{ "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.407, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.689, "chi2": -109.378, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.807, "C1C1_dist": 10.258, "N1N9_dist": 8.576, "C6C8_dist": 9.496, "CNNC_torsion": -2.744, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 11.996, "planarity": 0.214, "simple_Shear": -1.100, "simple_Stretch": -0.427, "simple_Buckle": -11.310, "simple_Propeller": 3.999, "bp_simpleParams": [ -1.100, -0.427, 0.250, -11.310, 3.999, 0.077 ], "bp_params": [ -1.048, -0.542, 0.250, -11.675, 2.757, 0.076 ], "frame": { "rmsd": null, "origin": [ 42.916, -16.628, 71.384 ], "x_axis": [ -0.856, -0.132, 0.499 ], "y_axis": [ -0.113, 0.991, 0.068 ], "z_axis": [ -0.504, 0.002, -0.864 ], "quaternion": [ -0.260, -0.063, 0.963, 0.018 ] } }, { "index": 2, "nt1": "///D/3", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.774, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.566, "chi2": -111.344, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.934, "C1C1_dist": 10.612, "N1N9_dist": 9.054, "C6C8_dist": 10.145, "CNNC_torsion": -8.907, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.15]", "interBase_angle": 7.780, "planarity": 0.110, "simple_Shear": -1.060, "simple_Stretch": 0.269, "simple_Buckle": -7.617, "simple_Propeller": -1.583, "bp_simpleParams": [ -1.060, 0.269, 0.530, -7.617, -1.583, 6.217 ], "bp_params": [ -1.083, 0.149, 0.530, -7.394, -2.421, 6.206 ], "frame": { "rmsd": null, "origin": [ 41.156, -17.717, 68.747 ], "x_axis": [ -0.781, 0.372, 0.502 ], "y_axis": [ 0.322, 0.928, -0.187 ], "z_axis": [ -0.535, 0.016, -0.845 ], "quaternion": [ -0.275, 0.184, 0.943, -0.045 ] } }, { "index": 3, "nt1": "///D/4", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.673, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.588, "chi2": -110.783, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.022, "C1C1_dist": 11.112, "N1N9_dist": 9.455, "C6C8_dist": 10.414, "CNNC_torsion": -6.260, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.48]", "interBase_angle": 4.260, "planarity": 0.060, "simple_Shear": -1.324, "simple_Stretch": 0.467, "simple_Buckle": 1.586, "simple_Propeller": -3.954, "bp_simpleParams": [ -1.324, 0.467, 0.186, 1.586, -3.954, 1.619 ], "bp_params": [ -1.373, 0.294, 0.186, 2.077, -3.719, 1.619 ], "frame": { "rmsd": null, "origin": [ 39.544, -17.322, 66.191 ], "x_axis": [ -0.470, 0.837, 0.279 ], "y_axis": [ 0.683, 0.545, -0.485 ], "z_axis": [ -0.559, -0.037, -0.828 ], "quaternion": [ -0.248, 0.451, 0.843, -0.155 ] } }, { "index": 4, "nt1": "///D/5", "nt2": "///E/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.292, "conf1": "anti", "pucker1": "----", "lambda1": 50.993, "chi2": -139.545, "conf2": "anti", "pucker2": "----", "lambda2": 50.203, "C1C1_dist": 11.022, "N1N9_dist": 9.161, "C6C8_dist": 9.917, "CNNC_torsion": -12.461, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.82],N1(imino)-N3[3.06],N2(amino)-O2(carbonyl)[3.27]", "interBase_angle": 18.645, "planarity": 0.249, "simple_Shear": 0.009, "simple_Stretch": -0.009, "simple_Buckle": 15.554, "simple_Propeller": -10.283, "bp_simpleParams": [ 0.009, -0.009, 0.475, 15.554, -10.283, -8.195 ], "bp_params": [ 0.009, -0.009, 0.475, 15.585, -10.234, -8.153 ], "frame": { "rmsd": null, "origin": [ 38.210, -17.942, 63.431 ], "x_axis": [ -0.000, 1.000, -0.010 ], "y_axis": [ 0.866, -0.004, -0.500 ], "z_axis": [ -0.500, -0.009, -0.866 ], "quaternion": [ -0.180, 0.684, 0.682, -0.186 ] } }, { "index": 5, "nt1": "///D/6", "nt2": "///E/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.090, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.218, "chi2": -110.899, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.493, "C1C1_dist": 10.468, "N1N9_dist": 8.747, "C6C8_dist": 9.688, "CNNC_torsion": -3.733, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.50],N3-N1(imino)[2.65],N4(amino)-O6(carbonyl)[2.68]", "interBase_angle": 6.855, "planarity": 0.090, "simple_Shear": -0.437, "simple_Stretch": -0.318, "simple_Buckle": 4.986, "simple_Propeller": -4.704, "bp_simpleParams": [ -0.437, -0.318, 0.091, 4.986, -4.704, 0.219 ], "bp_params": [ -0.421, -0.339, 0.091, 5.211, -4.454, 0.218 ], "frame": { "rmsd": null, "origin": [ 36.114, -16.805, 60.629 ], "x_axis": [ 0.482, 0.842, -0.240 ], "y_axis": [ 0.696, -0.535, -0.479 ], "z_axis": [ -0.532, 0.064, -0.845 ], "quaternion": [ -0.160, 0.846, 0.455, -0.228 ] } }, { "index": 6, "nt1": "///D/7", "nt2": "///E/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.104, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.517, "chi2": -111.178, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.769, "C1C1_dist": 11.013, "N1N9_dist": 9.346, "C6C8_dist": 10.336, "CNNC_torsion": -13.784, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.49],N1(imino)-N3[3.31],N2(amino)-O2(carbonyl)[3.08],N2(amino)-N3[3.19]", "interBase_angle": 22.827, "planarity": 0.272, "simple_Shear": 0.685, "simple_Stretch": 0.413, "simple_Buckle": -13.765, "simple_Propeller": -18.210, "bp_simpleParams": [ 0.685, 0.413, 0.096, -13.765, -18.210, 3.084 ], "bp_params": [ 0.717, 0.354, 0.096, -15.212, -17.020, 3.092 ], "frame": { "rmsd": null, "origin": [ 33.803, -17.263, 56.773 ], "x_axis": [ 0.773, 0.263, -0.578 ], "y_axis": [ 0.202, -0.965, -0.169 ], "z_axis": [ -0.602, 0.014, -0.799 ], "quaternion": [ -0.049, 0.940, 0.124, -0.314 ] } }, { "index": 7, "nt1": "///D/8", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.719, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.612, "chi2": -143.284, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 43.191, "C1C1_dist": 10.848, "N1N9_dist": 8.947, "C6C8_dist": 9.650, "CNNC_torsion": -8.283, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.55],N1-N3(imino)[2.81]", "interBase_angle": 5.879, "planarity": 0.172, "simple_Shear": 1.130, "simple_Stretch": -0.221, "simple_Buckle": 0.935, "simple_Propeller": -5.804, "bp_simpleParams": [ 1.130, -0.221, 0.713, 0.935, -5.804, -11.384 ], "bp_params": [ 1.096, -0.352, 0.713, 0.248, -5.873, -11.399 ], "frame": { "rmsd": null, "origin": [ 31.030, -17.186, 55.331 ], "x_axis": [ 0.730, -0.363, -0.579 ], "y_axis": [ -0.220, -0.927, 0.304 ], "z_axis": [ -0.647, -0.095, -0.757 ], "quaternion": [ 0.108, 0.924, -0.158, -0.332 ] } }, { "index": 8, "nt1": "///D/9", "nt2": "///E/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.175, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.346, "chi2": -151.573, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.320, "C1C1_dist": 10.187, "N1N9_dist": 8.441, "C6C8_dist": 9.332, "CNNC_torsion": -5.832, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.30],N1(imino)-N3[2.39],N2(amino)-O2(carbonyl)[2.35]", "interBase_angle": 3.629, "planarity": 0.173, "simple_Shear": 0.861, "simple_Stretch": -0.667, "simple_Buckle": -3.629, "simple_Propeller": 0.025, "bp_simpleParams": [ 0.861, -0.667, 0.548, -3.629, 0.025, -1.926 ], "bp_params": [ 0.798, -0.742, 0.548, -3.612, 0.352, -1.925 ], "frame": { "rmsd": null, "origin": [ 28.881, -16.864, 52.582 ], "x_axis": [ 0.476, -0.825, -0.304 ], "y_axis": [ -0.543, -0.548, 0.636 ], "z_axis": [ -0.692, -0.138, -0.709 ], "quaternion": [ 0.234, 0.826, -0.414, -0.301 ] } }, { "index": 9, "nt1": "///D/10", "nt2": "///E/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.777, "conf1": "anti", "pucker1": "----", "lambda1": 50.195, "chi2": -117.996, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 37.657, "C1C1_dist": 10.563, "N1N9_dist": 8.479, "C6C8_dist": 8.946, "CNNC_torsion": -0.927, "hbonds_num": 2, "hbonds_desc": "N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.23]", "interBase_angle": 15.859, "planarity": 0.241, "simple_Shear": 1.299, "simple_Stretch": -0.891, "simple_Buckle": -10.855, "simple_Propeller": 11.562, "bp_simpleParams": [ 1.299, -0.891, 1.110, -10.855, 11.562, -17.982 ], "bp_params": [ 1.179, -1.045, 1.110, -9.334, 12.821, -18.035 ], "frame": { "rmsd": null, "origin": [ 26.458, -15.771, 49.382 ], "x_axis": [ 0.071, -0.997, -0.007 ], "y_axis": [ -0.716, -0.055, 0.696 ], "z_axis": [ -0.695, -0.044, -0.718 ], "quaternion": [ 0.273, 0.679, -0.631, -0.258 ] } }, { "index": 10, "nt1": "///E/2", "nt2": "///F/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.076, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.086, "chi2": -102.823, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.060, "C1C1_dist": 11.773, "N1N9_dist": 9.751, "C6C8_dist": 10.297, "CNNC_torsion": 3.479, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[3.57]", "interBase_angle": 12.289, "planarity": 0.151, "simple_Shear": -0.018, "simple_Stretch": 0.429, "simple_Buckle": -12.231, "simple_Propeller": -1.196, "bp_simpleParams": [ -0.018, 0.429, -0.231, -12.231, -1.196, -16.990 ], "bp_params": [ -0.018, 0.429, -0.231, -12.234, -1.169, -16.895 ], "frame": { "rmsd": null, "origin": [ 16.670, -0.127, 23.524 ], "x_axis": [ 0.220, -0.809, -0.545 ], "y_axis": [ 0.951, 0.301, -0.064 ], "z_axis": [ 0.216, -0.505, 0.836 ], "quaternion": [ 0.768, 0.144, 0.248, -0.573 ] } }, { "index": 11, "nt1": "///E/3", "nt2": "///F/30", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.744, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.177, "chi2": -132.264, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.182, "C1C1_dist": 11.246, "N1N9_dist": 9.278, "C6C8_dist": 9.895, "CNNC_torsion": -1.848, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.16],O4(carbonyl)-N6(amino)[2.63]", "interBase_angle": 0.576, "planarity": 0.028, "simple_Shear": 0.200, "simple_Stretch": 0.021, "simple_Buckle": -0.276, "simple_Propeller": 0.505, "bp_simpleParams": [ 0.200, 0.021, 0.136, -0.276, 0.505, -14.946 ], "bp_params": [ 0.200, 0.017, 0.136, -0.267, 0.510, -14.946 ], "frame": { "rmsd": null, "origin": [ 16.764, -2.231, 25.890 ], "x_axis": [ 0.679, -0.489, -0.548 ], "y_axis": [ 0.679, 0.703, 0.215 ], "z_axis": [ 0.280, -0.517, 0.809 ], "quaternion": [ 0.893, 0.205, 0.232, -0.327 ] } }, { "index": 12, "nt1": "///E/4", "nt2": "///F/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.711, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.644, "chi2": -96.751, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.215, "C1C1_dist": 10.295, "N1N9_dist": 8.593, "C6C8_dist": 9.522, "CNNC_torsion": -14.454, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[2.69],N2(amino)-O2(carbonyl)[2.55]", "interBase_angle": 12.734, "planarity": 0.205, "simple_Shear": -0.725, "simple_Stretch": -0.481, "simple_Buckle": -7.516, "simple_Propeller": -10.279, "bp_simpleParams": [ -0.725, -0.481, 0.470, -7.516, -10.279, -0.557 ], "bp_params": [ -0.693, -0.527, 0.470, -6.824, -10.751, -0.559 ], "frame": { "rmsd": null, "origin": [ 18.512, -4.179, 28.252 ], "x_axis": [ 0.944, 0.051, -0.326 ], "y_axis": [ 0.139, 0.836, 0.531 ], "z_axis": [ 0.300, -0.546, 0.782 ], "quaternion": [ 0.944, 0.285, 0.166, -0.023 ] } }, { "index": 13, "nt1": "///E/5", "nt2": "///F/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.122, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.972, "chi2": -106.400, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 64.192, "C1C1_dist": 10.089, "N1N9_dist": 8.482, "C6C8_dist": 9.516, "CNNC_torsion": -14.660, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.21],N1(imino)-O2(carbonyl)[2.63],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 16.822, "planarity": 0.219, "simple_Shear": -1.595, "simple_Stretch": -0.381, "simple_Buckle": -4.180, "simple_Propeller": -16.295, "bp_simpleParams": [ -1.595, -0.381, 0.410, -4.180, -16.295, 5.057 ], "bp_params": [ -1.517, -0.621, 0.410, -1.606, -16.745, 5.111 ], "frame": { "rmsd": null, "origin": [ 19.319, -5.504, 31.024 ], "x_axis": [ 0.848, 0.530, 0.025 ], "y_axis": [ -0.447, 0.688, 0.571 ], "z_axis": [ 0.286, -0.495, 0.820 ], "quaternion": [ 0.916, 0.291, 0.071, 0.267 ] } }, { "index": 14, "nt1": "///E/6", "nt2": "///F/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.867, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.215, "chi2": -114.369, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.300, "C1C1_dist": 10.185, "N1N9_dist": 8.602, "C6C8_dist": 9.671, "CNNC_torsion": -0.929, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.36],N3-N1(imino)[2.69],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.524, "planarity": 0.143, "simple_Shear": 0.414, "simple_Stretch": -0.348, "simple_Buckle": 0.517, "simple_Propeller": 3.486, "bp_simpleParams": [ 0.414, -0.348, 0.522, 0.517, 3.486, 6.410 ], "bp_params": [ 0.401, -0.363, 0.522, 0.643, 3.465, 6.413 ], "frame": { "rmsd": null, "origin": [ 20.754, -6.463, 33.998 ], "x_axis": [ 0.288, 0.914, 0.287 ], "y_axis": [ -0.904, 0.160, 0.397 ], "z_axis": [ 0.317, -0.374, 0.872 ], "quaternion": [ 0.761, 0.253, 0.010, 0.597 ] } }, { "index": 15, "nt1": "///E/7", "nt2": "///F/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.235, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.940, "chi2": -108.736, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.070, "C1C1_dist": 10.530, "N1N9_dist": 8.793, "C6C8_dist": 9.699, "CNNC_torsion": -20.556, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.18],N1(imino)-O2(carbonyl)[3.06],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[3.12]", "interBase_angle": 25.548, "planarity": 0.306, "simple_Shear": -1.400, "simple_Stretch": -0.218, "simple_Buckle": -9.689, "simple_Propeller": -23.640, "bp_simpleParams": [ -1.400, -0.218, 0.013, -9.689, -23.640, 0.355 ], "bp_params": [ -1.360, -0.397, 0.013, -6.452, -24.720, 0.363 ], "frame": { "rmsd": null, "origin": [ 21.218, -8.576, 37.237 ], "x_axis": [ -0.232, 0.823, 0.519 ], "y_axis": [ -0.896, -0.388, 0.215 ], "z_axis": [ 0.378, -0.415, 0.827 ], "quaternion": [ 0.549, 0.287, -0.064, 0.782 ] } }, { "index": 16, "nt1": "///E/8", "nt2": "///F/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.272, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 41.892, "chi2": -104.290, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.057, "C1C1_dist": 10.941, "N1N9_dist": 9.046, "C6C8_dist": 9.743, "CNNC_torsion": -13.225, "hbonds_num": 3, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.09],N1*O2(carbonyl)[3.21],N1-N3(imino)[3.35]", "unusual_base2base_hbonds": 1, "interBase_angle": 12.651, "planarity": 0.183, "simple_Shear": -1.342, "simple_Stretch": -0.079, "simple_Buckle": -3.889, "simple_Propeller": -12.039, "bp_simpleParams": [ -1.342, -0.079, 0.342, -3.889, -12.039, -11.171 ], "bp_params": [ -1.320, -0.254, 0.342, -2.261, -12.448, -11.235 ], "frame": { "rmsd": null, "origin": [ 22.442, -10.302, 39.248 ], "x_axis": [ -0.750, 0.448, 0.487 ], "y_axis": [ -0.597, -0.775, -0.207 ], "z_axis": [ 0.284, -0.446, 0.848 ], "quaternion": [ 0.285, 0.210, -0.178, 0.918 ] } }, { "index": 17, "nt1": "///E/9", "nt2": "///F/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.392, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.222, "chi2": -126.833, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.001, "C1C1_dist": 10.458, "N1N9_dist": 8.620, "C6C8_dist": 9.423, "CNNC_torsion": -9.283, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.40],N1(imino)-N3[2.61],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 4.053, "planarity": 0.170, "simple_Shear": -0.364, "simple_Stretch": -0.604, "simple_Buckle": -3.640, "simple_Propeller": -1.783, "bp_simpleParams": [ -0.364, -0.604, 0.592, -3.640, -1.783, -5.841 ], "bp_params": [ -0.344, -0.616, 0.592, -3.581, -1.899, -5.839 ], "frame": { "rmsd": null, "origin": [ 23.309, -12.215, 42.417 ], "x_axis": [ -0.934, -0.155, 0.321 ], "y_axis": [ -0.070, -0.803, -0.592 ], "z_axis": [ 0.350, -0.575, 0.740 ], "quaternion": [ -0.023, 0.180, -0.313, 0.932 ] } }, { "index": 18, "nt1": "///E/10", "nt2": "///F/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.007, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.261, "chi2": -113.323, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.656, "C1C1_dist": 10.332, "N1N9_dist": 8.518, "C6C8_dist": 9.308, "CNNC_torsion": 0.379, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.68],N4(amino)-O6(carbonyl)[2.44]", "interBase_angle": 9.378, "planarity": 0.161, "simple_Shear": 0.948, "simple_Stretch": -0.678, "simple_Buckle": -4.989, "simple_Propeller": 7.941, "bp_simpleParams": [ 0.948, -0.678, 0.654, -4.989, 7.941, -5.223 ], "bp_params": [ 0.883, -0.759, 0.654, -4.259, 8.356, -5.233 ], "frame": { "rmsd": null, "origin": [ 24.185, -13.693, 45.452 ], "x_axis": [ -0.794, -0.557, -0.241 ], "y_axis": [ 0.565, -0.533, -0.630 ], "z_axis": [ 0.223, -0.637, 0.738 ], "quaternion": [ -0.321, -0.005, -0.362, 0.875 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GTGGCGAGCGCTCGCCAC", "strand2": "CACCGCTCGCGAGCGGTG", "bp_type": "||||||||||||||||||", "helix_form": ".BBBB...x...BBBB.", "helical_rise": 3.386, "helical_rise_std": 0.776, "helical_radius": 9.343, "helical_radius_std": 2.119, "helical_axis": [ -0.445, 0.234, -0.864 ], "point1": [ 40.940, -18.821, 72.196 ], "point2": [ 15.323, -5.351, 22.496 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.048, -0.542, 0.250, -11.675, 2.757, 0.076 ], "step_params": [ -0.007, -1.125, 3.158, -0.536, 2.171, 29.410 ], "heli_params": [ -2.650, -0.095, 3.069, 4.268, 1.054, 29.493 ], "bp2_params": [ -1.083, 0.149, 0.530, -7.394, -2.421, 6.206 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.158, "simple_Twist": 29.102, "simple_hRise": 3.067, "simple_hTwist": 29.185 }, { "index": 2, "nt1": "///D/3", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.083, 0.149, 0.530, -7.394, -2.421, 6.206 ], "step_params": [ 0.233, 0.362, 3.017, 3.400, -0.668, 35.073 ], "heli_params": [ 0.689, 0.082, 3.019, -1.105, -5.625, 35.238 ], "bp2_params": [ -1.373, 0.294, 0.186, 2.077, -3.719, 1.619 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.017, "simple_Twist": 36.423, "simple_hRise": 3.019, "simple_hTwist": 36.582 }, { "index": 3, "nt1": "///D/4", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.373, 0.294, 0.186, 2.077, -3.719, 1.619 ], "step_params": [ -0.621, 0.162, 3.061, -4.288, 0.468, 33.428 ], "heli_params": [ 0.208, 0.410, 3.116, 0.810, 7.417, 33.698 ], "bp2_params": [ 0.009, -0.009, 0.475, 15.585, -10.234, -8.153 ], "groove_widths": [ 13.323, null, 18.915, null ], "simple_Rise": 3.061, "simple_Twist": 26.699, "simple_hRise": 3.123, "simple_hTwist": 27.039 }, { "index": 4, "nt1": "///D/5", "nt2": "///E/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.009, -0.009, 0.475, 15.585, -10.234, -8.153 ], "step_params": [ 0.901, -0.627, 3.512, 3.249, 3.368, 32.220 ], "heli_params": [ -1.751, -0.996, 3.502, 6.029, -5.816, 32.549 ], "bp2_params": [ -0.421, -0.339, 0.091, 5.211, -4.454, 0.218 ], "groove_widths": [ 12.547, 12.542, 17.451, 17.266 ], "simple_Rise": 3.512, "simple_Twist": 34.148, "simple_hRise": 3.504, "simple_hTwist": 34.457 }, { "index": 5, "nt1": "///D/6", "nt2": "///E/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.421, -0.339, 0.091, 5.211, -4.454, 0.218 ], "step_params": [ -0.145, 0.680, 4.465, 0.559, -5.553, 42.538 ], "heli_params": [ 1.677, 0.274, 4.344, -7.615, -0.767, 42.886 ], "bp2_params": [ 0.717, 0.354, 0.096, -15.212, -17.020, 3.092 ], "groove_widths": [ 11.625, 11.624, 17.427, 17.425 ], "simple_Rise": 4.465, "simple_Twist": 35.931, "simple_hRise": 4.312, "simple_hTwist": 36.348 }, { "index": 6, "nt1": "///D/7", "nt2": "///E/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.717, 0.354, 0.096, -15.212, -17.020, 3.092 ], "step_params": [ -1.268, -0.126, 2.855, -6.417, -3.214, 36.460 ], "heli_params": [ 0.192, 1.214, 3.027, -5.076, 10.135, 37.137 ], "bp2_params": [ 1.096, -0.352, 0.713, 0.248, -5.873, -11.399 ], "groove_widths": [ 11.156, 11.153, 16.643, 16.441 ], "simple_Rise": 2.855, "simple_Twist": 34.977, "simple_hRise": 3.032, "simple_hTwist": 35.683 }, { "index": 7, "nt1": "///D/8", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.096, -0.352, 0.713, 0.248, -5.873, -11.399 ], "step_params": [ -0.246, -0.732, 3.418, -4.281, -1.361, 34.625 ], "heli_params": [ -1.003, -0.273, 3.449, -2.274, 7.155, 34.907 ], "bp2_params": [ 0.798, -0.742, 0.548, -3.612, 0.352, -1.925 ], "groove_widths": [ 11.957, 11.924, 17.605, 16.870 ], "simple_Rise": 3.418, "simple_Twist": 35.822, "simple_hRise": 3.448, "simple_hTwist": 36.093 }, { "index": 8, "nt1": "///D/9", "nt2": "///E/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.798, -0.742, 0.548, -3.612, 0.352, -1.925 ], "step_params": [ -1.222, -0.926, 3.867, 1.916, -5.005, 30.416 ], "heli_params": [ -0.578, 2.739, 3.884, -9.448, -3.617, 30.874 ], "bp2_params": [ 1.179, -1.045, 1.110, -9.334, 12.821, -18.035 ], "groove_widths": [ 12.894, 12.834, 21.680, 20.737 ], "simple_Rise": 3.867, "simple_Twist": 28.753, "simple_hRise": 3.881, "simple_hTwist": 29.238 }, { "index": 9, "nt1": "///D/10", "nt2": "///E/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.179, -1.045, 1.110, -9.334, 12.821, -18.035 ], "step_params": [ -0.518, -0.020, 4.965, 10.504, -47.840, 37.442 ], "heli_params": [ 3.650, 1.317, 3.072, -53.555, -11.759, 60.941 ], "bp2_params": [ -0.883, -0.759, 0.654, 4.259, 8.356, -5.233 ], "groove_widths": [ 12.354, 12.303, 21.554, 20.859 ], "simple_Rise": 4.965, "simple_Twist": 48.539, "simple_hRise": 3.593, "simple_hTwist": 67.882 }, { "index": 10, "nt1": "///F/23", "nt2": "///E/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.883, -0.759, 0.654, 4.259, 8.356, -5.233 ], "step_params": [ 0.110, -0.781, 3.397, 0.653, 8.073, 40.530 ], "heli_params": [ -1.990, -0.084, 3.192, 11.515, -0.932, 41.298 ], "bp2_params": [ 0.344, -0.616, 0.592, 3.581, -1.899, -5.839 ], "groove_widths": [ 12.390, 12.367, 21.804, 20.449 ], "simple_Rise": 3.397, "simple_Twist": 33.717, "simple_hRise": 3.134, "simple_hTwist": 34.649 }, { "index": 11, "nt1": "///F/24", "nt2": "///E/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.344, -0.616, 0.592, 3.581, -1.899, -5.839 ], "step_params": [ -0.371, 0.032, 3.783, 7.496, -7.169, 37.494 ], "heli_params": [ 1.050, 1.604, 3.581, -10.900, -11.397, 38.853 ], "bp2_params": [ 1.320, -0.254, 0.342, 2.261, -12.448, -11.235 ], "groove_widths": [ 11.965, 11.963, 15.621, 14.709 ], "simple_Rise": 3.783, "simple_Twist": 32.677, "simple_hRise": 3.530, "simple_hTwist": 34.241 }, { "index": 12, "nt1": "///F/25", "nt2": "///E/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.320, -0.254, 0.342, 2.261, -12.448, -11.235 ], "step_params": [ 0.679, 0.083, 2.838, 5.341, 2.225, 37.313 ], "heli_params": [ -0.126, -0.441, 2.904, 3.452, -8.287, 37.743 ], "bp2_params": [ 1.360, -0.397, 0.013, 6.452, -24.720, 0.363 ], "groove_widths": [ 11.875, 11.874, 17.405, 17.390 ], "simple_Rise": 2.838, "simple_Twist": 37.018, "simple_hRise": 2.904, "simple_hTwist": 37.452 }, { "index": 13, "nt1": "///F/26", "nt2": "///E/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.360, -0.397, 0.013, 6.452, -24.720, 0.363 ], "step_params": [ 0.577, 0.882, 3.751, -3.817, -3.102, 33.366 ], "heli_params": [ 2.087, -1.692, 3.570, -5.366, 6.604, 33.717 ], "bp2_params": [ -0.401, -0.363, 0.522, -0.643, 3.465, 6.413 ], "groove_widths": [ 12.484, 12.467, 15.594, 15.546 ], "simple_Rise": 3.751, "simple_Twist": 42.699, "simple_hRise": 3.619, "simple_hTwist": 42.968 }, { "index": 14, "nt1": "///F/27", "nt2": "///E/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.401, -0.363, 0.522, -0.643, 3.465, 6.413 ], "step_params": [ -0.668, -0.010, 3.373, 3.381, 6.991, 42.149 ], "heli_params": [ -0.727, 1.260, 3.270, 9.623, -4.653, 42.826 ], "bp2_params": [ 1.517, -0.621, 0.410, 1.606, -16.745, 5.111 ], "groove_widths": [ 12.820, 12.772, 14.630, 14.607 ], "simple_Rise": 3.373, "simple_Twist": 31.157, "simple_hRise": 3.207, "simple_hTwist": 32.087 }, { "index": 15, "nt1": "///F/28", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.517, -0.621, 0.410, 1.606, -16.745, 5.111 ], "step_params": [ 0.051, 0.415, 3.149, 3.743, -0.219, 35.036 ], "heli_params": [ 0.717, 0.452, 3.135, -0.363, -6.195, 35.230 ], "bp2_params": [ 0.693, -0.527, 0.470, 6.824, -10.751, -0.559 ], "groove_widths": [ 11.787, null, 15.592, null ], "simple_Rise": 3.149, "simple_Twist": 40.004, "simple_hRise": 3.139, "simple_hTwist": 40.172 }, { "index": 16, "nt1": "///F/29", "nt2": "///E/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.693, -0.527, 0.470, 6.824, -10.751, -0.559 ], "step_params": [ -0.843, 0.081, 3.422, -1.464, 2.060, 37.301 ], "heli_params": [ -0.159, 1.113, 3.451, 3.216, 2.286, 37.384 ], "bp2_params": [ -0.200, 0.017, 0.136, 0.267, 0.510, -14.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 42.158, "simple_hRise": 3.448, "simple_hTwist": 42.230 }, { "index": 17, "nt1": "///F/30", "nt2": "///E/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, 0.017, 0.136, 0.267, 0.510, -14.946 ], "step_params": [ -0.140, -0.858, 3.046, 2.604, 3.100, 32.383 ], "heli_params": [ -2.021, 0.664, 2.933, 5.532, -4.647, 32.628 ], "bp2_params": [ 0.018, 0.429, -0.231, 12.234, -1.169, -16.895 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.046, "simple_Twist": 31.153, "simple_hRise": 2.928, "simple_hTwist": 31.408 }, { "index": 18, "nt1": "///F/31", "nt2": "///E/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GTGGCGAGC", "strand2": "CACCGCTCG", "bp_type": "|||||||||", "helix_form": ".BBBB...", "helical_rise": 3.470, "helical_rise_std": 0.370, "helical_radius": 9.387, "helical_radius_std": 0.547, "helical_axis": [ -0.592, -0.014, -0.806 ], "point1": [ 43.794, -17.185, 71.752 ], "point2": [ 27.333, -17.574, 49.320 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.048, -0.542, 0.250, -11.675, 2.757, 0.076 ], "step_params": [ -0.007, -1.125, 3.158, -0.536, 2.171, 29.410 ], "heli_params": [ -2.650, -0.095, 3.069, 4.268, 1.054, 29.493 ], "bp2_params": [ -1.083, 0.149, 0.530, -7.394, -2.421, 6.206 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.158, "simple_Twist": 29.102, "simple_hRise": 3.067, "simple_hTwist": 29.185 }, { "index": 2, "nt1": "///D/3", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.083, 0.149, 0.530, -7.394, -2.421, 6.206 ], "step_params": [ 0.233, 0.362, 3.017, 3.400, -0.668, 35.073 ], "heli_params": [ 0.689, 0.082, 3.019, -1.105, -5.625, 35.238 ], "bp2_params": [ -1.373, 0.294, 0.186, 2.077, -3.719, 1.619 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.017, "simple_Twist": 36.423, "simple_hRise": 3.019, "simple_hTwist": 36.582 }, { "index": 3, "nt1": "///D/4", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.373, 0.294, 0.186, 2.077, -3.719, 1.619 ], "step_params": [ -0.621, 0.162, 3.061, -4.288, 0.468, 33.428 ], "heli_params": [ 0.208, 0.410, 3.116, 0.810, 7.417, 33.698 ], "bp2_params": [ 0.009, -0.009, 0.475, 15.585, -10.234, -8.153 ], "groove_widths": [ 13.323, null, 18.915, null ], "simple_Rise": 3.061, "simple_Twist": 26.699, "simple_hRise": 3.123, "simple_hTwist": 27.039 }, { "index": 4, "nt1": "///D/5", "nt2": "///E/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.009, -0.009, 0.475, 15.585, -10.234, -8.153 ], "step_params": [ 0.901, -0.627, 3.512, 3.249, 3.368, 32.220 ], "heli_params": [ -1.751, -0.996, 3.502, 6.029, -5.816, 32.549 ], "bp2_params": [ -0.421, -0.339, 0.091, 5.211, -4.454, 0.218 ], "groove_widths": [ 12.547, 12.542, 17.451, 17.266 ], "simple_Rise": 3.512, "simple_Twist": 34.148, "simple_hRise": 3.504, "simple_hTwist": 34.457 }, { "index": 5, "nt1": "///D/6", "nt2": "///E/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.421, -0.339, 0.091, 5.211, -4.454, 0.218 ], "step_params": [ -0.145, 0.680, 4.465, 0.559, -5.553, 42.538 ], "heli_params": [ 1.677, 0.274, 4.344, -7.615, -0.767, 42.886 ], "bp2_params": [ 0.717, 0.354, 0.096, -15.212, -17.020, 3.092 ], "groove_widths": [ 11.625, 11.624, 17.427, 17.425 ], "simple_Rise": 4.465, "simple_Twist": 35.931, "simple_hRise": 4.312, "simple_hTwist": 36.348 }, { "index": 6, "nt1": "///D/7", "nt2": "///E/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.717, 0.354, 0.096, -15.212, -17.020, 3.092 ], "step_params": [ -1.268, -0.126, 2.855, -6.417, -3.214, 36.460 ], "heli_params": [ 0.192, 1.214, 3.027, -5.076, 10.135, 37.137 ], "bp2_params": [ 1.096, -0.352, 0.713, 0.248, -5.873, -11.399 ], "groove_widths": [ 11.156, null, 16.643, null ], "simple_Rise": 2.855, "simple_Twist": 34.977, "simple_hRise": 3.032, "simple_hTwist": 35.683 }, { "index": 7, "nt1": "///D/8", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.096, -0.352, 0.713, 0.248, -5.873, -11.399 ], "step_params": [ -0.246, -0.732, 3.418, -4.281, -1.361, 34.625 ], "heli_params": [ -1.003, -0.273, 3.449, -2.274, 7.155, 34.907 ], "bp2_params": [ 0.798, -0.742, 0.548, -3.612, 0.352, -1.925 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.418, "simple_Twist": 35.822, "simple_hRise": 3.448, "simple_hTwist": 36.093 }, { "index": 8, "nt1": "///D/9", "nt2": "///E/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.798, -0.742, 0.548, -3.612, 0.352, -1.925 ], "step_params": [ -1.222, -0.926, 3.867, 1.916, -5.005, 30.416 ], "heli_params": [ -0.578, 2.739, 3.884, -9.448, -3.617, 30.874 ], "bp2_params": [ 1.179, -1.045, 1.110, -9.334, 12.821, -18.035 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.867, "simple_Twist": 28.753, "simple_hRise": 3.881, "simple_hTwist": 29.238 }, { "index": 9, "nt1": "///D/10", "nt2": "///E/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GTGGCGAGC", "strand2": "CACCGCTCG", "bp_type": "|||||||||", "helix_form": ".BB.B...", "helical_rise": 3.437, "helical_rise_std": 0.402, "helical_radius": 9.207, "helical_radius_std": 0.658, "helical_axis": [ 0.296, -0.513, 0.806 ], "point1": [ 15.974, -0.459, 22.736 ], "point2": [ 24.156, -14.619, 44.986 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///F/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.018, 0.429, -0.231, -12.234, -1.169, -16.895 ], "step_params": [ 0.140, -0.858, 3.046, -2.604, 3.100, 32.383 ], "heli_params": [ -2.021, -0.664, 2.933, 5.532, 4.647, 32.628 ], "bp2_params": [ 0.200, 0.017, 0.136, -0.267, 0.510, -14.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.046, "simple_Twist": 31.153, "simple_hRise": 2.928, "simple_hTwist": 31.408 }, { "index": 2, "nt1": "///E/3", "nt2": "///F/30", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, 0.017, 0.136, -0.267, 0.510, -14.946 ], "step_params": [ 0.843, 0.081, 3.422, 1.464, 2.060, 37.301 ], "heli_params": [ -0.159, -1.113, 3.451, 3.216, -2.286, 37.384 ], "bp2_params": [ -0.693, -0.527, 0.470, -6.824, -10.751, -0.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 42.158, "simple_hRise": 3.448, "simple_hTwist": 42.230 }, { "index": 3, "nt1": "///E/4", "nt2": "///F/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.693, -0.527, 0.470, -6.824, -10.751, -0.559 ], "step_params": [ -0.051, 0.415, 3.149, -3.743, -0.219, 35.036 ], "heli_params": [ 0.717, -0.452, 3.135, -0.363, 6.195, 35.230 ], "bp2_params": [ -1.517, -0.621, 0.410, -1.606, -16.745, 5.111 ], "groove_widths": [ 11.787, null, 15.592, null ], "simple_Rise": 3.149, "simple_Twist": 40.004, "simple_hRise": 3.139, "simple_hTwist": 40.172 }, { "index": 4, "nt1": "///E/5", "nt2": "///F/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.517, -0.621, 0.410, -1.606, -16.745, 5.111 ], "step_params": [ 0.668, -0.010, 3.373, -3.381, 6.991, 42.149 ], "heli_params": [ -0.727, -1.260, 3.270, 9.623, 4.653, 42.826 ], "bp2_params": [ 0.401, -0.363, 0.522, 0.643, 3.465, 6.413 ], "groove_widths": [ 12.820, 12.772, 14.630, 14.607 ], "simple_Rise": 3.373, "simple_Twist": 31.157, "simple_hRise": 3.207, "simple_hTwist": 32.087 }, { "index": 5, "nt1": "///E/6", "nt2": "///F/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.401, -0.363, 0.522, 0.643, 3.465, 6.413 ], "step_params": [ -0.577, 0.882, 3.751, 3.817, -3.102, 33.366 ], "heli_params": [ 2.087, 1.692, 3.570, -5.366, -6.604, 33.717 ], "bp2_params": [ -1.360, -0.397, 0.013, -6.452, -24.720, 0.363 ], "groove_widths": [ 12.484, 12.467, 15.594, 15.546 ], "simple_Rise": 3.751, "simple_Twist": 42.699, "simple_hRise": 3.619, "simple_hTwist": 42.968 }, { "index": 6, "nt1": "///E/7", "nt2": "///F/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.360, -0.397, 0.013, -6.452, -24.720, 0.363 ], "step_params": [ -0.679, 0.083, 2.838, -5.341, 2.225, 37.313 ], "heli_params": [ -0.126, 0.441, 2.904, 3.452, 8.287, 37.743 ], "bp2_params": [ -1.320, -0.254, 0.342, -2.261, -12.448, -11.235 ], "groove_widths": [ 11.875, null, 17.405, null ], "simple_Rise": 2.838, "simple_Twist": 37.018, "simple_hRise": 2.904, "simple_hTwist": 37.452 }, { "index": 7, "nt1": "///E/8", "nt2": "///F/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.320, -0.254, 0.342, -2.261, -12.448, -11.235 ], "step_params": [ 0.371, 0.032, 3.783, -7.496, -7.169, 37.494 ], "heli_params": [ 1.050, -1.604, 3.581, -10.900, 11.397, 38.853 ], "bp2_params": [ -0.344, -0.616, 0.592, -3.581, -1.899, -5.839 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.783, "simple_Twist": 32.677, "simple_hRise": 3.530, "simple_hTwist": 34.241 }, { "index": 8, "nt1": "///E/9", "nt2": "///F/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.344, -0.616, 0.592, -3.581, -1.899, -5.839 ], "step_params": [ -0.110, -0.781, 3.397, -0.653, 8.073, 40.530 ], "heli_params": [ -1.990, 0.084, 3.192, 11.515, 0.932, 41.298 ], "bp2_params": [ 0.883, -0.759, 0.654, -4.259, 8.356, -5.233 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.397, "simple_Twist": 33.717, "simple_hRise": 3.134, "simple_hTwist": 34.649 }, { "index": 9, "nt1": "///E/10", "nt2": "///F/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///D/2,///E/20" }, { "index": 2, "num_nts": 2, "nts_short": "CG", "nts_long": "///E/1,///E/2" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///E/11,///F/23" }, { "index": 4, "num_nts": 2, "nts_short": "CG", "nts_long": "///F/31,///F/32" } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///E/1" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///E/20" }, { "index": 3, "num_nts": 1, "nts_short": "G", "nts_long": "///F/32" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 18, "nts_short": "GTGGCGAGCGCTCGCCAC", "nts_long": "///D/2,///D/3,///D/4,///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///E/11,///E/12,///E/13,///E/14,///E/15,///E/16,///E/17,///E/18,///E/19" } ], "dbn": { "all_chains": { "num_nts": 39, "num_chars": 41, "bseq": "GTGGCGAGC&CGTGGCGAGCGCTCGCCACG&GCTCGCCACG", "sstr": "[[[[[[[[[&.(((((((((]]]]]]]]].&))))))))).", "form": ".BBB.BB.-&B.BB..BB....BBBBB.B-&BBBBBBB.B-" }, "chain_D": { "num_nts": 9, "num_chars": 9, "bseq": "GTGGCGAGC", "sstr": "[[[[[[[[[", "form": ".BBB.BB.-" }, "chain_E": { "num_nts": 20, "num_chars": 20, "bseq": "CGTGGCGAGCGCTCGCCACG", "sstr": ".(((((((((]]]]]]]]].", "form": "B.BB..BB....BBBBB.B-" }, "chain_F": { "num_nts": 10, "num_chars": 10, "bseq": "GCTCGCCACG", "sstr": "))))))))).", "form": "BBBBBBB.B-" } }, "chains": { "chain_D": { "num_nts": 9, "bseq": "GTGGCGAGC", "sstr": "[[[[[[[[[", "form": ".BBB.BB.-", "helical_rise": 3.517, "helical_rise_std": 0.358, "helical_axis": [ -0.630, -0.069, -0.774 ], "point1": [ 44.932, -16.103, 71.141 ], "point2": [ 27.139, -18.051, 49.292 ], "num_chars": 25, "suite": "G!!T!!G!!G1bC!!G!!A!!G!!C" }, "chain_E": { "num_nts": 20, "bseq": "CGTGGCGAGCGCTCGCCACG", "sstr": ".(((((((((]]]]]]]]].", "form": "B.BB..BB....BBBBB.B-", "helical_rise": 3.336, "helical_rise_std": 0.750, "helical_axis": [ 0.420, -0.317, 0.851 ], "point1": [ 16.378, -1.454, 20.348 ], "point2": [ 42.928, -21.492, 74.189 ], "num_chars": 58, "suite": "C!!G!!T!!G!!G!!C!!G!!A!!G!!C!!G!!C!!T!!C!!G!!C1bC!!A!!C4bG" }, "chain_F": { "num_nts": 10, "bseq": "GCTCGCCACG", "sstr": "))))))))).", "form": "BBBBBBB.B-", "helical_rise": 3.554, "helical_rise_std": 0.342, "helical_axis": [ -0.356, 0.434, -0.828 ], "point1": [ 25.324, -13.193, 45.704 ], "point2": [ 13.863, 0.789, 19.029 ], "num_chars": 28, "suite": "G!!C!!T!!C!!G!!C!!C!!A!!C!!G" } }, "num_nts": 39, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/2", "linked_nts": [ null, "///D/3" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 142.226, "gamma": 55.844, "delta": 137.744, "epsilon": -171.233, "zeta": -95.694, "epsilon_zeta": -75.539, "bb_type": "BI", "chi": -125.407, "glyco_bond": "anti", "C5prime_xyz": [ -2.119, 8.685, -1.023 ], "P_xyz": [ 0.483, 9.031, -0.571 ], "form": ".", "ssZp": 1.947, "Dp": 2.096, "splay_angle": 19.291, "splay_distance": 3.485, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": null, "theta": -117.010, "eta_prime": null, "theta_prime": -147.636, "eta_base": null, "theta_base": -118.003, "v0": -23.007, "v1": 34.784, "v2": -32.901, "v3": 20.447, "v4": 1.403, "amplitude": 35.228, "phase_angle": 159.061, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 43.332, -16.827, 70.996 ], "x_axis": [ -0.844, -0.132, 0.520 ], "y_axis": [ -0.059, 0.986, 0.154 ], "z_axis": [ -0.533, 0.099, -0.840 ], "quaternion": [ -0.275, -0.050, 0.958, 0.066 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.879, "beta": -177.518, "gamma": 41.957, "delta": 118.652, "epsilon": -165.792, "zeta": -126.668, "epsilon_zeta": -39.124, "bb_type": "BI", "chi": -120.774, "glyco_bond": "anti", "C5prime_xyz": [ -2.677, 8.539, -1.613 ], "P_xyz": [ -0.777, 10.328, -1.331 ], "form": "B", "ssZp": 2.372, "Dp": 2.362, "splay_angle": 16.782, "splay_distance": 2.844, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 167.714, "theta": -166.418, "eta_prime": -174.465, "theta_prime": -166.449, "eta_base": -133.016, "theta_base": -125.278, "v0": -35.673, "v1": 34.415, "v2": -20.414, "v3": 0.238, "v4": 22.171, "amplitude": 36.203, "phase_angle": 124.323, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 41.462, -17.845, 68.237 ], "x_axis": [ -0.772, 0.422, 0.476 ], "y_axis": [ 0.398, 0.904, -0.157 ], "z_axis": [ -0.497, 0.068, -0.865 ], "quaternion": [ -0.258, 0.218, 0.941, -0.024 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.807, "beta": 146.059, "gamma": 38.732, "delta": 133.057, "epsilon": -140.748, "zeta": -152.728, "epsilon_zeta": 11.980, "bb_type": "--", "chi": -109.673, "glyco_bond": "anti", "C5prime_xyz": [ -2.640, 8.370, -1.939 ], "P_xyz": [ -0.281, 9.547, -1.746 ], "form": "B", "ssZp": 1.543, "Dp": 1.711, "splay_angle": 18.451, "splay_distance": 3.200, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": -177.010, "theta": -141.173, "eta_prime": -155.478, "theta_prime": -153.510, "eta_base": -114.673, "theta_base": -116.707, "v0": -30.681, "v1": 38.059, "v2": -31.301, "v3": 14.395, "v4": 9.934, "amplitude": 37.629, "phase_angle": 146.287, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 39.915, -17.820, 65.851 ], "x_axis": [ -0.479, 0.843, 0.245 ], "y_axis": [ 0.680, 0.533, -0.504 ], "z_axis": [ -0.555, -0.075, -0.828 ], "quaternion": [ -0.238, 0.452, 0.843, -0.172 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -6.087, "beta": 110.363, "gamma": 24.736, "delta": 98.592, "epsilon": 167.462, "zeta": -89.969, "epsilon_zeta": -102.569, "bb_type": "BI", "chi": -114.292, "glyco_bond": "anti", "C5prime_xyz": [ -3.551, 8.096, -2.116 ], "P_xyz": [ -1.417, 9.642, -2.318 ], "form": "B", "ssZp": 2.481, "Dp": 2.542, "splay_angle": 20.186, "splay_distance": 3.507, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 161.261, "theta": -158.237, "eta_prime": -177.173, "theta_prime": -166.220, "eta_base": -135.161, "theta_base": -120.391, "v0": -44.364, "v1": 30.912, "v2": -6.802, "v3": -18.701, "v4": 39.307, "amplitude": 43.838, "phase_angle": 98.926, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 38.087, -17.940, 63.227 ], "x_axis": [ -0.106, 0.994, -0.040 ], "y_axis": [ 0.785, 0.059, -0.617 ], "z_axis": [ -0.611, -0.097, -0.786 ], "quaternion": [ -0.204, 0.636, 0.698, -0.256 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.217, "beta": 178.174, "gamma": 38.602, "delta": 144.325, "epsilon": -128.717, "zeta": -169.051, "epsilon_zeta": 40.334, "bb_type": "BII", "chi": -113.090, "glyco_bond": "anti", "C5prime_xyz": [ -2.475, 8.467, -1.705 ], "P_xyz": [ -0.401, 10.072, -1.296 ], "form": ".", "ssZp": 1.750, "Dp": 1.751, "splay_angle": 27.810, "splay_distance": 4.607, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": -173.830, "theta": -162.569, "eta_prime": -155.628, "theta_prime": -163.376, "eta_base": -108.252, "theta_base": -107.190, "v0": -32.991, "v1": 42.687, "v2": -35.926, "v3": 17.703, "v4": 9.294, "amplitude": 42.052, "phase_angle": 148.684, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 35.870, -16.888, 60.722 ], "x_axis": [ 0.462, 0.844, -0.273 ], "y_axis": [ 0.670, -0.534, -0.516 ], "z_axis": [ -0.581, 0.055, -0.812 ], "quaternion": [ -0.170, 0.838, 0.452, -0.255 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -39.688, "beta": 123.062, "gamma": 51.254, "delta": 122.881, "epsilon": -168.148, "zeta": -111.627, "epsilon_zeta": -56.521, "bb_type": "BI", "chi": -126.104, "glyco_bond": "anti", "C5prime_xyz": [ -2.419, 8.731, -1.307 ], "P_xyz": [ 0.204, 9.007, -1.241 ], "form": "B", "ssZp": 2.482, "Dp": 2.457, "splay_angle": 20.161, "splay_distance": 3.375, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 170.657, "theta": -141.949, "eta_prime": -160.494, "theta_prime": -160.742, "eta_base": -101.980, "theta_base": -137.374, "v0": -33.537, "v1": 34.430, "v2": -22.690, "v3": 3.672, "v4": 18.721, "amplitude": 35.248, "phase_angle": 130.070, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 34.088, -17.339, 56.498 ], "x_axis": [ 0.685, 0.227, -0.692 ], "y_axis": [ 0.268, -0.962, -0.049 ], "z_axis": [ -0.677, -0.152, -0.720 ], "quaternion": [ 0.028, 0.917, 0.135, -0.373 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.760, "beta": 173.511, "gamma": 54.646, "delta": 137.649, "epsilon": 171.876, "zeta": -110.956, "epsilon_zeta": -77.169, "bb_type": "BI", "chi": -113.719, "glyco_bond": "anti", "C5prime_xyz": [ -2.374, 8.411, -1.563 ], "P_xyz": [ 0.008, 9.522, -1.461 ], "form": "B", "ssZp": 2.384, "Dp": 2.297, "splay_angle": 21.518, "splay_distance": 3.432, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 160.697, "theta": -152.425, "eta_prime": -171.152, "theta_prime": -168.020, "eta_base": -138.311, "theta_base": -124.379, "v0": -26.241, "v1": 37.481, "v2": -33.829, "v3": 19.542, "v4": 3.939, "amplitude": 37.267, "phase_angle": 155.196, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 31.238, -17.255, 54.690 ], "x_axis": [ 0.715, -0.273, -0.644 ], "y_axis": [ -0.151, -0.959, 0.239 ], "z_axis": [ -0.683, -0.074, -0.727 ], "quaternion": [ 0.085, 0.922, -0.115, -0.360 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.312, "beta": -173.574, "gamma": 62.675, "delta": 143.491, "epsilon": -153.064, "zeta": -140.302, "epsilon_zeta": -12.762, "bb_type": "--", "chi": -124.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.771, 8.605, -1.060 ], "P_xyz": [ 0.603, 9.264, -0.208 ], "form": ".", "ssZp": 1.644, "Dp": 1.791, "splay_angle": 24.387, "splay_distance": 4.341, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": -178.541, "theta": -119.094, "eta_prime": -159.392, "theta_prime": -137.896, "eta_base": -112.312, "theta_base": -121.325, "v0": -20.695, "v1": 31.817, "v2": -30.647, "v3": 19.424, "v4": 0.615, "amplitude": 32.545, "phase_angle": 160.338, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 29.082, -17.027, 52.030 ], "x_axis": [ 0.487, -0.816, -0.313 ], "y_axis": [ -0.513, -0.557, 0.653 ], "z_axis": [ -0.707, -0.157, -0.689 ], "quaternion": [ 0.245, 0.827, -0.402, -0.309 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/10", "linked_nts": [ "///D/9", null ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 26.171, "beta": 118.567, "gamma": -23.245, "delta": 107.589, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -105.777, "glyco_bond": "anti", "C5prime_xyz": [ -2.814, 8.115, -2.330 ], "P_xyz": [ -1.254, 10.248, -1.964 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -33.958, "v1": 23.025, "v2": -4.451, "v3": -15.132, "v4": 30.863, "amplitude": 33.754, "phase_angle": 97.578, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 26.487, -16.355, 48.616 ], "x_axis": [ 0.252, -0.966, -0.048 ], "y_axis": [ -0.625, -0.201, 0.754 ], "z_axis": [ -0.738, -0.160, -0.655 ], "quaternion": [ 0.315, 0.726, -0.548, -0.271 ] } }, { "index": 10, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": -168.545, "gamma": 179.390, "delta": 143.559, "epsilon": -169.342, "zeta": -115.447, "epsilon_zeta": -53.895, "bb_type": "BI", "chi": -91.967, "glyco_bond": "anti", "C5prime_xyz": [ -2.363, 7.853, -2.320 ], "P_xyz": [ -1.279, 7.831, -4.695 ], "form": "B", "ssZp": 2.168, "Dp": 2.338, "splay_angle": 20.124, "splay_distance": 3.454, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": null, "theta": -167.534, "eta_prime": null, "theta_prime": 178.582, "eta_base": null, "theta_base": -147.246, "v0": -18.301, "v1": 33.078, "v2": -34.362, "v3": 24.511, "v4": -4.053, "amplitude": 35.153, "phase_angle": 167.826, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 16.084, 0.861, 20.161 ], "x_axis": [ -0.261, -0.965, -0.012 ], "y_axis": [ 0.937, -0.251, -0.243 ], "z_axis": [ 0.232, -0.075, 0.970 ], "quaternion": [ 0.604, -0.070, 0.101, -0.788 ] } }, { "index": 11, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -58.211, "beta": 159.613, "gamma": 54.329, "delta": 127.591, "epsilon": -178.461, "zeta": -99.995, "epsilon_zeta": -78.466, "bb_type": "BI", "chi": -124.076, "glyco_bond": "anti", "C5prime_xyz": [ -2.608, 8.655, -1.346 ], "P_xyz": [ -0.243, 9.812, -1.232 ], "form": ".", "ssZp": 2.488, "Dp": 2.450, "splay_angle": 19.174, "splay_distance": 3.386, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 158.466, "theta": -140.431, "eta_prime": -175.356, "theta_prime": -156.186, "eta_base": -137.310, "theta_base": -121.349, "v0": -35.601, "v1": 39.317, "v2": -27.808, "v3": 7.984, "v4": 17.085, "amplitude": 38.968, "phase_angle": 135.529, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 16.846, 0.003, 23.419 ], "x_axis": [ 0.085, -0.857, -0.508 ], "y_axis": [ 0.946, 0.230, -0.230 ], "z_axis": [ 0.314, -0.461, 0.830 ], "quaternion": [ 0.732, 0.079, 0.281, -0.616 ] } }, { "index": 12, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.945, "beta": 179.755, "gamma": 61.093, "delta": 121.902, "epsilon": 175.964, "zeta": -105.421, "epsilon_zeta": -78.615, "bb_type": "BI", "chi": -123.744, "glyco_bond": "anti", "C5prime_xyz": [ -2.779, 8.583, -1.482 ], "P_xyz": [ -0.610, 10.132, -1.277 ], "form": "B", "ssZp": 2.466, "Dp": 2.525, "splay_angle": 22.578, "splay_distance": 3.632, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 165.924, "theta": -158.424, "eta_prime": -170.464, "theta_prime": -165.172, "eta_base": -126.340, "theta_base": -113.117, "v0": -37.922, "v1": 39.181, "v2": -25.813, "v3": 4.601, "v4": 20.487, "amplitude": 39.739, "phase_angle": 130.508, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 16.857, -2.309, 25.892 ], "x_axis": [ 0.584, -0.574, -0.574 ], "y_axis": [ 0.760, 0.634, 0.139 ], "z_axis": [ 0.284, -0.518, 0.807 ], "quaternion": [ 0.870, 0.189, 0.247, -0.384 ] } }, { "index": 13, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.319, "beta": -177.787, "gamma": 52.899, "delta": 146.193, "epsilon": -166.691, "zeta": -121.165, "epsilon_zeta": -45.526, "bb_type": "BI", "chi": -114.711, "glyco_bond": "anti", "C5prime_xyz": [ -2.011, 8.422, -1.461 ], "P_xyz": [ 0.420, 9.293, -0.918 ], "form": "B", "ssZp": 2.214, "Dp": 2.141, "splay_angle": 19.230, "splay_distance": 3.151, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 173.432, "theta": -143.472, "eta_prime": -162.238, "theta_prime": -158.532, "eta_base": -105.385, "theta_base": -115.862, "v0": -18.696, "v1": 33.253, "v2": -34.356, "v3": 24.466, "v4": -3.799, "amplitude": 35.208, "phase_angle": 167.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 18.219, -4.546, 28.409 ], "x_axis": [ 0.968, -0.003, -0.252 ], "y_axis": [ 0.128, 0.867, 0.481 ], "z_axis": [ 0.218, -0.498, 0.839 ], "quaternion": [ 0.958, 0.256, 0.123, -0.034 ] } }, { "index": 14, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.293, "beta": 159.214, "gamma": 74.601, "delta": 139.955, "epsilon": -168.020, "zeta": -81.783, "epsilon_zeta": -86.237, "bb_type": "BI", "chi": -127.122, "glyco_bond": "anti", "C5prime_xyz": [ -2.208, 8.721, -0.991 ], "P_xyz": [ 0.350, 9.284, -1.169 ], "form": ".", "ssZp": 2.338, "Dp": 2.239, "splay_angle": 22.356, "splay_distance": 3.891, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 161.335, "theta": -104.271, "eta_prime": -166.215, "theta_prime": -129.568, "eta_base": -115.167, "theta_base": -81.527, "v0": -28.756, "v1": 38.593, "v2": -33.345, "v3": 17.381, "v4": 7.012, "amplitude": 38.140, "phase_angle": 150.960, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 18.873, -6.221, 30.996 ], "x_axis": [ 0.859, 0.483, 0.169 ], "y_axis": [ -0.489, 0.675, 0.553 ], "z_axis": [ 0.153, -0.558, 0.816 ], "quaternion": [ 0.915, 0.303, -0.005, 0.266 ] } }, { "index": 15, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.403, "beta": -170.610, "gamma": 31.716, "delta": 135.698, "epsilon": -143.788, "zeta": -176.235, "epsilon_zeta": 32.447, "bb_type": "--", "chi": -98.867, "glyco_bond": "anti", "C5prime_xyz": [ -2.735, 8.063, -2.221 ], "P_xyz": [ -0.910, 9.938, -2.203 ], "form": ".", "ssZp": 1.759, "Dp": 1.807, "splay_angle": 21.914, "splay_distance": 3.775, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 160.719, "theta": 170.760, "eta_prime": -168.467, "theta_prime": 169.026, "eta_base": -109.288, "theta_base": -150.001, "v0": -28.180, "v1": 36.036, "v2": -29.805, "v3": 14.287, "v4": 8.579, "amplitude": 35.352, "phase_angle": 147.470, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 21.058, -6.406, 34.210 ], "x_axis": [ 0.227, 0.932, 0.283 ], "y_axis": [ -0.916, 0.106, 0.387 ], "z_axis": [ 0.331, -0.347, 0.878 ], "quaternion": [ 0.743, 0.247, 0.016, 0.621 ] } }, { "index": 16, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.118, "beta": 122.480, "gamma": 51.874, "delta": 115.087, "epsilon": -178.104, "zeta": -92.341, "epsilon_zeta": -85.763, "bb_type": "BI", "chi": -124.235, "glyco_bond": "anti", "C5prime_xyz": [ -2.312, 8.704, -1.462 ], "P_xyz": [ 0.329, 8.910, -1.555 ], "form": "B", "ssZp": 2.526, "Dp": 2.626, "splay_angle": 18.233, "splay_distance": 3.103, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 170.324, "theta": -135.455, "eta_prime": -169.384, "theta_prime": -155.336, "eta_base": -128.457, "theta_base": -124.697, "v0": -29.882, "v1": 28.891, "v2": -17.501, "v3": 0.475, "v4": 18.459, "amplitude": 30.468, "phase_angle": 125.058, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 21.556, -9.061, 36.847 ], "x_axis": [ -0.154, 0.711, 0.686 ], "y_axis": [ -0.917, -0.362, 0.169 ], "z_axis": [ 0.368, -0.603, 0.708 ], "quaternion": [ 0.546, 0.353, -0.145, 0.746 ] } }, { "index": 17, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.343, "beta": -173.427, "gamma": 34.617, "delta": 135.813, "epsilon": 173.462, "zeta": -109.897, "epsilon_zeta": -76.641, "bb_type": "BI", "chi": -112.272, "glyco_bond": "anti", "C5prime_xyz": [ -2.143, 8.329, -1.742 ], "P_xyz": [ 0.010, 9.790, -1.238 ], "form": "B", "ssZp": 2.460, "Dp": 2.441, "splay_angle": 24.452, "splay_distance": 4.009, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 162.591, "theta": -150.050, "eta_prime": -173.806, "theta_prime": -157.111, "eta_base": -131.280, "theta_base": -107.375, "v0": -24.839, "v1": 33.171, "v2": -28.572, "v3": 14.762, "v4": 6.111, "amplitude": 32.765, "phase_angle": 150.695, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 23.062, -10.575, 39.098 ], "x_axis": [ -0.653, 0.469, 0.595 ], "y_axis": [ -0.671, -0.723, -0.166 ], "z_axis": [ 0.352, -0.507, 0.786 ], "quaternion": [ 0.320, 0.266, -0.189, 0.889 ] } }, { "index": 18, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.306, "beta": 162.001, "gamma": 47.743, "delta": 145.425, "epsilon": -172.259, "zeta": -139.232, "epsilon_zeta": -33.027, "bb_type": "--", "chi": -124.392, "glyco_bond": "anti", "C5prime_xyz": [ -2.205, 8.686, -1.068 ], "P_xyz": [ 0.169, 9.586, -0.320 ], "form": ".", "ssZp": 2.004, "Dp": 2.117, "splay_angle": 20.855, "splay_distance": 3.572, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 172.474, "theta": -117.008, "eta_prime": -152.797, "theta_prime": -136.787, "eta_base": -95.288, "theta_base": -95.481, "v0": -27.774, "v1": 39.761, "v2": -36.455, "v3": 21.363, "v4": 3.757, "amplitude": 39.902, "phase_angle": 156.011, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 23.595, -12.111, 42.763 ], "x_axis": [ -0.923, -0.125, 0.364 ], "y_axis": [ -0.128, -0.792, -0.596 ], "z_axis": [ 0.363, -0.597, 0.715 ], "quaternion": [ 0.001, 0.196, -0.322, 0.926 ] } }, { "index": 19, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 54.700, "beta": 125.793, "gamma": -38.995, "delta": 123.603, "epsilon": 103.659, "zeta": -53.165, "epsilon_zeta": -203.175, "bb_type": "--", "chi": -99.007, "glyco_bond": "anti", "C5prime_xyz": [ -1.726, 7.857, -2.310 ], "P_xyz": [ -0.171, 9.851, -1.650 ], "form": ".", "ssZp": 1.173, "Dp": 1.278, "splay_angle": 33.030, "splay_distance": 5.263, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": 163.966, "theta": 178.204, "eta_prime": -166.155, "theta_prime": 170.911, "eta_base": -115.237, "theta_base": -148.931, "v0": -6.920, "v1": 17.138, "v2": -20.277, "v3": 16.502, "v4": -6.197, "amplitude": 20.282, "phase_angle": 178.752, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 23.693, -13.945, 45.826 ], "x_axis": [ -0.834, -0.485, -0.263 ], "y_axis": [ 0.520, -0.531, -0.669 ], "z_axis": [ 0.185, -0.695, 0.695 ], "quaternion": [ -0.287, -0.022, -0.390, 0.875 ] } }, { "index": 20, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -100.353, "beta": -129.214, "gamma": 85.131, "delta": 115.935, "epsilon": 165.974, "zeta": -94.141, "epsilon_zeta": -99.885, "bb_type": "BI", "chi": -117.996, "glyco_bond": "anti", "C5prime_xyz": [ -2.404, 8.465, -1.781 ], "P_xyz": [ 0.167, 9.093, -1.690 ], "form": ".", "ssZp": 2.831, "Dp": 2.871, "splay_angle": 23.973, "splay_distance": 4.034, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -169.158, "theta": -142.520, "eta_prime": -159.835, "theta_prime": -161.909, "eta_base": -122.389, "theta_base": -115.773, "v0": -30.749, "v1": 25.428, "v2": -11.162, "v3": -6.389, "v4": 23.365, "amplitude": 30.069, "phase_angle": 111.790, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 26.428, -15.187, 50.148 ], "x_axis": [ -0.125, -0.992, 0.011 ], "y_axis": [ 0.760, -0.103, -0.642 ], "z_axis": [ 0.638, -0.072, 0.767 ], "quaternion": [ 0.620, -0.230, 0.253, -0.706 ] } }, { "index": 21, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -29.971, "beta": 160.547, "gamma": 35.513, "delta": 85.392, "epsilon": -170.245, "zeta": -90.263, "epsilon_zeta": -79.982, "bb_type": "BI", "chi": -151.573, "glyco_bond": "anti", "C5prime_xyz": [ -1.867, 8.986, -0.107 ], "P_xyz": [ 0.616, 9.817, 0.376 ], "form": ".", "ssZp": 4.062, "Dp": 4.180, "splay_angle": 22.160, "splay_distance": 3.581, "splay_ratio": 0.192, "d22": 4.298, "d64": 4.322, "eta": 175.757, "theta": -158.943, "eta_prime": -172.804, "theta_prime": -155.024, "eta_base": -110.554, "theta_base": -124.050, "v0": -12.197, "v1": -10.460, "v2": 27.386, "v3": -35.041, "v4": 29.899, "amplitude": 34.920, "phase_angle": 38.347, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 28.679, -16.700, 53.133 ], "x_axis": [ 0.464, -0.835, -0.296 ], "y_axis": [ 0.572, 0.538, -0.619 ], "z_axis": [ 0.676, 0.118, 0.727 ], "quaternion": [ 0.826, -0.223, 0.294, -0.426 ] } }, { "index": 22, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -24.441, "beta": 152.739, "gamma": 49.212, "delta": 117.298, "epsilon": -169.343, "zeta": -93.799, "epsilon_zeta": -75.544, "bb_type": "BI", "chi": -143.284, "glyco_bond": "anti", "C5prime_xyz": [ -1.871, 8.839, -0.330 ], "P_xyz": [ 0.716, 9.279, 0.151 ], "form": "B", "ssZp": 3.167, "Dp": 3.014, "splay_angle": 17.463, "splay_distance": 2.905, "splay_ratio": 0.152, "d22": 4.244, "d64": 3.638, "eta": -177.925, "theta": -131.488, "eta_prime": -151.761, "theta_prime": -138.281, "eta_base": -112.670, "theta_base": -82.479, "v0": -22.030, "v1": 20.472, "v2": -11.515, "v3": -1.130, "v4": 14.693, "amplitude": 22.175, "phase_angle": 121.282, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.007, "origin": [ 30.822, -17.117, 55.972 ], "x_axis": [ 0.737, -0.448, -0.507 ], "y_axis": [ 0.293, 0.887, -0.357 ], "z_axis": [ 0.609, 0.115, 0.785 ], "quaternion": [ 0.923, -0.128, 0.302, -0.201 ] } }, { "index": 23, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -35.401, "beta": 158.335, "gamma": 46.999, "delta": 135.186, "epsilon": -152.402, "zeta": -126.894, "epsilon_zeta": -25.508, "bb_type": "--", "chi": -111.178, "glyco_bond": "anti", "C5prime_xyz": [ -2.371, 8.426, -1.813 ], "P_xyz": [ 0.077, 9.462, -1.732 ], "form": "B", "ssZp": 1.868, "Dp": 1.902, "splay_angle": 26.594, "splay_distance": 4.521, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 177.494, "theta": -138.448, "eta_prime": -146.320, "theta_prime": -149.243, "eta_base": -80.983, "theta_base": -101.333, "v0": -26.283, "v1": 35.717, "v2": -31.201, "v3": 16.877, "v4": 5.711, "amplitude": 35.303, "phase_angle": 152.104, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 33.519, -17.187, 57.048 ], "x_axis": [ 0.851, 0.274, -0.447 ], "y_axis": [ -0.151, 0.945, 0.291 ], "z_axis": [ 0.502, -0.180, 0.846 ], "quaternion": [ 0.954, 0.123, 0.249, 0.111 ] } }, { "index": 24, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.528, "beta": 150.241, "gamma": 27.727, "delta": 135.541, "epsilon": -161.564, "zeta": -152.277, "epsilon_zeta": -9.287, "bb_type": "--", "chi": -110.899, "glyco_bond": "anti", "C5prime_xyz": [ -2.498, 8.392, -1.846 ], "P_xyz": [ -0.184, 9.669, -1.614 ], "form": "B", "ssZp": 2.376, "Dp": 2.390, "splay_angle": 23.019, "splay_distance": 3.873, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.943, "theta": -161.095, "eta_prime": -165.853, "theta_prime": -171.949, "eta_base": -111.989, "theta_base": -139.485, "v0": -31.109, "v1": 38.742, "v2": -31.291, "v3": 14.048, "v4": 10.451, "amplitude": 37.981, "phase_angle": 145.474, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 36.357, -16.721, 60.536 ], "x_axis": [ 0.501, 0.841, -0.206 ], "y_axis": [ -0.720, 0.536, 0.440 ], "z_axis": [ 0.480, -0.072, 0.874 ], "quaternion": [ 0.853, 0.150, 0.201, 0.457 ] } }, { "index": 25, "index_chain": 16, "chain_name": "E", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -20.844, "beta": 134.822, "gamma": 37.276, "delta": 109.131, "epsilon": -162.143, "zeta": -91.195, "epsilon_zeta": -70.948, "bb_type": "BI", "chi": -139.545, "glyco_bond": "anti", "C5prime_xyz": [ -2.302, 8.932, -0.789 ], "P_xyz": [ 0.155, 9.737, -0.267 ], "form": "B", "ssZp": 2.857, "Dp": 2.780, "splay_angle": 18.715, "splay_distance": 3.217, "splay_ratio": 0.163, "d22": 4.269, "d64": 3.652, "eta": 179.979, "theta": -134.230, "eta_prime": -170.415, "theta_prime": -137.859, "eta_base": -133.259, "theta_base": -90.384, "v0": -31.333, "v1": 24.156, "v2": -8.555, "v3": -9.481, "v4": 25.918, "amplitude": 30.745, "phase_angle": 106.156, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 38.332, -17.945, 63.634 ], "x_axis": [ 0.104, 0.994, 0.043 ], "y_axis": [ -0.921, 0.080, 0.382 ], "z_axis": [ 0.376, -0.080, 0.923 ], "quaternion": [ 0.726, 0.159, 0.115, 0.659 ] } }, { "index": 26, "index_chain": 17, "chain_name": "E", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.450, "beta": 158.043, "gamma": 51.683, "delta": 131.790, "epsilon": -154.229, "zeta": -152.580, "epsilon_zeta": -1.650, "bb_type": "--", "chi": -110.783, "glyco_bond": "anti", "C5prime_xyz": [ -2.873, 8.382, -1.886 ], "P_xyz": [ -0.573, 9.660, -2.158 ], "form": "B", "ssZp": 2.211, "Dp": 2.188, "splay_angle": 19.638, "splay_distance": 3.291, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.227, "theta": -172.091, "eta_prime": -155.867, "theta_prime": -177.066, "eta_base": -100.767, "theta_base": -130.685, "v0": -35.030, "v1": 40.626, "v2": -30.588, "v3": 11.103, "v4": 14.726, "amplitude": 39.990, "phase_angle": 139.898, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 39.173, -16.825, 66.531 ], "x_axis": [ -0.462, 0.830, 0.313 ], "y_axis": [ -0.687, -0.558, 0.466 ], "z_axis": [ 0.561, 0.000, 0.828 ], "quaternion": [ 0.450, 0.259, 0.138, 0.844 ] } }, { "index": 27, "index_chain": 18, "chain_name": "E", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.313, "beta": 146.139, "gamma": 52.001, "delta": 138.718, "epsilon": -164.695, "zeta": -94.061, "epsilon_zeta": -70.633, "bb_type": "BI", "chi": -111.344, "glyco_bond": "anti", "C5prime_xyz": [ -2.088, 8.339, -1.655 ], "P_xyz": [ 0.473, 8.644, -1.316 ], "form": ".", "ssZp": 1.683, "Dp": 1.891, "splay_angle": 17.423, "splay_distance": 3.224, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 170.655, "theta": -112.768, "eta_prime": -162.665, "theta_prime": -143.211, "eta_base": -117.174, "theta_base": -118.218, "v0": -21.865, "v1": 33.576, "v2": -32.491, "v3": 20.619, "v4": 0.610, "amplitude": 34.470, "phase_angle": 160.489, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 40.851, -17.589, 69.256 ], "x_axis": [ -0.784, 0.321, 0.532 ], "y_axis": [ -0.244, -0.946, 0.212 ], "z_axis": [ 0.571, 0.036, 0.820 ], "quaternion": [ 0.150, 0.293, 0.066, 0.942 ] } }, { "index": 28, "index_chain": 19, "chain_name": "E", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -56.426, "beta": 170.855, "gamma": 37.764, "delta": 130.305, "epsilon": -151.584, "zeta": -155.376, "epsilon_zeta": 3.791, "bb_type": "--", "chi": -109.378, "glyco_bond": "anti", "C5prime_xyz": [ -3.143, 8.237, -2.074 ], "P_xyz": [ -1.521, 10.282, -2.311 ], "form": "B", "ssZp": 1.943, "Dp": 2.036, "splay_angle": 20.700, "splay_distance": 3.387, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 166.179, "theta": 170.564, "eta_prime": -170.793, "theta_prime": 175.947, "eta_base": -138.677, "theta_base": -158.937, "v0": -40.536, "v1": 44.268, "v2": -30.618, "v3": 8.297, "v4": 19.856, "amplitude": 43.793, "phase_angle": 134.360, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 42.500, -16.428, 71.772 ], "x_axis": [ -0.868, -0.133, 0.478 ], "y_axis": [ 0.163, -0.986, 0.021 ], "z_axis": [ 0.469, 0.096, 0.878 ], "quaternion": [ -0.077, 0.245, 0.030, 0.966 ] } }, { "index": 29, "index_chain": 20, "chain_name": "E", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/20", "linked_nts": [ "///E/19", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -54.379, "beta": 167.789, "gamma": 42.308, "delta": 134.060, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -90.027, "glyco_bond": "anti", "C5prime_xyz": [ -2.328, 7.681, -2.640 ], "P_xyz": [ 0.186, 8.489, -2.918 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -17.593, "v1": 28.036, "v2": -27.447, "v3": 17.669, "v4": -0.203, "amplitude": 28.891, "phase_angle": 161.810, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 45.203, -15.448, 73.561 ], "x_axis": [ -0.578, -0.578, 0.576 ], "y_axis": [ 0.683, -0.729, -0.046 ], "z_axis": [ 0.446, 0.366, 0.816 ], "quaternion": [ -0.357, 0.289, 0.091, 0.884 ] } }, { "index": 30, "index_chain": 1, "chain_name": "F", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/23", "linked_nts": [ null, "///F/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": 75.499, "gamma": 53.712, "delta": 125.394, "epsilon": 170.576, "zeta": -99.524, "epsilon_zeta": -89.901, "bb_type": "BI", "chi": -113.323, "glyco_bond": "anti", "C5prime_xyz": [ -2.647, 8.405, -1.853 ], "P_xyz": [ -0.111, 7.688, -1.740 ], "form": "B", "ssZp": 2.671, "Dp": 2.587, "splay_angle": 21.619, "splay_distance": 3.611, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": null, "theta": -114.529, "eta_prime": null, "theta_prime": -156.527, "eta_base": null, "theta_base": -116.900, "v0": -31.928, "v1": 34.473, "v2": -23.862, "v3": 5.828, "v4": 16.261, "amplitude": 34.535, "phase_angle": 133.707, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 24.678, -13.441, 45.078 ], "x_axis": [ -0.750, -0.626, -0.213 ], "y_axis": [ -0.609, 0.527, 0.593 ], "z_axis": [ -0.259, 0.574, -0.777 ], "quaternion": [ -0.013, -0.353, 0.874, 0.334 ] } }, { "index": 31, "index_chain": 2, "chain_name": "F", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/24", "linked_nts": [ "///F/23", "///F/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.129, "beta": -179.118, "gamma": 54.350, "delta": 116.534, "epsilon": -173.738, "zeta": -96.770, "epsilon_zeta": -76.968, "bb_type": "BI", "chi": -126.833, "glyco_bond": "anti", "C5prime_xyz": [ -1.964, 8.723, -1.277 ], "P_xyz": [ 0.435, 9.739, -0.810 ], "form": "B", "ssZp": 2.528, "Dp": 2.699, "splay_angle": 22.117, "splay_distance": 3.719, "splay_ratio": 0.194, "d22": 5.200, "d64": 4.598, "eta": 179.586, "theta": -150.357, "eta_prime": -164.481, "theta_prime": -153.269, "eta_base": -111.324, "theta_base": -115.462, "v0": -23.644, "v1": 22.193, "v2": -12.789, "v3": -0.726, "v4": 15.422, "amplitude": 23.858, "phase_angle": 122.416, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 23.023, -12.319, 42.071 ], "x_axis": [ -0.942, -0.188, 0.279 ], "y_axis": [ 0.011, 0.812, 0.583 ], "z_axis": [ -0.336, 0.552, -0.763 ], "quaternion": [ -0.164, -0.047, 0.938, 0.303 ] } }, { "index": 32, "index_chain": 3, "chain_name": "F", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/25", "linked_nts": [ "///F/24", "///F/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.030, "beta": 170.047, "gamma": 62.104, "delta": 150.111, "epsilon": -152.247, "zeta": -154.658, "epsilon_zeta": 2.411, "bb_type": "--", "chi": -104.290, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.181, -1.945 ], "P_xyz": [ -0.052, 9.066, -2.241 ], "form": "B", "ssZp": 2.118, "Dp": 2.068, "splay_angle": 16.950, "splay_distance": 2.789, "splay_ratio": 0.148, "d22": 4.237, "d64": 3.275, "eta": 175.052, "theta": -144.034, "eta_prime": -151.058, "theta_prime": -162.666, "eta_base": -110.909, "theta_base": -100.715, "v0": -27.777, "v1": 41.356, "v2": -38.601, "v3": 23.551, "v4": 2.361, "amplitude": 41.626, "phase_angle": 158.023, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 21.823, -10.028, 39.398 ], "x_axis": [ -0.831, 0.414, 0.371 ], "y_axis": [ 0.514, 0.827, 0.227 ], "z_axis": [ -0.213, 0.380, -0.900 ], "quaternion": [ -0.155, 0.246, 0.943, 0.161 ] } }, { "index": 33, "index_chain": 4, "chain_name": "F", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/26", "linked_nts": [ "///F/25", "///F/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.030, "beta": 129.370, "gamma": 39.794, "delta": 122.050, "epsilon": -152.059, "zeta": -132.242, "epsilon_zeta": -19.816, "bb_type": "--", "chi": -108.736, "glyco_bond": "anti", "C5prime_xyz": [ -2.834, 8.279, -2.051 ], "P_xyz": [ -0.324, 9.047, -2.292 ], "form": "B", "ssZp": 2.237, "Dp": 2.392, "splay_angle": 24.490, "splay_distance": 4.174, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 173.072, "theta": -154.008, "eta_prime": -166.929, "theta_prime": -161.146, "eta_base": -101.053, "theta_base": -119.306, "v0": -35.006, "v1": 36.253, "v2": -23.653, "v3": 4.094, "v4": 19.187, "amplitude": 36.697, "phase_angle": 130.132, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 20.880, -8.092, 37.627 ], "x_axis": [ -0.310, 0.892, 0.330 ], "y_axis": [ 0.876, 0.403, -0.265 ], "z_axis": [ -0.369, 0.207, -0.906 ], "quaternion": [ -0.216, 0.546, 0.809, -0.018 ] } }, { "index": 34, "index_chain": 5, "chain_name": "F", "nt_resnum": 27, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/27", "linked_nts": [ "///F/26", "///F/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.068, "beta": 148.809, "gamma": 57.354, "delta": 139.905, "epsilon": -172.996, "zeta": -112.866, "epsilon_zeta": -60.130, "bb_type": "BI", "chi": -114.369, "glyco_bond": "anti", "C5prime_xyz": [ -2.171, 8.484, -1.609 ], "P_xyz": [ 0.450, 8.897, -1.665 ], "form": "B", "ssZp": 2.208, "Dp": 2.238, "splay_angle": 20.240, "splay_distance": 3.308, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 160.313, "theta": -134.056, "eta_prime": -166.033, "theta_prime": -157.333, "eta_base": -120.239, "theta_base": -111.580, "v0": -25.251, "v1": 36.705, "v2": -33.844, "v3": 19.864, "v4": 3.111, "amplitude": 36.894, "phase_angle": 156.541, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 20.449, -6.519, 33.785 ], "x_axis": [ 0.347, 0.891, 0.291 ], "y_axis": [ 0.887, -0.212, -0.409 ], "z_axis": [ -0.303, 0.400, -0.865 ], "quaternion": [ -0.260, 0.778, 0.571, -0.004 ] } }, { "index": 35, "index_chain": 6, "chain_name": "F", "nt_resnum": 28, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/28", "linked_nts": [ "///F/27", "///F/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.850, "beta": 179.128, "gamma": 46.199, "delta": 134.109, "epsilon": -168.246, "zeta": -112.435, "epsilon_zeta": -55.811, "bb_type": "BI", "chi": -106.400, "glyco_bond": "anti", "C5prime_xyz": [ -2.129, 8.207, -2.010 ], "P_xyz": [ 0.283, 9.200, -1.951 ], "form": "B", "ssZp": 2.156, "Dp": 2.330, "splay_angle": 19.269, "splay_distance": 3.258, "splay_ratio": 0.171, "d22": 4.704, "d64": 3.704, "eta": 173.338, "theta": -148.251, "eta_prime": -166.279, "theta_prime": -155.094, "eta_base": -113.579, "theta_base": -118.695, "v0": -24.382, "v1": 31.439, "v2": -26.539, "v3": 12.976, "v4": 6.991, "amplitude": 31.089, "phase_angle": 148.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 19.765, -4.786, 31.052 ], "x_axis": [ 0.816, 0.566, -0.120 ], "y_axis": [ 0.406, -0.708, -0.578 ], "z_axis": [ -0.412, 0.422, -0.807 ], "quaternion": [ -0.274, 0.913, 0.266, -0.146 ] } }, { "index": 36, "index_chain": 7, "chain_name": "F", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/29", "linked_nts": [ "///F/28", "///F/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.188, "beta": 165.185, "gamma": 66.916, "delta": 138.821, "epsilon": -150.607, "zeta": -124.312, "epsilon_zeta": -26.295, "bb_type": "--", "chi": -96.751, "glyco_bond": "anti", "C5prime_xyz": [ -2.647, 8.034, -2.284 ], "P_xyz": [ -0.183, 8.786, -2.771 ], "form": "B", "ssZp": 1.626, "Dp": 1.858, "splay_angle": 20.481, "splay_distance": 3.489, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 176.773, "theta": -153.684, "eta_prime": -156.068, "theta_prime": -173.740, "eta_base": -119.567, "theta_base": -139.820, "v0": -27.784, "v1": 39.023, "v2": -35.213, "v3": 20.021, "v4": 4.726, "amplitude": 38.988, "phase_angle": 154.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 18.805, -3.813, 28.095 ], "x_axis": [ 0.913, 0.108, -0.394 ], "y_axis": [ -0.154, -0.802, -0.578 ], "z_axis": [ -0.378, 0.588, -0.715 ], "quaternion": [ -0.315, 0.926, -0.013, -0.208 ] } }, { "index": 37, "index_chain": 8, "chain_name": "F", "nt_resnum": 30, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/30", "linked_nts": [ "///F/29", "///F/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -102.273, "beta": 133.749, "gamma": 102.052, "delta": 148.873, "epsilon": -133.687, "zeta": -97.877, "epsilon_zeta": -35.810, "bb_type": "--", "chi": -132.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.228, 8.721, -0.595 ], "P_xyz": [ 0.189, 9.159, -1.530 ], "form": ".", "ssZp": 1.233, "Dp": 1.488, "splay_angle": 16.817, "splay_distance": 2.954, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 178.628, "theta": -121.106, "eta_prime": -160.952, "theta_prime": -148.587, "eta_base": -129.652, "theta_base": -116.015, "v0": -27.552, "v1": 41.438, "v2": -38.722, "v3": 24.023, "v4": 2.054, "amplitude": 41.627, "phase_angle": 158.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 16.671, -2.153, 25.888 ], "x_axis": [ 0.763, -0.396, -0.511 ], "y_axis": [ -0.585, -0.759, -0.285 ], "z_axis": [ -0.275, 0.517, -0.811 ], "quaternion": [ -0.220, 0.913, -0.269, -0.215 ] } }, { "index": 38, "index_chain": 9, "chain_name": "F", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/31", "linked_nts": [ "///F/30", "///F/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -81.696, "beta": 155.775, "gamma": 44.981, "delta": 118.786, "epsilon": -157.240, "zeta": -133.916, "epsilon_zeta": -23.324, "bb_type": "--", "chi": -102.823, "glyco_bond": "anti", "C5prime_xyz": [ -3.346, 8.012, -2.252 ], "P_xyz": [ -1.490, 9.514, -3.216 ], "form": "B", "ssZp": 2.144, "Dp": 2.218, "splay_angle": 18.931, "splay_distance": 3.269, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 138.969, "theta": -179.887, "eta_prime": 171.777, "theta_prime": 179.884, "eta_base": -148.841, "theta_base": -132.663, "v0": -41.160, "v1": 39.773, "v2": -23.073, "v3": 0.139, "v4": 25.466, "amplitude": 41.526, "phase_angle": 123.754, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 16.493, -0.257, 23.630 ], "x_axis": [ 0.358, -0.759, -0.544 ], "y_axis": [ -0.926, -0.361, -0.106 ], "z_axis": [ -0.116, 0.542, -0.832 ], "quaternion": [ -0.203, 0.799, -0.528, -0.206 ] } }, { "index": 39, "index_chain": 10, "chain_name": "F", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/32", "linked_nts": [ "///F/31", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -75.504, "beta": 152.168, "gamma": 71.951, "delta": 128.303, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -112.553, "glyco_bond": "anti", "C5prime_xyz": [ -2.044, 8.401, -1.763 ], "P_xyz": [ 0.546, 8.439, -2.309 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -20.523, "v1": 27.027, "v2": -23.205, "v3": 11.665, "v4": 5.510, "amplitude": 26.821, "phase_angle": 149.903, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 15.093, 1.056, 20.983 ], "x_axis": [ -0.271, -0.886, -0.376 ], "y_axis": [ -0.962, 0.253, 0.099 ], "z_axis": [ 0.007, 0.389, -0.921 ], "quaternion": [ 0.122, -0.591, 0.782, 0.156 ] } } ], "num_hbonds": 1150, "hbonds": [ { "index": 1, "atom1_serNum": 17, "atom2_serNum": 576, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/2/O6", "atom2_id": "///E/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 18, "atom2_serNum": 574, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///D/2/N1", "atom2_id": "///E/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 20, "atom2_serNum": 573, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///D/2/N2", "atom2_id": "///E/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 37, "atom2_serNum": 556, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///D/3/N3", "atom2_id": "///E/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 62, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///D/4/N2", "atom2_id": "///E/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 66, "atom2_serNum": 5664, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///D/5/OP1", "atom2_id": "///H/401/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 7, "atom1_serNum": 81, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///D/5/O6", "atom2_id": "///E/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 82, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///D/5/N1", "atom2_id": "///E/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 84, "atom2_serNum": 514, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/5/N2", "atom2_id": "///E/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 100, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///D/6/O2", "atom2_id": "///E/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 101, "atom2_serNum": 496, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///D/6/N3", "atom2_id": "///E/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 103, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///D/6/N4", "atom2_id": "///E/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 122, "atom2_serNum": 476, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///D/7/O6", "atom2_id": "///E/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 123, "atom2_serNum": 474, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///D/7/N1", "atom2_id": "///E/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 125, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///D/7/N2", "atom2_id": "///E/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 125, "atom2_serNum": 474, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///D/7/N2", "atom2_id": "///E/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 144, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///D/8/N6", "atom2_id": "///E/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 145, "atom2_serNum": 454, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///D/8/N1", "atom2_id": "///E/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 165, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 2.300, "atom1_id": "///D/9/O6", "atom2_id": "///E/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 166, "atom2_serNum": 435, "donAcc_type": "standard", "distance": 2.390, "atom1_id": "///D/9/N1", "atom2_id": "///E/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 168, "atom2_serNum": 434, "donAcc_type": "standard", "distance": 2.345, "atom1_id": "///D/9/N2", "atom2_id": "///E/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 185, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/10/N3", "atom2_id": "///E/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 187, "atom2_serNum": 415, "donAcc_type": "standard", "distance": 2.226, "atom1_id": "///D/10/N4", "atom2_id": "///E/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 226, "atom2_serNum": 779, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///E/2/O6", "atom2_id": "///F/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 227, "atom2_serNum": 777, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///E/2/N1", "atom2_id": "///F/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 246, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///E/3/N3", "atom2_id": "///F/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 248, "atom2_serNum": 758, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///E/3/O4", "atom2_id": "///F/30/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 268, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///E/4/O6", "atom2_id": "///F/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 268, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///E/4/O6", "atom2_id": "///F/29/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 269, "atom2_serNum": 737, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///E/4/N1", "atom2_id": "///F/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 271, "atom2_serNum": 736, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///E/4/N2", "atom2_id": "///F/29/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 290, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///E/5/O6", "atom2_id": "///F/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 291, "atom2_serNum": 717, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///E/5/N1", "atom2_id": "///F/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 291, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/5/N1", "atom2_id": "///F/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 293, "atom2_serNum": 717, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///E/5/N2", "atom2_id": "///F/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 309, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.360, "atom1_id": "///E/6/O2", "atom2_id": "///F/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 310, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///E/6/N3", "atom2_id": "///F/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 312, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/6/N4", "atom2_id": "///F/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 331, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///E/7/O6", "atom2_id": "///F/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 332, "atom2_serNum": 676, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///E/7/N1", "atom2_id": "///F/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 332, "atom2_serNum": 677, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///E/7/N1", "atom2_id": "///F/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 334, "atom2_serNum": 676, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///E/7/N2", "atom2_id": "///F/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 353, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///E/8/N6", "atom2_id": "///F/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 354, "atom2_serNum": 656, "donAcc_type": "questionable", "distance": 3.207, "atom1_id": "///E/8/N1", "atom2_id": "///F/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 354, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///E/8/N1", "atom2_id": "///F/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 374, "atom2_serNum": 640, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///E/9/O6", "atom2_id": "///F/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 375, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///E/9/N1", "atom2_id": "///F/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 377, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///E/9/N2", "atom2_id": "///F/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 393, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///E/10/O2", "atom2_id": "///F/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 394, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///E/10/N3", "atom2_id": "///F/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 396, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 2.435, "atom1_id": "///E/10/N4", "atom2_id": "///F/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 743, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///F/30/OP1", "atom2_id": "///A/424/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 53, "atom1_serNum": 765, "atom2_serNum": 1372, "donAcc_type": "acceptable", "distance": 2.369, "atom1_id": "///F/31/OP2", "atom2_id": "///A/436/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 784, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/32/OP2", "atom2_id": "///A/420/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 828, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 835, "atom2_serNum": 875, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 847, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 859, "atom2_serNum": 892, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 867, "atom2_serNum": 900, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 878, "atom2_serNum": 907, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 884, "atom2_serNum": 914, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 895, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 903, "atom2_serNum": 931, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 903, "atom2_serNum": 936, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///A/381/O", "atom2_id": "///A/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 910, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/382/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 917, "atom2_serNum": 945, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/383/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 925, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/384/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 941, "atom2_serNum": 965, "donAcc_type": "questionable", "distance": 3.217, "atom1_id": "///A/386/O", "atom2_id": "///A/389/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 965, "atom2_serNum": 995, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 968, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///A/389/OD1", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 973, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 982, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/391/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 986, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/391/OD2", "atom2_id": "///A/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 990, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/392/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 993, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/392/OD1", "atom2_id": "///A/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 994, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/392/OD2", "atom2_id": "///A/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 994, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/392/OD2", "atom2_id": "///A/591/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 1030, "atom2_serNum": 1063, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/397/N", "atom2_id": "///A/400/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 1033, "atom2_serNum": 1065, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 1036, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/397/OD1", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 1036, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/397/OD1", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 1037, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/397/OD2", "atom2_id": "///A/599/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 1041, "atom2_serNum": 1074, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/398/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 1050, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/399/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 1059, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/400/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 1059, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 1063, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/400/OE1", "atom2_id": "///A/599/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 1064, "atom2_serNum": 2065, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/400/OE2", "atom2_id": "///A/547/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 1064, "atom2_serNum": 2066, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/400/OE2", "atom2_id": "///A/547/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 1068, "atom2_serNum": 1093, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 1068, "atom2_serNum": 1098, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///A/401/O", "atom2_id": "///A/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 1077, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 1081, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 1089, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 1096, "atom2_serNum": 1132, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 1112, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/407/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 1112, "atom2_serNum": 1179, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/407/O", "atom2_id": "///A/415/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 1149, "atom2_serNum": 1474, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/411/N", "atom2_id": "///A/449/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 1152, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 1154, "atom2_serNum": 1167, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///A/411/OG", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 1154, "atom2_serNum": 1473, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///A/411/OG", "atom2_id": "///A/449/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1158, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1163, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1170, "atom2_serNum": 1197, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1174, "atom2_serNum": 1209, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1183, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1192, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1200, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1212, "atom2_serNum": 1246, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1230, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/421/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1264, "atom2_serNum": 1372, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/424/NH1", "atom2_id": "///A/436/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1269, "atom2_serNum": 1283, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/425/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1297, "atom2_serNum": 1613, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/428/NE1", "atom2_id": "///A/467/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1303, "atom2_serNum": 1967, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/429/N", "atom2_id": "///A/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1306, "atom2_serNum": 1964, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/429/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1314, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/430/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1319, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.275, "atom1_id": "///A/430/NZ", "atom2_id": "///A/531/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1320, "atom2_serNum": 1952, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///A/431/N", "atom2_id": "///A/533/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1323, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/431/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1360, "atom2_serNum": 1373, "donAcc_type": "standard", "distance": 3.915, "atom1_id": "///A/435/OE2", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1364, "atom2_serNum": 1391, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/436/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1364, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1382, "atom2_serNum": 1389, "donAcc_type": "standard", "distance": 2.506, "atom1_id": "///A/438/N", "atom2_id": "///A/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1418, "atom2_serNum": 1428, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/442/OD1", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1423, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/443/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1423, "atom2_serNum": 1449, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1431, "atom2_serNum": 1457, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1433, "atom2_serNum": 1465, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///A/444/OG1", "atom2_id": "///A/448/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1438, "atom2_serNum": 1466, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1445, "atom2_serNum": 1475, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/446/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1452, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/447/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1452, "atom2_serNum": 1488, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/447/O", "atom2_id": "///A/451/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1460, "atom2_serNum": 1490, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/448/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1469, "atom2_serNum": 1498, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/449/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1478, "atom2_serNum": 1507, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/450/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1486, "atom2_serNum": 1503, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/451/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1510, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/455/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1526, "atom2_serNum": 1974, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/457/N", "atom2_id": "///A/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1529, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/457/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1533, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///A/457/OE1", "atom2_id": "///A/536/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1533, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/457/OE1", "atom2_id": "///A/536/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1534, "atom2_serNum": 1564, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/457/NE2", "atom2_id": "///A/461/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1538, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/458/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1540, "atom2_serNum": 1556, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///A/458/OG1", "atom2_id": "///A/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1542, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/459/N", "atom2_id": "///A/459/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1542, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/459/N", "atom2_id": "///A/534/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1545, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/459/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1549, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///A/459/OE1", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1560, "atom2_serNum": 1574, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/461/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1569, "atom2_serNum": 1926, "donAcc_type": "standard", "distance": 3.852, "atom1_id": "///A/462/O", "atom2_id": "///A/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1586, "atom2_serNum": 1615, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1595, "atom2_serNum": 1622, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1603, "atom2_serNum": 1630, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1609, "atom2_serNum": 1639, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1614, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/467/OE2", "atom2_id": "///A/536/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1618, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/468/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1655, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.341, "atom1_id": "///A/473/N", "atom2_id": "///A/476/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1658, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1660, "atom2_serNum": 1681, "donAcc_type": "acceptable", "distance": 2.990, "atom1_id": "///A/473/OG", "atom2_id": "///A/476/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1664, "atom2_serNum": 1690, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1664, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///A/474/O", "atom2_id": "///A/493/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1669, "atom2_serNum": 1699, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/475/O", "atom2_id": "///A/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1676, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/476/O", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1685, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/477/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1693, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/478/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1702, "atom2_serNum": 1727, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/479/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1708, "atom2_serNum": 1734, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///A/480/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1716, "atom2_serNum": 1755, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/481/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1721, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/482/O", "atom2_id": "///A/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1776, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.425, "atom1_id": "///A/488/OD1", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1800, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/492/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1800, "atom2_serNum": 1833, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1809, "atom2_serNum": 1841, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1818, "atom2_serNum": 1848, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/494/O", "atom2_id": "///A/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1827, "atom2_serNum": 1856, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/495/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1836, "atom2_serNum": 1861, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/496/O", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1844, "atom2_serNum": 1872, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1851, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1859, "atom2_serNum": 1889, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/499/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1864, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/500/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1905, "atom2_serNum": 1932, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/526/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1916, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1921, "atom2_serNum": 1945, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///A/528/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1993, "atom2_serNum": 2016, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///A/538/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1999, "atom2_serNum": 2027, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/539/O", "atom2_id": "///A/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 2008, "atom2_serNum": 2027, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/540/O", "atom2_id": "///A/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 2008, "atom2_serNum": 2032, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/540/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 2012, "atom2_serNum": 2032, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/541/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 2012, "atom2_serNum": 2039, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/541/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 2019, "atom2_serNum": 2050, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 2030, "atom2_serNum": 2056, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 2035, "atom2_serNum": 2067, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 2042, "atom2_serNum": 2075, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 2053, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 2055, "atom2_serNum": 2428, "donAcc_type": "acceptable", "distance": 3.816, "atom1_id": "///A/546/OG", "atom2_id": "///A/610/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 2059, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/547/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 2070, "atom2_serNum": 2099, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 2078, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 2102, "atom2_serNum": 4239, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/552/O", "atom2_id": "///A/861/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 2127, "atom2_serNum": 2129, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///A/555/O", "atom2_id": "///A/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 2139, "atom2_serNum": 2159, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/576/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 2154, "atom2_serNum": 2171, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/578/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 2154, "atom2_serNum": 2182, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///A/578/O", "atom2_id": "///A/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 2193, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/583/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2234, "atom2_serNum": 4235, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///A/587/OH", "atom2_id": "///A/861/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2234, "atom2_serNum": 4251, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///A/587/OH", "atom2_id": "///A/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2250, "atom2_serNum": 4213, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/590/N", "atom2_id": "///A/859/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2253, "atom2_serNum": 4195, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/590/O", "atom2_id": "///A/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2269, "atom2_serNum": 4201, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///A/592/N", "atom2_id": "///A/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2281, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 3.993, "atom1_id": "///A/593/O", "atom2_id": "///A/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2314, "atom2_serNum": 2357, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/597/N", "atom2_id": "///A/601/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2326, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2329, "atom2_serNum": 2350, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/598/OD1", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2329, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///A/598/OD1", "atom2_id": "///A/604/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2334, "atom2_serNum": 2366, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/599/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2340, "atom2_serNum": 2348, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/599/NH1", "atom2_id": "///A/600/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2345, "atom2_serNum": 2374, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/600/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2353, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/601/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2357, "atom2_serNum": 2756, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/601/OD2", "atom2_id": "///A/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2361, "atom2_serNum": 2397, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/602/O", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2369, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/603/O", "atom2_id": "///A/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2377, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2388, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2388, "atom2_serNum": 2417, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///A/605/O", "atom2_id": "///A/609/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2400, "atom2_serNum": 2419, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2405, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/607/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2410, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2415, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/609/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2422, "atom2_serNum": 2451, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/610/O", "atom2_id": "///A/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2432, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/611/O", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2440, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/612/O", "atom2_id": "///A/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2440, "atom2_serNum": 2472, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///A/612/O", "atom2_id": "///A/616/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2448, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2454, "atom2_serNum": 2479, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2462, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2470, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2472, "atom2_serNum": 2945, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///A/616/OG", "atom2_id": "///A/672/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2476, "atom2_serNum": 2497, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/617/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2482, "atom2_serNum": 2505, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/618/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2482, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/618/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2487, "atom2_serNum": 2505, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/619/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2508, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/622/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2512, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/623/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2520, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/624/O", "atom2_id": "///A/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2534, "atom2_serNum": 2563, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/625/O", "atom2_id": "///A/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2543, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/626/O", "atom2_id": "///A/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2552, "atom2_serNum": 2580, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/627/O", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2557, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/628/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2562, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 3.903, "atom1_id": "///A/628/NZ", "atom2_id": "///A/629/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2566, "atom2_serNum": 2594, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2575, "atom2_serNum": 2600, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2583, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2588, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/632/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2592, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/632/OE1", "atom2_id": "///A/636/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2597, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/633/O", "atom2_id": "///A/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2603, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/634/O", "atom2_id": "///A/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2608, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 3.904, "atom1_id": "///A/635/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2617, "atom2_serNum": 2663, "donAcc_type": "standard", "distance": 3.768, "atom1_id": "///A/636/O", "atom2_id": "///A/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2628, "atom2_serNum": 2672, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/637/O", "atom2_id": "///A/640/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2636, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/638/O", "atom2_id": "///A/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2636, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 2.299, "atom1_id": "///A/638/O", "atom2_id": "///A/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2653, "atom2_serNum": 2697, "donAcc_type": "questionable", "distance": 2.160, "atom1_id": "///A/639/O", "atom2_id": "///A/643/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2677, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.139, "atom1_id": "///A/641/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2677, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 2.363, "atom1_id": "///A/641/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2705, "atom2_serNum": 2716, "donAcc_type": "acceptable", "distance": 2.377, "atom1_id": "///A/644/ND1", "atom2_id": "///A/646/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2712, "atom2_serNum": 2730, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/645/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2719, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2725, "atom2_serNum": 2757, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2733, "atom2_serNum": 2757, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/648/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2733, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2744, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/649/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2744, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/649/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2750, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/650/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2750, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 3.745, "atom1_id": "///A/650/O", "atom2_id": "///A/658/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2760, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 2.505, "atom1_id": "///A/651/O", "atom2_id": "///A/658/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2777, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/653/O", "atom2_id": "///A/658/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2785, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/654/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2785, "atom2_serNum": 2816, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/654/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2792, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/655/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2811, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/657/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2847, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/661/O", "atom2_id": "///A/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2854, "atom2_serNum": 2884, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/662/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2861, "atom2_serNum": 2896, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2861, "atom2_serNum": 2901, "donAcc_type": "acceptable", "distance": 2.490, "atom1_id": "///A/663/O", "atom2_id": "///A/667/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2865, "atom2_serNum": 2903, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2879, "atom2_serNum": 2914, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/665/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2887, "atom2_serNum": 2922, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/666/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2899, "atom2_serNum": 2930, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/667/O", "atom2_id": "///A/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2906, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/668/O", "atom2_id": "///A/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2910, "atom2_serNum": 2946, "donAcc_type": "questionable", "distance": 3.264, "atom1_id": "///A/668/NE", "atom2_id": "///A/672/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2917, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/669/O", "atom2_id": "///A/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2925, "atom2_serNum": 2958, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/670/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2933, "atom2_serNum": 2965, "donAcc_type": "standard", "distance": 3.705, "atom1_id": "///A/671/O", "atom2_id": "///A/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2935, "atom2_serNum": 3235, "donAcc_type": "acceptable", "distance": 3.246, "atom1_id": "///A/671/OG", "atom2_id": "///A/706/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2935, "atom2_serNum": 3244, "donAcc_type": "acceptable", "distance": 3.794, "atom1_id": "///A/671/OG", "atom2_id": "///A/707/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2939, "atom2_serNum": 2974, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/672/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2950, "atom2_serNum": 2982, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/673/O", "atom2_id": "///A/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2961, "atom2_serNum": 2990, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/674/O", "atom2_id": "///A/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2968, "atom2_serNum": 2999, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/675/O", "atom2_id": "///A/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2977, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/676/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2985, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/677/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2985, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/677/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2993, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/678/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2998, "atom2_serNum": 3310, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/678/NE2", "atom2_id": "///A/714/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 3024, "atom2_serNum": 3047, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///A/681/ND1", "atom2_id": "///A/683/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 3031, "atom2_serNum": 3066, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/682/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 3036, "atom2_serNum": 3055, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/683/N", "atom2_id": "///A/684/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 3039, "atom2_serNum": 3071, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/683/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 3048, "atom2_serNum": 3055, "donAcc_type": "standard", "distance": 2.250, "atom1_id": "///A/684/N", "atom2_id": "///A/684/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 3051, "atom2_serNum": 3071, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/684/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 3051, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/684/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 3057, "atom2_serNum": 3064, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/685/N", "atom2_id": "///A/685/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 3060, "atom2_serNum": 3089, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/685/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 3069, "atom2_serNum": 3098, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/686/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 3074, "atom2_serNum": 3106, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/687/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 3081, "atom2_serNum": 3115, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/688/O", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 3092, "atom2_serNum": 3120, "donAcc_type": "acceptable", "distance": 2.386, "atom1_id": "///A/689/O", "atom2_id": "///A/692/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 3092, "atom2_serNum": 3121, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/689/O", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 3101, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/690/O", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 3109, "atom2_serNum": 3137, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/691/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 3118, "atom2_serNum": 3137, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/692/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 3118, "atom2_serNum": 3142, "donAcc_type": "acceptable", "distance": 2.382, "atom1_id": "///A/692/O", "atom2_id": "///A/695/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 3124, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/693/O", "atom2_id": "///A/704/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 3132, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/694/O", "atom2_id": "///A/704/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 3132, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/694/O", "atom2_id": "///A/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 3146, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 2.405, "atom1_id": "///A/696/O", "atom2_id": "///A/704/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3150, "atom2_serNum": 3163, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/696/OE1", "atom2_id": "///A/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3150, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/696/OE1", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3151, "atom2_serNum": 3174, "donAcc_type": "standard", "distance": 3.680, "atom1_id": "///A/696/NE2", "atom2_id": "///A/699/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3186, "atom2_serNum": 3204, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/700/O", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3192, "atom2_serNum": 3210, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/701/O", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3196, "atom2_serNum": 3202, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///A/702/N", "atom2_id": "///A/702/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3202, "atom2_serNum": 3204, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/702/OD1", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3207, "atom2_serNum": 3225, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/703/O", "atom2_id": "///A/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3207, "atom2_serNum": 3236, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/703/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3209, "atom2_serNum": 3234, "donAcc_type": "acceptable", "distance": 3.820, "atom1_id": "///A/703/OG", "atom2_id": "///A/706/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3213, "atom2_serNum": 3250, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3224, "atom2_serNum": 3264, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3228, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3239, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/707/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3239, "atom2_serNum": 3283, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3253, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3258, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/708/NE1", "atom2_id": "///A/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3267, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3270, "atom2_serNum": 3553, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///A/709/OD1", "atom2_id": "///A/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3275, "atom2_serNum": 3304, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3286, "atom2_serNum": 3312, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3294, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/712/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3299, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/713/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3307, "atom2_serNum": 3349, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///A/714/O", "atom2_id": "///A/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3315, "atom2_serNum": 3357, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/715/O", "atom2_id": "///A/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3315, "atom2_serNum": 3366, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/715/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3326, "atom2_serNum": 3592, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///A/716/ND1", "atom2_id": "///A/749/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3337, "atom2_serNum": 3592, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/717/OE1", "atom2_id": "///A/749/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3337, "atom2_serNum": 3593, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/717/OE1", "atom2_id": "///A/749/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3369, "atom2_serNum": 3406, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///A/721/O", "atom2_id": "///A/725/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3380, "atom2_serNum": 3408, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3388, "atom2_serNum": 3416, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3397, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/724/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3404, "atom2_serNum": 3431, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/725/O", "atom2_id": "///A/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3411, "atom2_serNum": 3439, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/726/O", "atom2_id": "///A/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3419, "atom2_serNum": 3444, "donAcc_type": "acceptable", "distance": 2.362, "atom1_id": "///A/727/O", "atom2_id": "///A/730/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3419, "atom2_serNum": 3446, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/727/O", "atom2_id": "///A/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3428, "atom2_serNum": 3455, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/728/O", "atom2_id": "///A/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3434, "atom2_serNum": 3459, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/729/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3442, "atom2_serNum": 3467, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3449, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3462, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/733/O", "atom2_id": "///A/743/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3475, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///A/735/O", "atom2_id": "///A/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3499, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/738/O", "atom2_id": "///A/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3506, "atom2_serNum": 3529, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3511, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3518, "atom2_serNum": 3548, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3522, "atom2_serNum": 3554, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3532, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3543, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/744/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3551, "atom2_serNum": 3583, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/745/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3557, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/746/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3565, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/747/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3565, "atom2_serNum": 3599, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/747/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3577, "atom2_serNum": 3606, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/748/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3581, "atom2_serNum": 3616, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/748/OE1", "atom2_id": "///A/752/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3586, "atom2_serNum": 3617, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/749/O", "atom2_id": "///A/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3597, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/750/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3602, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/751/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3602, "atom2_serNum": 3636, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/751/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3628, "atom2_serNum": 3634, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/754/O", "atom2_id": "///A/754/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3628, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/754/O", "atom2_id": "///A/763/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3648, "atom2_serNum": 3650, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///A/756/O", "atom2_id": "///A/756/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3648, "atom2_serNum": 3664, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/756/O", "atom2_id": "///A/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3648, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/756/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3682, "atom2_serNum": 3714, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/761/O", "atom2_id": "///A/764/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3691, "atom2_serNum": 3718, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/762/O", "atom2_id": "///A/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3702, "atom2_serNum": 3726, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/763/O", "atom2_id": "///A/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3708, "atom2_serNum": 3714, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///A/764/N", "atom2_id": "///A/764/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3711, "atom2_serNum": 3745, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/764/O", "atom2_id": "///A/767/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3746, "atom2_serNum": 3753, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/768/N", "atom2_id": "///A/768/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3797, "atom2_serNum": 5353, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/778/O", "atom2_id": "///A/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3809, "atom2_serNum": 5375, "donAcc_type": "acceptable", "distance": 3.123, "atom1_id": "///A/779/ND1", "atom2_id": "///A/1005/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3813, "atom2_serNum": 5356, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/780/N", "atom2_id": "///A/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3816, "atom2_serNum": 5366, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/780/O", "atom2_id": "///A/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3827, "atom2_serNum": 5369, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/782/N", "atom2_id": "///A/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3830, "atom2_serNum": 5383, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/782/O", "atom2_id": "///A/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3851, "atom2_serNum": 3879, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/813/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3853, "atom2_serNum": 3870, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///A/813/OG", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3857, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/814/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3864, "atom2_serNum": 3892, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/815/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3873, "atom2_serNum": 3900, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/816/O", "atom2_id": "///A/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3882, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/817/O", "atom2_id": "///A/821/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3890, "atom2_serNum": 3915, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/818/O", "atom2_id": "///A/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3895, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/819/O", "atom2_id": "///A/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3903, "atom2_serNum": 3938, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/820/O", "atom2_id": "///A/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3908, "atom2_serNum": 3949, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/821/O", "atom2_id": "///A/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3908, "atom2_serNum": 3954, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/821/O", "atom2_id": "///A/825/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3918, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/822/O", "atom2_id": "///A/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3918, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/822/O", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3926, "atom2_serNum": 5351, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///A/822/OH", "atom2_id": "///A/1002/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3934, "atom2_serNum": 3962, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/823/NE", "atom2_id": "///A/827/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3937, "atom2_serNum": 3962, "donAcc_type": "standard", "distance": 2.345, "atom1_id": "///A/823/NH2", "atom2_id": "///A/827/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3958, "atom2_serNum": 5050, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/826/O", "atom2_id": "///A/965/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3976, "atom2_serNum": 5051, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/828/OD1", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3977, "atom2_serNum": 3986, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/828/OD2", "atom2_id": "///A/829/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3977, "atom2_serNum": 5056, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///A/828/OD2", "atom2_id": "///A/966/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3978, "atom2_serNum": 5032, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/829/N", "atom2_id": "///A/964/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3981, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/829/O", "atom2_id": "///A/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3985, "atom2_serNum": 4772, "donAcc_type": "standard", "distance": 3.889, "atom1_id": "///A/829/OE1", "atom2_id": "///A/927/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3991, "atom2_serNum": 5018, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/831/N", "atom2_id": "///A/962/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3994, "atom2_serNum": 5015, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/831/O", "atom2_id": "///A/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4008, "atom2_serNum": 4021, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///A/832/NE2", "atom2_id": "///A/834/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4009, "atom2_serNum": 5005, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/833/N", "atom2_id": "///A/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 4012, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/833/O", "atom2_id": "///A/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4012, "atom2_serNum": 4031, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///A/833/O", "atom2_id": "///A/836/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4013, "atom2_serNum": 5005, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/834/N", "atom2_id": "///A/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4025, "atom2_serNum": 4050, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/835/O", "atom2_id": "///A/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4029, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/836/O", "atom2_id": "///A/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4029, "atom2_serNum": 4061, "donAcc_type": "acceptable", "distance": 2.442, "atom1_id": "///A/836/O", "atom2_id": "///A/840/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4031, "atom2_serNum": 4719, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///A/836/OG", "atom2_id": "///A/921/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4035, "atom2_serNum": 4063, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/837/O", "atom2_id": "///A/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4042, "atom2_serNum": 4071, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/838/O", "atom2_id": "///A/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4053, "atom2_serNum": 4083, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/839/O", "atom2_id": "///A/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4055, "atom2_serNum": 4672, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///A/839/OG", "atom2_id": "///A/916/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4059, "atom2_serNum": 4087, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/840/O", "atom2_id": "///A/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4061, "atom2_serNum": 4684, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/840/OG1", "atom2_id": "///A/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4061, "atom2_serNum": 4689, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///A/840/OG1", "atom2_id": "///A/918/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4066, "atom2_serNum": 4095, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/841/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4074, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4090, "atom2_serNum": 4583, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///A/844/O", "atom2_id": "///A/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4098, "atom2_serNum": 4432, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/845/O", "atom2_id": "///A/886/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4106, "atom2_serNum": 4133, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/846/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4106, "atom2_serNum": 4141, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/846/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4114, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/847/O", "atom2_id": "///A/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4131, "atom2_serNum": 4434, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/848/OD1", "atom2_id": "///A/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4131, "atom2_serNum": 4435, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///A/848/OD1", "atom2_id": "///A/886/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4136, "atom2_serNum": 4160, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/849/O", "atom2_id": "///A/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4183, "atom2_serNum": 4203, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///A/855/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4201, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 3.828, "atom1_id": "///A/857/OD1", "atom2_id": "///A/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4206, "atom2_serNum": 4259, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/858/O", "atom2_id": "///A/864/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4206, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/858/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4221, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/860/N", "atom2_id": "///A/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4238, "atom2_serNum": 4245, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/861/OD1", "atom2_id": "///A/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4259, "atom2_serNum": 4268, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/864/NE2", "atom2_id": "///A/866/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4263, "atom2_serNum": 4663, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///A/865/O", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4279, "atom2_serNum": 4299, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/867/O", "atom2_id": "///A/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4291, "atom2_serNum": 4297, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/869/N", "atom2_id": "///A/869/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4294, "atom2_serNum": 4313, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/869/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4297, "atom2_serNum": 4379, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/869/OD1", "atom2_id": "///A/879/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4298, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/869/OD2", "atom2_id": "///A/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4298, "atom2_serNum": 4379, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/869/OD2", "atom2_id": "///A/879/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4316, "atom2_serNum": 4334, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/872/O", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4318, "atom2_serNum": 4328, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/872/OG1", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4318, "atom2_serNum": 4333, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/872/OG1", "atom2_id": "///A/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4320, "atom2_serNum": 4326, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/873/N", "atom2_id": "///A/873/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4323, "atom2_serNum": 4356, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/873/O", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4326, "atom2_serNum": 4328, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/873/OD1", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4331, "atom2_serNum": 4361, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///A/874/O", "atom2_id": "///A/877/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4331, "atom2_serNum": 4363, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/874/O", "atom2_id": "///A/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4331, "atom2_serNum": 4368, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///A/874/O", "atom2_id": "///A/878/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4337, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/875/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4337, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/875/O", "atom2_id": "///A/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4348, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/876/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4348, "atom2_serNum": 4380, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/876/O", "atom2_id": "///A/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4372, "atom2_serNum": 4403, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4383, "atom2_serNum": 4411, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4394, "atom2_serNum": 4420, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4401, "atom2_serNum": 4425, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4406, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/883/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4414, "atom2_serNum": 4444, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4418, "atom2_serNum": 4893, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///A/884/OE1", "atom2_id": "///A/945/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4423, "atom2_serNum": 4453, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/885/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4428, "atom2_serNum": 4461, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/886/O", "atom2_id": "///A/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4439, "atom2_serNum": 4469, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/887/O", "atom2_id": "///A/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4447, "atom2_serNum": 4479, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/888/O", "atom2_id": "///A/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4452, "atom2_serNum": 4486, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/888/NE2", "atom2_id": "///A/892/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4464, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/890/O", "atom2_id": "///A/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4475, "atom2_serNum": 4485, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///A/891/ND1", "atom2_id": "///A/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4495, "atom2_serNum": 4517, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/894/O", "atom2_id": "///A/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4495, "atom2_serNum": 4523, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/894/O", "atom2_id": "///A/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4502, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/895/O", "atom2_id": "///A/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4507, "atom2_serNum": 4815, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///A/895/OE2", "atom2_id": "///A/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4511, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4520, "atom2_serNum": 4547, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/897/O", "atom2_id": "///A/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4526, "atom2_serNum": 4561, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/898/O", "atom2_id": "///A/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4534, "atom2_serNum": 4568, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/899/O", "atom2_id": "///A/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4534, "atom2_serNum": 4786, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///A/899/O", "atom2_id": "///A/929/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4541, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 3.639, "atom1_id": "///A/899/NH2", "atom2_id": "///A/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4541, "atom2_serNum": 4815, "donAcc_type": "acceptable", "distance": 3.344, "atom1_id": "///A/899/NH2", "atom2_id": "///A/933/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4545, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/900/O", "atom2_id": "///A/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4550, "atom2_serNum": 4578, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/901/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4564, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/902/O", "atom2_id": "///A/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4571, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/903/O", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4576, "atom2_serNum": 4609, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/904/O", "atom2_id": "///A/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4581, "atom2_serNum": 4618, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/905/O", "atom2_id": "///A/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4588, "atom2_serNum": 4627, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/906/O", "atom2_id": "///A/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4612, "atom2_serNum": 4650, "donAcc_type": "standard", "distance": 2.353, "atom1_id": "///A/908/O", "atom2_id": "///A/912/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4625, "atom2_serNum": 4647, "donAcc_type": "standard", "distance": 2.344, "atom1_id": "///A/909/OE1", "atom2_id": "///A/912/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4625, "atom2_serNum": 4650, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/909/OE1", "atom2_id": "///A/912/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4643, "atom2_serNum": 4658, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/912/O", "atom2_id": "///A/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4643, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 2.245, "atom1_id": "///A/912/O", "atom2_id": "///A/919/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4661, "atom2_serNum": 4677, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/914/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4661, "atom2_serNum": 4680, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///A/914/O", "atom2_id": "///A/917/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4666, "atom2_serNum": 4978, "donAcc_type": "standard", "distance": 4.000, "atom1_id": "///A/915/O", "atom2_id": "///A/955/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4687, "atom2_serNum": 4712, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/918/O", "atom2_id": "///A/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4704, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///A/920/N", "atom2_id": "///A/920/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4734, "atom2_serNum": 4771, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/923/N", "atom2_id": "///A/927/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4744, "atom2_serNum": 4773, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/924/O", "atom2_id": "///A/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4750, "atom2_serNum": 4778, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/925/O", "atom2_id": "///A/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4758, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/926/O", "atom2_id": "///A/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4767, "atom2_serNum": 4795, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/927/O", "atom2_id": "///A/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4776, "atom2_serNum": 4803, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/928/O", "atom2_id": "///A/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4781, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/929/O", "atom2_id": "///A/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4781, "atom2_serNum": 4815, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///A/929/O", "atom2_id": "///A/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4790, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/930/O", "atom2_id": "///A/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4798, "atom2_serNum": 4822, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/931/O", "atom2_id": "///A/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4806, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/932/O", "atom2_id": "///A/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4833, "atom2_serNum": 4852, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/936/O", "atom2_id": "///A/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4837, "atom2_serNum": 4860, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/937/O", "atom2_id": "///A/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4841, "atom2_serNum": 4866, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/938/O", "atom2_id": "///A/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4848, "atom2_serNum": 4870, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/939/O", "atom2_id": "///A/943/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4855, "atom2_serNum": 4877, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/940/O", "atom2_id": "///A/944/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4863, "atom2_serNum": 4883, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/941/O", "atom2_id": "///A/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4869, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/942/O", "atom2_id": "///A/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4873, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/943/O", "atom2_id": "///A/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4880, "atom2_serNum": 4912, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/944/O", "atom2_id": "///A/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4886, "atom2_serNum": 4917, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/945/O", "atom2_id": "///A/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4897, "atom2_serNum": 4922, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/946/O", "atom2_id": "///A/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4903, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/946/NE2", "atom2_id": "///A/993/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4925, "atom2_serNum": 4962, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/950/O", "atom2_id": "///A/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4929, "atom2_serNum": 4958, "donAcc_type": "acceptable", "distance": 2.090, "atom1_id": "///A/950/OD2", "atom2_id": "///A/953/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4933, "atom2_serNum": 4968, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/951/O", "atom2_id": "///A/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4944, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 3.753, "atom1_id": "///A/952/O", "atom2_id": "///A/986/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4955, "atom2_serNum": 4983, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/953/O", "atom2_id": "///A/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4965, "atom2_serNum": 4983, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/954/O", "atom2_id": "///A/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4965, "atom2_serNum": 4987, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///A/954/O", "atom2_id": "///A/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5002, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/960/N", "atom2_id": "///A/975/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5007, "atom2_serNum": 5124, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/961/N", "atom2_id": "///A/974/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5010, "atom2_serNum": 5121, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/961/O", "atom2_id": "///A/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5022, "atom2_serNum": 5107, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/963/N", "atom2_id": "///A/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5025, "atom2_serNum": 5104, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/963/O", "atom2_id": "///A/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 5043, "atom2_serNum": 5086, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/965/N", "atom2_id": "///A/970/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5046, "atom2_serNum": 5072, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/965/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 5049, "atom2_serNum": 5057, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/965/OD1", "atom2_id": "///A/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 5071, "atom2_serNum": 5083, "donAcc_type": "acceptable", "distance": 3.206, "atom1_id": "///A/968/OG", "atom2_id": "///A/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 5112, "atom2_serNum": 5352, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/972/NZ", "atom2_id": "///A/1002/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5113, "atom2_serNum": 5331, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/973/N", "atom2_id": "///A/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5116, "atom2_serNum": 5344, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/973/O", "atom2_id": "///A/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5128, "atom2_serNum": 5347, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/975/N", "atom2_id": "///A/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5131, "atom2_serNum": 5360, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/975/O", "atom2_id": "///A/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5136, "atom2_serNum": 5152, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/975/OE2", "atom2_id": "///A/977/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5144, "atom2_serNum": 5363, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/977/N", "atom2_id": "///A/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5147, "atom2_serNum": 5376, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/977/O", "atom2_id": "///A/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5152, "atom2_serNum": 5231, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/977/NZ", "atom2_id": "///A/987/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5156, "atom2_serNum": 5172, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/978/O", "atom2_id": "///A/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5170, "atom2_serNum": 6604, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/980/OD1", "atom2_id": "///H/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5171, "atom2_serNum": 6145, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///A/980/ND2", "atom2_id": "///H/460/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5178, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/981/OD1", "atom2_id": "///A/982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5189, "atom2_serNum": 6574, "donAcc_type": "standard", "distance": 2.242, "atom1_id": "///A/982/NH1", "atom2_id": "///H/525/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5199, "atom2_serNum": 5231, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///A/984/N", "atom2_id": "///A/987/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5202, "atom2_serNum": 5233, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/984/O", "atom2_id": "///A/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5204, "atom2_serNum": 5224, "donAcc_type": "acceptable", "distance": 3.234, "atom1_id": "///A/984/OG", "atom2_id": "///A/987/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5208, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/985/O", "atom2_id": "///A/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5218, "atom2_serNum": 5249, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/986/O", "atom2_id": "///A/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5227, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/987/O", "atom2_id": "///A/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5236, "atom2_serNum": 5271, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/988/O", "atom2_id": "///A/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5244, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/989/O", "atom2_id": "///A/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5252, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/990/O", "atom2_id": "///A/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5266, "atom2_serNum": 5293, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/991/O", "atom2_id": "///A/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5274, "atom2_serNum": 5302, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/992/O", "atom2_id": "///A/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5279, "atom2_serNum": 5311, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/993/O", "atom2_id": "///A/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5288, "atom2_serNum": 5323, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/994/O", "atom2_id": "///A/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5296, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/995/O", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5399, "atom2_serNum": 5779, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///H/371/O", "atom2_id": "///H/416/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5419, "atom2_serNum": 5455, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///H/373/O", "atom2_id": "///H/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5426, "atom2_serNum": 5466, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///H/374/O", "atom2_id": "///H/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5426, "atom2_serNum": 5471, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///H/374/O", "atom2_id": "///H/378/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5438, "atom2_serNum": 5472, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/375/O", "atom2_id": "///H/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5446, "atom2_serNum": 5774, "donAcc_type": "acceptable", "distance": 3.790, "atom1_id": "///H/375/OH", "atom2_id": "///H/416/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5450, "atom2_serNum": 5483, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///H/376/O", "atom2_id": "///H/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5458, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///H/377/O", "atom2_id": "///H/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5469, "atom2_serNum": 5498, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///H/378/O", "atom2_id": "///H/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5471, "atom2_serNum": 6825, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///H/378/OG", "atom2_id": "///H/577/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5471, "atom2_serNum": 6845, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///H/378/OG", "atom2_id": "///H/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5475, "atom2_serNum": 5505, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///H/379/O", "atom2_id": "///H/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5486, "atom2_serNum": 5513, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///H/380/O", "atom2_id": "///H/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5494, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/381/O", "atom2_id": "///H/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5494, "atom2_serNum": 5527, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///H/381/O", "atom2_id": "///H/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5501, "atom2_serNum": 5529, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///H/382/O", "atom2_id": "///H/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5508, "atom2_serNum": 5536, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/383/O", "atom2_id": "///H/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5516, "atom2_serNum": 5544, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/384/O", "atom2_id": "///H/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5532, "atom2_serNum": 5553, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///H/386/O", "atom2_id": "///H/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5556, "atom2_serNum": 5586, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///H/389/O", "atom2_id": "///H/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5559, "atom2_serNum": 5576, "donAcc_type": "questionable", "distance": 2.803, "atom1_id": "///H/389/OD1", "atom2_id": "///H/391/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5559, "atom2_serNum": 5578, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///H/389/OD1", "atom2_id": "///H/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5564, "atom2_serNum": 5594, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///H/390/O", "atom2_id": "///H/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5569, "atom2_serNum": 5577, "donAcc_type": "questionable", "distance": 2.934, "atom1_id": "///H/390/OE2", "atom2_id": "///H/391/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5576, "atom2_serNum": 5584, "donAcc_type": "questionable", "distance": 2.930, "atom1_id": "///H/391/OD1", "atom2_id": "///H/392/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5581, "atom2_serNum": 5602, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///H/392/O", "atom2_id": "///H/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5585, "atom2_serNum": 6945, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///H/392/OD2", "atom2_id": "///H/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5589, "atom2_serNum": 5610, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///H/393/O", "atom2_id": "///H/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5589, "atom2_serNum": 5664, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///H/393/O", "atom2_id": "///H/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5621, "atom2_serNum": 5654, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/397/N", "atom2_id": "///H/400/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5624, "atom2_serNum": 5656, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///H/397/O", "atom2_id": "///H/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5627, "atom2_serNum": 5638, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///H/397/OD1", "atom2_id": "///H/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5627, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///H/397/OD1", "atom2_id": "///H/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5632, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///H/398/O", "atom2_id": "///H/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5641, "atom2_serNum": 5669, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///H/399/O", "atom2_id": "///H/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5650, "atom2_serNum": 5669, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///H/400/O", "atom2_id": "///H/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5650, "atom2_serNum": 5677, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///H/400/O", "atom2_id": "///H/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5655, "atom2_serNum": 6743, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///H/400/OE2", "atom2_id": "///H/547/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5659, "atom2_serNum": 5684, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///H/401/O", "atom2_id": "///H/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5668, "atom2_serNum": 5691, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/402/O", "atom2_id": "///H/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5672, "atom2_serNum": 5700, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/403/O", "atom2_id": "///H/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5680, "atom2_serNum": 5711, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///H/404/O", "atom2_id": "///H/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5687, "atom2_serNum": 5723, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///H/405/O", "atom2_id": "///H/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5703, "atom2_serNum": 5732, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///H/407/O", "atom2_id": "///H/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5703, "atom2_serNum": 5770, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///H/407/O", "atom2_id": "///H/415/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5740, "atom2_serNum": 6065, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///H/411/N", "atom2_id": "///H/449/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5743, "atom2_serNum": 5762, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///H/411/O", "atom2_id": "///H/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5745, "atom2_serNum": 5758, "donAcc_type": "acceptable", "distance": 2.850, "atom1_id": "///H/411/OG", "atom2_id": "///H/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5745, "atom2_serNum": 6064, "donAcc_type": "acceptable", "distance": 2.739, "atom1_id": "///H/411/OG", "atom2_id": "///H/449/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5749, "atom2_serNum": 5771, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///H/412/O", "atom2_id": "///H/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5754, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///H/413/O", "atom2_id": "///H/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5761, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///H/414/O", "atom2_id": "///H/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5765, "atom2_serNum": 5800, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///H/415/O", "atom2_id": "///H/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5774, "atom2_serNum": 5807, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/416/O", "atom2_id": "///H/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5783, "atom2_serNum": 5818, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/417/O", "atom2_id": "///H/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5791, "atom2_serNum": 5818, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///H/418/O", "atom2_id": "///H/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5791, "atom2_serNum": 5826, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///H/418/O", "atom2_id": "///H/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5803, "atom2_serNum": 5844, "donAcc_type": "questionable", "distance": 2.532, "atom1_id": "///H/419/O", "atom2_id": "///H/423/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5816, "atom2_serNum": 5981, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///H/420/NH1", "atom2_id": "///H/438/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5821, "atom2_serNum": 5846, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///H/421/O", "atom2_id": "///H/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5821, "atom2_serNum": 5849, "donAcc_type": "questionable", "distance": 2.996, "atom1_id": "///H/421/O", "atom2_id": "///H/424/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5837, "atom2_serNum": 5844, "donAcc_type": "standard", "distance": 2.472, "atom1_id": "///H/423/N", "atom2_id": "///H/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5844, "atom2_serNum": 5846, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///H/423/OE1", "atom2_id": "///H/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5855, "atom2_serNum": 5963, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///H/424/NH1", "atom2_id": "///H/436/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5860, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///H/425/O", "atom2_id": "///H/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5888, "atom2_serNum": 6204, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///H/428/NE1", "atom2_id": "///H/467/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5894, "atom2_serNum": 6645, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///H/429/N", "atom2_id": "///H/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5897, "atom2_serNum": 6642, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///H/429/O", "atom2_id": "///H/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5905, "atom2_serNum": 5926, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///H/430/O", "atom2_id": "///H/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5910, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///H/430/NZ", "atom2_id": "///H/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5910, "atom2_serNum": 6272, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///H/430/NZ", "atom2_id": "///H/476/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5910, "atom2_serNum": 6621, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///H/430/NZ", "atom2_id": "///H/531/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5911, "atom2_serNum": 6630, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///H/431/N", "atom2_id": "///H/533/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5951, "atom2_serNum": 5971, "donAcc_type": "questionable", "distance": 2.705, "atom1_id": "///H/435/OE2", "atom2_id": "///H/437/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5955, "atom2_serNum": 5982, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///H/436/O", "atom2_id": "///H/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5955, "atom2_serNum": 5990, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///H/436/O", "atom2_id": "///H/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5964, "atom2_serNum": 5971, "donAcc_type": "standard", "distance": 2.446, "atom1_id": "///H/437/N", "atom2_id": "///H/437/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5973, "atom2_serNum": 5980, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///H/438/N", "atom2_id": "///H/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 6009, "atom2_serNum": 6019, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/442/OD1", "atom2_id": "///H/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 6009, "atom2_serNum": 6024, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///H/442/OD1", "atom2_id": "///H/444/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 6014, "atom2_serNum": 6040, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///H/443/O", "atom2_id": "///H/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 6022, "atom2_serNum": 6048, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///H/444/O", "atom2_id": "///H/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 6029, "atom2_serNum": 6057, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///H/445/O", "atom2_id": "///H/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 6036, "atom2_serNum": 6066, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///H/446/O", "atom2_id": "///H/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 6043, "atom2_serNum": 6074, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///H/447/O", "atom2_id": "///H/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 6043, "atom2_serNum": 6079, "donAcc_type": "acceptable", "distance": 2.434, "atom1_id": "///H/447/O", "atom2_id": "///H/451/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 6051, "atom2_serNum": 6081, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/448/O", "atom2_id": "///H/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 6060, "atom2_serNum": 6087, "donAcc_type": "questionable", "distance": 2.546, "atom1_id": "///H/449/O", "atom2_id": "///H/452/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 6060, "atom2_serNum": 6089, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///H/449/O", "atom2_id": "///H/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 6069, "atom2_serNum": 6098, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///H/450/O", "atom2_id": "///H/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 6069, "atom2_serNum": 6109, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///H/450/O", "atom2_id": "///H/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 6077, "atom2_serNum": 6094, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///H/451/O", "atom2_id": "///H/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 6087, "atom2_serNum": 6089, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///H/452/OD1", "atom2_id": "///H/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 6101, "atom2_serNum": 6668, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///H/455/O", "atom2_id": "///H/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 6117, "atom2_serNum": 6652, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///H/457/N", "atom2_id": "///H/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 6120, "atom2_serNum": 6649, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///H/457/O", "atom2_id": "///H/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 6124, "atom2_serNum": 6656, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///H/457/OE1", "atom2_id": "///H/536/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 6125, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/457/NE2", "atom2_id": "///H/461/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 6129, "atom2_serNum": 6148, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///H/458/O", "atom2_id": "///H/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 6131, "atom2_serNum": 6147, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///H/458/OG1", "atom2_id": "///H/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 6133, "atom2_serNum": 6140, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///H/459/N", "atom2_id": "///H/459/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 6133, "atom2_serNum": 6639, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///H/459/N", "atom2_id": "///H/534/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 6136, "atom2_serNum": 6157, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///H/459/O", "atom2_id": "///H/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 6136, "atom2_serNum": 6604, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///H/459/O", "atom2_id": "///H/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 6140, "atom2_serNum": 6636, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///H/459/OE1", "atom2_id": "///H/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 6145, "atom2_serNum": 6173, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///H/460/O", "atom2_id": "///H/463/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 6151, "atom2_serNum": 6165, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///H/461/O", "atom2_id": "///H/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 6160, "atom2_serNum": 6604, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///H/462/O", "atom2_id": "///H/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 6177, "atom2_serNum": 6206, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///H/464/O", "atom2_id": "///H/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 6186, "atom2_serNum": 6213, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///H/465/O", "atom2_id": "///H/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 6194, "atom2_serNum": 6221, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///H/466/O", "atom2_id": "///H/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6200, "atom2_serNum": 6230, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///H/467/O", "atom2_id": "///H/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6209, "atom2_serNum": 6238, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///H/468/O", "atom2_id": "///H/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6216, "atom2_serNum": 6405, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///H/469/O", "atom2_id": "///H/493/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6241, "atom2_serNum": 6405, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///H/472/O", "atom2_id": "///H/493/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6246, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///H/473/N", "atom2_id": "///H/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6249, "atom2_serNum": 6273, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///H/473/O", "atom2_id": "///H/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6255, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///H/474/O", "atom2_id": "///H/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6260, "atom2_serNum": 6290, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///H/475/O", "atom2_id": "///H/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6267, "atom2_serNum": 6296, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///H/476/O", "atom2_id": "///H/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6276, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///H/477/O", "atom2_id": "///H/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6284, "atom2_serNum": 6309, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///H/478/O", "atom2_id": "///H/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6293, "atom2_serNum": 6318, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///H/479/O", "atom2_id": "///H/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6293, "atom2_serNum": 6323, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///H/479/O", "atom2_id": "///H/483/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6299, "atom2_serNum": 6325, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///H/480/O", "atom2_id": "///H/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6307, "atom2_serNum": 6346, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///H/481/O", "atom2_id": "///H/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6312, "atom2_serNum": 6336, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/482/O", "atom2_id": "///H/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6364, "atom2_serNum": 6384, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///H/488/O", "atom2_id": "///H/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6367, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///H/488/OD1", "atom2_id": "///H/495/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6391, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///H/492/O", "atom2_id": "///H/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6400, "atom2_serNum": 6432, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///H/493/O", "atom2_id": "///H/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6406, "atom2_serNum": 6413, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///H/494/N", "atom2_id": "///H/494/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6409, "atom2_serNum": 6439, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///H/494/O", "atom2_id": "///H/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6418, "atom2_serNum": 6447, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///H/495/O", "atom2_id": "///H/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6427, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///H/496/O", "atom2_id": "///H/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6435, "atom2_serNum": 6463, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///H/497/O", "atom2_id": "///H/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6442, "atom2_serNum": 6471, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///H/498/O", "atom2_id": "///H/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6450, "atom2_serNum": 6480, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///H/499/O", "atom2_id": "///H/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6455, "atom2_serNum": 6488, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/500/O", "atom2_id": "///H/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6466, "atom2_serNum": 6493, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///H/501/O", "atom2_id": "///H/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6474, "atom2_serNum": 6493, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///H/502/O", "atom2_id": "///H/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6491, "atom2_serNum": 6531, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///H/504/O", "atom2_id": "///H/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6534, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 3.618, "atom1_id": "///H/519/O", "atom2_id": "///H/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6542, "atom2_serNum": 6563, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///H/520/O", "atom2_id": "///H/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6546, "atom2_serNum": 6571, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///H/521/O", "atom2_id": "///H/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6551, "atom2_serNum": 6580, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///H/522/O", "atom2_id": "///H/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6558, "atom2_serNum": 6591, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///H/523/O", "atom2_id": "///H/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6566, "atom2_serNum": 6596, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///H/524/O", "atom2_id": "///H/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6574, "atom2_serNum": 6605, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///H/525/O", "atom2_id": "///H/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6583, "atom2_serNum": 6610, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///H/526/O", "atom2_id": "///H/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6594, "atom2_serNum": 6618, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///H/527/O", "atom2_id": "///H/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6599, "atom2_serNum": 6623, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///H/528/O", "atom2_id": "///H/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6671, "atom2_serNum": 6694, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///H/538/O", "atom2_id": "///H/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6677, "atom2_serNum": 6705, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///H/539/O", "atom2_id": "///H/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6686, "atom2_serNum": 6705, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///H/540/O", "atom2_id": "///H/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6686, "atom2_serNum": 6710, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///H/540/O", "atom2_id": "///H/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6690, "atom2_serNum": 6717, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///H/541/O", "atom2_id": "///H/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6697, "atom2_serNum": 6728, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///H/542/O", "atom2_id": "///H/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6708, "atom2_serNum": 6734, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///H/543/O", "atom2_id": "///H/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6708, "atom2_serNum": 6741, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///H/543/O", "atom2_id": "///H/547/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6713, "atom2_serNum": 6745, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///H/544/O", "atom2_id": "///H/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6720, "atom2_serNum": 6753, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///H/545/O", "atom2_id": "///H/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6731, "atom2_serNum": 6761, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/546/O", "atom2_id": "///H/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6737, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/547/O", "atom2_id": "///H/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6748, "atom2_serNum": 6777, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///H/548/O", "atom2_id": "///H/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6756, "atom2_serNum": 6788, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///H/549/O", "atom2_id": "///H/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6780, "atom2_serNum": 8961, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///H/552/O", "atom2_id": "///H/861/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6793, "atom2_serNum": 6807, "donAcc_type": "acceptable", "distance": 3.343, "atom1_id": "///H/553/OG", "atom2_id": "///H/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6817, "atom2_serNum": 6837, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///H/576/O", "atom2_id": "///H/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6825, "atom2_serNum": 6845, "donAcc_type": "standard", "distance": 3.886, "atom1_id": "///H/577/O", "atom2_id": "///H/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6832, "atom2_serNum": 6849, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///H/578/O", "atom2_id": "///H/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6832, "atom2_serNum": 6860, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///H/578/O", "atom2_id": "///H/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6871, "atom2_serNum": 9373, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///H/583/O", "atom2_id": "///H/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6880, "atom2_serNum": 9371, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///H/584/O", "atom2_id": "///H/912/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6900, "atom2_serNum": 9371, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///H/586/OG", "atom2_id": "///H/912/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6912, "atom2_serNum": 8957, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///H/587/OH", "atom2_id": "///H/861/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6912, "atom2_serNum": 8973, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///H/587/OH", "atom2_id": "///H/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6928, "atom2_serNum": 8935, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///H/590/N", "atom2_id": "///H/859/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6931, "atom2_serNum": 8917, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///H/590/O", "atom2_id": "///H/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6943, "atom2_serNum": 8946, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///H/591/NE", "atom2_id": "///H/860/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6947, "atom2_serNum": 8923, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///H/592/N", "atom2_id": "///H/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6956, "atom2_serNum": 8923, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///H/593/N", "atom2_id": "///H/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6959, "atom2_serNum": 8952, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///H/593/O", "atom2_id": "///H/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6976, "atom2_serNum": 7434, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///H/595/O", "atom2_id": "///H/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6992, "atom2_serNum": 7035, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///H/597/N", "atom2_id": "///H/601/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 7001, "atom2_serNum": 7007, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///H/598/N", "atom2_id": "///H/598/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 7004, "atom2_serNum": 7036, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///H/598/O", "atom2_id": "///H/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 7012, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///H/599/O", "atom2_id": "///H/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 7023, "atom2_serNum": 7052, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///H/600/O", "atom2_id": "///H/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 7031, "atom2_serNum": 7063, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///H/601/O", "atom2_id": "///H/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 7035, "atom2_serNum": 7434, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/601/OD2", "atom2_id": "///H/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 7039, "atom2_serNum": 7075, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///H/602/O", "atom2_id": "///H/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 7047, "atom2_serNum": 7080, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///H/603/O", "atom2_id": "///H/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 7055, "atom2_serNum": 7085, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///H/604/O", "atom2_id": "///H/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 7066, "atom2_serNum": 7090, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///H/605/O", "atom2_id": "///H/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 7066, "atom2_serNum": 7095, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///H/605/O", "atom2_id": "///H/609/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 7078, "atom2_serNum": 7097, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///H/606/O", "atom2_id": "///H/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 7083, "atom2_serNum": 7107, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///H/607/O", "atom2_id": "///H/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 7088, "atom2_serNum": 7115, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///H/608/O", "atom2_id": "///H/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 7093, "atom2_serNum": 7123, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/609/O", "atom2_id": "///H/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 7100, "atom2_serNum": 7129, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///H/610/O", "atom2_id": "///H/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 7110, "atom2_serNum": 7137, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///H/611/O", "atom2_id": "///H/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 7118, "atom2_serNum": 7145, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///H/612/O", "atom2_id": "///H/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 7118, "atom2_serNum": 7150, "donAcc_type": "acceptable", "distance": 2.775, "atom1_id": "///H/612/O", "atom2_id": "///H/616/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 7126, "atom2_serNum": 7151, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///H/613/O", "atom2_id": "///H/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 7132, "atom2_serNum": 7157, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///H/614/O", "atom2_id": "///H/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 7140, "atom2_serNum": 7162, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///H/615/O", "atom2_id": "///H/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 7148, "atom2_serNum": 7170, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///H/616/O", "atom2_id": "///H/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 7150, "atom2_serNum": 7623, "donAcc_type": "acceptable", "distance": 3.700, "atom1_id": "///H/616/OG", "atom2_id": "///H/672/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 7154, "atom2_serNum": 7175, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///H/617/O", "atom2_id": "///H/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 7160, "atom2_serNum": 7175, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///H/618/O", "atom2_id": "///H/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 7160, "atom2_serNum": 7183, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///H/618/O", "atom2_id": "///H/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 7160, "atom2_serNum": 7187, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///H/618/O", "atom2_id": "///H/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 7165, "atom2_serNum": 7183, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///H/619/O", "atom2_id": "///H/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 7178, "atom2_serNum": 7182, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///H/621/O", "atom2_id": "///H/621/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 7190, "atom2_serNum": 7227, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///H/623/O", "atom2_id": "///H/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 7198, "atom2_serNum": 7232, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///H/624/O", "atom2_id": "///H/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 7212, "atom2_serNum": 7241, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///H/625/O", "atom2_id": "///H/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 7221, "atom2_serNum": 7250, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/626/O", "atom2_id": "///H/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 7230, "atom2_serNum": 7258, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///H/627/O", "atom2_id": "///H/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 7235, "atom2_serNum": 7263, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///H/628/O", "atom2_id": "///H/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 7244, "atom2_serNum": 7272, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/629/O", "atom2_id": "///H/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 7253, "atom2_serNum": 7278, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///H/630/O", "atom2_id": "///H/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 7261, "atom2_serNum": 7283, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///H/631/O", "atom2_id": "///H/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 7266, "atom2_serNum": 7292, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///H/632/O", "atom2_id": "///H/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 7266, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 2.353, "atom1_id": "///H/632/O", "atom2_id": "///H/636/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 7270, "atom2_serNum": 7302, "donAcc_type": "standard", "distance": 2.461, "atom1_id": "///H/632/OE1", "atom2_id": "///H/636/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 7275, "atom2_serNum": 7303, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///H/633/O", "atom2_id": "///H/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 7281, "atom2_serNum": 7311, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///H/634/O", "atom2_id": "///H/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 7286, "atom2_serNum": 7325, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///H/635/O", "atom2_id": "///H/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 7291, "atom2_serNum": 7743, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///H/635/NZ", "atom2_id": "///H/685/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 7295, "atom2_serNum": 7341, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///H/636/O", "atom2_id": "///H/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 7306, "atom2_serNum": 7350, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///H/637/O", "atom2_id": "///H/640/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 7309, "atom2_serNum": 7348, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///H/637/OD1", "atom2_id": "///H/640/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 7309, "atom2_serNum": 7351, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///H/637/OD1", "atom2_id": "///H/640/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 7314, "atom2_serNum": 7352, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///H/638/O", "atom2_id": "///H/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7331, "atom2_serNum": 7360, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///H/639/O", "atom2_id": "///H/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7337, "atom2_serNum": 7368, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///H/639/OD1", "atom2_id": "///H/642/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 7355, "atom2_serNum": 7377, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///H/641/O", "atom2_id": "///H/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 7383, "atom2_serNum": 7399, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///H/644/ND1", "atom2_id": "///H/646/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7390, "atom2_serNum": 7408, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/645/O", "atom2_id": "///H/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7397, "atom2_serNum": 7425, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///H/646/O", "atom2_id": "///H/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7403, "atom2_serNum": 7435, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///H/647/O", "atom2_id": "///H/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7411, "atom2_serNum": 7417, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///H/648/O", "atom2_id": "///H/648/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7411, "atom2_serNum": 7444, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///H/648/O", "atom2_id": "///H/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7417, "atom2_serNum": 7450, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///H/648/NH1", "atom2_id": "///H/652/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7418, "atom2_serNum": 7450, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///H/648/NH2", "atom2_id": "///H/652/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7428, "atom2_serNum": 7503, "donAcc_type": "standard", "distance": 2.183, "atom1_id": "///H/650/O", "atom2_id": "///H/658/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7455, "atom2_serNum": 7503, "donAcc_type": "standard", "distance": 2.239, "atom1_id": "///H/653/O", "atom2_id": "///H/658/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 7463, "atom2_serNum": 7486, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///H/654/O", "atom2_id": "///H/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7463, "atom2_serNum": 7494, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///H/654/O", "atom2_id": "///H/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7470, "atom2_serNum": 7494, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///H/655/O", "atom2_id": "///H/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7470, "atom2_serNum": 7505, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///H/655/O", "atom2_id": "///H/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7489, "atom2_serNum": 7511, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///H/657/O", "atom2_id": "///H/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7497, "atom2_serNum": 7527, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///H/658/O", "atom2_id": "///H/661/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7525, "atom2_serNum": 7554, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///H/661/O", "atom2_id": "///H/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7532, "atom2_serNum": 7562, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///H/662/O", "atom2_id": "///H/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7539, "atom2_serNum": 7574, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/663/O", "atom2_id": "///H/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7539, "atom2_serNum": 7579, "donAcc_type": "acceptable", "distance": 2.610, "atom1_id": "///H/663/O", "atom2_id": "///H/667/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7543, "atom2_serNum": 7581, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///H/664/O", "atom2_id": "///H/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7557, "atom2_serNum": 7592, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///H/665/O", "atom2_id": "///H/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7565, "atom2_serNum": 7600, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///H/666/O", "atom2_id": "///H/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7577, "atom2_serNum": 7608, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///H/667/O", "atom2_id": "///H/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7584, "atom2_serNum": 7614, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///H/668/O", "atom2_id": "///H/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7595, "atom2_serNum": 7625, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///H/669/O", "atom2_id": "///H/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7603, "atom2_serNum": 7636, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///H/670/O", "atom2_id": "///H/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7611, "atom2_serNum": 7643, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///H/671/O", "atom2_id": "///H/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7613, "atom2_serNum": 7912, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///H/671/OG", "atom2_id": "///H/706/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7617, "atom2_serNum": 7652, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///H/672/O", "atom2_id": "///H/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7628, "atom2_serNum": 7660, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/673/O", "atom2_id": "///H/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7639, "atom2_serNum": 7668, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///H/674/O", "atom2_id": "///H/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7646, "atom2_serNum": 7677, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///H/675/O", "atom2_id": "///H/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7655, "atom2_serNum": 7688, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///H/676/O", "atom2_id": "///H/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7663, "atom2_serNum": 7696, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///H/677/O", "atom2_id": "///H/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7663, "atom2_serNum": 7706, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///H/677/O", "atom2_id": "///H/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7671, "atom2_serNum": 7696, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///H/678/O", "atom2_id": "///H/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7702, "atom2_serNum": 7725, "donAcc_type": "acceptable", "distance": 2.686, "atom1_id": "///H/681/ND1", "atom2_id": "///H/683/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7709, "atom2_serNum": 7744, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///H/682/O", "atom2_id": "///H/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7717, "atom2_serNum": 7749, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///H/683/O", "atom2_id": "///H/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7729, "atom2_serNum": 7756, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///H/684/O", "atom2_id": "///H/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7738, "atom2_serNum": 7767, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///H/685/O", "atom2_id": "///H/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7747, "atom2_serNum": 7776, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/686/O", "atom2_id": "///H/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7752, "atom2_serNum": 7784, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///H/687/O", "atom2_id": "///H/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7759, "atom2_serNum": 7793, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///H/688/O", "atom2_id": "///H/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7770, "atom2_serNum": 7799, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///H/689/O", "atom2_id": "///H/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7779, "atom2_serNum": 7807, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///H/690/O", "atom2_id": "///H/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7787, "atom2_serNum": 7815, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///H/691/O", "atom2_id": "///H/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7796, "atom2_serNum": 7815, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///H/692/O", "atom2_id": "///H/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7796, "atom2_serNum": 7820, "donAcc_type": "acceptable", "distance": 2.379, "atom1_id": "///H/692/O", "atom2_id": "///H/695/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7802, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///H/693/O", "atom2_id": "///H/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7802, "atom2_serNum": 7824, "donAcc_type": "questionable", "distance": 2.973, "atom1_id": "///H/693/O", "atom2_id": "///H/696/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7802, "atom2_serNum": 7829, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///H/693/O", "atom2_id": "///H/696/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7810, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///H/694/O", "atom2_id": "///H/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7824, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.415, "atom1_id": "///H/696/O", "atom2_id": "///H/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7828, "atom2_serNum": 7841, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///H/696/OE1", "atom2_id": "///H/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7828, "atom2_serNum": 7849, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///H/696/OE1", "atom2_id": "///H/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7829, "atom2_serNum": 7852, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///H/696/NE2", "atom2_id": "///H/699/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7864, "atom2_serNum": 7882, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///H/700/O", "atom2_id": "///H/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7870, "atom2_serNum": 7888, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///H/701/O", "atom2_id": "///H/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7877, "atom2_serNum": 9683, "donAcc_type": "standard", "distance": 3.978, "atom1_id": "///H/702/O", "atom2_id": "///H/953/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7885, "atom2_serNum": 7903, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///H/703/O", "atom2_id": "///H/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7885, "atom2_serNum": 7914, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///H/703/O", "atom2_id": "///H/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7891, "atom2_serNum": 7928, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///H/704/O", "atom2_id": "///H/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7897, "atom2_serNum": 7936, "donAcc_type": "questionable", "distance": 3.416, "atom1_id": "///H/704/NH1", "atom2_id": "///H/708/NE1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7897, "atom2_serNum": 8157, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///H/704/NH1", "atom2_id": "///H/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7902, "atom2_serNum": 7942, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///H/705/O", "atom2_id": "///H/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7906, "atom2_serNum": 7950, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///H/706/O", "atom2_id": "///H/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7917, "atom2_serNum": 7961, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///H/707/O", "atom2_id": "///H/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7931, "atom2_serNum": 7969, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///H/708/O", "atom2_id": "///H/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7936, "atom2_serNum": 8157, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///H/708/NE1", "atom2_id": "///H/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7945, "atom2_serNum": 7974, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///H/709/O", "atom2_id": "///H/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7948, "atom2_serNum": 8231, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///H/709/OD1", "atom2_id": "///H/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7953, "atom2_serNum": 7982, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///H/710/O", "atom2_id": "///H/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7964, "atom2_serNum": 7990, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/711/O", "atom2_id": "///H/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7972, "atom2_serNum": 7998, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///H/712/O", "atom2_id": "///H/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7977, "atom2_serNum": 8008, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///H/713/O", "atom2_id": "///H/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7985, "atom2_serNum": 7989, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///H/714/O", "atom2_id": "///H/714/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7985, "atom2_serNum": 8027, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///H/714/O", "atom2_id": "///H/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7993, "atom2_serNum": 8044, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///H/715/O", "atom2_id": "///H/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 8004, "atom2_serNum": 8270, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///H/716/ND1", "atom2_id": "///H/749/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 8011, "atom2_serNum": 8035, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///H/717/O", "atom2_id": "///H/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 8047, "atom2_serNum": 8079, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///H/721/O", "atom2_id": "///H/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 8047, "atom2_serNum": 8084, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///H/721/O", "atom2_id": "///H/725/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 8053, "atom2_serNum": 8070, "donAcc_type": "standard", "distance": 2.375, "atom1_id": "///H/721/NH1", "atom2_id": "///H/723/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 8058, "atom2_serNum": 8086, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///H/722/O", "atom2_id": "///H/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 8063, "atom2_serNum": 8070, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///H/723/N", "atom2_id": "///H/723/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 8066, "atom2_serNum": 8094, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///H/723/O", "atom2_id": "///H/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 8075, "atom2_serNum": 8103, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///H/724/O", "atom2_id": "///H/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 8082, "atom2_serNum": 8109, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///H/725/O", "atom2_id": "///H/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 8089, "atom2_serNum": 8117, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///H/726/O", "atom2_id": "///H/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 8097, "atom2_serNum": 8122, "donAcc_type": "acceptable", "distance": 2.460, "atom1_id": "///H/727/O", "atom2_id": "///H/730/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 8097, "atom2_serNum": 8124, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///H/727/O", "atom2_id": "///H/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 8106, "atom2_serNum": 8133, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///H/728/O", "atom2_id": "///H/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 8112, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///H/729/O", "atom2_id": "///H/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 8120, "atom2_serNum": 8145, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///H/730/O", "atom2_id": "///H/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 8127, "atom2_serNum": 8150, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///H/731/O", "atom2_id": "///H/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 8140, "atom2_serNum": 8217, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///H/733/O", "atom2_id": "///H/743/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 8153, "atom2_serNum": 8174, "donAcc_type": "standard", "distance": 3.998, "atom1_id": "///H/735/O", "atom2_id": "///H/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 8156, "atom2_serNum": 8158, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///H/735/OD1", "atom2_id": "///H/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 8156, "atom2_serNum": 8165, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///H/735/OD1", "atom2_id": "///H/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 8177, "atom2_serNum": 8216, "donAcc_type": "standard", "distance": 3.608, "atom1_id": "///H/738/O", "atom2_id": "///H/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 8184, "atom2_serNum": 8207, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///H/739/O", "atom2_id": "///H/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 8189, "atom2_serNum": 8218, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///H/740/O", "atom2_id": "///H/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 8196, "atom2_serNum": 8226, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///H/741/O", "atom2_id": "///H/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 8200, "atom2_serNum": 8232, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///H/742/O", "atom2_id": "///H/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8210, "atom2_serNum": 8240, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///H/743/O", "atom2_id": "///H/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 8221, "atom2_serNum": 8252, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///H/744/O", "atom2_id": "///H/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8229, "atom2_serNum": 8261, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///H/745/O", "atom2_id": "///H/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 8235, "atom2_serNum": 8272, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///H/746/O", "atom2_id": "///H/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 8243, "atom2_serNum": 8272, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///H/747/O", "atom2_id": "///H/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 8243, "atom2_serNum": 8277, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///H/747/O", "atom2_id": "///H/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 8251, "atom2_serNum": 8313, "donAcc_type": "acceptable", "distance": 3.523, "atom1_id": "///H/747/OH", "atom2_id": "///H/754/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 8255, "atom2_serNum": 8284, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///H/748/O", "atom2_id": "///H/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 8264, "atom2_serNum": 8295, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///H/749/O", "atom2_id": "///H/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8275, "atom2_serNum": 8303, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///H/750/O", "atom2_id": "///H/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 8280, "atom2_serNum": 8303, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///H/751/O", "atom2_id": "///H/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8280, "atom2_serNum": 8314, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///H/751/O", "atom2_id": "///H/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8287, "atom2_serNum": 8293, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///H/752/O", "atom2_id": "///H/752/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8293, "atom2_serNum": 8328, "donAcc_type": "acceptable", "distance": 3.951, "atom1_id": "///H/752/NH1", "atom2_id": "///H/756/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8298, "atom2_serNum": 8323, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///H/753/O", "atom2_id": "///H/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8298, "atom2_serNum": 8328, "donAcc_type": "acceptable", "distance": 3.260, "atom1_id": "///H/753/O", "atom2_id": "///H/756/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8306, "atom2_serNum": 8385, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///H/754/O", "atom2_id": "///H/763/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8326, "atom2_serNum": 8336, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///H/756/O", "atom2_id": "///H/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8326, "atom2_serNum": 8342, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///H/756/O", "atom2_id": "///H/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8332, "atom2_serNum": 8348, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///H/757/O", "atom2_id": "///H/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8351, "atom2_serNum": 8377, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///H/760/O", "atom2_id": "///H/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8360, "atom2_serNum": 8392, "donAcc_type": "acceptable", "distance": 3.581, "atom1_id": "///H/761/O", "atom2_id": "///H/764/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8369, "atom2_serNum": 8396, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///H/762/O", "atom2_id": "///H/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8380, "atom2_serNum": 8404, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///H/763/O", "atom2_id": "///H/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8386, "atom2_serNum": 8392, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///H/764/N", "atom2_id": "///H/764/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8451, "atom2_serNum": 8465, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///H/771/O", "atom2_id": "///H/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8468, "atom2_serNum": 8477, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///H/773/O", "atom2_id": "///H/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8485, "atom2_serNum": 10022, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///H/775/NE2", "atom2_id": "///H/995/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8486, "atom2_serNum": 8492, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///H/776/N", "atom2_id": "///H/776/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8497, "atom2_serNum": 8510, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///H/777/O", "atom2_id": "///H/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8504, "atom2_serNum": 10075, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///H/778/O", "atom2_id": "///H/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8516, "atom2_serNum": 10097, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///H/779/ND1", "atom2_id": "///H/1005/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8520, "atom2_serNum": 10078, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///H/780/N", "atom2_id": "///H/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8523, "atom2_serNum": 10088, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/780/O", "atom2_id": "///H/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8534, "atom2_serNum": 10091, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///H/782/N", "atom2_id": "///H/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8537, "atom2_serNum": 10105, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///H/782/O", "atom2_id": "///H/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8549, "atom2_serNum": 10108, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///H/784/N", "atom2_id": "///H/1007/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8573, "atom2_serNum": 8601, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///H/813/O", "atom2_id": "///H/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8579, "atom2_serNum": 8609, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///H/814/O", "atom2_id": "///H/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8586, "atom2_serNum": 8614, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///H/815/O", "atom2_id": "///H/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8595, "atom2_serNum": 8622, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///H/816/O", "atom2_id": "///H/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8604, "atom2_serNum": 8627, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///H/817/O", "atom2_id": "///H/821/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8612, "atom2_serNum": 8637, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///H/818/O", "atom2_id": "///H/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8617, "atom2_serNum": 8649, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///H/819/O", "atom2_id": "///H/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8617, "atom2_serNum": 8658, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///H/819/O", "atom2_id": "///H/823/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8625, "atom2_serNum": 8660, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///H/820/O", "atom2_id": "///H/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8630, "atom2_serNum": 8671, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///H/821/O", "atom2_id": "///H/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8630, "atom2_serNum": 8676, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///H/821/O", "atom2_id": "///H/825/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8640, "atom2_serNum": 8677, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///H/822/O", "atom2_id": "///H/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8640, "atom2_serNum": 8681, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///H/822/O", "atom2_id": "///H/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8648, "atom2_serNum": 10073, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///H/822/OH", "atom2_id": "///H/1002/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8652, "atom2_serNum": 8677, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///H/823/O", "atom2_id": "///H/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8698, "atom2_serNum": 9771, "donAcc_type": "questionable", "distance": 3.101, "atom1_id": "///H/828/OD1", "atom2_id": "///H/965/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8698, "atom2_serNum": 9773, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///H/828/OD1", "atom2_id": "///H/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8698, "atom2_serNum": 9778, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///H/828/OD1", "atom2_id": "///H/966/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8699, "atom2_serNum": 8708, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///H/828/OD2", "atom2_id": "///H/829/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8699, "atom2_serNum": 9778, "donAcc_type": "acceptable", "distance": 2.312, "atom1_id": "///H/828/OD2", "atom2_id": "///H/966/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8700, "atom2_serNum": 9754, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///H/829/N", "atom2_id": "///H/964/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8703, "atom2_serNum": 9751, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///H/829/O", "atom2_id": "///H/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8713, "atom2_serNum": 9740, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///H/831/N", "atom2_id": "///H/962/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8716, "atom2_serNum": 9737, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///H/831/O", "atom2_id": "///H/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8731, "atom2_serNum": 9727, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///H/833/N", "atom2_id": "///H/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8734, "atom2_serNum": 8748, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///H/833/O", "atom2_id": "///H/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8734, "atom2_serNum": 8753, "donAcc_type": "acceptable", "distance": 2.431, "atom1_id": "///H/833/O", "atom2_id": "///H/836/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8735, "atom2_serNum": 9727, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///H/834/N", "atom2_id": "///H/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8747, "atom2_serNum": 8772, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///H/835/O", "atom2_id": "///H/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8751, "atom2_serNum": 8778, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///H/836/O", "atom2_id": "///H/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8751, "atom2_serNum": 8783, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///H/836/O", "atom2_id": "///H/840/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8753, "atom2_serNum": 9441, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///H/836/OG", "atom2_id": "///H/921/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8757, "atom2_serNum": 8785, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///H/837/O", "atom2_id": "///H/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8764, "atom2_serNum": 8793, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///H/838/O", "atom2_id": "///H/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8775, "atom2_serNum": 8805, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///H/839/O", "atom2_id": "///H/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8777, "atom2_serNum": 9394, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///H/839/OG", "atom2_id": "///H/916/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8781, "atom2_serNum": 8809, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/840/O", "atom2_id": "///H/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8783, "atom2_serNum": 9406, "donAcc_type": "acceptable", "distance": 3.171, "atom1_id": "///H/840/OG1", "atom2_id": "///H/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8788, "atom2_serNum": 8817, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///H/841/O", "atom2_id": "///H/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8796, "atom2_serNum": 8817, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///H/842/O", "atom2_id": "///H/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8796, "atom2_serNum": 8825, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/842/O", "atom2_id": "///H/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8812, "atom2_serNum": 9305, "donAcc_type": "acceptable", "distance": 2.488, "atom1_id": "///H/844/O", "atom2_id": "///H/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8820, "atom2_serNum": 9156, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///H/845/O", "atom2_id": "///H/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8828, "atom2_serNum": 8855, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///H/846/O", "atom2_id": "///H/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8828, "atom2_serNum": 8863, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/846/O", "atom2_id": "///H/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8836, "atom2_serNum": 8871, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/847/O", "atom2_id": "///H/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8853, "atom2_serNum": 9156, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///H/848/OD1", "atom2_id": "///H/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8854, "atom2_serNum": 9157, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/848/OD2", "atom2_id": "///H/886/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8858, "atom2_serNum": 8882, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///H/849/O", "atom2_id": "///H/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8858, "atom2_serNum": 9098, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///H/849/O", "atom2_id": "///H/879/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8905, "atom2_serNum": 8925, "donAcc_type": "standard", "distance": 3.625, "atom1_id": "///H/855/O", "atom2_id": "///H/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8928, "atom2_serNum": 8981, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///H/858/O", "atom2_id": "///H/864/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8928, "atom2_serNum": 9005, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///H/858/O", "atom2_id": "///H/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8943, "atom2_serNum": 8980, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/860/N", "atom2_id": "///H/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8954, "atom2_serNum": 8980, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///H/861/N", "atom2_id": "///H/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8960, "atom2_serNum": 8967, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///H/861/OD1", "atom2_id": "///H/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8981, "atom2_serNum": 8990, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///H/864/NE2", "atom2_id": "///H/866/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8985, "atom2_serNum": 9385, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///H/865/O", "atom2_id": "///H/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 9001, "atom2_serNum": 9021, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///H/867/O", "atom2_id": "///H/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 9013, "atom2_serNum": 9019, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///H/869/N", "atom2_id": "///H/869/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 9016, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///H/869/O", "atom2_id": "///H/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 9020, "atom2_serNum": 9100, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///H/869/OD2", "atom2_id": "///H/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 9020, "atom2_serNum": 9101, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///H/869/OD2", "atom2_id": "///H/879/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 9032, "atom2_serNum": 9672, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///H/871/O", "atom2_id": "///H/952/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 9038, "atom2_serNum": 9056, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///H/872/O", "atom2_id": "///H/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 9045, "atom2_serNum": 9083, "donAcc_type": "acceptable", "distance": 3.487, "atom1_id": "///H/873/O", "atom2_id": "///H/877/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 9053, "atom2_serNum": 9085, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///H/874/O", "atom2_id": "///H/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 9053, "atom2_serNum": 9090, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///H/874/O", "atom2_id": "///H/878/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 9059, "atom2_serNum": 9100, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/875/O", "atom2_id": "///H/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 9070, "atom2_serNum": 9091, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///H/876/O", "atom2_id": "///H/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 9070, "atom2_serNum": 9102, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///H/876/O", "atom2_id": "///H/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 9094, "atom2_serNum": 9125, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///H/879/O", "atom2_id": "///H/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 9105, "atom2_serNum": 9133, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///H/880/O", "atom2_id": "///H/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 9116, "atom2_serNum": 9142, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///H/881/O", "atom2_id": "///H/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 9123, "atom2_serNum": 9147, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///H/882/O", "atom2_id": "///H/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 9128, "atom2_serNum": 9158, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///H/883/O", "atom2_id": "///H/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 9136, "atom2_serNum": 9166, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///H/884/O", "atom2_id": "///H/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 9140, "atom2_serNum": 9615, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///H/884/OE1", "atom2_id": "///H/945/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 9145, "atom2_serNum": 9175, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///H/885/O", "atom2_id": "///H/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 9150, "atom2_serNum": 9183, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///H/886/O", "atom2_id": "///H/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 9161, "atom2_serNum": 9191, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/887/O", "atom2_id": "///H/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 9161, "atom2_serNum": 9587, "donAcc_type": "acceptable", "distance": 2.545, "atom1_id": "///H/887/O", "atom2_id": "///H/941/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 9186, "atom2_serNum": 9209, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///H/890/O", "atom2_id": "///H/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 9197, "atom2_serNum": 9207, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///H/891/ND1", "atom2_id": "///H/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 9217, "atom2_serNum": 9239, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///H/894/O", "atom2_id": "///H/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 9217, "atom2_serNum": 9245, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///H/894/O", "atom2_id": "///H/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 9224, "atom2_serNum": 9253, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///H/895/O", "atom2_id": "///H/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9228, "atom2_serNum": 9803, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///H/895/OE1", "atom2_id": "///H/969/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9228, "atom2_serNum": 9804, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///H/895/OE1", "atom2_id": "///H/969/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 9229, "atom2_serNum": 9804, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/895/OE2", "atom2_id": "///H/969/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9233, "atom2_serNum": 9264, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///H/896/O", "atom2_id": "///H/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9242, "atom2_serNum": 9269, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/897/O", "atom2_id": "///H/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9248, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///H/898/O", "atom2_id": "///H/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9256, "atom2_serNum": 9290, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///H/899/O", "atom2_id": "///H/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9256, "atom2_serNum": 9508, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///H/899/O", "atom2_id": "///H/929/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9262, "atom2_serNum": 9515, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///H/899/NH1", "atom2_id": "///H/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9262, "atom2_serNum": 9537, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///H/899/NH1", "atom2_id": "///H/933/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9263, "atom2_serNum": 9484, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///H/899/NH2", "atom2_id": "///H/926/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 9263, "atom2_serNum": 9515, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///H/899/NH2", "atom2_id": "///H/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9267, "atom2_serNum": 9295, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/900/O", "atom2_id": "///H/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 9272, "atom2_serNum": 9300, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///H/901/O", "atom2_id": "///H/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 9272, "atom2_serNum": 9305, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///H/901/O", "atom2_id": "///H/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9286, "atom2_serNum": 9305, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///H/902/O", "atom2_id": "///H/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9286, "atom2_serNum": 9307, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///H/902/O", "atom2_id": "///H/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9293, "atom2_serNum": 9321, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///H/903/O", "atom2_id": "///H/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9298, "atom2_serNum": 9331, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///H/904/O", "atom2_id": "///H/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9303, "atom2_serNum": 9340, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/905/O", "atom2_id": "///H/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9310, "atom2_serNum": 9349, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///H/906/O", "atom2_id": "///H/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9343, "atom2_serNum": 9362, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///H/909/O", "atom2_id": "///H/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9365, "atom2_serNum": 9380, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///H/912/O", "atom2_id": "///H/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9365, "atom2_serNum": 9420, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///H/912/O", "atom2_id": "///H/919/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9383, "atom2_serNum": 9399, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///H/914/O", "atom2_id": "///H/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9409, "atom2_serNum": 9434, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///H/918/O", "atom2_id": "///H/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9426, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///H/920/N", "atom2_id": "///H/920/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9466, "atom2_serNum": 9495, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///H/924/O", "atom2_id": "///H/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9472, "atom2_serNum": 9500, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///H/925/O", "atom2_id": "///H/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9480, "atom2_serNum": 9509, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///H/926/O", "atom2_id": "///H/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9489, "atom2_serNum": 9517, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///H/927/O", "atom2_id": "///H/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9493, "atom2_serNum": 9516, "donAcc_type": "questionable", "distance": 3.301, "atom1_id": "///H/927/OE1", "atom2_id": "///H/930/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9498, "atom2_serNum": 9525, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///H/928/O", "atom2_id": "///H/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9503, "atom2_serNum": 9532, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///H/929/O", "atom2_id": "///H/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9503, "atom2_serNum": 9537, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///H/929/O", "atom2_id": "///H/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9512, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/930/O", "atom2_id": "///H/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9520, "atom2_serNum": 9544, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/931/O", "atom2_id": "///H/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9528, "atom2_serNum": 9552, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///H/932/O", "atom2_id": "///H/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9555, "atom2_serNum": 9574, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///H/936/O", "atom2_id": "///H/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9559, "atom2_serNum": 9582, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///H/937/O", "atom2_id": "///H/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9563, "atom2_serNum": 9588, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///H/938/O", "atom2_id": "///H/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9570, "atom2_serNum": 9592, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/939/O", "atom2_id": "///H/943/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9577, "atom2_serNum": 9599, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///H/940/O", "atom2_id": "///H/944/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9585, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///H/941/O", "atom2_id": "///H/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9587, "atom2_serNum": 9614, "donAcc_type": "acceptable", "distance": 3.993, "atom1_id": "///H/941/OG", "atom2_id": "///H/945/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9591, "atom2_serNum": 9616, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///H/942/O", "atom2_id": "///H/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9591, "atom2_serNum": 9622, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///H/942/O", "atom2_id": "///H/946/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9595, "atom2_serNum": 9626, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///H/943/O", "atom2_id": "///H/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9602, "atom2_serNum": 9634, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///H/944/O", "atom2_id": "///H/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9608, "atom2_serNum": 9639, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///H/945/O", "atom2_id": "///H/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9616, "atom2_serNum": 9622, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///H/946/N", "atom2_id": "///H/946/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9619, "atom2_serNum": 9644, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///H/946/O", "atom2_id": "///H/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9647, "atom2_serNum": 9674, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///H/950/O", "atom2_id": "///H/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9647, "atom2_serNum": 9684, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///H/950/O", "atom2_id": "///H/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9651, "atom2_serNum": 9680, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///H/950/OD2", "atom2_id": "///H/953/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9655, "atom2_serNum": 9690, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///H/951/O", "atom2_id": "///H/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9666, "atom2_serNum": 9945, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///H/952/O", "atom2_id": "///H/986/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9693, "atom2_serNum": 9709, "donAcc_type": "standard", "distance": 3.884, "atom1_id": "///H/955/O", "atom2_id": "///H/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9724, "atom2_serNum": 9857, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///H/960/N", "atom2_id": "///H/975/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9729, "atom2_serNum": 9846, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///H/961/N", "atom2_id": "///H/974/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9732, "atom2_serNum": 9843, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///H/961/O", "atom2_id": "///H/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9744, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///H/963/N", "atom2_id": "///H/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9747, "atom2_serNum": 9826, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///H/963/O", "atom2_id": "///H/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9765, "atom2_serNum": 9808, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/965/N", "atom2_id": "///H/970/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9768, "atom2_serNum": 9794, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///H/965/O", "atom2_id": "///H/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9772, "atom2_serNum": 9793, "donAcc_type": "acceptable", "distance": 3.341, "atom1_id": "///H/965/ND2", "atom2_id": "///H/968/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9834, "atom2_serNum": 10074, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///H/972/NZ", "atom2_id": "///H/1002/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9835, "atom2_serNum": 10053, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///H/973/N", "atom2_id": "///H/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9838, "atom2_serNum": 10066, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///H/973/O", "atom2_id": "///H/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9850, "atom2_serNum": 10069, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///H/975/N", "atom2_id": "///H/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9853, "atom2_serNum": 10082, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///H/975/O", "atom2_id": "///H/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9858, "atom2_serNum": 9874, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///H/975/OE2", "atom2_id": "///H/977/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9866, "atom2_serNum": 10085, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///H/977/N", "atom2_id": "///H/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9869, "atom2_serNum": 10098, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///H/977/O", "atom2_id": "///H/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9874, "atom2_serNum": 9954, "donAcc_type": "questionable", "distance": 3.411, "atom1_id": "///H/977/NZ", "atom2_id": "///H/987/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9878, "atom2_serNum": 9894, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///H/978/O", "atom2_id": "///H/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 9879, "atom2_serNum": 10101, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///H/979/N", "atom2_id": "///H/1006/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9900, "atom2_serNum": 9902, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///H/981/OD1", "atom2_id": "///H/982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9921, "atom2_serNum": 9953, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///H/984/N", "atom2_id": "///H/987/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9924, "atom2_serNum": 9955, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///H/984/O", "atom2_id": "///H/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9930, "atom2_serNum": 9963, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/985/O", "atom2_id": "///H/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9940, "atom2_serNum": 9971, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///H/986/O", "atom2_id": "///H/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9949, "atom2_serNum": 9985, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///H/987/O", "atom2_id": "///H/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9958, "atom2_serNum": 9993, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///H/988/O", "atom2_id": "///H/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9966, "atom2_serNum": 9998, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///H/989/O", "atom2_id": "///H/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9974, "atom2_serNum": 10007, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/990/O", "atom2_id": "///H/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9988, "atom2_serNum": 10015, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/991/O", "atom2_id": "///H/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9996, "atom2_serNum": 10024, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///H/992/O", "atom2_id": "///H/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 10001, "atom2_serNum": 10033, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///H/993/O", "atom2_id": "///H/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 10010, "atom2_serNum": 10045, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///H/994/O", "atom2_id": "///H/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 10018, "atom2_serNum": 10041, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/995/O", "atom2_id": "///H/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4reb", "num_aaChains": 2, "aaChains": "A=566,H=584", "num_naChains": 3, "naChains": "D=9,E=20,F=10", "num_atoms": 10098, "num_waters": 0, "num_metals": 2, "metals_desc": "Sm=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }