 17, "index_chain": 17, "chain_name": "M", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///M/17", "linked_nts": [ "///M/16", "///M/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -14.197, "beta": 155.990, "gamma": 11.225, "delta": 149.048, "epsilon": -115.568, "zeta": -177.037, "epsilon_zeta": 61.469, "bb_type": "BII", "chi": -99.899, "glyco_bond": "anti", "C5prime_xyz": [ -3.027, 8.063, -2.035 ], "P_xyz": [ -1.265, 10.033, -1.783 ], "form": "B", "ssZp": 1.471, "Dp": 1.339, "splay_angle": 21.269, "splay_distance": 3.575, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 179.922, "theta": -161.752, "eta_prime": -153.627, "theta_prime": -167.042, "eta_base": -112.589, "theta_base": -108.948, "v0": -31.616, "v1": 45.409, "v2": -41.126, "v3": 24.208, "v4": 4.387, "amplitude": 45.131, "phase_angle": 155.680, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 22.216, 63.924, 50.393 ], "x_axis": [ 0.731, 0.520, -0.442 ], "y_axis": [ -0.448, 0.854, 0.264 ], "z_axis": [ 0.515, 0.005, 0.857 ], "quaternion": [ 0.928, 0.070, 0.258, 0.261 ] } }, { "index": 18, "index_chain": 18, "chain_name": "M", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/18", "linked_nts": [ "///M/17", "///M/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -41.873, "beta": 126.761, "gamma": 33.751, "delta": 121.511, "epsilon": -166.047, "zeta": -122.674, "epsilon_zeta": -43.373, "bb_type": "BI", "chi": -116.983, "glyco_bond": "anti", "C5prime_xyz": [ -2.843, 8.510, -1.766 ], "P_xyz": [ -0.469, 9.580, -1.633 ], "form": "B", "ssZp": 2.389, "Dp": 2.389, "splay_angle": 20.421, "splay_distance": 3.607, "splay_ratio": 0.180, "d22": 3.916, "d64": 3.727, "eta": 168.273, "theta": -136.510, "eta_prime": -171.324, "theta_prime": -148.176, "eta_base": -110.281, "theta_base": -114.823, "v0": -37.741, "v1": 38.974, "v2": -25.456, "v3": 4.198, "v4": 20.820, "amplitude": 39.594, "phase_angle": 130.009, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 24.186, 64.579, 53.304 ], "x_axis": [ 0.299, 0.952, -0.072 ], "y_axis": [ -0.838, 0.298, 0.456 ], "z_axis": [ 0.456, -0.077, 0.887 ], "quaternion": [ 0.788, 0.169, 0.167, 0.568 ] } }, { "index": 19, "index_chain": 19, "chain_name": "M", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/19", "linked_nts": [ "///M/18", "///M/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 2.925, "beta": 152.481, "gamma": -3.333, "delta": 143.206, "epsilon": -144.438, "zeta": -160.937, "epsilon_zeta": 16.499, "bb_type": "--", "chi": -98.429, "glyco_bond": "anti", "C5prime_xyz": [ -2.670, 8.104, -2.171 ], "P_xyz": [ -0.980, 10.125, -1.851 ], "form": "B", "ssZp": 1.818, "Dp": 1.791, "splay_angle": 19.140, "splay_distance": 3.277, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 173.530, "theta": -173.046, "eta_prime": -165.915, "theta_prime": -171.381, "eta_base": -126.929, "theta_base": -117.224, "v0": -26.602, "v1": 39.425, "v2": -36.613, "v3": 22.203, "v4": 2.581, "amplitude": 39.596, "phase_angle": 157.617, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 26.367, 65.218, 56.105 ], "x_axis": [ -0.275, 0.961, -0.018 ], "y_axis": [ -0.847, -0.233, 0.477 ], "z_axis": [ 0.454, 0.146, 0.879 ], "quaternion": [ 0.585, 0.141, 0.202, 0.773 ] } }, { "index": 20, "index_chain": 20, "chain_name": "M", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/20", "linked_nts": [ "///M/19", "///M/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.278, "beta": 135.132, "gamma": 48.651, "delta": 140.789, "epsilon": -158.687, "zeta": -158.651, "epsilon_zeta": -0.036, "bb_type": "--", "chi": -102.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.511, 8.217, -2.064 ], "P_xyz": [ 0.110, 8.552, -2.257 ], "form": "B", "ssZp": 2.060, "Dp": 2.073, "splay_angle": 20.372, "splay_distance": 3.417, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 166.920, "theta": -145.306, "eta_prime": -165.131, "theta_prime": -167.478, "eta_base": -111.652, "theta_base": -137.611, "v0": -26.458, "v1": 38.505, "v2": -35.584, "v3": 20.934, "v4": 3.318, "amplitude": 38.767, "phase_angle": 156.620, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.046, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 26.966, 65.223, 59.327 ], "x_axis": [ -0.681, 0.617, 0.395 ], "y_axis": [ -0.426, -0.772, 0.472 ], "z_axis": [ 0.596, 0.153, 0.789 ], "quaternion": [ 0.289, 0.275, 0.174, 0.900 ] } }, { "index": 21, "index_chain": 21, "chain_name": "M", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/21", "linked_nts": [ "///M/20", "///M/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -10.238, "beta": 130.199, "gamma": 27.685, "delta": 127.830, "epsilon": 178.218, "zeta": -95.351, "epsilon_zeta": -86.431, "bb_type": "BI", "chi": -110.855, "glyco_bond": "anti", "C5prime_xyz": [ -2.668, 8.376, -1.896 ], "P_xyz": [ -0.261, 9.434, -1.471 ], "form": ".", "ssZp": 2.359, "Dp": 2.366, "splay_angle": 21.644, "splay_distance": 3.885, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 166.229, "theta": -133.363, "eta_prime": -173.201, "theta_prime": -150.223, "eta_base": -137.287, "theta_base": -118.583, "v0": -32.414, "v1": 38.114, "v2": -29.161, "v3": 11.109, "v4": 13.179, "amplitude": 37.508, "phase_angle": 141.031, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 29.433, 65.614, 61.657 ], "x_axis": [ -0.827, 0.175, 0.534 ], "y_axis": [ -0.047, -0.969, 0.244 ], "z_axis": [ 0.560, 0.177, 0.809 ], "quaternion": [ 0.059, 0.288, 0.111, 0.949 ] } }, { "index": 22, "index_chain": 22, "chain_name": "M", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///M/22", "linked_nts": [ "///M/21", "///M/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.335, "beta": -176.048, "gamma": 35.500, "delta": 136.749, "epsilon": -121.468, "zeta": -157.235, "epsilon_zeta": 35.767, "bb_type": "--", "chi": -112.922, "glyco_bond": "anti", "C5prime_xyz": [ -2.787, 8.404, -1.702 ], "P_xyz": [ -1.079, 10.360, -1.251 ], "form": "B", "ssZp": 1.587, "Dp": 1.536, "splay_angle": 19.458, "splay_distance": 3.312, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -171.155, "theta": -164.582, "eta_prime": -156.198, "theta_prime": -160.453, "eta_base": -119.381, "theta_base": -121.491, "v0": -34.060, "v1": 42.639, "v2": -34.645, "v3": 15.980, "v4": 11.045, "amplitude": 41.761, "phase_angle": 146.058, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 30.688, 67.297, 64.926 ], "x_axis": [ -0.804, -0.349, 0.482 ], "y_axis": [ 0.362, -0.930, -0.069 ], "z_axis": [ 0.472, 0.119, 0.874 ], "quaternion": [ -0.187, 0.251, 0.013, 0.950 ] } }, { "index": 23, "index_chain": 23, "chain_name": "M", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///M/23", "linked_nts": [ "///M/22", "///M/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.333, "beta": 135.350, "gamma": 44.843, "delta": 146.423, "epsilon": -67.130, "zeta": 143.282, "epsilon_zeta": 149.588, "bb_type": "BII", "chi": -97.933, "glyco_bond": "anti", "C5prime_xyz": [ -3.035, 7.971, -2.202 ], "P_xyz": [ -0.547, 8.787, -2.562 ], "form": "B", "ssZp": 0.602, "Dp": 0.789, "splay_angle": 19.297, "splay_distance": 3.194, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -171.079, "theta": -147.559, "eta_prime": -146.261, "theta_prime": -170.943, "eta_base": -114.590, "theta_base": -121.529, "v0": -32.868, "v1": 43.980, "v2": -37.835, "v3": 20.043, "v4": 7.757, "amplitude": 43.261, "phase_angle": 150.994, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.073, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 32.926, 67.509, 67.360 ], "x_axis": [ -0.431, -0.784, 0.447 ], "y_axis": [ 0.794, -0.565, -0.226 ], "z_axis": [ 0.430, 0.258, 0.865 ], "quaternion": [ -0.466, 0.259, 0.009, 0.846 ] } }, { "index": 24, "index_chain": 24, "chain_name": "M", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/24", "linked_nts": [ "///M/23", "///M/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 99.681, "beta": -133.478, "gamma": 153.232, "delta": 128.739, "epsilon": -169.363, "zeta": -106.284, "epsilon_zeta": -63.080, "bb_type": "BI", "chi": -121.193, "glyco_bond": "anti", "C5prime_xyz": [ -2.713, 8.641, -1.432 ], "P_xyz": [ -0.476, 9.063, -2.838 ], "form": ".", "ssZp": 2.391, "Dp": 2.389, "splay_angle": 18.467, "splay_distance": 3.292, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 142.284, "theta": -143.729, "eta_prime": 176.937, "theta_prime": -170.741, "eta_base": -133.591, "theta_base": -137.299, "v0": -35.166, "v1": 40.728, "v2": -30.703, "v3": 11.161, "v4": 14.728, "amplitude": 40.116, "phase_angle": 139.940, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 34.596, 68.473, 69.906 ], "x_axis": [ 0.134, -0.966, 0.219 ], "y_axis": [ 0.905, 0.029, -0.424 ], "z_axis": [ 0.403, 0.255, 0.879 ], "quaternion": [ 0.714, -0.238, 0.064, -0.655 ] } }, { "index": 25, "index_chain": 25, "chain_name": "M", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///M/25", "linked_nts": [ "///M/24", "///M/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -32.728, "beta": -165.971, "gamma": 5.074, "delta": 142.334, "epsilon": -169.442, "zeta": -102.185, "epsilon_zeta": -67.257, "bb_type": "BI", "chi": -103.263, "glyco_bond": "anti", "C5prime_xyz": [ -1.953, 8.102, -2.023 ], "P_xyz": [ -0.318, 10.154, -1.715 ], "form": "B", "ssZp": 1.965, "Dp": 2.081, "splay_angle": 17.862, "splay_distance": 3.097, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 171.157, "theta": -149.656, "eta_prime": -173.916, "theta_prime": -156.341, "eta_base": -136.256, "theta_base": -110.926, "v0": -13.737, "v1": 28.182, "v2": -31.124, "v3": 23.723, "v4": -6.406, "amplitude": 31.359, "phase_angle": 172.983, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 34.828, 68.698, 73.183 ], "x_axis": [ 0.560, -0.813, -0.159 ], "y_axis": [ 0.723, 0.574, -0.385 ], "z_axis": [ 0.404, 0.100, 0.909 ], "quaternion": [ 0.872, -0.139, 0.162, -0.440 ] } }, { "index": 26, "index_chain": 26, "chain_name": "M", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///M/26", "linked_nts": [ "///M/25", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -68.515, "beta": 160.370, "gamma": 62.689, "delta": 102.273, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -128.604, "glyco_bond": "anti", "C5prime_xyz": [ -2.630, 8.717, -1.463 ], "P_xyz": [ -0.323, 9.850, -2.061 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.803, "v1": 23.051, "v2": -3.655, "v3": -16.489, "v4": 32.335, "amplitude": 34.854, "phase_angle": 96.019, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 36.515, 68.386, 75.761 ], "x_axis": [ 0.855, -0.357, -0.376 ], "y_axis": [ 0.330, 0.934, -0.137 ], "z_axis": [ 0.400, -0.007, 0.916 ], "quaternion": [ 0.963, -0.034, 0.202, -0.178 ] } }, { "index": 27, "index_chain": 1, "chain_name": "N", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/1", "linked_nts": [ null, "///N/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 33.144, "delta": 74.020, "epsilon": -173.800, "zeta": -65.936, "epsilon_zeta": -107.864, "bb_type": "BI", "chi": -157.391, "glyco_bond": "anti", "C5prime_xyz": [ -1.235, 8.862, 0.477 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.078, "Dp": 4.180, "splay_angle": 22.410, "splay_distance": 3.623, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 14.439, "v1": -26.240, "v2": 26.843, "v3": -19.112, "v4": 3.104, "amplitude": 27.506, "phase_angle": 347.402, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 36.453, 68.419, 76.160 ], "x_axis": [ 0.799, -0.334, -0.500 ], "y_axis": [ -0.149, -0.916, 0.373 ], "z_axis": [ -0.582, -0.223, -0.782 ], "quaternion": [ 0.159, 0.935, -0.129, -0.289 ] } }, { "index": 28, "index_chain": 2, "chain_name": "N", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/2", "linked_nts": [ "///N/1", "///N/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -171.885, "beta": -174.333, "gamma": 148.166, "delta": 100.615, "epsilon": -162.945, "zeta": -56.541, "epsilon_zeta": -106.405, "bb_type": "BI", "chi": -159.499, "glyco_bond": "anti", "C5prime_xyz": [ -1.026, 8.561, 0.619 ], "P_xyz": [ 1.048, 9.321, -0.854 ], "form": "A", "ssZp": 4.062, "Dp": 4.113, "splay_angle": 18.323, "splay_distance": 3.080, "splay_ratio": 0.162, "d22": 4.248, "d64": 3.954, "eta": 167.954, "theta": -140.944, "eta_prime": -167.219, "theta_prime": -141.609, "eta_base": -125.522, "theta_base": -118.497, "v0": 7.075, "v1": -19.015, "v2": 22.999, "v3": -19.265, "v4": 7.799, "amplitude": 23.002, "phase_angle": 0.788, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 34.820, 68.665, 72.935 ], "x_axis": [ 0.433, -0.792, -0.430 ], "y_axis": [ -0.634, -0.606, 0.480 ], "z_axis": [ -0.641, 0.065, -0.765 ], "quaternion": [ 0.124, 0.837, -0.426, -0.320 ] } }, { "index": 29, "index_chain": 3, "chain_name": "N", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/3", "linked_nts": [ "///N/2", "///N/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -82.826, "beta": -171.822, "gamma": 69.315, "delta": 134.357, "epsilon": -164.269, "zeta": -94.759, "epsilon_zeta": -69.511, "bb_type": "BI", "chi": -121.071, "glyco_bond": "anti", "C5prime_xyz": [ -2.266, 8.660, -1.341 ], "P_xyz": [ 0.121, 9.746, -0.961 ], "form": "B", "ssZp": 2.232, "Dp": 2.226, "splay_angle": 17.956, "splay_distance": 3.036, "splay_ratio": 0.157, "d22": 4.254, "d64": 3.469, "eta": 167.230, "theta": -125.016, "eta_prime": -152.669, "theta_prime": -136.330, "eta_base": -116.595, "theta_base": -96.049, "v0": -29.488, "v1": 38.278, "v2": -32.279, "v3": 15.972, "v4": 8.310, "amplitude": 37.727, "phase_angle": 148.826, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.138, "filter_rmsd": 0.062, "frame": { "rmsd": 0.001, "origin": [ 34.196, 68.565, 69.921 ], "x_axis": [ 0.096, -0.995, -0.004 ], "y_axis": [ -0.896, -0.088, 0.434 ], "z_axis": [ -0.433, -0.038, -0.901 ], "quaternion": [ 0.164, 0.722, -0.655, -0.151 ] } }, { "index": 30, "index_chain": 4, "chain_name": "N", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/4", "linked_nts": [ "///N/3", "///N/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -66.412, "beta": -178.072, "gamma": 41.082, "delta": 144.909, "epsilon": -110.724, "zeta": 173.007, "epsilon_zeta": 76.269, "bb_type": "BII", "chi": -86.200, "glyco_bond": "anti", "C5prime_xyz": [ -3.147, 7.604, -2.523 ], "P_xyz": [ -1.162, 9.254, -3.090 ], "form": ".", "ssZp": 1.170, "Dp": 1.162, "splay_angle": 22.561, "splay_distance": 3.900, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 176.220, "theta": -179.820, "eta_prime": -157.355, "theta_prime": 178.923, "eta_base": -113.263, "theta_base": -126.877, "v0": -28.267, "v1": 40.849, "v2": -37.269, "v3": 22.038, "v4": 3.713, "amplitude": 40.759, "phase_angle": 156.116, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 32.892, 67.367, 67.456 ], "x_axis": [ -0.399, -0.860, 0.318 ], "y_axis": [ -0.880, 0.457, 0.129 ], "z_axis": [ -0.256, -0.229, -0.939 ], "quaternion": [ -0.172, -0.520, 0.836, -0.030 ] } }, { "index": 31, "index_chain": 5, "chain_name": "N", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/5", "linked_nts": [ "///N/4", "///N/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.700, "beta": 133.378, "gamma": 43.861, "delta": 136.848, "epsilon": 179.011, "zeta": -98.344, "epsilon_zeta": -82.645, "bb_type": "BI", "chi": -101.929, "glyco_bond": "anti", "C5prime_xyz": [ -2.447, 8.094, -2.128 ], "P_xyz": [ 0.174, 8.435, -2.183 ], "form": ".", "ssZp": 2.189, "Dp": 2.224, "splay_angle": 22.218, "splay_distance": 3.916, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 157.147, "theta": -123.466, "eta_prime": -173.632, "theta_prime": -152.781, "eta_base": -120.183, "theta_base": -120.971, "v0": -24.537, "v1": 35.542, "v2": -32.592, "v3": 19.092, "v4": 3.250, "amplitude": 35.621, "phase_angle": 156.201, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.363, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 30.964, 67.830, 64.098 ], "x_axis": [ -0.876, -0.380, 0.298 ], "y_axis": [ -0.420, 0.904, -0.081 ], "z_axis": [ -0.239, -0.196, -0.951 ], "quaternion": [ -0.139, -0.207, 0.966, -0.072 ] } }, { "index": 32, "index_chain": 6, "chain_name": "N", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/6", "linked_nts": [ "///N/5", "///N/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.332, "beta": -174.753, "gamma": 38.487, "delta": 129.339, "epsilon": -179.469, "zeta": -104.219, "epsilon_zeta": -75.250, "bb_type": "BI", "chi": -117.690, "glyco_bond": "anti", "C5prime_xyz": [ -2.383, 8.577, -1.578 ], "P_xyz": [ -0.446, 10.285, -1.068 ], "form": "B", "ssZp": 2.364, "Dp": 2.346, "splay_angle": 20.005, "splay_distance": 3.392, "splay_ratio": 0.176, "d22": 4.257, "d64": 3.914, "eta": 167.486, "theta": -154.980, "eta_prime": -172.969, "theta_prime": -159.801, "eta_base": -130.825, "theta_base": -118.106, "v0": -30.772, "v1": 37.222, "v2": -29.322, "v3": 12.196, "v4": 11.498, "amplitude": 36.577, "phase_angle": 143.287, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 29.487, 66.186, 60.864 ], "x_axis": [ -0.872, 0.191, 0.450 ], "y_axis": [ 0.128, 0.977, -0.168 ], "z_axis": [ -0.472, -0.089, -0.877 ], "quaternion": [ -0.239, 0.083, 0.965, -0.067 ] } }, { "index": 33, "index_chain": 7, "chain_name": "N", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/7", "linked_nts": [ "///N/6", "///N/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.550, "beta": -177.702, "gamma": 38.829, "delta": 139.994, "epsilon": -164.835, "zeta": -128.041, "epsilon_zeta": -36.794, "bb_type": "BI", "chi": -111.739, "glyco_bond": "anti", "C5prime_xyz": [ -2.157, 8.446, -1.666 ], "P_xyz": [ 0.000, 9.850, -1.100 ], "form": "B", "ssZp": 2.045, "Dp": 2.039, "splay_angle": 18.905, "splay_distance": 3.140, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 175.138, "theta": -160.261, "eta_prime": -163.803, "theta_prime": -164.984, "eta_base": -117.617, "theta_base": -122.947, "v0": -23.470, "v1": 35.990, "v2": -34.264, "v3": 21.414, "v4": 1.146, "amplitude": 36.554, "phase_angle": 159.612, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 27.406, 65.437, 58.293 ], "x_axis": [ -0.620, 0.732, 0.283 ], "y_axis": [ 0.609, 0.677, -0.414 ], "z_axis": [ -0.495, -0.085, -0.865 ], "quaternion": [ -0.219, 0.377, 0.889, -0.140 ] } }, { "index": 34, "index_chain": 8, "chain_name": "N", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/8", "linked_nts": [ "///N/7", "///N/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.923, "beta": 173.598, "gamma": 51.958, "delta": 133.511, "epsilon": 165.319, "zeta": -80.799, "epsilon_zeta": -113.882, "bb_type": "BI", "chi": -103.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.730, 8.094, -2.038 ], "P_xyz": [ 0.835, 8.634, -1.834 ], "form": "B", "ssZp": 1.710, "Dp": 1.927, "splay_angle": 19.313, "splay_distance": 3.298, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 167.196, "theta": -132.601, "eta_prime": -166.770, "theta_prime": -154.831, "eta_base": -122.581, "theta_base": -117.746, "v0": -9.941, "v1": 21.850, "v2": -24.843, "v3": 19.458, "v4": -6.136, "amplitude": 24.924, "phase_angle": 175.366, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 26.492, 64.917, 55.334 ], "x_axis": [ -0.129, 0.988, -0.090 ], "y_axis": [ 0.817, 0.054, -0.575 ], "z_axis": [ -0.563, -0.148, -0.813 ], "quaternion": [ -0.167, 0.638, 0.707, -0.256 ] } }, { "index": 35, "index_chain": 9, "chain_name": "N", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/9", "linked_nts": [ "///N/8", "///N/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -65.558, "beta": -165.747, "gamma": 45.228, "delta": 140.501, "epsilon": -152.057, "zeta": -135.187, "epsilon_zeta": -16.870, "bb_type": "--", "chi": -104.286, "glyco_bond": "anti", "C5prime_xyz": [ -2.418, 8.218, -1.978 ], "P_xyz": [ -0.348, 9.799, -1.641 ], "form": "B", "ssZp": 1.821, "Dp": 1.848, "splay_angle": 20.193, "splay_distance": 3.468, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 176.517, "theta": -158.263, "eta_prime": -161.982, "theta_prime": -170.349, "eta_base": -120.097, "theta_base": -139.973, "v0": -21.859, "v1": 34.755, "v2": -33.785, "v3": 21.914, "v4": -0.219, "amplitude": 35.594, "phase_angle": 161.654, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 24.424, 64.665, 52.777 ], "x_axis": [ 0.321, 0.875, -0.362 ], "y_axis": [ 0.762, -0.466, -0.450 ], "z_axis": [ -0.563, -0.131, -0.816 ], "quaternion": [ -0.099, 0.807, 0.507, -0.287 ] } }, { "index": 36, "index_chain": 10, "chain_name": "N", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/10", "linked_nts": [ "///N/9", "///N/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.522, "beta": 146.175, "gamma": 58.027, "delta": 103.454, "epsilon": 179.178, "zeta": -93.576, "epsilon_zeta": -87.246, "bb_type": "BI", "chi": -134.728, "glyco_bond": "anti", "C5prime_xyz": [ -2.607, 8.748, -1.227 ], "P_xyz": [ -0.190, 9.759, -1.585 ], "form": ".", "ssZp": 2.890, "Dp": 2.943, "splay_angle": 21.392, "splay_distance": 3.690, "splay_ratio": 0.188, "d22": 4.320, "d64": 4.381, "eta": 165.610, "theta": -153.508, "eta_prime": 179.396, "theta_prime": -163.039, "eta_base": -143.894, "theta_base": -127.582, "v0": -36.240, "v1": 25.094, "v2": -5.482, "v3": -15.381, "v4": 32.449, "amplitude": 35.890, "phase_angle": 98.786, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 21.783, 63.712, 50.742 ], "x_axis": [ 0.581, 0.537, -0.611 ], "y_axis": [ 0.512, -0.825, -0.238 ], "z_axis": [ -0.633, -0.174, -0.755 ], "quaternion": [ -0.018, 0.889, 0.295, -0.350 ] } }, { "index": 37, "index_chain": 11, "chain_name": "N", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/11", "linked_nts": [ "///N/10", "///N/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.962, "beta": 166.284, "gamma": 49.979, "delta": 121.172, "epsilon": -173.961, "zeta": -94.205, "epsilon_zeta": -79.756, "bb_type": "BI", "chi": -130.665, "glyco_bond": "anti", "C5prime_xyz": [ -2.443, 8.762, -1.113 ], "P_xyz": [ -0.195, 10.091, -0.629 ], "form": "B", "ssZp": 2.468, "Dp": 2.476, "splay_angle": 21.054, "splay_distance": 3.518, "splay_ratio": 0.183, "d22": 4.457, "d64": 3.836, "eta": 179.408, "theta": -142.530, "eta_prime": -156.816, "theta_prime": -148.860, "eta_base": -113.791, "theta_base": -94.742, "v0": -33.795, "v1": 35.333, "v2": -23.708, "v3": 4.640, "v4": 18.166, "amplitude": 35.823, "phase_angle": 131.438, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 19.437, 64.084, 47.918 ], "x_axis": [ 0.712, -0.003, -0.702 ], "y_axis": [ 0.121, -0.984, 0.128 ], "z_axis": [ -0.691, -0.176, -0.701 ], "quaternion": [ 0.083, 0.922, 0.032, -0.378 ] } }, { "index": 38, "index_chain": 12, "chain_name": "N", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/12", "linked_nts": [ "///N/11", "///N/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.741, "beta": -174.929, "gamma": 31.120, "delta": 135.255, "epsilon": -176.495, "zeta": -106.173, "epsilon_zeta": -70.322, "bb_type": "BI", "chi": -102.709, "glyco_bond": "anti", "C5prime_xyz": [ -2.047, 8.136, -2.097 ], "P_xyz": [ 0.135, 9.583, -1.799 ], "form": "B", "ssZp": 1.987, "Dp": 2.149, "splay_angle": 19.214, "splay_distance": 3.233, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 172.491, "theta": -150.323, "eta_prime": -161.316, "theta_prime": -156.047, "eta_base": -100.701, "theta_base": -116.954, "v0": -16.815, "v1": 28.118, "v2": -28.179, "v3": 18.973, "v4": -1.465, "amplitude": 29.281, "phase_angle": 164.229, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 18.135, 63.225, 44.765 ], "x_axis": [ 0.538, -0.714, -0.448 ], "y_axis": [ -0.496, -0.697, 0.518 ], "z_axis": [ -0.682, -0.056, -0.729 ], "quaternion": [ 0.167, 0.861, -0.351, -0.328 ] } }, { "index": 39, "index_chain": 13, "chain_name": "N", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/13", "linked_nts": [ "///N/12", "///N/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.298, "beta": -177.942, "gamma": 31.805, "delta": 142.553, "epsilon": -171.325, "zeta": -112.226, "epsilon_zeta": -59.099, "bb_type": "BI", "chi": -90.885, "glyco_bond": "anti", "C5prime_xyz": [ -2.208, 7.735, -2.455 ], "P_xyz": [ 0.061, 9.068, -2.453 ], "form": "B", "ssZp": 1.679, "Dp": 1.951, "splay_angle": 18.986, "splay_distance": 3.258, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 173.513, "theta": -142.731, "eta_prime": -163.698, "theta_prime": -154.253, "eta_base": -122.667, "theta_base": -123.464, "v0": -13.325, "v1": 28.387, "v2": -31.814, "v3": 24.756, "v4": -7.327, "amplitude": 31.968, "phase_angle": 174.384, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 15.809, 62.631, 42.599 ], "x_axis": [ 0.203, -0.978, -0.051 ], "y_axis": [ -0.795, -0.195, 0.575 ], "z_axis": [ -0.572, -0.076, -0.817 ], "quaternion": [ 0.219, 0.744, -0.596, -0.209 ] } }, { "index": 40, "index_chain": 14, "chain_name": "N", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/14", "linked_nts": [ "///N/13", "///N/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -44.115, "beta": 168.533, "gamma": 34.242, "delta": 140.939, "epsilon": -147.787, "zeta": -168.888, "epsilon_zeta": 21.102, "bb_type": "--", "chi": -95.042, "glyco_bond": "anti", "C5prime_xyz": [ -2.805, 7.984, -2.313 ], "P_xyz": [ -0.666, 9.505, -2.550 ], "form": "B", "ssZp": 1.856, "Dp": 1.897, "splay_angle": 18.803, "splay_distance": 3.214, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.083, "theta": -175.845, "eta_prime": -167.874, "theta_prime": 177.922, "eta_base": -134.721, "theta_base": -138.176, "v0": -28.357, "v1": 39.752, "v2": -35.455, "v3": 20.062, "v4": 5.014, "amplitude": 39.424, "phase_angle": 154.068, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.001, "origin": [ 13.882, 62.148, 40.017 ], "x_axis": [ -0.084, -0.932, 0.353 ], "y_axis": [ -0.849, 0.253, 0.465 ], "z_axis": [ -0.522, -0.261, -0.812 ], "quaternion": [ -0.299, -0.607, 0.733, 0.070 ] } }, { "index": 41, "index_chain": 15, "chain_name": "N", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/15", "linked_nts": [ "///N/14", "///N/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.196, "beta": 126.128, "gamma": 52.127, "delta": 135.010, "epsilon": -170.231, "zeta": -127.684, "epsilon_zeta": -42.547, "bb_type": "BI", "chi": -113.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.625, 8.469, -1.671 ], "P_xyz": [ -0.010, 8.834, -1.809 ], "form": "B", "ssZp": 2.330, "Dp": 2.259, "splay_angle": 20.376, "splay_distance": 3.281, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.140, "theta": -143.594, "eta_prime": -167.229, "theta_prime": -168.133, "eta_base": -122.867, "theta_base": -120.237, "v0": -31.164, "v1": 40.331, "v2": -33.708, "v3": 16.534, "v4": 8.906, "amplitude": 39.584, "phase_angle": 148.382, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.015, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 11.932, 62.163, 37.462 ], "x_axis": [ -0.599, -0.686, 0.413 ], "y_axis": [ -0.699, 0.700, 0.148 ], "z_axis": [ -0.390, -0.200, -0.899 ], "quaternion": [ -0.225, -0.387, 0.894, -0.015 ] } }, { "index": 42, "index_chain": 16, "chain_name": "N", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/16", "linked_nts": [ "///N/15", "///N/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.836, "beta": 166.357, "gamma": 55.579, "delta": 139.378, "epsilon": -170.564, "zeta": -113.502, "epsilon_zeta": -57.063, "bb_type": "BI", "chi": -113.995, "glyco_bond": "anti", "C5prime_xyz": [ -1.975, 8.392, -1.547 ], "P_xyz": [ 0.581, 8.989, -1.304 ], "form": "B", "ssZp": 2.089, "Dp": 2.103, "splay_angle": 18.887, "splay_distance": 3.299, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 171.759, "theta": -126.797, "eta_prime": -164.109, "theta_prime": -146.808, "eta_base": -111.119, "theta_base": -108.511, "v0": -19.236, "v1": 32.060, "v2": -32.108, "v3": 21.540, "v4": -1.589, "amplitude": 33.387, "phase_angle": 164.090, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 10.469, 61.519, 34.597 ], "x_axis": [ -0.935, -0.056, 0.351 ], "y_axis": [ -0.132, 0.971, -0.198 ], "z_axis": [ -0.330, -0.232, -0.915 ], "quaternion": [ -0.174, -0.048, 0.977, -0.110 ] } }, { "index": 43, "index_chain": 17, "chain_name": "N", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/17", "linked_nts": [ "///N/16", "///N/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -15.787, "beta": 158.762, "gamma": 15.214, "delta": 141.026, "epsilon": -163.224, "zeta": -137.771, "epsilon_zeta": -25.452, "bb_type": "--", "chi": -104.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.646, 8.207, -2.031 ], "P_xyz": [ -0.757, 10.026, -1.650 ], "form": "B", "ssZp": 1.990, "Dp": 2.048, "splay_angle": 20.230, "splay_distance": 3.508, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 169.366, "theta": -152.619, "eta_prime": -162.941, "theta_prime": -161.774, "eta_base": -116.465, "theta_base": -116.468, "v0": -30.294, "v1": 41.797, "v2": -37.028, "v3": 20.368, "v4": 5.986, "amplitude": 41.505, "phase_angle": 153.142, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 8.715, 60.387, 32.042 ], "x_axis": [ -0.847, 0.491, 0.205 ], "y_axis": [ 0.382, 0.830, -0.407 ], "z_axis": [ -0.370, -0.266, -0.890 ], "quaternion": [ -0.152, 0.231, 0.944, -0.178 ] } }, { "index": 44, "index_chain": 18, "chain_name": "N", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/18", "linked_nts": [ "///N/17", "///N/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -22.881, "beta": 144.116, "gamma": 32.940, "delta": 122.173, "epsilon": -164.036, "zeta": -123.330, "epsilon_zeta": -40.707, "bb_type": "BI", "chi": -117.792, "glyco_bond": "anti", "C5prime_xyz": [ -2.824, 8.541, -1.702 ], "P_xyz": [ -0.608, 10.014, -1.486 ], "form": "B", "ssZp": 2.408, "Dp": 2.376, "splay_angle": 21.016, "splay_distance": 3.702, "splay_ratio": 0.185, "d22": 3.968, "d64": 3.743, "eta": 174.956, "theta": -140.541, "eta_prime": -167.562, "theta_prime": -146.785, "eta_base": -117.566, "theta_base": -114.049, "v0": -37.762, "v1": 39.501, "v2": -26.308, "v3": 5.144, "v4": 20.252, "amplitude": 39.911, "phase_angle": 131.236, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 6.637, 59.499, 29.360 ], "x_axis": [ -0.483, 0.868, -0.116 ], "y_axis": [ 0.800, 0.384, -0.460 ], "z_axis": [ -0.355, -0.315, -0.880 ], "quaternion": [ -0.072, 0.503, 0.829, -0.234 ] } }, { "index": 45, "index_chain": 19, "chain_name": "N", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/19", "linked_nts": [ "///N/18", "///N/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 3.841, "beta": 152.449, "gamma": -4.295, "delta": 142.229, "epsilon": -142.301, "zeta": -161.646, "epsilon_zeta": 19.345, "bb_type": "--", "chi": -97.031, "glyco_bond": "anti", "C5prime_xyz": [ -2.608, 8.046, -2.278 ], "P_xyz": [ -0.941, 10.094, -1.949 ], "form": "B", "ssZp": 1.631, "Dp": 1.767, "splay_angle": 20.457, "splay_distance": 3.532, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 173.858, "theta": -173.595, "eta_prime": -166.156, "theta_prime": -169.921, "eta_base": -128.644, "theta_base": -126.328, "v0": -26.895, "v1": 39.463, "v2": -36.579, "v3": 21.937, "v4": 2.970, "amplitude": 39.688, "phase_angle": 157.171, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 4.600, 59.175, 26.286 ], "x_axis": [ 0.093, 0.990, -0.103 ], "y_axis": [ 0.915, -0.126, -0.382 ], "z_axis": [ -0.392, -0.059, -0.918 ], "quaternion": [ -0.111, 0.731, 0.652, -0.169 ] } }, { "index": 46, "index_chain": 20, "chain_name": "N", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/20", "linked_nts": [ "///N/19", "///N/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.323, "beta": 136.352, "gamma": 47.999, "delta": 143.470, "epsilon": -160.019, "zeta": -154.957, "epsilon_zeta": -5.062, "bb_type": "--", "chi": -98.627, "glyco_bond": "anti", "C5prime_xyz": [ -2.629, 8.056, -2.176 ], "P_xyz": [ -0.021, 8.513, -2.336 ], "form": "B", "ssZp": 1.987, "Dp": 2.033, "splay_angle": 20.251, "splay_distance": 3.358, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 165.594, "theta": -140.727, "eta_prime": -165.797, "theta_prime": -165.005, "eta_base": -123.578, "theta_base": -115.618, "v0": -26.564, "v1": 39.360, "v2": -36.423, "v3": 22.132, "v4": 2.550, "amplitude": 39.413, "phase_angle": 157.540, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.066, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 4.094, 58.136, 22.948 ], "x_axis": [ 0.560, 0.744, -0.366 ], "y_axis": [ 0.672, -0.665, -0.325 ], "z_axis": [ -0.485, -0.064, -0.872 ], "quaternion": [ -0.074, 0.880, 0.402, -0.242 ] } }, { "index": 47, "index_chain": 21, "chain_name": "N", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/21", "linked_nts": [ "///N/20", "///N/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -13.024, "beta": 130.806, "gamma": 30.403, "delta": 127.713, "epsilon": 177.191, "zeta": -95.937, "epsilon_zeta": -86.872, "bb_type": "BI", "chi": -110.752, "glyco_bond": "anti", "C5prime_xyz": [ -2.548, 8.374, -1.915 ], "P_xyz": [ -0.048, 9.251, -1.660 ], "form": ".", "ssZp": 2.359, "Dp": 2.359, "splay_angle": 22.092, "splay_distance": 3.957, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 164.881, "theta": -134.482, "eta_prime": -170.640, "theta_prime": -153.230, "eta_base": -115.405, "theta_base": -127.259, "v0": -29.753, "v1": 35.644, "v2": -27.906, "v3": 11.259, "v4": 11.446, "amplitude": 35.112, "phase_angle": 142.633, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 3.100, 57.924, 19.748 ], "x_axis": [ 0.867, 0.167, -0.469 ], "y_axis": [ 0.158, -0.986, -0.060 ], "z_axis": [ -0.473, -0.022, -0.881 ], "quaternion": [ -0.010, 0.966, 0.084, -0.244 ] } }, { "index": 48, "index_chain": 22, "chain_name": "N", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/22", "linked_nts": [ "///N/21", "///N/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -46.883, "beta": -175.701, "gamma": 36.212, "delta": 137.700, "epsilon": -121.195, "zeta": -176.889, "epsilon_zeta": 55.694, "bb_type": "BII", "chi": -114.191, "glyco_bond": "anti", "C5prime_xyz": [ -2.739, 8.447, -1.651 ], "P_xyz": [ -1.028, 10.385, -1.117 ], "form": ".", "ssZp": 1.527, "Dp": 1.524, "splay_angle": 18.420, "splay_distance": 3.218, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -169.425, "theta": 178.854, "eta_prime": -155.101, "theta_prime": -176.244, "eta_base": -124.387, "theta_base": -125.995, "v0": -33.859, "v1": 42.989, "v2": -35.228, "v3": 16.591, "v4": 10.542, "amplitude": 42.073, "phase_angle": 146.855, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.001, "origin": [ 1.620, 59.062, 16.258 ], "x_axis": [ 0.898, -0.282, -0.338 ], "y_axis": [ -0.228, -0.955, 0.191 ], "z_axis": [ -0.377, -0.094, -0.922 ], "quaternion": [ 0.073, 0.971, -0.131, -0.184 ] } }, { "index": 49, "index_chain": 23, "chain_name": "N", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/23", "linked_nts": [ "///N/22", "///N/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.132, "beta": 134.731, "gamma": 46.070, "delta": 143.860, "epsilon": -174.372, "zeta": -114.379, "epsilon_zeta": -59.993, "bb_type": "BI", "chi": -98.382, "glyco_bond": "anti", "C5prime_xyz": [ -2.455, 8.004, -2.239 ], "P_xyz": [ 0.180, 8.296, -2.394 ], "form": "B", "ssZp": 2.131, "Dp": 2.200, "splay_angle": 19.292, "splay_distance": 3.252, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 159.766, "theta": -127.271, "eta_prime": -168.276, "theta_prime": -157.461, "eta_base": -118.294, "theta_base": -112.239, "v0": -24.528, "v1": 37.509, "v2": -35.531, "v3": 22.163, "v4": 1.294, "amplitude": 37.966, "phase_angle": 159.371, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.316, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -0.733, 58.524, 14.130 ], "x_axis": [ 0.370, -0.798, -0.477 ], "y_axis": [ -0.796, -0.536, 0.280 ], "z_axis": [ -0.479, 0.276, -0.833 ], "quaternion": [ 0.001, 0.828, -0.482, -0.289 ] } }, { "index": 50, "index_chain": 24, "chain_name": "N", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/24", "linked_nts": [ "///N/23", "///N/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.751, "beta": 164.772, "gamma": 61.806, "delta": 130.510, "epsilon": -170.328, "zeta": -106.459, "epsilon_zeta": -63.869, "bb_type": "BI", "chi": -117.241, "glyco_bond": "anti", "C5prime_xyz": [ -2.656, 8.490, -1.672 ], "P_xyz": [ -0.332, 9.634, -1.924 ], "form": ".", "ssZp": 2.315, "Dp": 2.340, "splay_angle": 18.609, "splay_distance": 3.282, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 170.150, "theta": -143.516, "eta_prime": -164.098, "theta_prime": -160.379, "eta_base": -111.854, "theta_base": -130.204, "v0": -34.963, "v1": 39.573, "v2": -29.042, "v3": 9.615, "v4": 15.671, "amplitude": 39.105, "phase_angle": 137.960, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -1.866, 58.462, 11.083 ], "x_axis": [ -0.158, -0.973, -0.171 ], "y_axis": [ -0.903, 0.073, 0.423 ], "z_axis": [ -0.399, 0.221, -0.890 ], "quaternion": [ -0.078, -0.644, 0.728, 0.221 ] } }, { "index": 51, "index_chain": 25, "chain_name": "N", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/25", "linked_nts": [ "///N/24", "///N/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -31.999, "beta": -166.130, "gamma": 4.622, "delta": 142.693, "epsilon": -170.166, "zeta": -101.907, "epsilon_zeta": -68.259, "bb_type": "BI", "chi": -101.579, "glyco_bond": "anti", "C5prime_xyz": [ -1.935, 8.044, -2.077 ], "P_xyz": [ -0.275, 10.081, -1.836 ], "form": "B", "ssZp": 1.907, "Dp": 2.054, "splay_angle": 17.713, "splay_distance": 3.068, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 171.482, "theta": -149.784, "eta_prime": -173.880, "theta_prime": -156.858, "eta_base": -137.820, "theta_base": -110.704, "v0": -12.709, "v1": 27.424, "v2": -30.830, "v3": 24.046, "v4": -7.256, "amplitude": 30.964, "phase_angle": 174.682, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -2.230, 58.698, 7.830 ], "x_axis": [ -0.560, -0.802, 0.208 ], "y_axis": [ -0.719, 0.595, 0.359 ], "z_axis": [ -0.412, 0.051, -0.910 ], "quaternion": [ -0.177, -0.434, 0.875, 0.117 ] } }, { "index": 52, "index_chain": 26, "chain_name": "N", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/26", "linked_nts": [ "///N/25", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -68.136, "beta": 159.958, "gamma": 62.777, "delta": 102.378, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -127.863, "glyco_bond": "anti", "C5prime_xyz": [ -2.630, 8.698, -1.506 ], "P_xyz": [ -0.320, 9.810, -2.127 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.489, "v1": 22.693, "v2": -3.439, "v3": -16.482, "v4": 32.168, "amplitude": 34.558, "phase_angle": 95.711, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -3.976, 58.296, 5.339 ], "x_axis": [ -0.853, -0.334, 0.402 ], "y_axis": [ -0.329, 0.941, 0.085 ], "z_axis": [ -0.406, -0.060, -0.912 ], "quaternion": [ -0.210, -0.172, 0.962, 0.006 ] } } ], "num_hbonds": 1238, "hbonds": [ { "index": 1, "atom1_serNum": 21, "atom2_serNum": 260, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/8/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 29, "atom2_serNum": 548, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/9/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 38, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/10/N", "atom2_id": "///A/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 42, "atom2_serNum": 247, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/10/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 49, "atom2_serNum": 71, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/10/NE", "atom2_id": "///A/12/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 55, "atom2_serNum": 71, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/10/NH2", "atom2_id": "///A/12/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 57, "atom2_serNum": 551, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/11/N", "atom2_id": "///A/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 64, "atom2_serNum": 231, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/12/N", "atom2_id": "///A/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 67, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/12/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 71, "atom2_serNum": 98, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/12/OE1", "atom2_id": "///A/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 72, "atom2_serNum": 98, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/12/OE2", "atom2_id": "///A/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 72, "atom2_serNum": 238, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/12/OE2", "atom2_id": "///A/34/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 76, "atom2_serNum": 90, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/13/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 84, "atom2_serNum": 594, "donAcc_type": "acceptable", "distance": 3.049, "atom1_id": "///A/13/OH", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 84, "atom2_serNum": 633, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///A/13/OH", "atom2_id": "///A/81/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 85, "atom2_serNum": 217, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/14/N", "atom2_id": "///A/32/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 88, "atom2_serNum": 206, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/14/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 104, "atom2_serNum": 11693, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///A/16/OG", "atom2_id": "///N/24/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 19, "atom1_serNum": 104, "atom2_serNum": 11708, "donAcc_type": "acceptable", "distance": 2.791, "atom1_id": "///A/16/OG", "atom2_id": "///N/25/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 20, "atom1_serNum": 118, "atom2_serNum": 11705, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///A/18/NH1", "atom2_id": "///N/24/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 21, "atom1_serNum": 120, "atom2_serNum": 11708, "donAcc_type": "standard", "distance": 3.878, "atom1_id": "///A/19/N", "atom2_id": "///N/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 22, "atom1_serNum": 123, "atom2_serNum": 182, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/19/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 125, "atom2_serNum": 11730, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/20/N", "atom2_id": "///N/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 24, "atom1_serNum": 131, "atom2_serNum": 170, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/21/N", "atom2_id": "///A/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 134, "atom2_serNum": 161, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 137, "atom2_serNum": 364, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/22/N", "atom2_id": "///A/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 158, "atom2_serNum": 166, "donAcc_type": "acceptable", "distance": 2.530, "atom1_id": "///A/24/O", "atom2_id": "///A/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 164, "atom2_serNum": 166, "donAcc_type": "acceptable", "distance": 2.653, "atom1_id": "///A/25/O", "atom2_id": "///A/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 170, "atom2_serNum": 182, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/26/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 179, "atom2_serNum": 190, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/27/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 193, "atom2_serNum": 219, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///A/29/O", "atom2_id": "///A/32/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 217, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/32/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 223, "atom2_serNum": 397, "donAcc_type": "standard", "distance": 3.748, "atom1_id": "///A/33/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 237, "atom2_serNum": 11708, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/34/NH1", "atom2_id": "///N/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 35, "atom1_serNum": 238, "atom2_serNum": 11709, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/34/NH2", "atom2_id": "///N/25/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 36, "atom1_serNum": 239, "atom2_serNum": 378, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/35/N", "atom2_id": "///A/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 242, "atom2_serNum": 375, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/35/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 252, "atom2_serNum": 354, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/37/N", "atom2_id": "///A/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 255, "atom2_serNum": 351, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/37/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 268, "atom2_serNum": 340, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/39/N", "atom2_id": "///A/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 271, "atom2_serNum": 337, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/39/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 282, "atom2_serNum": 324, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/40/OE1", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 283, "atom2_serNum": 287, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/40/NE2", "atom2_id": "///A/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 284, "atom2_serNum": 327, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/41/N", "atom2_id": "///A/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 287, "atom2_serNum": 308, "donAcc_type": "questionable", "distance": 2.930, "atom1_id": "///A/41/O", "atom2_id": "///A/44/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 293, "atom2_serNum": 2203, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/42/O", "atom2_id": "///C/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 300, "atom2_serNum": 2149, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/43/O", "atom2_id": "///C/589/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 308, "atom2_serNum": 324, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/44/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 322, "atom2_serNum": 2168, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/45/OD1", "atom2_id": "///C/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 323, "atom2_serNum": 2011, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/45/OD2", "atom2_id": "///C/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 323, "atom2_serNum": 2024, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///A/45/OD2", "atom2_id": "///C/568/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 323, "atom2_serNum": 2168, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/45/OD2", "atom2_id": "///C/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 390, "atom2_serNum": 420, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 400, "atom2_serNum": 439, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/54/O", "atom2_id": "///A/58/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 417, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/56/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 478, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/63/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 489, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///A/65/N", "atom2_id": "///A/70/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 500, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/66/N", "atom2_id": "///A/70/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 503, "atom2_serNum": 532, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 513, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 517, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/68/N", "atom2_id": "///A/68/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 554, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///A/72/OD1", "atom2_id": "///A/305/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 554, "atom2_serNum": 1359, "donAcc_type": "acceptable", "distance": 3.756, "atom1_id": "///A/72/OD1", "atom2_id": "///A/306/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 555, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/72/OD2", "atom2_id": "///A/305/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 574, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///A/75/O", "atom2_id": "///A/242/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 576, "atom2_serNum": 1357, "donAcc_type": "acceptable", "distance": 3.339, "atom1_id": "///A/75/OG", "atom2_id": "///A/306/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 577, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/76/N", "atom2_id": "///A/76/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 580, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/76/O", "atom2_id": "///A/246/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 584, "atom2_serNum": 1354, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/76/OE1", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 585, "atom2_serNum": 1359, "donAcc_type": "acceptable", "distance": 3.848, "atom1_id": "///A/76/OE2", "atom2_id": "///A/306/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 589, "atom2_serNum": 643, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/77/O", "atom2_id": "///A/82/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 589, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/77/O", "atom2_id": "///A/242/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 597, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/78/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 597, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 603, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/78/NH1", "atom2_id": "///A/250/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 605, "atom2_serNum": 863, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/79/N", "atom2_id": "///A/242/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 608, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 619, "atom2_serNum": 626, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/80/N", "atom2_id": "///A/80/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 622, "atom2_serNum": 653, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 630, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 638, "atom2_serNum": 669, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 643, "atom2_serNum": 864, "donAcc_type": "questionable", "distance": 3.369, "atom1_id": "///A/82/NE2", "atom2_id": "///A/242/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 647, "atom2_serNum": 678, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 656, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 656, "atom2_serNum": 692, "donAcc_type": "acceptable", "distance": 2.553, "atom1_id": "///A/84/O", "atom2_id": "///A/88/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 665, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 681, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 690, "atom2_serNum": 711, "donAcc_type": "questionable", "distance": 3.033, "atom1_id": "///A/88/O", "atom2_id": "///A/91/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 716, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 722, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 731, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/226/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 740, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 749, "atom2_serNum": 780, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 758, "atom2_serNum": 786, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 766, "atom2_serNum": 795, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 775, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 783, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 789, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 798, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 806, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 815, "atom2_serNum": 843, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 824, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 829, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 837, "atom2_serNum": 865, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 842, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/239/NZ", "atom2_id": "///A/243/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 851, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 855, "atom2_serNum": 1723, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/241/OE1", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 856, "atom2_serNum": 1702, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///A/241/NE2", "atom2_id": "///A/353/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 856, "atom2_serNum": 1707, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/241/NE2", "atom2_id": "///A/354/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 860, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 868, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 868, "atom2_serNum": 909, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///A/243/O", "atom2_id": "///A/247/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 872, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/243/OD2", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 876, "atom2_serNum": 911, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 884, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/245/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 892, "atom2_serNum": 928, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/246/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 906, "atom2_serNum": 935, "donAcc_type": "questionable", "distance": 3.068, "atom1_id": "///A/247/O", "atom2_id": "///A/250/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 906, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/247/O", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 914, "atom2_serNum": 945, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/248/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 922, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/249/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 935, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/250/OD2", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 939, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/251/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 948, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/252/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 987, "atom2_serNum": 1013, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/257/O", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 993, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/258/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1000, "atom2_serNum": 1030, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/259/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1005, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/260/N", "atom2_id": "///A/260/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1008, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1016, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/261/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1024, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/262/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1033, "atom2_serNum": 1063, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1042, "atom2_serNum": 1074, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1042, "atom2_serNum": 1081, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/264/O", "atom2_id": "///A/268/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1050, "atom2_serNum": 1082, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1050, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/265/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1058, "atom2_serNum": 1082, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/266/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1077, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///A/268/O", "atom2_id": "///A/270/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1080, "atom2_serNum": 1582, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/268/OD1", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1081, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/268/ND2", "atom2_id": "///A/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1099, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/270/NE2", "atom2_id": "///A/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1103, "atom2_serNum": 1116, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/271/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1103, "atom2_serNum": 1186, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///A/271/O", "atom2_id": "///A/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1128, "atom2_serNum": 11666, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///A/274/OG", "atom2_id": "///N/23/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 144, "atom1_serNum": 1128, "atom2_serNum": 11667, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///A/274/OG", "atom2_id": "///N/23/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 145, "atom1_serNum": 1136, "atom2_serNum": 1153, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/276/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1136, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///A/276/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1145, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/277/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1151, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1156, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/279/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1164, "atom2_serNum": 1195, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/280/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1172, "atom2_serNum": 1200, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1180, "atom2_serNum": 1208, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/282/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1191, "atom2_serNum": 1212, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1198, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/284/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1203, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/285/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1207, "atom2_serNum": 1384, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/285/OD2", "atom2_id": "///A/309/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1207, "atom2_serNum": 1722, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/285/OD2", "atom2_id": "///A/355/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1211, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/286/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1241, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/290/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1242, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/291/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1245, "atom2_serNum": 1550, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/291/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1255, "atom2_serNum": 1534, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/293/N", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1270, "atom2_serNum": 1309, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/295/N", "atom2_id": "///A/300/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1283, "atom2_serNum": 1537, "donAcc_type": "questionable", "distance": 2.952, "atom1_id": "///A/296/OE1", "atom2_id": "///A/329/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1285, "atom2_serNum": 1292, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/297/N", "atom2_id": "///A/297/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1313, "atom2_serNum": 1403, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/301/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1313, "atom2_serNum": 1408, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///A/301/O", "atom2_id": "///A/312/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1318, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/301/NE2", "atom2_id": "///A/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1327, "atom2_serNum": 1388, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/303/N", "atom2_id": "///A/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1330, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/303/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1345, "atom2_serNum": 1371, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/305/N", "atom2_id": "///A/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1348, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/305/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1360, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/307/N", "atom2_id": "///A/307/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1363, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/307/O", "atom2_id": "///A/326/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1366, "atom2_serNum": 1396, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///A/307/OD1", "atom2_id": "///A/310/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1373, "atom2_serNum": 1504, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/309/N", "atom2_id": "///A/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1376, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/309/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1384, "atom2_serNum": 1719, "donAcc_type": "acceptable", "distance": 3.323, "atom1_id": "///A/309/OH", "atom2_id": "///A/355/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1397, "atom2_serNum": 1488, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/311/N", "atom2_id": "///A/323/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1413, "atom2_serNum": 1471, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/313/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1432, "atom2_serNum": 1458, "donAcc_type": "questionable", "distance": 2.695, "atom1_id": "///A/316/O", "atom2_id": "///A/319/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1434, "atom2_serNum": 1441, "donAcc_type": "acceptable", "distance": 3.379, "atom1_id": "///A/316/OG1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1434, "atom2_serNum": 3155, "donAcc_type": "acceptable", "distance": 3.429, "atom1_id": "///A/316/OG1", "atom2_id": "///C/731/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1506, "atom2_serNum": 1517, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///A/325/OG1", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1520, "atom2_serNum": 1522, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///A/327/O", "atom2_id": "///A/327/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1549, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/330/NH2", "atom2_id": "///A/354/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1566, "atom2_serNum": 1694, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/332/OE1", "atom2_id": "///A/352/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1576, "atom2_serNum": 1594, "donAcc_type": "acceptable", "distance": 3.344, "atom1_id": "///A/333/NE1", "atom2_id": "///A/335/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1606, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/337/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1634, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/341/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1639, "atom2_serNum": 1656, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/342/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1654, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///A/345/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1664, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/347/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1710, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/354/OD1", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1774, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///C/534/N", "atom2_id": "///C/573/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1777, "atom2_serNum": 1797, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///C/534/O", "atom2_id": "///C/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1777, "atom2_serNum": 1802, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///C/534/O", "atom2_id": "///C/537/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1789, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/536/N", "atom2_id": "///C/536/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1802, "atom2_serNum": 1807, "donAcc_type": "acceptable", "distance": 3.334, "atom1_id": "///C/537/OG", "atom2_id": "///C/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1810, "atom2_serNum": 1840, "donAcc_type": "standard", "distance": 3.717, "atom1_id": "///C/539/O", "atom2_id": "///C/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1845, "atom2_serNum": 1851, "donAcc_type": "acceptable", "distance": 3.232, "atom1_id": "///C/544/N", "atom2_id": "///C/544/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1862, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///C/546/N", "atom2_id": "///C/574/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1865, "atom2_serNum": 1912, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/546/O", "atom2_id": "///C/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1879, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///C/548/N", "atom2_id": "///C/551/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1882, "atom2_serNum": 1892, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///C/548/O", "atom2_id": "///C/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1895, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/550/O", "atom2_id": "///C/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1904, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.697, "atom1_id": "///C/551/NZ", "atom2_id": "///C/626/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1908, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///C/552/O", "atom2_id": "///C/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1915, "atom2_serNum": 2075, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/553/O", "atom2_id": "///C/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1928, "atom2_serNum": 2061, "donAcc_type": "acceptable", "distance": 3.856, "atom1_id": "///C/554/OG", "atom2_id": "///C/572/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1929, "atom2_serNum": 2061, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/555/N", "atom2_id": "///C/572/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1932, "atom2_serNum": 2058, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///C/555/O", "atom2_id": "///C/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1937, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///C/556/O", "atom2_id": "///C/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1941, "atom2_serNum": 2040, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/557/N", "atom2_id": "///C/570/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1944, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/557/O", "atom2_id": "///C/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1949, "atom2_serNum": 2559, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/558/N", "atom2_id": "///C/639/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1952, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/558/O", "atom2_id": "///C/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1953, "atom2_serNum": 2022, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///C/559/N", "atom2_id": "///C/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1956, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///C/559/O", "atom2_id": "///C/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1968, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/561/N", "atom2_id": "///C/566/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1971, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///C/561/O", "atom2_id": "///C/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1971, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///C/561/O", "atom2_id": "///C/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1974, "atom2_serNum": 1984, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///C/561/OD1", "atom2_id": "///C/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1976, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/562/N", "atom2_id": "///C/734/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1979, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///C/562/O", "atom2_id": "///C/748/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2003, "atom2_serNum": 2168, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/565/O", "atom2_id": "///C/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2003, "atom2_serNum": 2169, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/565/O", "atom2_id": "///C/591/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2009, "atom2_serNum": 2024, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///C/566/OG1", "atom2_id": "///C/568/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2014, "atom2_serNum": 2170, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///C/567/O", "atom2_id": "///C/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2018, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///C/567/ND2", "atom2_id": "///C/742/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2025, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/569/N", "atom2_id": "///C/590/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2028, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///C/569/O", "atom2_id": "///C/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2048, "atom2_serNum": 10707, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///C/570/OH", "atom2_id": "///M/2/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 234, "atom1_serNum": 2049, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/571/N", "atom2_id": "///C/588/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2052, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/571/O", "atom2_id": "///C/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2066, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/573/N", "atom2_id": "///C/586/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2069, "atom2_serNum": 2113, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///C/573/O", "atom2_id": "///C/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2083, "atom2_serNum": 2094, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/575/N", "atom2_id": "///C/584/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2105, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/585/N", "atom2_id": "///C/602/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2108, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/585/O", "atom2_id": "///C/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2124, "atom2_serNum": 2224, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/587/N", "atom2_id": "///C/600/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2127, "atom2_serNum": 2221, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/587/O", "atom2_id": "///C/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2133, "atom2_serNum": 10707, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///C/587/NH1", "atom2_id": "///M/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 244, "atom1_serNum": 2134, "atom2_serNum": 2246, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///C/587/NH2", "atom2_id": "///C/602/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2141, "atom2_serNum": 2210, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/589/N", "atom2_id": "///C/598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2144, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/589/O", "atom2_id": "///C/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2159, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/591/N", "atom2_id": "///C/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2162, "atom2_serNum": 2181, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///C/591/O", "atom2_id": "///C/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2162, "atom2_serNum": 2186, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///C/591/O", "atom2_id": "///C/594/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2166, "atom2_serNum": 3275, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///C/591/NE", "atom2_id": "///C/745/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2169, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/591/NH2", "atom2_id": "///C/747/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2191, "atom2_serNum": 2203, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///C/595/O", "atom2_id": "///C/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2216, "atom2_serNum": 2220, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/599/O", "atom2_id": "///C/599/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2229, "atom2_serNum": 10726, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/600/NZ", "atom2_id": "///M/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 255, "atom1_serNum": 2246, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 3.922, "atom1_id": "///C/602/OE2", "atom2_id": "///C/613/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2280, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 3.698, "atom1_id": "///C/607/O", "atom2_id": "///C/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2289, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///C/608/O", "atom2_id": "///C/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2298, "atom2_serNum": 2325, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/609/O", "atom2_id": "///C/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2306, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/610/O", "atom2_id": "///C/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2311, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/611/O", "atom2_id": "///C/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2328, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/613/O", "atom2_id": "///C/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2338, "atom2_serNum": 2371, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/614/O", "atom2_id": "///C/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2349, "atom2_serNum": 2383, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///C/615/O", "atom2_id": "///C/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2357, "atom2_serNum": 2392, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/616/O", "atom2_id": "///C/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2366, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/617/O", "atom2_id": "///C/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2374, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/618/O", "atom2_id": "///C/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2374, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///C/618/O", "atom2_id": "///C/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2386, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///C/619/O", "atom2_id": "///C/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2404, "atom2_serNum": 2545, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/621/O", "atom2_id": "///C/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2409, "atom2_serNum": 10708, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///C/621/NZ", "atom2_id": "///M/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 271, "atom1_serNum": 2413, "atom2_serNum": 2415, "donAcc_type": "acceptable", "distance": 3.103, "atom1_id": "///C/622/O", "atom2_id": "///C/622/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2413, "atom2_serNum": 2548, "donAcc_type": "questionable", "distance": 3.298, "atom1_id": "///C/622/O", "atom2_id": "///C/638/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2421, "atom2_serNum": 2427, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///C/624/N", "atom2_id": "///C/624/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2427, "atom2_serNum": 2495, "donAcc_type": "questionable", "distance": 2.920, "atom1_id": "///C/624/OD1", "atom2_id": "///C/632/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2428, "atom2_serNum": 2497, "donAcc_type": "acceptable", "distance": 3.066, "atom1_id": "///C/624/ND2", "atom2_id": "///C/632/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2473, "atom2_serNum": 2479, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///C/630/N", "atom2_id": "///C/630/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2495, "atom2_serNum": 2497, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///C/632/O", "atom2_id": "///C/632/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2507, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 2.519, "atom1_id": "///C/633/NZ", "atom2_id": "///C/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2511, "atom2_serNum": 2536, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/634/O", "atom2_id": "///C/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2571, "atom2_serNum": 2590, "donAcc_type": "questionable", "distance": 3.139, "atom1_id": "///C/640/O", "atom2_id": "///C/642/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2578, "atom2_serNum": 2592, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///C/641/O", "atom2_id": "///C/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2586, "atom2_serNum": 2931, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///C/642/O", "atom2_id": "///C/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2590, "atom2_serNum": 2964, "donAcc_type": "questionable", "distance": 2.879, "atom1_id": "///C/642/OE1", "atom2_id": "///C/705/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2600, "atom2_serNum": 2917, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/644/N", "atom2_id": "///C/700/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2623, "atom2_serNum": 3606, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///C/664/N", "atom2_id": "///C/791/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2643, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/666/O", "atom2_id": "///C/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2650, "atom2_serNum": 2679, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/667/O", "atom2_id": "///C/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2659, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/668/O", "atom2_id": "///C/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2666, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///C/669/O", "atom2_id": "///C/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2673, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/670/O", "atom2_id": "///C/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2682, "atom2_serNum": 2712, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/671/O", "atom2_id": "///C/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2690, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/672/O", "atom2_id": "///C/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2698, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/673/O", "atom2_id": "///C/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2731, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/677/O", "atom2_id": "///C/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2742, "atom2_serNum": 2769, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///C/678/O", "atom2_id": "///C/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2745, "atom2_serNum": 2754, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///C/678/OD1", "atom2_id": "///C/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2750, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/679/O", "atom2_id": "///C/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2757, "atom2_serNum": 2786, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/680/O", "atom2_id": "///C/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2766, "atom2_serNum": 2795, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/681/O", "atom2_id": "///C/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2772, "atom2_serNum": 2800, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///C/682/O", "atom2_id": "///C/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2780, "atom2_serNum": 2800, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/683/O", "atom2_id": "///C/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2780, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///C/683/O", "atom2_id": "///C/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2789, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/684/O", "atom2_id": "///C/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2798, "atom2_serNum": 4239, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///C/685/O", "atom2_id": "///C/865/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2803, "atom2_serNum": 2824, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/686/O", "atom2_id": "///C/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2803, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///C/686/O", "atom2_id": "///C/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2811, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///C/687/O", "atom2_id": "///C/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2822, "atom2_serNum": 4240, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/688/OE1", "atom2_id": "///C/865/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2835, "atom2_serNum": 3441, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///C/689/OH", "atom2_id": "///C/767/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2839, "atom2_serNum": 3253, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/690/O", "atom2_id": "///C/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2853, "atom2_serNum": 3239, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///C/692/N", "atom2_id": "///C/741/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2860, "atom2_serNum": 2886, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/692/OD2", "atom2_id": "///C/695/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2881, "atom2_serNum": 2910, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/695/O", "atom2_id": "///C/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2898, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///C/697/O", "atom2_id": "///C/779/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2913, "atom2_serNum": 2923, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///C/699/O", "atom2_id": "///C/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2923, "atom2_serNum": 3482, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///C/701/N", "atom2_id": "///C/772/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2934, "atom2_serNum": 2966, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/702/O", "atom2_id": "///C/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2936, "atom2_serNum": 2946, "donAcc_type": "acceptable", "distance": 3.438, "atom1_id": "///C/702/OG", "atom2_id": "///C/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2940, "atom2_serNum": 2974, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/703/O", "atom2_id": "///C/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2949, "atom2_serNum": 2983, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///C/704/O", "atom2_id": "///C/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2960, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/705/O", "atom2_id": "///C/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2965, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/705/NE2", "atom2_id": "///C/739/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2969, "atom2_serNum": 2993, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///C/706/O", "atom2_id": "///C/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2977, "atom2_serNum": 3005, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/707/O", "atom2_id": "///C/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2977, "atom2_serNum": 3010, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///C/707/O", "atom2_id": "///C/711/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2986, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/708/O", "atom2_id": "///C/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2991, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///C/709/O", "atom2_id": "///C/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2996, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/710/O", "atom2_id": "///C/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3004, "atom2_serNum": 3434, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///C/710/OH", "atom2_id": "///C/766/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3008, "atom2_serNum": 3032, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///C/711/O", "atom2_id": "///C/714/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3008, "atom2_serNum": 3033, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/711/O", "atom2_id": "///C/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3014, "atom2_serNum": 3042, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/712/O", "atom2_id": "///C/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3022, "atom2_serNum": 3049, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/713/O", "atom2_id": "///C/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3030, "atom2_serNum": 3058, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///C/714/O", "atom2_id": "///C/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3032, "atom2_serNum": 4367, "donAcc_type": "acceptable", "distance": 3.544, "atom1_id": "///C/714/OG", "atom2_id": "///C/883/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3036, "atom2_serNum": 3067, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/715/O", "atom2_id": "///C/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3045, "atom2_serNum": 3072, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///C/716/O", "atom2_id": "///C/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3052, "atom2_serNum": 3079, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///C/717/O", "atom2_id": "///C/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3052, "atom2_serNum": 3084, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///C/717/O", "atom2_id": "///C/721/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3061, "atom2_serNum": 3084, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///C/718/O", "atom2_id": "///C/721/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3070, "atom2_serNum": 3098, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/719/O", "atom2_id": "///C/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3075, "atom2_serNum": 3094, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///C/720/O", "atom2_id": "///C/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3107, "atom2_serNum": 3133, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/725/O", "atom2_id": "///C/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3113, "atom2_serNum": 3141, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///C/726/O", "atom2_id": "///C/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3121, "atom2_serNum": 3149, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/727/O", "atom2_id": "///C/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3127, "atom2_serNum": 3157, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///C/728/O", "atom2_id": "///C/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3136, "atom2_serNum": 3165, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/729/O", "atom2_id": "///C/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3136, "atom2_serNum": 3170, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///C/729/O", "atom2_id": "///C/733/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3144, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///C/730/O", "atom2_id": "///C/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3152, "atom2_serNum": 3179, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///C/731/O", "atom2_id": "///C/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3160, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/732/O", "atom2_id": "///C/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3168, "atom2_serNum": 3201, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///C/733/O", "atom2_id": "///C/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3170, "atom2_serNum": 3324, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///C/733/OG", "atom2_id": "///C/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3174, "atom2_serNum": 3213, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/734/O", "atom2_id": "///C/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3174, "atom2_serNum": 3218, "donAcc_type": "acceptable", "distance": 2.392, "atom1_id": "///C/734/O", "atom2_id": "///C/738/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3182, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/735/O", "atom2_id": "///C/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3193, "atom2_serNum": 3228, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///C/736/O", "atom2_id": "///C/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3212, "atom2_serNum": 3312, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///C/737/OH", "atom2_id": "///C/750/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3212, "atom2_serNum": 3396, "donAcc_type": "acceptable", "distance": 3.412, "atom1_id": "///C/737/OH", "atom2_id": "///C/761/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3231, "atom2_serNum": 3243, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///C/740/O", "atom2_id": "///C/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3231, "atom2_serNum": 3249, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///C/740/O", "atom2_id": "///C/742/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3243, "atom2_serNum": 3249, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///C/742/N", "atom2_id": "///C/742/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3259, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///C/743/OD1", "atom2_id": "///C/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3264, "atom2_serNum": 3284, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///C/744/O", "atom2_id": "///C/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3319, "atom2_serNum": 3332, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/751/O", "atom2_id": "///C/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3332, "atom2_serNum": 3338, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///C/753/N", "atom2_id": "///C/753/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3338, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/753/OD1", "atom2_id": "///C/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3340, "atom2_serNum": 3366, "donAcc_type": "acceptable", "distance": 3.222, "atom1_id": "///C/754/N", "atom2_id": "///C/757/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3353, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/756/N", "atom2_id": "///C/756/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3356, "atom2_serNum": 3383, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///C/756/O", "atom2_id": "///C/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3360, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///C/756/OD2", "atom2_id": "///C/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3364, "atom2_serNum": 3388, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///C/757/O", "atom2_id": "///C/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3370, "atom2_serNum": 3397, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///C/758/O", "atom2_id": "///C/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3377, "atom2_serNum": 3402, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/759/O", "atom2_id": "///C/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3386, "atom2_serNum": 3411, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///C/760/O", "atom2_id": "///C/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3391, "atom2_serNum": 3419, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///C/761/O", "atom2_id": "///C/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3400, "atom2_serNum": 3427, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/762/O", "atom2_id": "///C/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3405, "atom2_serNum": 3435, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/763/O", "atom2_id": "///C/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3414, "atom2_serNum": 3443, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///C/764/O", "atom2_id": "///C/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3422, "atom2_serNum": 3451, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/765/O", "atom2_id": "///C/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3430, "atom2_serNum": 3459, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///C/766/O", "atom2_id": "///C/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3430, "atom2_serNum": 3465, "donAcc_type": "questionable", "distance": 3.002, "atom1_id": "///C/766/O", "atom2_id": "///C/770/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3438, "atom2_serNum": 3467, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///C/767/O", "atom2_id": "///C/771/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3442, "atom2_serNum": 4261, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///C/767/ND2", "atom2_id": "///C/868/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3446, "atom2_serNum": 3475, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///C/768/O", "atom2_id": "///C/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3454, "atom2_serNum": 3484, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/769/O", "atom2_id": "///C/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3459, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/770/N", "atom2_id": "///C/770/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3462, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/770/O", "atom2_id": "///C/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3466, "atom2_serNum": 4336, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///C/770/OD2", "atom2_id": "///C/878/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3470, "atom2_serNum": 3496, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/771/O", "atom2_id": "///C/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3478, "atom2_serNum": 3508, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/772/O", "atom2_id": "///C/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3478, "atom2_serNum": 3513, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///C/772/O", "atom2_id": "///C/776/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3487, "atom2_serNum": 3514, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/773/O", "atom2_id": "///C/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3494, "atom2_serNum": 3522, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/774/O", "atom2_id": "///C/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3499, "atom2_serNum": 3530, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///C/775/O", "atom2_id": "///C/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3517, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///C/777/O", "atom2_id": "///C/796/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3525, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/778/O", "atom2_id": "///C/796/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3552, "atom2_serNum": 3559, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/782/O", "atom2_id": "///C/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3562, "atom2_serNum": 3569, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///C/784/O", "atom2_id": "///C/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3582, "atom2_serNum": 3607, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/788/O", "atom2_id": "///C/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3587, "atom2_serNum": 3614, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///C/789/O", "atom2_id": "///C/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3594, "atom2_serNum": 3622, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/790/O", "atom2_id": "///C/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3602, "atom2_serNum": 3634, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/791/O", "atom2_id": "///C/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3610, "atom2_serNum": 3643, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///C/792/O", "atom2_id": "///C/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3625, "atom2_serNum": 3660, "donAcc_type": "standard", "distance": 3.822, "atom1_id": "///C/794/O", "atom2_id": "///C/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3633, "atom2_serNum": 3684, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///C/794/OH", "atom2_id": "///C/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3663, "atom2_serNum": 4027, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/798/O", "atom2_id": "///C/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3676, "atom2_serNum": 4010, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/800/N", "atom2_id": "///C/840/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3679, "atom2_serNum": 4007, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/800/O", "atom2_id": "///C/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3692, "atom2_serNum": 3993, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/802/N", "atom2_id": "///C/838/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3695, "atom2_serNum": 3990, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/802/O", "atom2_id": "///C/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3708, "atom2_serNum": 3974, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/804/N", "atom2_id": "///C/836/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3718, "atom2_serNum": 3742, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///C/805/O", "atom2_id": "///C/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3726, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/806/O", "atom2_id": "///C/815/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3734, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/807/N", "atom2_id": "///C/807/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3745, "atom2_serNum": 3771, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///C/808/O", "atom2_id": "///C/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3751, "atom2_serNum": 3780, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///C/809/O", "atom2_id": "///C/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3760, "atom2_serNum": 3788, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///C/810/O", "atom2_id": "///C/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3764, "atom2_serNum": 5254, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///C/810/OE1", "atom2_id": "///C/1001/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3769, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///C/811/O", "atom2_id": "///C/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3774, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/812/O", "atom2_id": "///C/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3783, "atom2_serNum": 3816, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///C/813/O", "atom2_id": "///C/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3791, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///C/814/O", "atom2_id": "///C/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3799, "atom2_serNum": 3835, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/815/O", "atom2_id": "///C/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3810, "atom2_serNum": 3844, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///C/816/O", "atom2_id": "///C/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3810, "atom2_serNum": 3851, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/816/O", "atom2_id": "///C/820/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3819, "atom2_serNum": 3857, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///C/817/O", "atom2_id": "///C/821/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3827, "atom2_serNum": 4183, "donAcc_type": "acceptable", "distance": 3.016, "atom1_id": "///C/817/OH", "atom2_id": "///C/859/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3827, "atom2_serNum": 4490, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///C/817/OH", "atom2_id": "///C/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3850, "atom2_serNum": 5017, "donAcc_type": "questionable", "distance": 3.091, "atom1_id": "///C/820/OD1", "atom2_id": "///C/971/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3855, "atom2_serNum": 3857, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///C/821/O", "atom2_id": "///C/821/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3855, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/821/O", "atom2_id": "///C/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3857, "atom2_serNum": 4490, "donAcc_type": "acceptable", "distance": 3.749, "atom1_id": "///C/821/OG1", "atom2_id": "///C/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3857, "atom2_serNum": 4503, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///C/821/OG1", "atom2_id": "///C/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3868, "atom2_serNum": 3891, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/822/NE2", "atom2_id": "///C/826/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3868, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///C/822/NE2", "atom2_id": "///C/829/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3884, "atom2_serNum": 3898, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/825/O", "atom2_id": "///C/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3886, "atom2_serNum": 5124, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///C/825/OG1", "atom2_id": "///C/986/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3894, "atom2_serNum": 4515, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///C/826/ND1", "atom2_id": "///C/902/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3898, "atom2_serNum": 3904, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///C/827/N", "atom2_id": "///C/827/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3922, "atom2_serNum": 4513, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///C/829/OH", "atom2_id": "///C/902/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3922, "atom2_serNum": 4543, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///C/829/OH", "atom2_id": "///C/906/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3923, "atom2_serNum": 5311, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/830/N", "atom2_id": "///C/1008/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3926, "atom2_serNum": 5308, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/830/O", "atom2_id": "///C/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3939, "atom2_serNum": 5291, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/832/N", "atom2_id": "///C/1006/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3942, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/832/O", "atom2_id": "///C/834/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3942, "atom2_serNum": 5288, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/832/O", "atom2_id": "///C/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3955, "atom2_serNum": 5274, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///C/834/N", "atom2_id": "///C/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3963, "atom2_serNum": 5274, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///C/835/N", "atom2_id": "///C/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3966, "atom2_serNum": 5271, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///C/835/O", "atom2_id": "///C/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3979, "atom2_serNum": 5258, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///C/837/N", "atom2_id": "///C/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3982, "atom2_serNum": 5255, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///C/837/O", "atom2_id": "///C/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3999, "atom2_serNum": 5237, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/839/N", "atom2_id": "///C/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4002, "atom2_serNum": 5229, "donAcc_type": "questionable", "distance": 3.114, "atom1_id": "///C/839/O", "atom2_id": "///C/999/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4019, "atom2_serNum": 4036, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/841/O", "atom2_id": "///C/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4025, "atom2_serNum": 4294, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/841/NH1", "atom2_id": "///C/873/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4025, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///C/841/NH1", "atom2_id": "///C/874/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4039, "atom2_serNum": 4064, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///C/843/O", "atom2_id": "///C/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4043, "atom2_serNum": 4075, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///C/844/O", "atom2_id": "///C/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4047, "atom2_serNum": 5224, "donAcc_type": "questionable", "distance": 3.229, "atom1_id": "///C/844/OE1", "atom2_id": "///C/998/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4048, "atom2_serNum": 4073, "donAcc_type": "standard", "distance": 3.899, "atom1_id": "///C/844/OE2", "atom2_id": "///C/847/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4052, "atom2_serNum": 4087, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///C/845/O", "atom2_id": "///C/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4078, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/848/O", "atom2_id": "///C/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4078, "atom2_serNum": 4114, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///C/848/O", "atom2_id": "///C/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4086, "atom2_serNum": 4669, "donAcc_type": "acceptable", "distance": 3.242, "atom1_id": "///C/848/OH", "atom2_id": "///C/923/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4090, "atom2_serNum": 4114, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/849/O", "atom2_id": "///C/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4099, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 3.636, "atom1_id": "///C/850/O", "atom2_id": "///C/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4122, "atom2_serNum": 4669, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///C/852/NZ", "atom2_id": "///C/923/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4135, "atom2_serNum": 4167, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///C/854/O", "atom2_id": "///C/857/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4153, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///C/856/O", "atom2_id": "///C/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4153, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///C/856/O", "atom2_id": "///C/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4156, "atom2_serNum": 4693, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///C/856/OD1", "atom2_id": "///C/927/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4161, "atom2_serNum": 4992, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/857/O", "atom2_id": "///C/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4165, "atom2_serNum": 4669, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///C/857/NE", "atom2_id": "///C/923/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4168, "atom2_serNum": 4984, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/857/NH2", "atom2_id": "///C/966/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4169, "atom2_serNum": 4673, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///C/858/N", "atom2_id": "///C/924/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4172, "atom2_serNum": 4670, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/858/O", "atom2_id": "///C/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4179, "atom2_serNum": 5153, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///C/858/NH2", "atom2_id": "///C/989/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4180, "atom2_serNum": 4995, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///C/859/N", "atom2_id": "///C/968/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4188, "atom2_serNum": 4660, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///C/860/N", "atom2_id": "///C/922/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4191, "atom2_serNum": 4657, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///C/860/O", "atom2_id": "///C/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4196, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///C/861/N", "atom2_id": "///C/898/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4199, "atom2_serNum": 4482, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/861/O", "atom2_id": "///C/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4210, "atom2_serNum": 4644, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///C/862/N", "atom2_id": "///C/920/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4213, "atom2_serNum": 4641, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/862/O", "atom2_id": "///C/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4216, "atom2_serNum": 4462, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///C/862/ND1", "atom2_id": "///C/896/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4216, "atom2_serNum": 11753, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///C/862/ND1", "atom2_id": "///C/1101/N", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 488, "atom1_serNum": 4220, "atom2_serNum": 11751, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///C/863/N", "atom2_id": "///C/1101/O", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 489, "atom1_serNum": 4223, "atom2_serNum": 11753, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/863/O", "atom2_id": "///C/1101/N", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 490, "atom1_serNum": 4229, "atom2_serNum": 4262, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///C/864/OG", "atom2_id": "///C/868/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4233, "atom2_serNum": 4255, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/865/O", "atom2_id": "///C/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4233, "atom2_serNum": 4263, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///C/865/O", "atom2_id": "///C/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4244, "atom2_serNum": 4246, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///C/866/O", "atom2_id": "///C/866/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4258, "atom2_serNum": 4279, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///C/868/O", "atom2_id": "///C/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4258, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/868/O", "atom2_id": "///C/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4277, "atom2_serNum": 4304, "donAcc_type": "acceptable", "distance": 3.484, "atom1_id": "///C/870/O", "atom2_id": "///C/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4282, "atom2_serNum": 4304, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///C/871/O", "atom2_id": "///C/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4282, "atom2_serNum": 4305, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/871/O", "atom2_id": "///C/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4286, "atom2_serNum": 4314, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/872/O", "atom2_id": "///C/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4317, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/876/O", "atom2_id": "///C/878/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4353, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/881/O", "atom2_id": "///C/893/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4376, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///C/884/O", "atom2_id": "///C/893/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4388, "atom2_serNum": 4403, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///C/886/O", "atom2_id": "///C/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4418, "atom2_serNum": 4763, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///C/890/O", "atom2_id": "///C/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4423, "atom2_serNum": 4470, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///C/891/N", "atom2_id": "///C/896/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4426, "atom2_serNum": 5180, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///C/891/O", "atom2_id": "///C/992/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4437, "atom2_serNum": 4470, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///C/892/O", "atom2_id": "///C/896/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4451, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/895/N", "atom2_id": "///C/991/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4454, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/895/O", "atom2_id": "///C/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4471, "atom2_serNum": 5145, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///C/897/N", "atom2_id": "///C/989/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4474, "atom2_serNum": 5142, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/897/O", "atom2_id": "///C/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4493, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/899/OD1", "atom2_id": "///C/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4494, "atom2_serNum": 5132, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/899/OD2", "atom2_id": "///C/987/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4494, "atom2_serNum": 5153, "donAcc_type": "acceptable", "distance": 3.339, "atom1_id": "///C/899/OD2", "atom2_id": "///C/989/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4498, "atom2_serNum": 4525, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///C/900/O", "atom2_id": "///C/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4506, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/901/O", "atom2_id": "///C/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4513, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/902/O", "atom2_id": "///C/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4513, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///C/902/O", "atom2_id": "///C/906/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4524, "atom2_serNum": 5141, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///C/903/NZ", "atom2_id": "///C/988/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4528, "atom2_serNum": 4544, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/904/O", "atom2_id": "///C/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4530, "atom2_serNum": 11751, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///C/904/OG", "atom2_id": "///C/1101/O", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 522, "atom1_serNum": 4534, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/905/O", "atom2_id": "///C/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4579, "atom2_serNum": 4601, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///C/911/N", "atom2_id": "///C/914/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4584, "atom2_serNum": 4598, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///C/911/OG", "atom2_id": "///C/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4585, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///C/912/N", "atom2_id": "///C/912/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4593, "atom2_serNum": 5341, "donAcc_type": "acceptable", "distance": 3.645, "atom1_id": "///C/912/NE2", "atom2_id": "///C/1011/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4621, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/917/N", "atom2_id": "///C/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4624, "atom2_serNum": 5280, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///C/917/O", "atom2_id": "///C/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4633, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///C/919/N", "atom2_id": "///C/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4636, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/919/O", "atom2_id": "///C/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4649, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///C/921/N", "atom2_id": "///C/1001/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4652, "atom2_serNum": 5234, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/921/O", "atom2_id": "///C/1000/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4652, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/921/O", "atom2_id": "///C/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4660, "atom2_serNum": 4670, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/922/O", "atom2_id": "///C/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4661, "atom2_serNum": 5221, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///C/923/N", "atom2_id": "///C/998/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4668, "atom2_serNum": 5242, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/923/OE1", "atom2_id": "///C/1000/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4673, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/924/O", "atom2_id": "///C/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4677, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/925/N", "atom2_id": "///C/996/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4685, "atom2_serNum": 4854, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///C/926/O", "atom2_id": "///C/947/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4693, "atom2_serNum": 4702, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///C/927/O", "atom2_id": "///C/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4694, "atom2_serNum": 4845, "donAcc_type": "acceptable", "distance": 3.556, "atom1_id": "///C/928/N", "atom2_id": "///C/946/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4697, "atom2_serNum": 4839, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///C/928/O", "atom2_id": "///C/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4710, "atom2_serNum": 4852, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/930/N", "atom2_id": "///C/947/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4713, "atom2_serNum": 4862, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/930/O", "atom2_id": "///C/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4731, "atom2_serNum": 4865, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/932/N", "atom2_id": "///C/949/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4734, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/932/O", "atom2_id": "///C/951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4742, "atom2_serNum": 5089, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///C/933/O", "atom2_id": "///C/982/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4758, "atom2_serNum": 5096, "donAcc_type": "acceptable", "distance": 3.906, "atom1_id": "///C/935/N", "atom2_id": "///C/983/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4766, "atom2_serNum": 4779, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///C/936/O", "atom2_id": "///C/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4813, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///C/942/O", "atom2_id": "///C/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4842, "atom2_serNum": 5210, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/946/O", "atom2_id": "///C/996/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4855, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/948/N", "atom2_id": "///C/990/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4858, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/948/O", "atom2_id": "///C/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4871, "atom2_serNum": 5136, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/950/N", "atom2_id": "///C/988/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4874, "atom2_serNum": 5133, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/950/O", "atom2_id": "///C/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4878, "atom2_serNum": 5089, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///C/951/O", "atom2_id": "///C/982/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4883, "atom2_serNum": 5131, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/952/N", "atom2_id": "///C/987/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4886, "atom2_serNum": 5056, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///C/952/O", "atom2_id": "///C/977/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4887, "atom2_serNum": 5100, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///C/953/N", "atom2_id": "///C/984/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4890, "atom2_serNum": 5051, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/953/O", "atom2_id": "///C/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4890, "atom2_serNum": 5056, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///C/953/O", "atom2_id": "///C/977/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4895, "atom2_serNum": 5071, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///C/953/NZ", "atom2_id": "///C/980/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4896, "atom2_serNum": 5108, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/954/N", "atom2_id": "///C/985/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4903, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/955/N", "atom2_id": "///C/975/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4906, "atom2_serNum": 5037, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/955/O", "atom2_id": "///C/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4908, "atom2_serNum": 5132, "donAcc_type": "acceptable", "distance": 3.565, "atom1_id": "///C/955/OG1", "atom2_id": "///C/987/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4913, "atom2_serNum": 4925, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/956/O", "atom2_id": "///C/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4917, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/957/N", "atom2_id": "///C/973/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4920, "atom2_serNum": 4938, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/957/O", "atom2_id": "///C/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4920, "atom2_serNum": 4950, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/957/O", "atom2_id": "///C/961/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4923, "atom2_serNum": 4937, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///C/957/OD1", "atom2_id": "///C/959/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4924, "atom2_serNum": 4937, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///C/957/OD2", "atom2_id": "///C/959/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4951, "atom2_serNum": 5003, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///C/962/N", "atom2_id": "///C/969/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4954, "atom2_serNum": 5000, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///C/962/O", "atom2_id": "///C/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4965, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///C/964/N", "atom2_id": "///C/967/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4988, "atom2_serNum": 5000, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///C/967/O", "atom2_id": "///C/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4992, "atom2_serNum": 4999, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///C/968/N", "atom2_id": "///C/968/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5003, "atom2_serNum": 5014, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/969/O", "atom2_id": "///C/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5050, "atom2_serNum": 5074, "donAcc_type": "acceptable", "distance": 3.971, "atom1_id": "///C/976/OG", "atom2_id": "///C/980/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5056, "atom2_serNum": 5064, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///C/977/OG", "atom2_id": "///C/979/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5056, "atom2_serNum": 5074, "donAcc_type": "acceptable", "distance": 3.428, "atom1_id": "///C/977/OG", "atom2_id": "///C/980/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5089, "atom2_serNum": 5097, "donAcc_type": "acceptable", "distance": 3.280, "atom1_id": "///C/982/OG1", "atom2_id": "///C/984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5132, "atom2_serNum": 5153, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///C/987/ND2", "atom2_id": "///C/989/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5184, "atom2_serNum": 5202, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/993/O", "atom2_id": "///C/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5364, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/8/O", "atom2_id": "///D/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5372, "atom2_serNum": 5891, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///D/9/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5381, "atom2_serNum": 5593, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///D/10/N", "atom2_id": "///D/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5385, "atom2_serNum": 5590, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///D/10/O", "atom2_id": "///D/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5392, "atom2_serNum": 5414, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/10/NE", "atom2_id": "///D/12/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5398, "atom2_serNum": 5414, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///D/10/NH2", "atom2_id": "///D/12/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5400, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/11/N", "atom2_id": "///D/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5407, "atom2_serNum": 5574, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///D/12/N", "atom2_id": "///D/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5410, "atom2_serNum": 5571, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/12/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5414, "atom2_serNum": 5441, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///D/12/OE1", "atom2_id": "///D/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5415, "atom2_serNum": 5441, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///D/12/OE2", "atom2_id": "///D/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5415, "atom2_serNum": 5581, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///D/12/OE2", "atom2_id": "///D/34/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5419, "atom2_serNum": 5433, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/13/O", "atom2_id": "///D/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5427, "atom2_serNum": 5937, "donAcc_type": "acceptable", "distance": 3.051, "atom1_id": "///D/13/OH", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5427, "atom2_serNum": 5976, "donAcc_type": "acceptable", "distance": 2.656, "atom1_id": "///D/13/OH", "atom2_id": "///D/81/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5428, "atom2_serNum": 5560, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/14/N", "atom2_id": "///D/32/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5431, "atom2_serNum": 5549, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/14/O", "atom2_id": "///D/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5447, "atom2_serNum": 11162, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///D/16/OG", "atom2_id": "///M/24/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 603, "atom1_serNum": 5447, "atom2_serNum": 11177, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///D/16/OG", "atom2_id": "///M/25/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 604, "atom1_serNum": 5461, "atom2_serNum": 11174, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///D/18/NH1", "atom2_id": "///M/24/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 605, "atom1_serNum": 5463, "atom2_serNum": 11177, "donAcc_type": "standard", "distance": 3.870, "atom1_id": "///D/19/N", "atom2_id": "///M/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 606, "atom1_serNum": 5466, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///D/19/O", "atom2_id": "///D/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5468, "atom2_serNum": 11199, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/20/N", "atom2_id": "///M/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 608, "atom1_serNum": 5474, "atom2_serNum": 5513, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/21/N", "atom2_id": "///D/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5477, "atom2_serNum": 5504, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/21/O", "atom2_id": "///D/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5480, "atom2_serNum": 5707, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///D/22/N", "atom2_id": "///D/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5501, "atom2_serNum": 5509, "donAcc_type": "acceptable", "distance": 2.530, "atom1_id": "///D/24/O", "atom2_id": "///D/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5507, "atom2_serNum": 5509, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///D/25/O", "atom2_id": "///D/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5513, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///D/26/O", "atom2_id": "///D/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5522, "atom2_serNum": 5533, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///D/27/O", "atom2_id": "///D/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5536, "atom2_serNum": 5562, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///D/29/O", "atom2_id": "///D/32/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5560, "atom2_serNum": 5571, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/32/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5566, "atom2_serNum": 5740, "donAcc_type": "standard", "distance": 3.750, "atom1_id": "///D/33/O", "atom2_id": "///D/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5580, "atom2_serNum": 11177, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/34/NH1", "atom2_id": "///M/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 619, "atom1_serNum": 5581, "atom2_serNum": 11178, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///D/34/NH2", "atom2_id": "///M/25/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 620, "atom1_serNum": 5582, "atom2_serNum": 5721, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///D/35/N", "atom2_id": "///D/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5585, "atom2_serNum": 5718, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///D/35/O", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5595, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///D/37/N", "atom2_id": "///D/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5598, "atom2_serNum": 5694, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/37/O", "atom2_id": "///D/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5611, "atom2_serNum": 5683, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/39/N", "atom2_id": "///D/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5614, "atom2_serNum": 5680, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///D/39/O", "atom2_id": "///D/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5625, "atom2_serNum": 5667, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///D/40/OE1", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5626, "atom2_serNum": 5630, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///D/40/NE2", "atom2_id": "///D/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5627, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///D/41/N", "atom2_id": "///D/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5630, "atom2_serNum": 5651, "donAcc_type": "questionable", "distance": 2.928, "atom1_id": "///D/41/O", "atom2_id": "///D/44/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5636, "atom2_serNum": 7546, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/42/O", "atom2_id": "///F/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5643, "atom2_serNum": 7492, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///D/43/O", "atom2_id": "///F/589/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5651, "atom2_serNum": 5667, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/44/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5665, "atom2_serNum": 7511, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///D/45/OD1", "atom2_id": "///F/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5666, "atom2_serNum": 7354, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///D/45/OD2", "atom2_id": "///F/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5666, "atom2_serNum": 7367, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///D/45/OD2", "atom2_id": "///F/568/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5666, "atom2_serNum": 7511, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///D/45/OD2", "atom2_id": "///F/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5733, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///D/53/O", "atom2_id": "///D/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5743, "atom2_serNum": 5782, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///D/54/O", "atom2_id": "///D/58/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5760, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///D/56/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5821, "atom2_serNum": 5832, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///D/63/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5832, "atom2_serNum": 5882, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///D/65/N", "atom2_id": "///D/70/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5843, "atom2_serNum": 5882, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///D/66/N", "atom2_id": "///D/70/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5846, "atom2_serNum": 5875, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5856, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5860, "atom2_serNum": 5866, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///D/68/N", "atom2_id": "///D/68/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5897, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///D/72/OD1", "atom2_id": "///D/305/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5897, "atom2_serNum": 6702, "donAcc_type": "acceptable", "distance": 3.733, "atom1_id": "///D/72/OD1", "atom2_id": "///D/306/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5898, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///D/72/OD2", "atom2_id": "///D/305/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5917, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///D/75/O", "atom2_id": "///D/242/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5919, "atom2_serNum": 6700, "donAcc_type": "acceptable", "distance": 3.451, "atom1_id": "///D/75/OG", "atom2_id": "///D/306/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5920, "atom2_serNum": 5928, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///D/76/N", "atom2_id": "///D/76/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5923, "atom2_serNum": 6240, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///D/76/O", "atom2_id": "///D/246/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5927, "atom2_serNum": 6697, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///D/76/OE1", "atom2_id": "///D/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5928, "atom2_serNum": 6702, "donAcc_type": "acceptable", "distance": 3.960, "atom1_id": "///D/76/OE2", "atom2_id": "///D/306/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5932, "atom2_serNum": 5986, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///D/77/O", "atom2_id": "///D/82/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5932, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///D/77/O", "atom2_id": "///D/242/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5932, "atom2_serNum": 6240, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///D/77/O", "atom2_id": "///D/246/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5940, "atom2_serNum": 5970, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/78/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5940, "atom2_serNum": 5978, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/78/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5946, "atom2_serNum": 6277, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/78/NH1", "atom2_id": "///D/250/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5948, "atom2_serNum": 6206, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///D/79/N", "atom2_id": "///D/242/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5951, "atom2_serNum": 5987, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///D/79/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5962, "atom2_serNum": 5969, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///D/80/N", "atom2_id": "///D/80/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5965, "atom2_serNum": 5996, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///D/80/O", "atom2_id": "///D/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5973, "atom2_serNum": 6005, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///D/81/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5981, "atom2_serNum": 6012, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/82/O", "atom2_id": "///D/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5986, "atom2_serNum": 6207, "donAcc_type": "questionable", "distance": 3.289, "atom1_id": "///D/82/NE2", "atom2_id": "///D/242/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5990, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///D/83/O", "atom2_id": "///D/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5999, "atom2_serNum": 6030, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///D/84/O", "atom2_id": "///D/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5999, "atom2_serNum": 6035, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///D/84/O", "atom2_id": "///D/88/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 6008, "atom2_serNum": 6037, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/85/O", "atom2_id": "///D/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 6024, "atom2_serNum": 6051, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///D/87/O", "atom2_id": "///D/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 6033, "atom2_serNum": 6054, "donAcc_type": "questionable", "distance": 3.033, "atom1_id": "///D/88/O", "atom2_id": "///D/91/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 6059, "atom2_serNum": 6089, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///D/224/O", "atom2_id": "///D/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 6065, "atom2_serNum": 6098, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/225/O", "atom2_id": "///D/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 6074, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///D/226/O", "atom2_id": "///D/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 6083, "atom2_serNum": 6115, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///D/227/O", "atom2_id": "///D/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 6092, "atom2_serNum": 6123, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/228/O", "atom2_id": "///D/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 6101, "atom2_serNum": 6129, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///D/229/O", "atom2_id": "///D/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 6109, "atom2_serNum": 6138, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///D/230/O", "atom2_id": "///D/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 6118, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///D/231/O", "atom2_id": "///D/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 6126, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///D/232/O", "atom2_id": "///D/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 6132, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///D/233/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 6141, "atom2_serNum": 6169, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///D/234/O", "atom2_id": "///D/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 6149, "atom2_serNum": 6177, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///D/235/O", "atom2_id": "///D/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 6158, "atom2_serNum": 6186, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/236/O", "atom2_id": "///D/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 6167, "atom2_serNum": 6191, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///D/237/O", "atom2_id": "///D/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 6172, "atom2_serNum": 6200, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///D/238/O", "atom2_id": "///D/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 6180, "atom2_serNum": 6208, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/239/O", "atom2_id": "///D/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 6185, "atom2_serNum": 6214, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///D/239/NZ", "atom2_id": "///D/243/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 6194, "atom2_serNum": 6224, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///D/241/O", "atom2_id": "///D/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 6198, "atom2_serNum": 7066, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///D/241/OE1", "atom2_id": "///D/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 6199, "atom2_serNum": 7045, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///D/241/NE2", "atom2_id": "///D/353/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 6199, "atom2_serNum": 7050, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///D/241/NE2", "atom2_id": "///D/354/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 6203, "atom2_serNum": 6232, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///D/242/O", "atom2_id": "///D/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 6211, "atom2_serNum": 6246, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///D/243/O", "atom2_id": "///D/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 6211, "atom2_serNum": 6252, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///D/243/O", "atom2_id": "///D/247/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 6215, "atom2_serNum": 6216, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/243/OD2", "atom2_id": "///D/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 6219, "atom2_serNum": 6254, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///D/244/O", "atom2_id": "///D/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 6227, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/245/O", "atom2_id": "///D/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 6235, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///D/246/O", "atom2_id": "///D/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6249, "atom2_serNum": 6278, "donAcc_type": "questionable", "distance": 3.069, "atom1_id": "///D/247/O", "atom2_id": "///D/250/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6249, "atom2_serNum": 6279, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/247/O", "atom2_id": "///D/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6257, "atom2_serNum": 6288, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///D/248/O", "atom2_id": "///D/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6265, "atom2_serNum": 6296, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///D/249/O", "atom2_id": "///D/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6274, "atom2_serNum": 6305, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///D/250/O", "atom2_id": "///D/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6278, "atom2_serNum": 6279, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/250/OD2", "atom2_id": "///D/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6282, "atom2_serNum": 6314, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///D/251/O", "atom2_id": "///D/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6291, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///D/252/O", "atom2_id": "///D/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6330, "atom2_serNum": 6356, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///D/257/O", "atom2_id": "///D/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6336, "atom2_serNum": 6364, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///D/258/O", "atom2_id": "///D/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6343, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/259/O", "atom2_id": "///D/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6348, "atom2_serNum": 6354, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///D/260/N", "atom2_id": "///D/260/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6351, "atom2_serNum": 6382, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/260/O", "atom2_id": "///D/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6359, "atom2_serNum": 6390, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///D/261/O", "atom2_id": "///D/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6367, "atom2_serNum": 6398, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///D/262/O", "atom2_id": "///D/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6376, "atom2_serNum": 6406, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/263/O", "atom2_id": "///D/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6385, "atom2_serNum": 6417, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///D/264/O", "atom2_id": "///D/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6385, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///D/264/O", "atom2_id": "///D/268/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6393, "atom2_serNum": 6425, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///D/265/O", "atom2_id": "///D/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6393, "atom2_serNum": 6434, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///D/265/O", "atom2_id": "///D/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6401, "atom2_serNum": 6425, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///D/266/O", "atom2_id": "///D/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6420, "atom2_serNum": 6442, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///D/268/O", "atom2_id": "///D/270/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6423, "atom2_serNum": 6925, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///D/268/OD1", "atom2_id": "///D/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6424, "atom2_serNum": 6928, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///D/268/ND2", "atom2_id": "///D/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6442, "atom2_serNum": 6593, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///D/270/NE2", "atom2_id": "///D/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6446, "atom2_serNum": 6459, "donAcc_type": "standard", "distance": 3.425, "atom1_id": "///D/271/O", "atom2_id": "///D/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6446, "atom2_serNum": 6529, "donAcc_type": "standard", "distance": 3.761, "atom1_id": "///D/271/O", "atom2_id": "///D/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6471, "atom2_serNum": 11135, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///D/274/OG", "atom2_id": "///M/23/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 730, "atom1_serNum": 6471, "atom2_serNum": 11136, "donAcc_type": "acceptable", "distance": 2.499, "atom1_id": "///D/274/OG", "atom2_id": "///M/23/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 731, "atom1_serNum": 6476, "atom2_serNum": 11155, "donAcc_type": "standard", "distance": 3.872, "atom1_id": "///D/276/N", "atom2_id": "///M/24/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 732, "atom1_serNum": 6479, "atom2_serNum": 6496, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///D/276/O", "atom2_id": "///D/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6479, "atom2_serNum": 6504, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///D/276/O", "atom2_id": "///D/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6488, "atom2_serNum": 6512, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/277/O", "atom2_id": "///D/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6494, "atom2_serNum": 6520, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/278/O", "atom2_id": "///D/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6499, "atom2_serNum": 6531, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/279/O", "atom2_id": "///D/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6507, "atom2_serNum": 6538, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/280/O", "atom2_id": "///D/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6515, "atom2_serNum": 6543, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///D/281/O", "atom2_id": "///D/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6523, "atom2_serNum": 6551, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///D/282/O", "atom2_id": "///D/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6534, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///D/283/O", "atom2_id": "///D/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6541, "atom2_serNum": 6563, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///D/284/O", "atom2_id": "///D/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6546, "atom2_serNum": 6570, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///D/285/O", "atom2_id": "///D/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6550, "atom2_serNum": 6727, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///D/285/OD2", "atom2_id": "///D/309/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6550, "atom2_serNum": 7065, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///D/285/OD2", "atom2_id": "///D/355/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6554, "atom2_serNum": 6581, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/286/O", "atom2_id": "///D/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6584, "atom2_serNum": 6590, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///D/290/O", "atom2_id": "///D/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6585, "atom2_serNum": 6896, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///D/291/N", "atom2_id": "///D/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6588, "atom2_serNum": 6893, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///D/291/O", "atom2_id": "///D/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6598, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///D/293/N", "atom2_id": "///D/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6613, "atom2_serNum": 6652, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///D/295/N", "atom2_id": "///D/300/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6626, "atom2_serNum": 6880, "donAcc_type": "questionable", "distance": 2.952, "atom1_id": "///D/296/OE1", "atom2_id": "///D/329/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6628, "atom2_serNum": 6635, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///D/297/N", "atom2_id": "///D/297/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6656, "atom2_serNum": 6746, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/301/O", "atom2_id": "///D/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6656, "atom2_serNum": 6751, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///D/301/O", "atom2_id": "///D/312/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6661, "atom2_serNum": 6665, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/301/NE2", "atom2_id": "///D/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6670, "atom2_serNum": 6731, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///D/303/N", "atom2_id": "///D/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6673, "atom2_serNum": 6728, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/303/O", "atom2_id": "///D/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6688, "atom2_serNum": 6714, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/305/N", "atom2_id": "///D/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6691, "atom2_serNum": 6703, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///D/305/O", "atom2_id": "///D/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6703, "atom2_serNum": 6709, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///D/307/N", "atom2_id": "///D/307/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6706, "atom2_serNum": 6859, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///D/307/O", "atom2_id": "///D/326/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6709, "atom2_serNum": 6739, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///D/307/OD1", "atom2_id": "///D/310/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6716, "atom2_serNum": 6847, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///D/309/N", "atom2_id": "///D/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6719, "atom2_serNum": 6844, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///D/309/O", "atom2_id": "///D/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6727, "atom2_serNum": 7062, "donAcc_type": "acceptable", "distance": 3.323, "atom1_id": "///D/309/OH", "atom2_id": "///D/355/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6740, "atom2_serNum": 6831, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/311/N", "atom2_id": "///D/323/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6756, "atom2_serNum": 6814, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///D/313/O", "atom2_id": "///D/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6775, "atom2_serNum": 6801, "donAcc_type": "questionable", "distance": 2.695, "atom1_id": "///D/316/O", "atom2_id": "///D/319/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6777, "atom2_serNum": 6784, "donAcc_type": "acceptable", "distance": 3.379, "atom1_id": "///D/316/OG1", "atom2_id": "///D/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6777, "atom2_serNum": 8498, "donAcc_type": "acceptable", "distance": 3.394, "atom1_id": "///D/316/OG1", "atom2_id": "///F/731/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6849, "atom2_serNum": 6860, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///D/325/OG1", "atom2_id": "///D/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6863, "atom2_serNum": 6865, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///D/327/O", "atom2_id": "///D/327/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6892, "atom2_serNum": 7053, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///D/330/NH2", "atom2_id": "///D/354/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6909, "atom2_serNum": 7037, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///D/332/OE1", "atom2_id": "///D/352/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6919, "atom2_serNum": 6937, "donAcc_type": "acceptable", "distance": 3.343, "atom1_id": "///D/333/NE1", "atom2_id": "///D/335/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6949, "atom2_serNum": 6964, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/337/O", "atom2_id": "///D/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6977, "atom2_serNum": 6994, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///D/341/O", "atom2_id": "///D/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6982, "atom2_serNum": 6999, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/342/O", "atom2_id": "///D/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6997, "atom2_serNum": 7009, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///D/345/O", "atom2_id": "///D/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 7007, "atom2_serNum": 7014, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/347/O", "atom2_id": "///D/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 7053, "atom2_serNum": 7055, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///D/354/OD1", "atom2_id": "///D/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 7117, "atom2_serNum": 7416, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///F/534/N", "atom2_id": "///F/573/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 7120, "atom2_serNum": 7140, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///F/534/O", "atom2_id": "///F/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 7120, "atom2_serNum": 7145, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///F/534/O", "atom2_id": "///F/537/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 7132, "atom2_serNum": 7138, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///F/536/N", "atom2_id": "///F/536/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 7145, "atom2_serNum": 7150, "donAcc_type": "acceptable", "distance": 3.335, "atom1_id": "///F/537/OG", "atom2_id": "///F/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 7153, "atom2_serNum": 7183, "donAcc_type": "standard", "distance": 3.716, "atom1_id": "///F/539/O", "atom2_id": "///F/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 7188, "atom2_serNum": 7194, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///F/544/N", "atom2_id": "///F/544/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 7205, "atom2_serNum": 7421, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///F/546/N", "atom2_id": "///F/574/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 7208, "atom2_serNum": 7255, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/546/O", "atom2_id": "///F/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 7222, "atom2_serNum": 7242, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///F/548/N", "atom2_id": "///F/551/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 7225, "atom2_serNum": 7235, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///F/548/O", "atom2_id": "///F/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 7238, "atom2_serNum": 7248, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///F/550/O", "atom2_id": "///F/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 7247, "atom2_serNum": 7780, "donAcc_type": "standard", "distance": 3.707, "atom1_id": "///F/551/NZ", "atom2_id": "///F/626/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 7251, "atom2_serNum": 7266, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///F/552/O", "atom2_id": "///F/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 7258, "atom2_serNum": 7418, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///F/553/O", "atom2_id": "///F/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 7271, "atom2_serNum": 7404, "donAcc_type": "acceptable", "distance": 3.849, "atom1_id": "///F/554/OG", "atom2_id": "///F/572/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 7272, "atom2_serNum": 7404, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///F/555/N", "atom2_id": "///F/572/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 7275, "atom2_serNum": 7401, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///F/555/O", "atom2_id": "///F/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 7280, "atom2_serNum": 7918, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///F/556/O", "atom2_id": "///F/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 7284, "atom2_serNum": 7383, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/557/N", "atom2_id": "///F/570/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 7287, "atom2_serNum": 7380, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///F/557/O", "atom2_id": "///F/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 7292, "atom2_serNum": 7902, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///F/558/N", "atom2_id": "///F/639/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 7295, "atom2_serNum": 7899, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///F/558/O", "atom2_id": "///F/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 7296, "atom2_serNum": 7365, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///F/559/N", "atom2_id": "///F/568/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 7299, "atom2_serNum": 7362, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///F/559/O", "atom2_id": "///F/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 7311, "atom2_serNum": 7350, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///F/561/N", "atom2_id": "///F/566/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 7314, "atom2_serNum": 7343, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///F/561/O", "atom2_id": "///F/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 7314, "atom2_serNum": 7347, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///F/561/O", "atom2_id": "///F/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 7317, "atom2_serNum": 7327, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///F/561/OD1", "atom2_id": "///F/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 7319, "atom2_serNum": 8520, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///F/562/N", "atom2_id": "///F/734/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 7322, "atom2_serNum": 8644, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///F/562/O", "atom2_id": "///F/748/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 7346, "atom2_serNum": 7511, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///F/565/O", "atom2_id": "///F/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 7346, "atom2_serNum": 7512, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///F/565/O", "atom2_id": "///F/591/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 7352, "atom2_serNum": 7367, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///F/566/OG1", "atom2_id": "///F/568/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 7357, "atom2_serNum": 7513, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///F/567/O", "atom2_id": "///F/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 7361, "atom2_serNum": 8589, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///F/567/ND2", "atom2_id": "///F/742/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 7368, "atom2_serNum": 7501, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/569/N", "atom2_id": "///F/590/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 7371, "atom2_serNum": 7498, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///F/569/O", "atom2_id": "///F/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 7391, "atom2_serNum": 11238, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///F/570/OH", "atom2_id": "///N/2/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 821, "atom1_serNum": 7392, "atom2_serNum": 7481, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///F/571/N", "atom2_id": "///F/588/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 7395, "atom2_serNum": 7478, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///F/571/O", "atom2_id": "///F/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 7409, "atom2_serNum": 7459, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///F/573/N", "atom2_id": "///F/586/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 7412, "atom2_serNum": 7456, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///F/573/O", "atom2_id": "///F/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 7426, "atom2_serNum": 7437, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///F/575/N", "atom2_id": "///F/584/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 7448, "atom2_serNum": 7584, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///F/585/N", "atom2_id": "///F/602/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7451, "atom2_serNum": 7581, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///F/585/O", "atom2_id": "///F/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7467, "atom2_serNum": 7567, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///F/587/N", "atom2_id": "///F/600/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 7470, "atom2_serNum": 7564, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///F/587/O", "atom2_id": "///F/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 7477, "atom2_serNum": 7589, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///F/587/NH2", "atom2_id": "///F/602/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7484, "atom2_serNum": 7553, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/589/N", "atom2_id": "///F/598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7487, "atom2_serNum": 7550, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///F/589/O", "atom2_id": "///F/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7502, "atom2_serNum": 7541, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///F/591/N", "atom2_id": "///F/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7505, "atom2_serNum": 7524, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///F/591/O", "atom2_id": "///F/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7505, "atom2_serNum": 7529, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///F/591/O", "atom2_id": "///F/594/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7509, "atom2_serNum": 8618, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///F/591/NE", "atom2_id": "///F/745/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7512, "atom2_serNum": 8630, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///F/591/NH2", "atom2_id": "///F/747/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7534, "atom2_serNum": 7546, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///F/595/O", "atom2_id": "///F/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7559, "atom2_serNum": 7563, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///F/599/O", "atom2_id": "///F/599/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 7572, "atom2_serNum": 11257, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///F/600/NZ", "atom2_id": "///N/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 841, "atom1_serNum": 7589, "atom2_serNum": 7677, "donAcc_type": "standard", "distance": 3.921, "atom1_id": "///F/602/OE2", "atom2_id": "///F/613/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7623, "atom2_serNum": 7651, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "///F/607/O", "atom2_id": "///F/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7632, "atom2_serNum": 7659, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///F/608/O", "atom2_id": "///F/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7641, "atom2_serNum": 7668, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/609/O", "atom2_id": "///F/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7649, "atom2_serNum": 7678, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///F/610/O", "atom2_id": "///F/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7654, "atom2_serNum": 7689, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/611/O", "atom2_id": "///F/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7671, "atom2_serNum": 7706, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///F/613/O", "atom2_id": "///F/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7681, "atom2_serNum": 7714, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///F/614/O", "atom2_id": "///F/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7692, "atom2_serNum": 7726, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///F/615/O", "atom2_id": "///F/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7700, "atom2_serNum": 7735, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/616/O", "atom2_id": "///F/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7709, "atom2_serNum": 7744, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///F/617/O", "atom2_id": "///F/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7717, "atom2_serNum": 7744, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///F/618/O", "atom2_id": "///F/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7717, "atom2_serNum": 7753, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///F/618/O", "atom2_id": "///F/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7729, "atom2_serNum": 7760, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///F/619/O", "atom2_id": "///F/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7747, "atom2_serNum": 7888, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///F/621/O", "atom2_id": "///F/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7752, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///F/621/NZ", "atom2_id": "///N/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 857, "atom1_serNum": 7756, "atom2_serNum": 7758, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///F/622/O", "atom2_id": "///F/622/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7756, "atom2_serNum": 7891, "donAcc_type": "questionable", "distance": 3.296, "atom1_id": "///F/622/O", "atom2_id": "///F/638/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7764, "atom2_serNum": 7770, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///F/624/N", "atom2_id": "///F/624/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7770, "atom2_serNum": 7838, "donAcc_type": "questionable", "distance": 2.930, "atom1_id": "///F/624/OD1", "atom2_id": "///F/632/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7771, "atom2_serNum": 7840, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///F/624/ND2", "atom2_id": "///F/632/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7810, "atom2_serNum": 7824, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///F/629/O", "atom2_id": "///F/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7816, "atom2_serNum": 7822, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///F/630/N", "atom2_id": "///F/630/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7838, "atom2_serNum": 7840, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///F/632/O", "atom2_id": "///F/632/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7850, "atom2_serNum": 7882, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///F/633/NZ", "atom2_id": "///F/637/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7854, "atom2_serNum": 7879, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/634/O", "atom2_id": "///F/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7914, "atom2_serNum": 7933, "donAcc_type": "questionable", "distance": 3.107, "atom1_id": "///F/640/O", "atom2_id": "///F/642/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7921, "atom2_serNum": 7935, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///F/641/O", "atom2_id": "///F/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7929, "atom2_serNum": 8274, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///F/642/O", "atom2_id": "///F/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7933, "atom2_serNum": 8307, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///F/642/OE1", "atom2_id": "///F/705/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7943, "atom2_serNum": 8260, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///F/644/N", "atom2_id": "///F/700/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7966, "atom2_serNum": 8949, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///F/664/N", "atom2_id": "///F/791/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7986, "atom2_serNum": 8013, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///F/666/O", "atom2_id": "///F/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7993, "atom2_serNum": 8022, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///F/667/O", "atom2_id": "///F/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 8002, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/668/O", "atom2_id": "///F/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 8009, "atom2_serNum": 8038, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///F/669/O", "atom2_id": "///F/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 8016, "atom2_serNum": 8046, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///F/670/O", "atom2_id": "///F/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 8025, "atom2_serNum": 8055, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///F/671/O", "atom2_id": "///F/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 8033, "atom2_serNum": 8063, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///F/672/O", "atom2_id": "///F/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 8041, "atom2_serNum": 8071, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/673/O", "atom2_id": "///F/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 8074, "atom2_serNum": 8090, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///F/677/O", "atom2_id": "///F/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 8085, "atom2_serNum": 8112, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///F/678/O", "atom2_id": "///F/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 8088, "atom2_serNum": 8097, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///F/678/OD1", "atom2_id": "///F/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 8093, "atom2_serNum": 8120, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///F/679/O", "atom2_id": "///F/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 8100, "atom2_serNum": 8129, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///F/680/O", "atom2_id": "///F/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 8109, "atom2_serNum": 8138, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///F/681/O", "atom2_id": "///F/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 8115, "atom2_serNum": 8143, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///F/682/O", "atom2_id": "///F/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 8123, "atom2_serNum": 8143, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/683/O", "atom2_id": "///F/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 8123, "atom2_serNum": 8151, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///F/683/O", "atom2_id": "///F/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 8132, "atom2_serNum": 8151, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///F/684/O", "atom2_id": "///F/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 8141, "atom2_serNum": 9582, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///F/685/O", "atom2_id": "///F/865/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 8146, "atom2_serNum": 8167, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///F/686/O", "atom2_id": "///F/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 8146, "atom2_serNum": 8179, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///F/686/O", "atom2_id": "///F/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 8154, "atom2_serNum": 8179, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///F/687/O", "atom2_id": "///F/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 8165, "atom2_serNum": 9583, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/688/OE1", "atom2_id": "///F/865/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 8178, "atom2_serNum": 8784, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///F/689/OH", "atom2_id": "///F/767/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 8182, "atom2_serNum": 8596, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/690/O", "atom2_id": "///F/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 8196, "atom2_serNum": 8582, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///F/692/N", "atom2_id": "///F/741/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 8203, "atom2_serNum": 8229, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///F/692/OD2", "atom2_id": "///F/695/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 8224, "atom2_serNum": 8253, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///F/695/O", "atom2_id": "///F/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 8241, "atom2_serNum": 8883, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///F/697/O", "atom2_id": "///F/779/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 8256, "atom2_serNum": 8266, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///F/699/O", "atom2_id": "///F/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 8266, "atom2_serNum": 8825, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///F/701/N", "atom2_id": "///F/772/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 8277, "atom2_serNum": 8309, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///F/702/O", "atom2_id": "///F/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 8279, "atom2_serNum": 8289, "donAcc_type": "acceptable", "distance": 3.439, "atom1_id": "///F/702/OG", "atom2_id": "///F/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 8283, "atom2_serNum": 8317, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///F/703/O", "atom2_id": "///F/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 8292, "atom2_serNum": 8326, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///F/704/O", "atom2_id": "///F/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 8303, "atom2_serNum": 8331, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///F/705/O", "atom2_id": "///F/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 8308, "atom2_serNum": 8566, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/705/NE2", "atom2_id": "///F/739/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 8312, "atom2_serNum": 8336, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///F/706/O", "atom2_id": "///F/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 8320, "atom2_serNum": 8348, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///F/707/O", "atom2_id": "///F/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 8320, "atom2_serNum": 8353, "donAcc_type": "acceptable", "distance": 2.833, "atom1_id": "///F/707/O", "atom2_id": "///F/711/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 8329, "atom2_serNum": 8354, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///F/708/O", "atom2_id": "///F/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 8334, "atom2_serNum": 8362, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///F/709/O", "atom2_id": "///F/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 8339, "atom2_serNum": 8370, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///F/710/O", "atom2_id": "///F/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 8347, "atom2_serNum": 8777, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///F/710/OH", "atom2_id": "///F/766/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 8351, "atom2_serNum": 8375, "donAcc_type": "acceptable", "distance": 2.645, "atom1_id": "///F/711/O", "atom2_id": "///F/714/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 8351, "atom2_serNum": 8376, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///F/711/O", "atom2_id": "///F/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 8357, "atom2_serNum": 8385, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///F/712/O", "atom2_id": "///F/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 8365, "atom2_serNum": 8392, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///F/713/O", "atom2_id": "///F/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 8373, "atom2_serNum": 8401, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///F/714/O", "atom2_id": "///F/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 8375, "atom2_serNum": 9710, "donAcc_type": "acceptable", "distance": 3.538, "atom1_id": "///F/714/OG", "atom2_id": "///F/883/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 8379, "atom2_serNum": 8410, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/715/O", "atom2_id": "///F/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 8388, "atom2_serNum": 8415, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///F/716/O", "atom2_id": "///F/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 8395, "atom2_serNum": 8422, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///F/717/O", "atom2_id": "///F/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 8395, "atom2_serNum": 8427, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///F/717/O", "atom2_id": "///F/721/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 8404, "atom2_serNum": 8427, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///F/718/O", "atom2_id": "///F/721/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 8413, "atom2_serNum": 8441, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/719/O", "atom2_id": "///F/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 8418, "atom2_serNum": 8437, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///F/720/O", "atom2_id": "///F/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 8450, "atom2_serNum": 8476, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/725/O", "atom2_id": "///F/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 8456, "atom2_serNum": 8484, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///F/726/O", "atom2_id": "///F/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 8464, "atom2_serNum": 8492, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///F/727/O", "atom2_id": "///F/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 8470, "atom2_serNum": 8500, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///F/728/O", "atom2_id": "///F/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 8479, "atom2_serNum": 8508, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///F/729/O", "atom2_id": "///F/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 8479, "atom2_serNum": 8513, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///F/729/O", "atom2_id": "///F/733/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8487, "atom2_serNum": 8514, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/730/O", "atom2_id": "///F/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 8495, "atom2_serNum": 8522, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///F/731/O", "atom2_id": "///F/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8503, "atom2_serNum": 8533, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///F/732/O", "atom2_id": "///F/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 8511, "atom2_serNum": 8544, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/733/O", "atom2_id": "///F/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 8513, "atom2_serNum": 8667, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///F/733/OG", "atom2_id": "///F/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 8517, "atom2_serNum": 8556, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///F/734/O", "atom2_id": "///F/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 8517, "atom2_serNum": 8561, "donAcc_type": "acceptable", "distance": 2.405, "atom1_id": "///F/734/O", "atom2_id": "///F/738/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 8525, "atom2_serNum": 8563, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///F/735/O", "atom2_id": "///F/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 8536, "atom2_serNum": 8571, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///F/736/O", "atom2_id": "///F/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8555, "atom2_serNum": 8655, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///F/737/OH", "atom2_id": "///F/750/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 8555, "atom2_serNum": 8739, "donAcc_type": "acceptable", "distance": 3.418, "atom1_id": "///F/737/OH", "atom2_id": "///F/761/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8574, "atom2_serNum": 8586, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///F/740/O", "atom2_id": "///F/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8574, "atom2_serNum": 8592, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///F/740/O", "atom2_id": "///F/742/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8586, "atom2_serNum": 8592, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///F/742/N", "atom2_id": "///F/742/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8602, "atom2_serNum": 8615, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///F/743/OD1", "atom2_id": "///F/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8607, "atom2_serNum": 8627, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///F/744/O", "atom2_id": "///F/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8662, "atom2_serNum": 8675, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///F/751/O", "atom2_id": "///F/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8675, "atom2_serNum": 8681, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///F/753/N", "atom2_id": "///F/753/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8681, "atom2_serNum": 8683, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/753/OD1", "atom2_id": "///F/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8683, "atom2_serNum": 8709, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///F/754/N", "atom2_id": "///F/757/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8696, "atom2_serNum": 8703, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///F/756/N", "atom2_id": "///F/756/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8699, "atom2_serNum": 8726, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///F/756/O", "atom2_id": "///F/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8703, "atom2_serNum": 8704, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/756/OD2", "atom2_id": "///F/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8707, "atom2_serNum": 8731, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///F/757/O", "atom2_id": "///F/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8713, "atom2_serNum": 8740, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///F/758/O", "atom2_id": "///F/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8720, "atom2_serNum": 8745, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///F/759/O", "atom2_id": "///F/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8729, "atom2_serNum": 8754, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///F/760/O", "atom2_id": "///F/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8734, "atom2_serNum": 8762, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///F/761/O", "atom2_id": "///F/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8743, "atom2_serNum": 8770, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///F/762/O", "atom2_id": "///F/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8748, "atom2_serNum": 8778, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///F/763/O", "atom2_id": "///F/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8757, "atom2_serNum": 8786, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///F/764/O", "atom2_id": "///F/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8765, "atom2_serNum": 8794, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/765/O", "atom2_id": "///F/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8773, "atom2_serNum": 8802, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///F/766/O", "atom2_id": "///F/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8773, "atom2_serNum": 8808, "donAcc_type": "questionable", "distance": 3.002, "atom1_id": "///F/766/O", "atom2_id": "///F/770/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8781, "atom2_serNum": 8810, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///F/767/O", "atom2_id": "///F/771/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8785, "atom2_serNum": 9604, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///F/767/ND2", "atom2_id": "///F/868/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8789, "atom2_serNum": 8818, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///F/768/O", "atom2_id": "///F/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8797, "atom2_serNum": 8827, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/769/O", "atom2_id": "///F/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8802, "atom2_serNum": 8808, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///F/770/N", "atom2_id": "///F/770/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8805, "atom2_serNum": 8834, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/770/O", "atom2_id": "///F/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8809, "atom2_serNum": 9679, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///F/770/OD2", "atom2_id": "///F/878/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8813, "atom2_serNum": 8839, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///F/771/O", "atom2_id": "///F/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8821, "atom2_serNum": 8851, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///F/772/O", "atom2_id": "///F/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8821, "atom2_serNum": 8856, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///F/772/O", "atom2_id": "///F/776/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8830, "atom2_serNum": 8857, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///F/773/O", "atom2_id": "///F/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8837, "atom2_serNum": 8865, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///F/774/O", "atom2_id": "///F/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8842, "atom2_serNum": 8873, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///F/775/O", "atom2_id": "///F/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8860, "atom2_serNum": 8994, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///F/777/O", "atom2_id": "///F/796/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8868, "atom2_serNum": 8994, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///F/778/O", "atom2_id": "///F/796/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8895, "atom2_serNum": 8902, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///F/782/O", "atom2_id": "///F/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8905, "atom2_serNum": 8912, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///F/784/O", "atom2_id": "///F/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8925, "atom2_serNum": 8950, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///F/788/O", "atom2_id": "///F/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8930, "atom2_serNum": 8957, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///F/789/O", "atom2_id": "///F/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8937, "atom2_serNum": 8965, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///F/790/O", "atom2_id": "///F/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8945, "atom2_serNum": 8977, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///F/791/O", "atom2_id": "///F/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8953, "atom2_serNum": 8986, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///F/792/O", "atom2_id": "///F/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8968, "atom2_serNum": 9003, "donAcc_type": "standard", "distance": 3.823, "atom1_id": "///F/794/O", "atom2_id": "///F/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8976, "atom2_serNum": 9027, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///F/794/OH", "atom2_id": "///F/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 9006, "atom2_serNum": 9370, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///F/798/O", "atom2_id": "///F/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 9019, "atom2_serNum": 9353, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///F/800/N", "atom2_id": "///F/840/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 9022, "atom2_serNum": 9350, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///F/800/O", "atom2_id": "///F/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 9035, "atom2_serNum": 9336, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///F/802/N", "atom2_id": "///F/838/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 9038, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///F/802/O", "atom2_id": "///F/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 9051, "atom2_serNum": 9317, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///F/804/N", "atom2_id": "///F/836/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 9061, "atom2_serNum": 9085, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///F/805/O", "atom2_id": "///F/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 9069, "atom2_serNum": 9149, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/806/O", "atom2_id": "///F/815/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 9077, "atom2_serNum": 9084, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///F/807/N", "atom2_id": "///F/807/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 9088, "atom2_serNum": 9114, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///F/808/O", "atom2_id": "///F/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 9094, "atom2_serNum": 9123, "donAcc_type": "standard", "distance": 3.678, "atom1_id": "///F/809/O", "atom2_id": "///F/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 9103, "atom2_serNum": 9131, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///F/810/O", "atom2_id": "///F/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 9107, "atom2_serNum": 10597, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///F/810/OE1", "atom2_id": "///F/1001/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 9112, "atom2_serNum": 9139, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///F/811/O", "atom2_id": "///F/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 9117, "atom2_serNum": 9150, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///F/812/O", "atom2_id": "///F/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 9126, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///F/813/O", "atom2_id": "///F/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 9134, "atom2_serNum": 9171, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///F/814/O", "atom2_id": "///F/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 9142, "atom2_serNum": 9178, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/815/O", "atom2_id": "///F/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 9153, "atom2_serNum": 9187, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///F/816/O", "atom2_id": "///F/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 9153, "atom2_serNum": 9194, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///F/816/O", "atom2_id": "///F/820/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 9162, "atom2_serNum": 9200, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///F/817/O", "atom2_id": "///F/821/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 9170, "atom2_serNum": 9526, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///F/817/OH", "atom2_id": "///F/859/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 9170, "atom2_serNum": 9833, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///F/817/OH", "atom2_id": "///F/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 9193, "atom2_serNum": 10360, "donAcc_type": "questionable", "distance": 3.090, "atom1_id": "///F/820/OD1", "atom2_id": "///F/971/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 9198, "atom2_serNum": 9200, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///F/821/O", "atom2_id": "///F/821/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 9198, "atom2_serNum": 9846, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///F/821/O", "atom2_id": "///F/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 9200, "atom2_serNum": 9833, "donAcc_type": "acceptable", "distance": 3.750, "atom1_id": "///F/821/OG1", "atom2_id": "///F/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 9200, "atom2_serNum": 9846, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///F/821/OG1", "atom2_id": "///F/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 9211, "atom2_serNum": 9234, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/822/NE2", "atom2_id": "///F/826/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 9211, "atom2_serNum": 9257, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///F/822/NE2", "atom2_id": "///F/829/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 9220, "atom2_serNum": 9222, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///F/824/O", "atom2_id": "///F/824/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 9227, "atom2_serNum": 9241, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///F/825/O", "atom2_id": "///F/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 9229, "atom2_serNum": 10467, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///F/825/OG1", "atom2_id": "///F/986/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 9237, "atom2_serNum": 9858, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///F/826/ND1", "atom2_id": "///F/902/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 9241, "atom2_serNum": 9247, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///F/827/N", "atom2_id": "///F/827/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 9265, "atom2_serNum": 9856, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///F/829/OH", "atom2_id": "///F/902/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 9265, "atom2_serNum": 9886, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///F/829/OH", "atom2_id": "///F/906/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 9266, "atom2_serNum": 10654, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/830/N", "atom2_id": "///F/1008/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 9269, "atom2_serNum": 10651, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/830/O", "atom2_id": "///F/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 9282, "atom2_serNum": 10634, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///F/832/N", "atom2_id": "///F/1006/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 9285, "atom2_serNum": 9298, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///F/832/O", "atom2_id": "///F/834/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 9285, "atom2_serNum": 10631, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/832/O", "atom2_id": "///F/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 9298, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///F/834/N", "atom2_id": "///F/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 9306, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///F/835/N", "atom2_id": "///F/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 9309, "atom2_serNum": 10614, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///F/835/O", "atom2_id": "///F/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 9322, "atom2_serNum": 10601, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///F/837/N", "atom2_id": "///F/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 9325, "atom2_serNum": 10598, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///F/837/O", "atom2_id": "///F/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 9342, "atom2_serNum": 10580, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///F/839/N", "atom2_id": "///F/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 9345, "atom2_serNum": 10572, "donAcc_type": "questionable", "distance": 3.114, "atom1_id": "///F/839/O", "atom2_id": "///F/999/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 9362, "atom2_serNum": 9379, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///F/841/O", "atom2_id": "///F/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 9368, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///F/841/NH1", "atom2_id": "///F/873/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 9368, "atom2_serNum": 9645, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///F/841/NH1", "atom2_id": "///F/874/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 9382, "atom2_serNum": 9407, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///F/843/O", "atom2_id": "///F/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 9386, "atom2_serNum": 9418, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///F/844/O", "atom2_id": "///F/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 9390, "atom2_serNum": 10567, "donAcc_type": "questionable", "distance": 3.228, "atom1_id": "///F/844/OE1", "atom2_id": "///F/998/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 9391, "atom2_serNum": 9416, "donAcc_type": "standard", "distance": 3.899, "atom1_id": "///F/844/OE2", "atom2_id": "///F/847/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 9395, "atom2_serNum": 9430, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///F/845/O", "atom2_id": "///F/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 9421, "atom2_serNum": 9446, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///F/848/O", "atom2_id": "///F/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 9421, "atom2_serNum": 9457, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///F/848/O", "atom2_id": "///F/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 9429, "atom2_serNum": 10012, "donAcc_type": "acceptable", "distance": 3.242, "atom1_id": "///F/848/OH", "atom2_id": "///F/923/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 9433, "atom2_serNum": 9457, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///F/849/O", "atom2_id": "///F/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 9442, "atom2_serNum": 9466, "donAcc_type": "standard", "distance": 3.636, "atom1_id": "///F/850/O", "atom2_id": "///F/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 9465, "atom2_serNum": 10012, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///F/852/NZ", "atom2_id": "///F/923/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 9478, "atom2_serNum": 9510, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///F/854/O", "atom2_id": "///F/857/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 9496, "atom2_serNum": 10025, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///F/856/O", "atom2_id": "///F/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 9496, "atom2_serNum": 10033, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///F/856/O", "atom2_id": "///F/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9499, "atom2_serNum": 10036, "donAcc_type": "questionable", "distance": 3.009, "atom1_id": "///F/856/OD1", "atom2_id": "///F/927/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9504, "atom2_serNum": 10335, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///F/857/O", "atom2_id": "///F/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 9508, "atom2_serNum": 10012, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///F/857/NE", "atom2_id": "///F/923/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9511, "atom2_serNum": 10327, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///F/857/NH2", "atom2_id": "///F/966/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9512, "atom2_serNum": 10016, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///F/858/N", "atom2_id": "///F/924/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9515, "atom2_serNum": 10013, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///F/858/O", "atom2_id": "///F/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9522, "atom2_serNum": 10496, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///F/858/NH2", "atom2_id": "///F/989/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9523, "atom2_serNum": 10338, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///F/859/N", "atom2_id": "///F/968/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9531, "atom2_serNum": 10003, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///F/860/N", "atom2_id": "///F/922/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9534, "atom2_serNum": 10000, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///F/860/O", "atom2_id": "///F/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9539, "atom2_serNum": 9828, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///F/861/N", "atom2_id": "///F/898/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 9542, "atom2_serNum": 9825, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///F/861/O", "atom2_id": "///F/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9553, "atom2_serNum": 9987, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///F/862/N", "atom2_id": "///F/920/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 9556, "atom2_serNum": 9984, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///F/862/O", "atom2_id": "///F/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 9559, "atom2_serNum": 9805, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///F/862/ND1", "atom2_id": "///F/896/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9572, "atom2_serNum": 9605, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///F/864/OG", "atom2_id": "///F/868/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9576, "atom2_serNum": 9598, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///F/865/O", "atom2_id": "///F/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9576, "atom2_serNum": 9606, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///F/865/O", "atom2_id": "///F/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9587, "atom2_serNum": 9589, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///F/866/O", "atom2_id": "///F/866/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9601, "atom2_serNum": 9622, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///F/868/O", "atom2_id": "///F/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9601, "atom2_serNum": 9626, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///F/868/O", "atom2_id": "///F/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9620, "atom2_serNum": 9647, "donAcc_type": "acceptable", "distance": 3.484, "atom1_id": "///F/870/O", "atom2_id": "///F/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9625, "atom2_serNum": 9647, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///F/871/O", "atom2_id": "///F/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9625, "atom2_serNum": 9648, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///F/871/O", "atom2_id": "///F/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9629, "atom2_serNum": 9657, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///F/872/O", "atom2_id": "///F/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9660, "atom2_serNum": 9678, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///F/876/O", "atom2_id": "///F/878/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9696, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///F/881/O", "atom2_id": "///F/893/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9719, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///F/884/O", "atom2_id": "///F/893/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9731, "atom2_serNum": 9746, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///F/886/O", "atom2_id": "///F/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9761, "atom2_serNum": 10106, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///F/890/O", "atom2_id": "///F/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9766, "atom2_serNum": 9813, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///F/891/N", "atom2_id": "///F/896/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9769, "atom2_serNum": 10523, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///F/891/O", "atom2_id": "///F/992/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9780, "atom2_serNum": 9813, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///F/892/O", "atom2_id": "///F/896/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9794, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///F/895/N", "atom2_id": "///F/991/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9797, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///F/895/O", "atom2_id": "///F/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9814, "atom2_serNum": 10488, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///F/897/N", "atom2_id": "///F/989/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9817, "atom2_serNum": 10485, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///F/897/O", "atom2_id": "///F/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9836, "atom2_serNum": 9838, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///F/899/OD1", "atom2_id": "///F/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9837, "atom2_serNum": 10475, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///F/899/OD2", "atom2_id": "///F/987/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9837, "atom2_serNum": 10496, "donAcc_type": "acceptable", "distance": 3.341, "atom1_id": "///F/899/OD2", "atom2_id": "///F/989/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9841, "atom2_serNum": 9868, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///F/900/O", "atom2_id": "///F/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9849, "atom2_serNum": 9874, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///F/901/O", "atom2_id": "///F/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9856, "atom2_serNum": 9879, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///F/902/O", "atom2_id": "///F/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9856, "atom2_serNum": 9886, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///F/902/O", "atom2_id": "///F/906/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9867, "atom2_serNum": 10484, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///F/903/NZ", "atom2_id": "///F/988/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9871, "atom2_serNum": 9887, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///F/904/O", "atom2_id": "///F/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9877, "atom2_serNum": 9899, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///F/905/O", "atom2_id": "///F/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9922, "atom2_serNum": 9944, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///F/911/N", "atom2_id": "///F/914/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9927, "atom2_serNum": 9941, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///F/911/OG", "atom2_id": "///F/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9928, "atom2_serNum": 9935, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///F/912/N", "atom2_id": "///F/912/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9936, "atom2_serNum": 10684, "donAcc_type": "acceptable", "distance": 3.645, "atom1_id": "///F/912/NE2", "atom2_id": "///F/1011/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9964, "atom2_serNum": 10626, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/917/N", "atom2_id": "///F/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9967, "atom2_serNum": 10623, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///F/917/O", "atom2_id": "///F/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9976, "atom2_serNum": 10609, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///F/919/N", "atom2_id": "///F/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9979, "atom2_serNum": 10606, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///F/919/O", "atom2_id": "///F/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9992, "atom2_serNum": 10589, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///F/921/N", "atom2_id": "///F/1001/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9995, "atom2_serNum": 10577, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///F/921/O", "atom2_id": "///F/1000/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9995, "atom2_serNum": 10586, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/921/O", "atom2_id": "///F/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 10003, "atom2_serNum": 10013, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///F/922/O", "atom2_id": "///F/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 10004, "atom2_serNum": 10564, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///F/923/N", "atom2_id": "///F/998/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 10011, "atom2_serNum": 10585, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///F/923/OE1", "atom2_id": "///F/1000/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 10016, "atom2_serNum": 10025, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///F/924/O", "atom2_id": "///F/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 10020, "atom2_serNum": 10548, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///F/925/N", "atom2_id": "///F/996/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 10028, "atom2_serNum": 10197, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///F/926/O", "atom2_id": "///F/947/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 10036, "atom2_serNum": 10045, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///F/927/O", "atom2_id": "///F/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 10037, "atom2_serNum": 10188, "donAcc_type": "acceptable", "distance": 3.557, "atom1_id": "///F/928/N", "atom2_id": "///F/946/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 10040, "atom2_serNum": 10182, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///F/928/O", "atom2_id": "///F/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 10053, "atom2_serNum": 10195, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///F/930/N", "atom2_id": "///F/947/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 10056, "atom2_serNum": 10205, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///F/930/O", "atom2_id": "///F/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 10074, "atom2_serNum": 10208, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///F/932/N", "atom2_id": "///F/949/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 10077, "atom2_serNum": 10218, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///F/932/O", "atom2_id": "///F/951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 10085, "atom2_serNum": 10432, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///F/933/O", "atom2_id": "///F/982/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 10101, "atom2_serNum": 10439, "donAcc_type": "acceptable", "distance": 3.906, "atom1_id": "///F/935/N", "atom2_id": "///F/983/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 10109, "atom2_serNum": 10122, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///F/936/O", "atom2_id": "///F/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 10156, "atom2_serNum": 10173, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///F/942/O", "atom2_id": "///F/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 10185, "atom2_serNum": 10553, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///F/946/O", "atom2_id": "///F/996/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 10198, "atom2_serNum": 10500, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/948/N", "atom2_id": "///F/990/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 10201, "atom2_serNum": 10497, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///F/948/O", "atom2_id": "///F/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 10214, "atom2_serNum": 10479, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/950/N", "atom2_id": "///F/988/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 10217, "atom2_serNum": 10476, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///F/950/O", "atom2_id": "///F/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 10221, "atom2_serNum": 10432, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///F/951/O", "atom2_id": "///F/982/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 10226, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///F/952/N", "atom2_id": "///F/987/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 10229, "atom2_serNum": 10399, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///F/952/O", "atom2_id": "///F/977/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 10230, "atom2_serNum": 10443, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///F/953/N", "atom2_id": "///F/984/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 10233, "atom2_serNum": 10394, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///F/953/O", "atom2_id": "///F/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 10233, "atom2_serNum": 10399, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///F/953/O", "atom2_id": "///F/977/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 10238, "atom2_serNum": 10414, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///F/953/NZ", "atom2_id": "///F/980/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 10239, "atom2_serNum": 10451, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///F/954/N", "atom2_id": "///F/985/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 10246, "atom2_serNum": 10383, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///F/955/N", "atom2_id": "///F/975/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 10249, "atom2_serNum": 10380, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/955/O", "atom2_id": "///F/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 10251, "atom2_serNum": 10475, "donAcc_type": "acceptable", "distance": 3.565, "atom1_id": "///F/955/OG1", "atom2_id": "///F/987/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 10256, "atom2_serNum": 10268, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///F/956/O", "atom2_id": "///F/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 10260, "atom2_serNum": 10372, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/957/N", "atom2_id": "///F/973/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 10263, "atom2_serNum": 10281, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///F/957/O", "atom2_id": "///F/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 10263, "atom2_serNum": 10293, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///F/957/O", "atom2_id": "///F/961/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 10266, "atom2_serNum": 10280, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///F/957/OD1", "atom2_id": "///F/959/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 10267, "atom2_serNum": 10280, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///F/957/OD2", "atom2_id": "///F/959/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 10294, "atom2_serNum": 10346, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///F/962/N", "atom2_id": "///F/969/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 10297, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///F/962/O", "atom2_id": "///F/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 10308, "atom2_serNum": 10331, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///F/964/N", "atom2_id": "///F/967/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 10331, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///F/967/O", "atom2_id": "///F/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 10335, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///F/968/N", "atom2_id": "///F/968/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 10346, "atom2_serNum": 10357, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/969/O", "atom2_id": "///F/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 10393, "atom2_serNum": 10417, "donAcc_type": "acceptable", "distance": 3.970, "atom1_id": "///F/976/OG", "atom2_id": "///F/980/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 10399, "atom2_serNum": 10407, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///F/977/OG", "atom2_id": "///F/979/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 10399, "atom2_serNum": 10417, "donAcc_type": "acceptable", "distance": 3.428, "atom1_id": "///F/977/OG", "atom2_id": "///F/980/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 10432, "atom2_serNum": 10440, "donAcc_type": "acceptable", "distance": 3.279, "atom1_id": "///F/982/OG1", "atom2_id": "///F/984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 10475, "atom2_serNum": 10496, "donAcc_type": "acceptable", "distance": 3.318, "atom1_id": "///F/987/ND2", "atom2_id": "///F/989/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 10527, "atom2_serNum": 10545, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///F/993/O", "atom2_id": "///F/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 10700, "atom2_serNum": 11745, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///M/1/O6", "atom2_id": "///N/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1170, "atom1_serNum": 10701, "atom2_serNum": 11743, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///M/1/N1", "atom2_id": "///N/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1171, "atom1_serNum": 10703, "atom2_serNum": 11742, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///M/1/N2", "atom2_id": "///N/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1172, "atom1_serNum": 10719, "atom2_serNum": 11726, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///M/2/O2", "atom2_id": "///N/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1173, "atom1_serNum": 10720, "atom2_serNum": 11724, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///M/2/N3", "atom2_id": "///N/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1174, "atom1_serNum": 10722, "atom2_serNum": 11723, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///M/2/N4", "atom2_id": "///N/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1175, "atom1_serNum": 10738, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///M/3/O2", "atom2_id": "///N/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1176, "atom1_serNum": 10739, "atom2_serNum": 11702, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///M/3/N3", "atom2_id": "///N/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1177, "atom1_serNum": 10741, "atom2_serNum": 11701, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///M/3/N4", "atom2_id": "///N/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1178, "atom1_serNum": 10758, "atom2_serNum": 11681, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///M/4/N3", "atom2_id": "///N/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1179, "atom1_serNum": 10760, "atom2_serNum": 11680, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///M/4/O4", "atom2_id": "///N/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1180, "atom1_serNum": 10780, "atom2_serNum": 11638, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///M/5/N6", "atom2_id": "///N/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1181, "atom1_serNum": 10780, "atom2_serNum": 11660, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///M/5/N6", "atom2_id": "///N/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1182, "atom1_serNum": 10781, "atom2_serNum": 11658, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///M/5/N1", "atom2_id": "///N/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1183, "atom1_serNum": 10798, "atom2_serNum": 11641, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///M/6/O2", "atom2_id": "///N/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1184, "atom1_serNum": 10799, "atom2_serNum": 11641, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///M/6/N3", "atom2_id": "///N/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1185, "atom1_serNum": 10801, "atom2_serNum": 11616, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///M/6/N4", "atom2_id": "///N/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1186, "atom1_serNum": 10817, "atom2_serNum": 11619, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///M/7/O2", "atom2_id": "///N/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1187, "atom1_serNum": 10818, "atom2_serNum": 11617, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///M/7/N3", "atom2_id": "///N/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1188, "atom1_serNum": 10820, "atom2_serNum": 11616, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///M/7/N4", "atom2_id": "///N/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1189, "atom1_serNum": 10839, "atom2_serNum": 11597, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///M/8/O6", "atom2_id": "///N/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1190, "atom1_serNum": 10840, "atom2_serNum": 11595, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///M/8/N1", "atom2_id": "///N/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1191, "atom1_serNum": 10842, "atom2_serNum": 11594, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///M/8/N2", "atom2_id": "///N/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1192, "atom1_serNum": 10861, "atom2_serNum": 11578, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///M/9/O6", "atom2_id": "///N/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1193, "atom1_serNum": 10862, "atom2_serNum": 11576, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///M/9/N1", "atom2_id": "///N/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1194, "atom1_serNum": 10864, "atom2_serNum": 11575, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///M/9/N2", "atom2_id": "///N/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1195, "atom1_serNum": 10881, "atom2_serNum": 11558, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///M/10/N3", "atom2_id": "///N/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1196, "atom1_serNum": 10883, "atom2_serNum": 11557, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///M/10/O4", "atom2_id": "///N/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1197, "atom1_serNum": 10901, "atom2_serNum": 11537, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///M/11/N3", "atom2_id": "///N/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1198, "atom1_serNum": 10903, "atom2_serNum": 11536, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///M/11/O4", "atom2_id": "///N/16/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1199, "atom1_serNum": 10920, "atom2_serNum": 11517, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///M/12/O2", "atom2_id": "///N/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1200, "atom1_serNum": 10921, "atom2_serNum": 11515, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///M/12/N3", "atom2_id": "///N/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1201, "atom1_serNum": 10923, "atom2_serNum": 11514, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///M/12/N4", "atom2_id": "///N/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1202, "atom1_serNum": 10942, "atom2_serNum": 11495, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///M/13/O6", "atom2_id": "///N/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1203, "atom1_serNum": 10943, "atom2_serNum": 11493, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///M/13/N1", "atom2_id": "///N/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1204, "atom1_serNum": 10945, "atom2_serNum": 11492, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///M/13/N2", "atom2_id": "///N/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1205, "atom1_serNum": 10961, "atom2_serNum": 11476, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///M/14/O2", "atom2_id": "///N/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1206, "atom1_serNum": 10962, "atom2_serNum": 11474, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///M/14/N3", "atom2_id": "///N/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1207, "atom1_serNum": 10964, "atom2_serNum": 11473, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///M/14/N4", "atom2_id": "///N/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1208, "atom1_serNum": 10983, "atom2_serNum": 11454, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///M/15/O6", "atom2_id": "///N/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1209, "atom1_serNum": 10984, "atom2_serNum": 11452, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///M/15/N1", "atom2_id": "///N/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1210, "atom1_serNum": 10986, "atom2_serNum": 11451, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///M/15/N2", "atom2_id": "///N/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1211, "atom1_serNum": 11005, "atom2_serNum": 11434, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///M/16/N6", "atom2_id": "///N/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1212, "atom1_serNum": 11006, "atom2_serNum": 11432, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///M/16/N1", "atom2_id": "///N/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1213, "atom1_serNum": 11026, "atom2_serNum": 11414, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///M/17/N6", "atom2_id": "///N/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1214, "atom1_serNum": 11027, "atom2_serNum": 11412, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///M/17/N1", "atom2_id": "///N/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1215, "atom1_serNum": 11044, "atom2_serNum": 11395, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///M/18/O2", "atom2_id": "///N/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1216, "atom1_serNum": 11045, "atom2_serNum": 11393, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///M/18/N3", "atom2_id": "///N/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1217, "atom1_serNum": 11047, "atom2_serNum": 11392, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///M/18/N4", "atom2_id": "///N/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1218, "atom1_serNum": 11063, "atom2_serNum": 11373, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///M/19/O2", "atom2_id": "///N/8/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1219, "atom1_serNum": 11064, "atom2_serNum": 11371, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///M/19/N3", "atom2_id": "///N/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1220, "atom1_serNum": 11066, "atom2_serNum": 11370, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///M/19/N4", "atom2_id": "///N/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1221, "atom1_serNum": 11088, "atom2_serNum": 11348, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///M/20/N2", "atom2_id": "///N/7/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1222, "atom1_serNum": 11107, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 3.814, "atom1_id": "///M/21/O6", "atom2_id": "///N/6/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1223, "atom1_serNum": 11108, "atom2_serNum": 11330, "donAcc_type": "standard", "distance": 3.713, "atom1_id": "///M/21/N1", "atom2_id": "///N/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1224, "atom1_serNum": 11110, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///M/21/N2", "atom2_id": "///N/6/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1225, "atom1_serNum": 11127, "atom2_serNum": 11312, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///M/22/N3", "atom2_id": "///N/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1226, "atom1_serNum": 11129, "atom2_serNum": 11311, "donAcc_type": "standard", "distance": 3.670, "atom1_id": "///M/22/O4", "atom2_id": "///N/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1227, "atom1_serNum": 11149, "atom2_serNum": 11291, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///M/23/N6", "atom2_id": "///N/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1228, "atom1_serNum": 11150, "atom2_serNum": 11289, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///M/23/N1", "atom2_id": "///N/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1229, "atom1_serNum": 11170, "atom2_serNum": 11253, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///M/24/O6", "atom2_id": "///N/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1230, "atom1_serNum": 11170, "atom2_serNum": 11272, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///M/24/O6", "atom2_id": "///N/3/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1231, "atom1_serNum": 11171, "atom2_serNum": 11270, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///M/24/N1", "atom2_id": "///N/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1232, "atom1_serNum": 11173, "atom2_serNum": 11269, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///M/24/N2", "atom2_id": "///N/3/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1233, "atom1_serNum": 11192, "atom2_serNum": 11253, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///M/25/O6", "atom2_id": "///N/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1234, "atom1_serNum": 11193, "atom2_serNum": 11251, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///M/25/N1", "atom2_id": "///N/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1235, "atom1_serNum": 11195, "atom2_serNum": 11250, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///M/25/N2", "atom2_id": "///N/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1236, "atom1_serNum": 11211, "atom2_serNum": 11234, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///M/26/O2", "atom2_id": "///N/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1237, "atom1_serNum": 11212, "atom2_serNum": 11232, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///M/26/N3", "atom2_id": "///N/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1238, "atom1_serNum": 11214, "atom2_serNum": 11231, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///M/26/N4", "atom2_id": "///N/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4opx", "num_aaChains": 4, "aaChains": "A=222,C=456,D=222,F=456", "num_naChains": 2, "naChains": "M=26,N=26", "num_atoms": 11744, "num_waters": 0, "num_metals": 4, "metals_desc": "Zn=4", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }