{ "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///D/8", "nt2": "///D/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.699, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.579, "chi2": -166.011, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.204, "C1C1_dist": 10.942, "N1N9_dist": 9.155, "C6C8_dist": 10.050, "CNNC_torsion": -10.512, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 11.887, "planarity": 0.188, "simple_Shear": 0.343, "simple_Stretch": 0.066, "simple_Buckle": -8.925, "simple_Propeller": -7.852, "bp_simpleParams": [ 0.343, 0.066, 0.311, -8.925, -7.852, -0.074 ], "bp_params": [ 0.345, 0.052, 0.311, -9.250, -7.466, -0.074 ], "frame": { "rmsd": null, "origin": [ -36.750, -15.435, -6.835 ], "x_axis": [ 0.471, 0.853, -0.225 ], "y_axis": [ 0.833, -0.514, -0.204 ], "z_axis": [ -0.289, -0.091, -0.953 ], "quaternion": [ -0.033, 0.857, 0.492, -0.150 ] } }, { "index": 2, "nt1": "///D/9", "nt2": "///D/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.721, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.367, "chi2": -156.799, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.817, "C1C1_dist": 10.739, "N1N9_dist": 9.003, "C6C8_dist": 9.992, "CNNC_torsion": -10.718, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.27],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.63]", "interBase_angle": 13.565, "planarity": 0.164, "simple_Shear": -0.389, "simple_Stretch": 0.022, "simple_Buckle": -7.423, "simple_Propeller": -11.353, "bp_simpleParams": [ -0.389, 0.022, 0.072, -7.423, -11.353, 5.097 ], "bp_params": [ -0.390, 0.011, 0.072, -7.081, -11.570, 5.114 ], "frame": { "rmsd": null, "origin": [ -38.772, -15.222, -9.473 ], "x_axis": [ 0.884, 0.426, -0.192 ], "y_axis": [ 0.419, -0.905, -0.076 ], "z_axis": [ -0.206, -0.014, -0.978 ], "quaternion": [ -0.016, 0.970, 0.218, -0.103 ] } }, { "index": 3, "nt1": "///D/10", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.705, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.177, "chi2": -171.684, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.521, "C1C1_dist": 10.607, "N1N9_dist": 8.929, "C6C8_dist": 10.007, "CNNC_torsion": -8.096, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.54],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[3.27]", "interBase_angle": 10.032, "planarity": 0.143, "simple_Shear": 0.014, "simple_Stretch": 0.014, "simple_Buckle": 5.316, "simple_Propeller": -8.507, "bp_simpleParams": [ 0.014, 0.014, 0.278, 5.316, -8.507, 6.813 ], "bp_params": [ 0.014, 0.014, 0.278, 5.354, -8.483, 6.825 ], "frame": { "rmsd": null, "origin": [ -38.491, -13.489, -12.381 ], "x_axis": [ 0.985, -0.069, -0.156 ], "y_axis": [ -0.064, -0.997, 0.035 ], "z_axis": [ -0.157, -0.024, -0.987 ], "quaternion": [ 0.015, 0.996, -0.033, -0.079 ] } }, { "index": 4, "nt1": "///D/11", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.646, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.617, "chi2": -173.844, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.501, "C1C1_dist": 10.340, "N1N9_dist": 8.825, "C6C8_dist": 9.804, "CNNC_torsion": 3.590, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 13.779, "planarity": 0.200, "simple_Shear": -0.359, "simple_Stretch": -0.223, "simple_Buckle": 9.628, "simple_Propeller": -9.857, "bp_simpleParams": [ -0.359, -0.223, -0.879, 9.628, -9.857, 2.549 ], "bp_params": [ -0.349, -0.239, -0.879, 10.052, -9.424, 2.548 ], "frame": { "rmsd": null, "origin": [ -37.602, -11.383, -15.443 ], "x_axis": [ 0.836, -0.539, -0.103 ], "y_axis": [ -0.547, -0.834, -0.072 ], "z_axis": [ -0.047, 0.117, -0.992 ], "quaternion": [ -0.049, 0.957, -0.284, -0.039 ] } }, { "index": 5, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.222, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.722, "chi2": -165.744, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.009, "C1C1_dist": 10.553, "N1N9_dist": 8.874, "C6C8_dist": 9.822, "CNNC_torsion": 7.041, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.77],N4(amino)-O6(carbonyl)[2.75]", "interBase_angle": 4.106, "planarity": 0.061, "simple_Shear": -0.425, "simple_Stretch": -0.203, "simple_Buckle": 1.284, "simple_Propeller": 3.901, "bp_simpleParams": [ -0.425, -0.203, -0.149, 1.284, 3.901, 0.283 ], "bp_params": [ -0.415, -0.222, -0.149, 1.101, 3.956, 0.284 ], "frame": { "rmsd": null, "origin": [ -36.474, -9.202, -19.089 ], "x_axis": [ 0.550, -0.833, 0.067 ], "y_axis": [ -0.835, -0.548, 0.049 ], "z_axis": [ -0.004, -0.082, -0.997 ], "quaternion": [ 0.037, 0.880, -0.474, 0.018 ] } }, { "index": 6, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.158, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.997, "chi2": -178.608, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.926, "C1C1_dist": 10.113, "N1N9_dist": 8.578, "C6C8_dist": 9.654, "CNNC_torsion": 20.273, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[3.22]", "interBase_angle": 27.356, "planarity": 0.324, "simple_Shear": -0.169, "simple_Stretch": -0.126, "simple_Buckle": 22.193, "simple_Propeller": 15.995, "bp_simpleParams": [ -0.169, -0.126, -0.915, 22.193, 15.995, 5.720 ], "bp_params": [ -0.168, -0.128, -0.915, 22.097, 16.127, 5.673 ], "frame": { "rmsd": null, "origin": [ -34.138, -9.367, -22.234 ], "x_axis": [ 0.126, -0.992, -0.020 ], "y_axis": [ -0.992, -0.126, 0.005 ], "z_axis": [ -0.007, 0.020, -1.000 ], "quaternion": [ -0.005, 0.750, -0.661, -0.009 ] } }, { "index": 7, "nt1": "///C/8", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.502, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.696, "chi2": -160.616, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.656, "C1C1_dist": 10.398, "N1N9_dist": 8.823, "C6C8_dist": 9.919, "CNNC_torsion": -8.038, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.50]", "interBase_angle": 13.493, "planarity": 0.155, "simple_Shear": -0.146, "simple_Stretch": -0.076, "simple_Buckle": -8.806, "simple_Propeller": -10.223, "bp_simpleParams": [ -0.146, -0.076, -0.045, -8.806, -10.223, 6.332 ], "bp_params": [ -0.145, -0.077, -0.045, -8.736, -10.283, 6.339 ], "frame": { "rmsd": null, "origin": [ -11.313, -21.280, -1.234 ], "x_axis": [ -0.215, -0.830, -0.516 ], "y_axis": [ -0.522, 0.544, -0.657 ], "z_axis": [ 0.826, 0.128, -0.550 ], "quaternion": [ 0.441, -0.445, 0.760, -0.174 ] } }, { "index": 8, "nt1": "///C/9", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.101, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.643, "chi2": -157.001, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.419, "C1C1_dist": 10.596, "N1N9_dist": 8.951, "C6C8_dist": 9.957, "CNNC_torsion": -0.152, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.22],N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 4.611, "planarity": 0.053, "simple_Shear": -0.901, "simple_Stretch": -0.025, "simple_Buckle": -4.611, "simple_Propeller": 0.059, "bp_simpleParams": [ -0.901, -0.025, -0.201, -4.611, 0.059, 2.948 ], "bp_params": [ -0.895, -0.103, -0.201, -4.599, -0.337, 2.945 ], "frame": { "rmsd": null, "origin": [ -7.918, -21.503, -1.693 ], "x_axis": [ -0.591, -0.462, -0.662 ], "y_axis": [ -0.338, 0.886, -0.316 ], "z_axis": [ 0.733, 0.037, -0.679 ], "quaternion": [ 0.393, -0.225, 0.888, -0.079 ] } }, { "index": 9, "nt1": "///C/10", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.766, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.875, "chi2": -169.733, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.523, "C1C1_dist": 10.660, "N1N9_dist": 8.873, "C6C8_dist": 9.702, "CNNC_torsion": -4.484, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.01],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.67]", "interBase_angle": 17.361, "planarity": 0.190, "simple_Shear": 0.525, "simple_Stretch": -0.275, "simple_Buckle": 12.555, "simple_Propeller": -11.990, "bp_simpleParams": [ 0.525, -0.275, -0.576, 12.555, -11.990, -3.889 ], "bp_params": [ 0.513, -0.297, -0.576, 12.032, -12.515, -3.891 ], "frame": { "rmsd": null, "origin": [ -6.169, -23.206, -4.048 ], "x_axis": [ -0.692, 0.113, -0.713 ], "y_axis": [ 0.127, 0.991, 0.034 ], "z_axis": [ 0.711, -0.066, -0.700 ], "quaternion": [ 0.387, 0.065, 0.920, -0.009 ] } }, { "index": 10, "nt1": "///C/11", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.940, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.466, "chi2": -172.326, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.964, "C1C1_dist": 10.491, "N1N9_dist": 8.916, "C6C8_dist": 9.886, "CNNC_torsion": 2.672, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 10.873, "planarity": 0.238, "simple_Shear": 0.390, "simple_Stretch": -0.148, "simple_Buckle": -2.358, "simple_Propeller": -10.614, "bp_simpleParams": [ 0.390, -0.148, -0.707, -2.358, -10.614, 2.235 ], "bp_params": [ 0.385, -0.162, -0.707, -2.732, -10.524, 2.244 ], "frame": { "rmsd": null, "origin": [ -4.892, -25.374, -7.732 ], "x_axis": [ -0.632, 0.592, -0.501 ], "y_axis": [ 0.509, 0.804, 0.307 ], "z_axis": [ 0.584, -0.061, -0.809 ], "quaternion": [ 0.301, 0.306, 0.901, 0.068 ] } }, { "index": 11, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.393, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.763, "chi2": -165.150, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.315, "C1C1_dist": 10.480, "N1N9_dist": 8.912, "C6C8_dist": 10.030, "CNNC_torsion": 13.807, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.45],N3-N1(imino)[2.91],N3-N2(amino)[3.14],N4(amino)-O6(carbonyl)[3.32]", "interBase_angle": 14.979, "planarity": 0.185, "simple_Shear": -0.100, "simple_Stretch": 0.041, "simple_Buckle": -6.065, "simple_Propeller": 13.696, "bp_simpleParams": [ -0.100, 0.041, -0.096, -6.065, 13.696, 9.319 ], "bp_params": [ -0.101, 0.039, -0.096, -6.316, 13.582, 9.371 ], "frame": { "rmsd": null, "origin": [ -4.063, -27.332, -11.617 ], "x_axis": [ -0.468, 0.834, -0.292 ], "y_axis": [ 0.636, 0.547, 0.544 ], "z_axis": [ 0.614, 0.069, -0.786 ], "quaternion": [ 0.271, 0.439, 0.837, 0.183 ] } }, { "index": 12, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.406, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.178, "chi2": -167.901, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.765, "C1C1_dist": 10.086, "N1N9_dist": 8.569, "C6C8_dist": 9.661, "CNNC_torsion": 13.632, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 14.749, "planarity": 0.217, "simple_Shear": 0.151, "simple_Stretch": -0.253, "simple_Buckle": 13.958, "simple_Propeller": 4.765, "bp_simpleParams": [ 0.151, -0.253, -1.046, 13.958, 4.765, 6.572 ], "bp_params": [ 0.148, -0.255, -1.046, 14.027, 4.559, 6.528 ], "frame": { "rmsd": null, "origin": [ -4.162, -27.325, -15.066 ], "x_axis": [ -0.103, 0.995, -0.016 ], "y_axis": [ 0.875, 0.098, 0.474 ], "z_axis": [ 0.473, 0.035, -0.880 ], "quaternion": [ 0.170, 0.648, 0.721, 0.176 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGCCCU", "strand2": "CCGGGA", "bp_type": "||||||", "helix_form": "AAA..", "helical_rise": 3.006, "helical_rise_std": 0.254, "helical_radius": 9.870, "helical_radius_std": 1.463, "helical_axis": [ -0.158, -0.124, -0.980 ], "point1": [ -33.306, -13.588, -7.071 ], "point2": [ -35.693, -15.464, -21.862 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///D/8", "nt2": "///D/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.345, 0.052, 0.311, -9.250, -7.466, -0.074 ], "step_params": [ -0.716, -1.151, 3.042, -0.045, 6.666, 33.964 ], "heli_params": [ -2.858, 1.198, 2.774, 11.277, 0.076, 34.593 ], "bp2_params": [ -0.390, 0.011, 0.072, -7.081, -11.570, 5.114 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.042, "simple_Twist": 37.692, "simple_hRise": 2.806, "simple_hTwist": 38.256 }, { "index": 2, "nt1": "///D/9", "nt2": "///D/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.390, 0.011, 0.072, -7.081, -11.570, 5.114 ], "step_params": [ 1.121, -1.606, 2.776, -1.123, 2.682, 29.216 ], "heli_params": [ -3.643, -2.410, 2.577, 5.299, 2.220, 29.357 ], "bp2_params": [ 0.014, 0.014, 0.278, 5.354, -8.483, 6.825 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.776, "simple_Twist": 27.229, "simple_hRise": 2.561, "simple_hTwist": 27.381 }, { "index": 3, "nt1": "///D/10", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, 0.014, 0.278, 5.354, -8.483, 6.825 ], "step_params": [ 0.521, -2.244, 3.049, 9.673, 3.471, 28.649 ], "heli_params": [ -4.919, 0.791, 2.789, 6.746, -18.801, 30.400 ], "bp2_params": [ -0.349, -0.239, -0.879, 10.052, -9.424, 2.548 ], "groove_widths": [ 16.615, null, 20.649, null ], "simple_Rise": 3.049, "simple_Twist": 30.907, "simple_hRise": 2.818, "simple_hTwist": 32.532 }, { "index": 4, "nt1": "///D/11", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.349, -0.239, -0.879, 10.052, -9.424, 2.548 ], "step_params": [ -0.628, -2.363, 3.653, -6.358, 9.811, 23.731 ], "heli_params": [ -7.796, -0.326, 2.571, 22.214, 14.394, 26.418 ], "bp2_params": [ -0.415, -0.222, -0.149, 1.101, 3.956, 0.284 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.653, "simple_Twist": 24.077, "simple_hRise": 2.589, "simple_hTwist": 26.727 }, { "index": 5, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.415, -0.222, -0.149, 1.101, 3.956, 0.284 ], "step_params": [ 0.879, -2.184, 3.136, 1.865, -5.557, 26.065 ], "heli_params": [ -3.227, -1.400, 3.569, -12.127, -4.070, 26.705 ], "bp2_params": [ -0.168, -0.128, -0.915, 22.097, 16.127, 5.673 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.136, "simple_Twist": 24.023, "simple_hRise": 3.598, "simple_hTwist": 24.717 }, { "index": 6, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "GGCCCU", "strand2": "CCGGGA", "bp_type": "||||||", "helix_form": "AA..A", "helical_rise": 2.920, "helical_rise_std": 0.256, "helical_radius": 9.807, "helical_radius_std": 1.091, "helical_axis": [ 0.670, 0.173, -0.722 ], "point1": [ -13.610, -24.062, -3.142 ], "point2": [ -3.776, -21.527, -13.734 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///C/8", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.077, -0.045, -8.736, -10.283, 6.339 ], "step_params": [ -0.976, -1.517, 2.921, -2.267, 10.287, 30.015 ], "heli_params": [ -4.336, 1.439, 2.351, 19.137, 4.216, 31.770 ], "bp2_params": [ -0.895, -0.103, -0.201, -4.599, -0.337, 2.945 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 34.470, "simple_hRise": 2.440, "simple_hTwist": 35.997 }, { "index": 2, "nt1": "///C/9", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.895, -0.103, -0.201, -4.599, -0.337, 2.945 ], "step_params": [ 0.790, -1.542, 2.916, 5.518, 2.780, 33.994 ], "heli_params": [ -2.981, -0.568, 2.874, 4.707, -9.342, 34.535 ], "bp2_params": [ 0.513, -0.297, -0.576, 12.032, -12.515, -3.891 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.916, "simple_Twist": 26.039, "simple_hRise": 2.843, "simple_hTwist": 26.750 }, { "index": 3, "nt1": "///C/10", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.513, -0.297, -0.576, 12.032, -12.515, -3.891 ], "step_params": [ 0.625, -2.320, 3.759, 3.202, 9.037, 29.228 ], "heli_params": [ -6.251, -0.515, 2.976, 17.329, -6.140, 30.728 ], "bp2_params": [ 0.385, -0.162, -0.707, -2.732, -10.524, 2.244 ], "groove_widths": [ 16.711, null, 20.461, null ], "simple_Rise": 3.759, "simple_Twist": 29.705, "simple_hRise": 2.990, "simple_hTwist": 31.180 }, { "index": 4, "nt1": "///C/11", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.385, -0.162, -0.707, -2.732, -10.524, 2.244 ], "step_params": [ -0.282, -2.570, 3.596, -6.668, 3.933, 20.371 ], "heli_params": [ -8.412, -1.982, 2.993, 10.638, 18.033, 21.778 ], "bp2_params": [ -0.101, 0.039, -0.096, -6.316, 13.582, 9.371 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.596, "simple_Twist": 23.695, "simple_hRise": 3.098, "simple_hTwist": 24.910 }, { "index": 5, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, 0.039, -0.096, -6.316, 13.582, 9.371 ], "step_params": [ 0.524, -1.900, 2.831, 9.788, 1.377, 28.141 ], "heli_params": [ -3.949, 0.779, 2.760, 2.728, -19.388, 29.794 ], "bp2_params": [ 0.148, -0.255, -1.046, 14.027, 4.559, 6.528 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.831, "simple_Twist": 26.147, "simple_hRise": 2.743, "simple_hTwist": 27.922 }, { "index": 6, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGCCCU", "strand2": "CCGGGA", "bp_type": "||||||", "helix_form": "AAA..", "helical_rise": 3.006, "helical_rise_std": 0.254, "helical_radius": 9.870, "helical_radius_std": 1.463, "helical_axis": [ -0.158, -0.124, -0.980 ], "point1": [ -33.306, -13.588, -7.071 ], "point2": [ -35.693, -15.464, -21.862 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///D/8", "nt2": "///D/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.345, 0.052, 0.311, -9.250, -7.466, -0.074 ], "step_params": [ -0.716, -1.151, 3.042, -0.045, 6.666, 33.964 ], "heli_params": [ -2.858, 1.198, 2.774, 11.277, 0.076, 34.593 ], "bp2_params": [ -0.390, 0.011, 0.072, -7.081, -11.570, 5.114 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.042, "simple_Twist": 37.692, "simple_hRise": 2.806, "simple_hTwist": 38.256 }, { "index": 2, "nt1": "///D/9", "nt2": "///D/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.390, 0.011, 0.072, -7.081, -11.570, 5.114 ], "step_params": [ 1.121, -1.606, 2.776, -1.123, 2.682, 29.216 ], "heli_params": [ -3.643, -2.410, 2.577, 5.299, 2.220, 29.357 ], "bp2_params": [ 0.014, 0.014, 0.278, 5.354, -8.483, 6.825 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.776, "simple_Twist": 27.229, "simple_hRise": 2.561, "simple_hTwist": 27.381 }, { "index": 3, "nt1": "///D/10", "nt2": "///D/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, 0.014, 0.278, 5.354, -8.483, 6.825 ], "step_params": [ 0.521, -2.244, 3.049, 9.673, 3.471, 28.649 ], "heli_params": [ -4.919, 0.791, 2.789, 6.746, -18.801, 30.400 ], "bp2_params": [ -0.349, -0.239, -0.879, 10.052, -9.424, 2.548 ], "groove_widths": [ 16.615, null, 20.649, null ], "simple_Rise": 3.049, "simple_Twist": 30.907, "simple_hRise": 2.818, "simple_hTwist": 32.532 }, { "index": 4, "nt1": "///D/11", "nt2": "///D/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.349, -0.239, -0.879, 10.052, -9.424, 2.548 ], "step_params": [ -0.628, -2.363, 3.653, -6.358, 9.811, 23.731 ], "heli_params": [ -7.796, -0.326, 2.571, 22.214, 14.394, 26.418 ], "bp2_params": [ -0.415, -0.222, -0.149, 1.101, 3.956, 0.284 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.653, "simple_Twist": 24.077, "simple_hRise": 2.589, "simple_hTwist": 26.727 }, { "index": 5, "nt1": "///D/12", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.415, -0.222, -0.149, 1.101, 3.956, 0.284 ], "step_params": [ 0.879, -2.184, 3.136, 1.865, -5.557, 26.065 ], "heli_params": [ -3.227, -1.400, 3.569, -12.127, -4.070, 26.705 ], "bp2_params": [ -0.168, -0.128, -0.915, 22.097, 16.127, 5.673 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.136, "simple_Twist": 24.023, "simple_hRise": 3.598, "simple_hTwist": 24.717 }, { "index": 6, "nt1": "///D/13", "nt2": "///D/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GGCCCU", "strand2": "CCGGGA", "bp_type": "||||||", "helix_form": "AA..A", "helical_rise": 2.920, "helical_rise_std": 0.256, "helical_radius": 9.807, "helical_radius_std": 1.091, "helical_axis": [ 0.670, 0.173, -0.722 ], "point1": [ -13.610, -24.062, -3.142 ], "point2": [ -3.776, -21.527, -13.734 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///C/8", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.077, -0.045, -8.736, -10.283, 6.339 ], "step_params": [ -0.976, -1.517, 2.921, -2.267, 10.287, 30.015 ], "heli_params": [ -4.336, 1.439, 2.351, 19.137, 4.216, 31.770 ], "bp2_params": [ -0.895, -0.103, -0.201, -4.599, -0.337, 2.945 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 34.470, "simple_hRise": 2.440, "simple_hTwist": 35.997 }, { "index": 2, "nt1": "///C/9", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.895, -0.103, -0.201, -4.599, -0.337, 2.945 ], "step_params": [ 0.790, -1.542, 2.916, 5.518, 2.780, 33.994 ], "heli_params": [ -2.981, -0.568, 2.874, 4.707, -9.342, 34.535 ], "bp2_params": [ 0.513, -0.297, -0.576, 12.032, -12.515, -3.891 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.916, "simple_Twist": 26.039, "simple_hRise": 2.843, "simple_hTwist": 26.750 }, { "index": 3, "nt1": "///C/10", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.513, -0.297, -0.576, 12.032, -12.515, -3.891 ], "step_params": [ 0.625, -2.320, 3.759, 3.202, 9.037, 29.228 ], "heli_params": [ -6.251, -0.515, 2.976, 17.329, -6.140, 30.728 ], "bp2_params": [ 0.385, -0.162, -0.707, -2.732, -10.524, 2.244 ], "groove_widths": [ 16.711, null, 20.461, null ], "simple_Rise": 3.759, "simple_Twist": 29.705, "simple_hRise": 2.990, "simple_hTwist": 31.180 }, { "index": 4, "nt1": "///C/11", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.385, -0.162, -0.707, -2.732, -10.524, 2.244 ], "step_params": [ -0.282, -2.570, 3.596, -6.668, 3.933, 20.371 ], "heli_params": [ -8.412, -1.982, 2.993, 10.638, 18.033, 21.778 ], "bp2_params": [ -0.101, 0.039, -0.096, -6.316, 13.582, 9.371 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.596, "simple_Twist": 23.695, "simple_hRise": 3.098, "simple_hTwist": 24.910 }, { "index": 5, "nt1": "///C/12", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, 0.039, -0.096, -6.316, 13.582, 9.371 ], "step_params": [ 0.524, -1.900, 2.831, 9.788, 1.377, 28.141 ], "heli_params": [ -3.949, 0.779, 2.760, 2.728, -19.388, 29.794 ], "bp2_params": [ 0.148, -0.255, -1.046, 14.027, 4.559, 6.528 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.831, "simple_Twist": 26.147, "simple_hRise": 2.743, "simple_hTwist": 27.922 }, { "index": 6, "nt1": "///C/13", "nt2": "///C/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "YU", "nts_long": "///A/204,///C/14" }, { "index": 2, "num_nts": 2, "nts_short": "HC", "nts_long": "///A/254,///C/17" }, { "index": 3, "num_nts": 2, "nts_short": "YU", "nts_long": "///B/204,///D/14" }, { "index": 4, "num_nts": 2, "nts_short": "HC", "nts_long": "///B/254,///D/17" }, { "index": 5, "num_nts": 2, "nts_short": "UA", "nts_long": "///D/16,///D/18" }, { "index": 6, "num_nts": 2, "nts_short": "UA", "nts_long": "///C/16,///C/18" }, { "index": 7, "num_nts": 4, "nts_short": "RGAC", "nts_long": "///B/240,///D/8,///D/24,///D/25" }, { "index": 8, "num_nts": 5, "nts_short": "GACCC", "nts_long": "///C/8,///C/24,///C/25,///C/26,///C/27" }, { "index": 9, "num_nts": 7, "nts_short": "GGCCAAA", "nts_long": "///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7" }, { "index": 10, "num_nts": 7, "nts_short": "GGCCAAA", "nts_long": "///C/1,///C/2,///C/3,///C/4,///C/5,///C/6,///C/7" } ], "nonStack": { "num_nts": 2, "nts_short": "UU", "nts_long": "///D/15,///C/15" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///D/16/O4'", "nt": "///D/18", "vert_dist": 2.897 }, { "index": 2, "type": "sugar", "atom": "///C/16/O4'", "nt": "///C/18", "vert_dist": 2.895 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 1 ], "summary": "[1] 4 [D.13 D.18] 6", "num_nts": 6, "nts_short": "UUUUCA", "nts_long": "///D/13,///D/14,///D/15,///D/16,///D/17,///D/18", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UUUC", "nts_long": "///D/14,///D/15,///D/16,///D/17" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 2 ], "summary": "[1] 4 [C.13 C.18] 6", "num_nts": 6, "nts_short": "UUUUCA", "nts_long": "///C/13,///C/14,///C/15,///C/16,///C/17,///C/18", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UUUC", "nts_long": "///C/14,///C/15,///C/16,///C/17" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 7, "nts_short": "GGCCAAA", "nts_long": "///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7" }, { "index": 2, "num_nts": 3, "nts_short": "ACC", "nts_long": "///D/24,///D/25,///D/26" }, { "index": 3, "num_nts": 7, "nts_short": "GGCCAAA", "nts_long": "///C/1,///C/2,///C/3,///C/4,///C/5,///C/6,///C/7" }, { "index": 4, "num_nts": 5, "nts_short": "ACCCC", "nts_long": "///C/24,///C/25,///C/26,///C/27,///C/28" } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///D/7,///D/8" }, { "index": 2, "num_nts": 5, "nts_short": "UUUCA", "nts_long": "///D/14,///D/15,///D/16,///D/17,///D/18" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/7,///C/8" }, { "index": 4, "num_nts": 5, "nts_short": "UUUCA", "nts_long": "///C/14,///C/15,///C/16,///C/17,///C/18" } ], "dbn": { "all_chains": { "num_nts": 54, "num_chars": 55, "bseq": "GGCCAAAGGCCCUUUUCAGGGCCACC&GGCCAAAGGCCCUUUUCAGGGCCACCCC", "sstr": ".......((((((....))))))...&.......((((((....)))))).....", "form": ".AAA.A.AAA.A......AAAAA.--&.AAA...AAA.A.....A..AAAA..--" }, "chain_D": { "num_nts": 26, "num_chars": 26, "bseq": "GGCCAAAGGCCCUUUUCAGGGCCACC", "sstr": ".......((((((....))))))...", "form": ".AAA.A.AAA.A......AAAAA.--" }, "chain_C": { "num_nts": 28, "num_chars": 28, "bseq": "GGCCAAAGGCCCUUUUCAGGGCCACCCC", "sstr": ".......((((((....)))))).....", "form": ".AAA...AAA.A.....A..AAAA..--" } }, "chains": { "chain_D": { "num_nts": 26, "bseq": "GGCCAAAGGCCCUUUUCAGGGCCACC", "sstr": ".......((((((....))))))...", "form": ".AAA.A.AAA.A......AAAAA.--", "helical_rise": 0.660, "helical_rise_std": 3.090, "helical_axis": [ 0.699, 0.258, 0.667 ], "point1": [ -34.412, -21.180, -19.014 ], "point2": [ -21.809, -16.535, -6.984 ], "num_chars": 76, "suite": "G!!G1aC1aC1aA1aA1aA7dG1aG1cC1aC1aC1aU!!U4pU2[U!!C!!A1aG1aG1aG1aC1aC1aA1aC!!C" }, "chain_C": { "num_nts": 28, "bseq": "GGCCAAAGGCCCUUUUCAGGGCCACCCC", "sstr": ".......((((((....)))))).....", "form": ".AAA...AAA.A.....A..AAAA..--", "helical_rise": 1.066, "helical_rise_std": 3.117, "helical_axis": [ -0.901, -0.327, 0.286 ], "point1": [ -3.565, -14.263, -13.460 ], "point2": [ -29.394, -23.655, -5.254 ], "num_chars": 82, "suite": "G1aG1aC1aC1aA1aA1aA7dG1aG1cC1aC1aC1aU!!U4pU2[U!!C!!A1aG1aG1aG1aC1aC1aA1aC1aC!!C!!C" } }, "num_nts": 54, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 64.710, "delta": 78.788, "epsilon": -152.883, "zeta": -45.689, "epsilon_zeta": -107.194, "bb_type": "BI", "chi": 18.681, "glyco_bond": "syn", "C5prime_xyz": [ -5.410, 3.411, -0.604 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -4.440, "Dp": 4.611, "splay_angle": 36.815, "splay_distance": 5.659, "splay_ratio": 0.324, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.786, "v1": -25.994, "v2": 38.477, "v3": -37.717, "v4": 22.102, "amplitude": 39.777, "phase_angle": 14.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -27.787, -42.379, -22.292 ], "x_axis": [ 0.885, 0.259, -0.388 ], "y_axis": [ 0.463, -0.388, 0.797 ], "z_axis": [ 0.056, -0.885, -0.463 ], "quaternion": [ 0.508, 0.827, 0.218, -0.100 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -91.327, "beta": 163.888, "gamma": 87.818, "delta": 76.610, "epsilon": -121.250, "zeta": -87.629, "epsilon_zeta": -33.620, "bb_type": "--", "chi": 179.146, "glyco_bond": "anti", "C5prime_xyz": [ -1.517, 8.435, 1.683 ], "P_xyz": [ 0.982, 9.242, 1.387 ], "form": "A", "ssZp": 4.731, "Dp": 4.750, "splay_angle": 23.343, "splay_distance": 3.623, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 169.834, "theta": -148.745, "eta_prime": -165.319, "theta_prime": -147.880, "eta_base": -172.369, "theta_base": -118.426, "v0": 1.121, "v1": -24.559, "v2": 37.694, "v3": -37.930, "v4": 23.223, "amplitude": 39.417, "phase_angle": 17.002, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -23.607, -38.716, -21.226 ], "x_axis": [ -0.848, 0.219, -0.482 ], "y_axis": [ -0.525, -0.464, 0.714 ], "z_axis": [ -0.067, 0.859, 0.508 ], "quaternion": [ 0.222, -0.163, 0.468, 0.840 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -67.115, "beta": 150.922, "gamma": 67.884, "delta": 73.309, "epsilon": -131.274, "zeta": -83.353, "epsilon_zeta": -47.921, "bb_type": "BI", "chi": -173.218, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.566, 1.269 ], "P_xyz": [ 1.099, 9.049, 0.614 ], "form": "A", "ssZp": 4.701, "Dp": 4.788, "splay_angle": 28.115, "splay_distance": 4.325, "splay_ratio": 0.248, "d22": 4.245, "d64": 4.662, "eta": 161.195, "theta": -143.855, "eta_prime": 175.391, "theta_prime": -142.935, "eta_base": -137.893, "theta_base": -113.955, "v0": 4.125, "v1": -29.425, "v2": 42.635, "v3": -41.346, "v4": 23.380, "amplitude": 43.822, "phase_angle": 13.365, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.309, "filter_rmsd": 0.055, "frame": { "rmsd": 0.012, "origin": [ -23.933, -35.109, -21.313 ], "x_axis": [ -0.999, -0.019, 0.033 ], "y_axis": [ 0.038, -0.411, 0.911 ], "z_axis": [ -0.003, 0.911, 0.412 ], "quaternion": [ -0.017, 0.009, 0.542, 0.840 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -43.499, "beta": 166.082, "gamma": 50.391, "delta": 78.800, "epsilon": -143.424, "zeta": -81.866, "epsilon_zeta": -61.558, "bb_type": "BI", "chi": -166.336, "glyco_bond": "anti", "C5prime_xyz": [ -1.212, 8.679, 0.877 ], "P_xyz": [ 1.372, 9.007, 0.995 ], "form": "A", "ssZp": 4.596, "Dp": 4.719, "splay_angle": 21.663, "splay_distance": 3.317, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 177.276, "theta": -149.029, "eta_prime": -170.071, "theta_prime": -146.892, "eta_base": -125.358, "theta_base": -116.667, "v0": 3.340, "v1": -26.728, "v2": 38.770, "v3": -37.761, "v4": 21.785, "amplitude": 39.936, "phase_angle": 13.876, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.471, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ -26.235, -31.452, -21.141 ], "x_axis": [ -0.750, -0.369, 0.548 ], "y_axis": [ 0.650, -0.264, 0.712 ], "z_axis": [ -0.118, 0.891, 0.439 ], "quaternion": [ -0.325, 0.137, 0.512, 0.783 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -44.998, "beta": 169.450, "gamma": 37.186, "delta": 83.593, "epsilon": -125.370, "zeta": -70.192, "epsilon_zeta": -55.177, "bb_type": "--", "chi": -158.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.004, 8.594, 0.394 ], "P_xyz": [ 1.591, 8.761, 0.598 ], "form": ".", "ssZp": 4.336, "Dp": 4.825, "splay_angle": 33.324, "splay_distance": 5.088, "splay_ratio": 0.287, "d22": null, "d64": null, "eta": 174.697, "theta": -122.240, "eta_prime": -176.220, "theta_prime": -117.049, "eta_base": -136.245, "theta_base": -68.242, "v0": 6.782, "v1": -27.670, "v2": 36.743, "v3": -33.907, "v4": 17.086, "amplitude": 37.134, "phase_angle": 8.322, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.405, "filter_rmsd": 0.043, "frame": { "rmsd": 0.008, "origin": [ -28.088, -28.931, -20.039 ], "x_axis": [ -0.223, -0.518, 0.826 ], "y_axis": [ 0.939, 0.114, 0.326 ], "z_axis": [ -0.263, 0.848, 0.461 ], "quaternion": [ 0.581, -0.225, -0.468, -0.626 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -68.573, "beta": 171.361, "gamma": 53.584, "delta": 83.015, "epsilon": -138.079, "zeta": -68.533, "epsilon_zeta": -69.546, "bb_type": "BI", "chi": -159.674, "glyco_bond": "anti", "C5prime_xyz": [ -0.787, 8.530, 0.514 ], "P_xyz": [ 1.835, 8.458, 0.428 ], "form": "A", "ssZp": 4.440, "Dp": 4.765, "splay_angle": 26.706, "splay_distance": 4.058, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 159.064, "theta": -132.055, "eta_prime": -178.233, "theta_prime": -128.454, "eta_base": -111.715, "theta_base": -89.134, "v0": 10.347, "v1": -30.609, "v2": 38.307, "v3": -33.266, "v4": 14.527, "amplitude": 38.371, "phase_angle": 3.319, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.690, "filter_rmsd": 0.045, "frame": { "rmsd": 0.012, "origin": [ -28.178, -28.608, -14.962 ], "x_axis": [ 0.778, -0.461, 0.426 ], "y_axis": [ 0.617, 0.687, -0.384 ], "z_axis": [ -0.116, 0.562, 0.819 ], "quaternion": [ 0.906, -0.261, -0.149, -0.298 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -63.946, "beta": 167.088, "gamma": 61.179, "delta": 86.567, "epsilon": -127.342, "zeta": -110.404, "epsilon_zeta": -16.937, "bb_type": "--", "chi": -164.088, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.555, 0.826 ], "P_xyz": [ 1.460, 8.598, 0.924 ], "form": ".", "ssZp": 4.378, "Dp": 4.669, "splay_angle": 136.625, "splay_distance": 16.977, "splay_ratio": 0.929, "d22": null, "d64": null, "eta": 175.715, "theta": -143.712, "eta_prime": -164.612, "theta_prime": -172.713, "eta_base": -109.161, "theta_base": 163.533, "v0": 4.571, "v1": -24.941, "v2": 34.603, "v3": -33.066, "v4": 18.086, "amplitude": 35.310, "phase_angle": 11.486, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.811, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ -26.385, -28.091, -11.358 ], "x_axis": [ 0.986, 0.033, -0.163 ], "y_axis": [ -0.110, 0.865, -0.489 ], "z_axis": [ 0.125, 0.500, 0.857 ], "quaternion": [ 0.963, -0.257, 0.075, 0.037 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": 49.650, "beta": -164.733, "gamma": 81.855, "delta": 89.412, "epsilon": -133.859, "zeta": -83.674, "epsilon_zeta": -50.185, "bb_type": "BI", "chi": 179.699, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.494, 1.697 ], "P_xyz": [ 0.807, 8.570, 2.612 ], "form": "A", "ssZp": 4.286, "Dp": 4.379, "splay_angle": 20.575, "splay_distance": 3.326, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": -31.436, "theta": -136.472, "eta_prime": -21.840, "theta_prime": -138.848, "eta_base": -30.260, "theta_base": -119.202, "v0": -1.132, "v1": -17.465, "v2": 28.266, "v3": -29.736, "v4": 19.535, "amplitude": 30.224, "phase_angle": 20.738, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.033, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -36.692, -15.316, -7.028 ], "x_axis": [ 0.453, 0.844, -0.286 ], "y_axis": [ 0.855, -0.502, -0.127 ], "z_axis": [ -0.251, -0.187, -0.950 ], "quaternion": [ 0.018, 0.852, 0.499, -0.158 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.912, "beta": 176.138, "gamma": 26.553, "delta": 78.305, "epsilon": -162.222, "zeta": -72.060, "epsilon_zeta": -90.162, "bb_type": "BI", "chi": -153.721, "glyco_bond": "anti", "C5prime_xyz": [ -0.894, 8.758, 0.160 ], "P_xyz": [ 1.600, 9.256, 0.728 ], "form": "A", "ssZp": 4.293, "Dp": 4.597, "splay_angle": 20.857, "splay_distance": 3.573, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 152.403, "theta": -130.418, "eta_prime": 164.303, "theta_prime": -134.458, "eta_base": -157.508, "theta_base": -105.267, "v0": 6.399, "v1": -29.125, "v2": 39.645, "v3": -36.953, "v4": 19.297, "amplitude": 40.213, "phase_angle": 9.640, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.094, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -38.949, -15.310, -9.471 ], "x_axis": [ 0.879, 0.379, -0.291 ], "y_axis": [ 0.395, -0.919, -0.003 ], "z_axis": [ -0.268, -0.112, -0.957 ], "quaternion": [ 0.028, 0.969, 0.200, -0.144 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 147.084, "beta": -154.716, "gamma": -179.078, "delta": 79.358, "epsilon": -128.097, "zeta": -72.561, "epsilon_zeta": -55.537, "bb_type": "BI", "chi": -175.705, "glyco_bond": "anti", "C5prime_xyz": [ -0.875, 8.318, 1.488 ], "P_xyz": [ 0.778, 9.914, 0.294 ], "form": "A", "ssZp": 4.715, "Dp": 4.774, "splay_angle": 19.676, "splay_distance": 3.446, "splay_ratio": 0.188, "d22": 4.498, "d64": 4.982, "eta": 163.628, "theta": -156.488, "eta_prime": -178.168, "theta_prime": -154.065, "eta_base": -127.927, "theta_base": -135.578, "v0": 6.922, "v1": -28.950, "v2": 39.230, "v3": -36.303, "v4": 18.511, "amplitude": 39.710, "phase_angle": 8.916, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.891, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -38.507, -13.500, -12.519 ], "x_axis": [ 0.965, -0.128, -0.228 ], "y_axis": [ -0.131, -0.991, 0.003 ], "z_axis": [ -0.227, 0.027, -0.974 ], "quaternion": [ -0.006, 0.991, -0.065, -0.115 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.454, "beta": 172.025, "gamma": 46.360, "delta": 73.166, "epsilon": -157.353, "zeta": -81.255, "epsilon_zeta": -76.098, "bb_type": "BI", "chi": -154.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.750, 8.887, 0.132 ], "P_xyz": [ 0.639, 9.876, -0.085 ], "form": ".", "ssZp": 4.301, "Dp": 4.629, "splay_angle": 30.245, "splay_distance": 4.794, "splay_ratio": 0.264, "d22": 4.495, "d64": 5.129, "eta": 160.511, "theta": -167.011, "eta_prime": 177.117, "theta_prime": -163.630, "eta_base": -149.260, "theta_base": -145.741, "v0": -0.721, "v1": -25.553, "v2": 40.624, "v3": -42.109, "v4": 26.909, "amplitude": 43.086, "phase_angle": 19.464, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.611, "filter_rmsd": 0.062, "frame": { "rmsd": 0.011, "origin": [ -37.662, -11.241, -14.981 ], "x_axis": [ 0.819, -0.543, -0.187 ], "y_axis": [ -0.570, -0.807, -0.154 ], "z_axis": [ -0.067, 0.233, -0.970 ], "quaternion": [ -0.102, 0.948, -0.294, -0.067 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.904, "beta": 175.111, "gamma": 50.393, "delta": 79.124, "epsilon": -150.100, "zeta": -67.562, "epsilon_zeta": -82.538, "bb_type": "BI", "chi": -166.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 8.738, 0.889 ], "P_xyz": [ 0.950, 9.326, 1.323 ], "form": "A", "ssZp": 4.561, "Dp": 4.624, "splay_angle": 21.653, "splay_distance": 3.666, "splay_ratio": 0.198, "d22": 4.454, "d64": 4.816, "eta": 178.554, "theta": -143.310, "eta_prime": -176.287, "theta_prime": -141.190, "eta_base": -154.039, "theta_base": -117.991, "v0": 0.780, "v1": -23.743, "v2": 36.461, "v3": -36.975, "v4": 22.765, "amplitude": 38.214, "phase_angle": 17.423, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.666, "filter_rmsd": 0.056, "frame": { "rmsd": 0.010, "origin": [ -36.495, -8.962, -19.034 ], "x_axis": [ 0.547, -0.831, 0.101 ], "y_axis": [ -0.837, -0.547, 0.039 ], "z_axis": [ 0.023, -0.106, -0.994 ], "quaternion": [ 0.041, 0.879, -0.474, 0.035 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -59.367, "beta": 176.790, "gamma": 54.701, "delta": 79.238, "epsilon": -126.118, "zeta": -85.179, "epsilon_zeta": -40.939, "bb_type": "--", "chi": -152.158, "glyco_bond": "anti", "C5prime_xyz": [ -1.834, 8.883, -0.001 ], "P_xyz": [ 0.598, 9.830, 0.001 ], "form": ".", "ssZp": 3.914, "Dp": 4.562, "splay_angle": 64.387, "splay_distance": 10.704, "splay_ratio": 0.534, "d22": 9.674, "d64": 11.495, "eta": -179.778, "theta": -142.970, "eta_prime": -168.463, "theta_prime": -143.919, "eta_base": -136.299, "theta_base": -132.560, "v0": -6.144, "v1": -17.757, "v2": 33.504, "v3": -38.147, "v4": 27.828, "amplitude": 37.875, "phase_angle": 27.798, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.952, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ -34.082, -9.285, -21.775 ], "x_axis": [ 0.064, -0.992, 0.110 ], "y_axis": [ -0.978, -0.085, -0.192 ], "z_axis": [ 0.200, -0.095, -0.975 ], "quaternion": [ -0.033, 0.729, -0.676, 0.106 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -56.879, "beta": 130.567, "gamma": 173.093, "delta": 144.226, "epsilon": -88.872, "zeta": -153.024, "epsilon_zeta": 64.152, "bb_type": "BII", "chi": -121.758, "glyco_bond": "anti", "C5prime_xyz": [ -2.142, 8.561, -1.154 ], "P_xyz": [ -1.794, 9.711, -3.474 ], "form": ".", "ssZp": 0.826, "Dp": 0.773, "splay_angle": 127.411, "splay_distance": 17.675, "splay_ratio": 0.897, "d22": 12.280, "d64": 15.666, "eta": -36.827, "theta": 171.402, "eta_prime": -47.622, "theta_prime": 156.142, "eta_base": -58.046, "theta_base": 135.982, "v0": -23.172, "v1": 35.464, "v2": -33.504, "v3": 21.028, "v4": 1.187, "amplitude": 35.797, "phase_angle": 159.382, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ -32.835, -10.820, -32.295 ], "x_axis": [ -0.386, -0.357, -0.851 ], "y_axis": [ -0.836, 0.525, 0.159 ], "z_axis": [ 0.390, 0.772, -0.501 ], "quaternion": [ 0.399, -0.384, 0.777, 0.300 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 40.261, "beta": -172.648, "gamma": 74.516, "delta": 138.291, "epsilon": -77.608, "zeta": -72.477, "epsilon_zeta": -5.131, "bb_type": "--", "chi": -148.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.981, 8.842, 0.123 ], "P_xyz": [ 0.199, 9.501, 1.377 ], "form": ".", "ssZp": 0.453, "Dp": 0.537, "splay_angle": 90.622, "splay_distance": 14.352, "splay_ratio": 0.711, "d22": 7.393, "d64": 8.719, "eta": -11.025, "theta": -44.951, "eta_prime": 20.042, "theta_prime": -60.865, "eta_base": 34.839, "theta_base": -46.240, "v0": -26.241, "v1": 35.694, "v2": -31.221, "v3": 16.878, "v4": 5.690, "amplitude": 35.307, "phase_angle": 152.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.117, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ -33.162, 0.045, -18.358 ], "x_axis": [ -0.927, 0.153, 0.343 ], "y_axis": [ -0.373, -0.269, -0.888 ], "z_axis": [ -0.043, -0.951, 0.306 ], "quaternion": [ 0.166, 0.095, -0.581, 0.791 ] } }, { "index": 16, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -73.146, "beta": -178.211, "gamma": 45.244, "delta": 137.105, "epsilon": -85.506, "zeta": 125.127, "epsilon_zeta": 149.367, "bb_type": "BII", "chi": -141.674, "glyco_bond": "anti", "C5prime_xyz": [ -2.407, 8.768, -0.244 ], "P_xyz": [ -0.636, 10.013, 1.208 ], "form": ".", "ssZp": 0.767, "Dp": 0.795, "splay_angle": 152.724, "splay_distance": 18.401, "splay_ratio": 0.972, "d22": 11.639, "d64": 15.118, "eta": 156.333, "theta": 132.089, "eta_prime": -154.167, "theta_prime": 98.808, "eta_base": -135.082, "theta_base": 138.093, "v0": -27.960, "v1": 36.943, "v2": -31.296, "v3": 16.050, "v4": 7.228, "amplitude": 36.214, "phase_angle": 149.790, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.339, "filter_rmsd": 0.097, "frame": { "rmsd": 0.015, "origin": [ -36.419, -11.603, -26.084 ], "x_axis": [ -0.757, 0.530, 0.383 ], "y_axis": [ 0.574, 0.819, -0.000 ], "z_axis": [ -0.314, 0.219, -0.924 ], "quaternion": [ -0.186, 0.295, 0.935, 0.059 ] } }, { "index": 17, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,hairpin-loop,phosphate,splayed-apart", "alpha": -43.656, "beta": -159.640, "gamma": 124.605, "delta": 143.360, "epsilon": -106.128, "zeta": -24.922, "epsilon_zeta": -81.206, "bb_type": "--", "chi": -115.203, "glyco_bond": "anti", "C5prime_xyz": [ -1.992, 8.488, -1.514 ], "P_xyz": [ 0.497, 8.648, -2.261 ], "form": ".", "ssZp": 0.942, "Dp": 1.152, "splay_angle": 133.001, "splay_distance": 17.190, "splay_ratio": 0.918, "d22": null, "d64": null, "eta": -9.107, "theta": -27.535, "eta_prime": -2.275, "theta_prime": -36.845, "eta_base": -48.842, "theta_base": 6.496, "v0": -23.775, "v1": 35.594, "v2": -33.491, "v3": 20.584, "v4": 1.792, "amplitude": 35.992, "phase_angle": 158.512, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ -18.554, -9.263, -29.825 ], "x_axis": [ -0.066, 0.556, -0.829 ], "y_axis": [ -0.934, 0.259, 0.248 ], "z_axis": [ 0.352, 0.790, 0.502 ], "quaternion": [ 0.651, -0.208, 0.453, 0.572 ] } }, { "index": 18, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -73.436, "beta": -175.904, "gamma": 74.226, "delta": 88.254, "epsilon": -150.410, "zeta": -80.115, "epsilon_zeta": -70.294, "bb_type": "BI", "chi": -178.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.252, 8.232, 1.674 ], "P_xyz": [ 1.383, 8.094, 2.016 ], "form": ".", "ssZp": 4.581, "Dp": 4.586, "splay_angle": 26.568, "splay_distance": 4.207, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 170.476, "theta": -142.374, "eta_prime": -138.061, "theta_prime": -145.527, "eta_base": -129.380, "theta_base": -140.257, "v0": 7.063, "v1": -24.853, "v2": 32.406, "v3": -29.163, "v4": 13.969, "amplitude": 32.611, "phase_angle": 6.417, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ -34.194, -9.449, -22.694 ], "x_axis": [ 0.159, -0.973, -0.169 ], "y_axis": [ 0.964, 0.190, -0.187 ], "z_axis": [ 0.214, -0.133, 0.968 ], "quaternion": [ 0.761, -0.018, 0.126, -0.636 ] } }, { "index": 19, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.193, "beta": 170.119, "gamma": 51.094, "delta": 77.464, "epsilon": -152.344, "zeta": -61.453, "epsilon_zeta": -90.891, "bb_type": "BI", "chi": -165.744, "glyco_bond": "anti", "C5prime_xyz": [ -1.406, 8.771, 0.779 ], "P_xyz": [ 1.187, 9.288, 0.900 ], "form": "A", "ssZp": 4.594, "Dp": 4.672, "splay_angle": 23.600, "splay_distance": 4.002, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 172.572, "theta": -141.697, "eta_prime": -175.882, "theta_prime": -142.095, "eta_base": -152.393, "theta_base": -124.365, "v0": 1.963, "v1": -25.333, "v2": 37.915, "v3": -37.693, "v4": 22.484, "amplitude": 39.391, "phase_angle": 15.736, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.761, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -36.453, -9.442, -19.144 ], "x_axis": [ 0.551, -0.834, 0.032 ], "y_axis": [ 0.834, 0.549, -0.058 ], "z_axis": [ 0.031, 0.059, 0.998 ], "quaternion": [ 0.880, -0.033, -0.000, -0.474 ] } }, { "index": 20, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -78.662, "beta": 168.516, "gamma": 76.766, "delta": 73.907, "epsilon": -155.615, "zeta": -82.164, "epsilon_zeta": -73.451, "bb_type": "BI", "chi": -173.844, "glyco_bond": "anti", "C5prime_xyz": [ -2.040, 8.706, 1.235 ], "P_xyz": [ 0.300, 9.861, 1.020 ], "form": "A", "ssZp": 4.667, "Dp": 4.627, "splay_angle": 28.028, "splay_distance": 4.254, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 168.002, "theta": -166.713, "eta_prime": -174.072, "theta_prime": -166.118, "eta_base": -136.696, "theta_base": -141.143, "v0": -1.384, "v1": -23.292, "v2": 37.832, "v3": -39.677, "v4": 25.826, "amplitude": 40.397, "phase_angle": 20.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.210, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -37.542, -11.526, -15.906 ], "x_axis": [ 0.851, -0.525, -0.021 ], "y_axis": [ 0.525, 0.851, -0.015 ], "z_axis": [ 0.026, 0.001, 1.000 ], "quaternion": [ 0.962, -0.004, 0.012, -0.273 ] } }, { "index": 21, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.707, "beta": 176.990, "gamma": 50.378, "delta": 81.772, "epsilon": -146.781, "zeta": -85.146, "epsilon_zeta": -61.635, "bb_type": "BI", "chi": -171.684, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.531, 1.226 ], "P_xyz": [ 1.343, 8.740, 1.775 ], "form": "A", "ssZp": 4.666, "Dp": 4.690, "splay_angle": 21.046, "splay_distance": 3.228, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 178.747, "theta": -155.438, "eta_prime": -176.138, "theta_prime": -152.751, "eta_base": -144.033, "theta_base": -137.576, "v0": 6.178, "v1": -28.412, "v2": 38.505, "v3": -36.102, "v4": 18.762, "amplitude": 39.065, "phase_angle": 9.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.739, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -38.476, -13.478, -12.243 ], "x_axis": [ 0.996, -0.006, -0.087 ], "y_axis": [ -0.001, 0.997, -0.076 ], "z_axis": [ 0.087, 0.076, 0.993 ], "quaternion": [ 0.998, -0.038, 0.044, -0.001 ] } }, { "index": 22, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.524, "beta": 171.723, "gamma": 42.571, "delta": 79.663, "epsilon": -136.692, "zeta": -85.505, "epsilon_zeta": -51.187, "bb_type": "BI", "chi": -156.799, "glyco_bond": "anti", "C5prime_xyz": [ -0.977, 8.664, 0.363 ], "P_xyz": [ 1.629, 8.815, 0.541 ], "form": "A", "ssZp": 4.317, "Dp": 4.753, "splay_angle": 21.924, "splay_distance": 3.375, "splay_ratio": 0.190, "d22": 3.943, "d64": 3.879, "eta": 171.717, "theta": -148.238, "eta_prime": 178.600, "theta_prime": -145.122, "eta_base": -157.484, "theta_base": -117.103, "v0": 8.197, "v1": -30.005, "v2": 39.498, "v3": -35.718, "v4": 17.342, "amplitude": 39.792, "phase_angle": 6.968, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.645, "filter_rmsd": 0.072, "frame": { "rmsd": 0.011, "origin": [ -38.594, -15.133, -9.475 ], "x_axis": [ 0.882, 0.462, -0.087 ], "y_axis": [ -0.449, 0.883, 0.141 ], "z_axis": [ 0.142, -0.085, 0.986 ], "quaternion": [ 0.968, 0.058, 0.059, 0.235 ] } }, { "index": 23, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -54.796, "beta": 153.499, "gamma": 56.739, "delta": 79.047, "epsilon": -153.987, "zeta": -63.086, "epsilon_zeta": -90.901, "bb_type": "BI", "chi": -166.011, "glyco_bond": "anti", "C5prime_xyz": [ -1.137, 8.643, 0.880 ], "P_xyz": [ 1.461, 8.761, 0.449 ], "form": "A", "ssZp": 4.622, "Dp": 4.699, "splay_angle": 26.284, "splay_distance": 4.009, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 161.775, "theta": -137.323, "eta_prime": 178.142, "theta_prime": -138.989, "eta_base": -136.467, "theta_base": -110.729, "v0": 7.713, "v1": -30.732, "v2": 40.841, "v3": -37.329, "v4": 18.692, "amplitude": 41.238, "phase_angle": 7.961, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.670, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ -36.808, -15.555, -6.643 ], "x_axis": [ 0.492, 0.855, -0.163 ], "y_axis": [ -0.808, 0.518, 0.281 ], "z_axis": [ 0.324, -0.006, 0.946 ], "quaternion": [ 0.860, 0.083, 0.142, 0.484 ] } }, { "index": 24, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -70.488, "beta": 176.555, "gamma": 63.707, "delta": 80.461, "epsilon": -144.587, "zeta": -61.932, "epsilon_zeta": -82.655, "bb_type": "BI", "chi": -162.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.213, 8.624, 0.683 ], "P_xyz": [ 1.414, 8.892, 0.538 ], "form": ".", "ssZp": 4.539, "Dp": 4.726, "splay_angle": 26.507, "splay_distance": 4.139, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 172.958, "theta": -130.867, "eta_prime": -169.880, "theta_prime": -129.447, "eta_base": -120.715, "theta_base": -88.065, "v0": 6.753, "v1": -28.356, "v2": 38.150, "v3": -35.236, "v4": 17.947, "amplitude": 38.599, "phase_angle": 8.751, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.777, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ -33.857, -14.593, -4.105 ], "x_axis": [ -0.094, 0.989, 0.111 ], "y_axis": [ -0.912, -0.130, 0.388 ], "z_axis": [ 0.398, -0.065, 0.915 ], "quaternion": [ 0.650, 0.174, 0.110, 0.731 ] } }, { "index": 25, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -69.207, "beta": 174.151, "gamma": 61.633, "delta": 79.956, "epsilon": -128.976, "zeta": -17.719, "epsilon_zeta": -111.257, "bb_type": "--", "chi": -159.067, "glyco_bond": "anti", "C5prime_xyz": [ -1.230, 8.793, 0.469 ], "P_xyz": [ 1.386, 9.122, 0.380 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 171.196, "theta": -50.619, "eta_prime": -169.812, "theta_prime": -69.294, "eta_base": -110.013, "theta_base": null, "v0": 3.435, "v1": -25.574, "v2": 36.828, "v3": -35.799, "v4": 20.376, "amplitude": 37.871, "phase_angle": 13.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -32.801, -11.703, -1.336 ], "x_axis": [ -0.767, 0.581, 0.273 ], "y_axis": [ -0.488, -0.804, 0.339 ], "z_axis": [ 0.416, 0.126, 0.900 ], "quaternion": [ 0.287, 0.185, 0.125, 0.932 ] } }, { "index": 26, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///D/26", "linked_nts": [ "///D/25", null ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,ss-non-loop", "alpha": 130.728, "beta": -166.539, "gamma": -50.928, "delta": 80.651, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.351, "v1": -25.118, "v2": 36.132, "v3": -35.205, "v4": 20.086, "amplitude": 37.168, "phase_angle": 13.561, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 27, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 60.605, "delta": 78.346, "epsilon": -156.631, "zeta": -49.045, "epsilon_zeta": -107.586, "bb_type": "BI", "chi": 12.891, "glyco_bond": "syn", "C5prime_xyz": [ -5.481, 3.443, -0.891 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -4.483, "Dp": 4.522, "splay_angle": 37.690, "splay_distance": 5.792, "splay_ratio": 0.327, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.842, "v1": -21.505, "v2": 35.637, "v3": -37.546, "v4": 24.903, "amplitude": 38.253, "phase_angle": 21.311, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ -9.192, 5.903, -18.248 ], "x_axis": [ -0.577, -0.204, -0.791 ], "y_axis": [ -0.788, 0.394, 0.473 ], "z_axis": [ 0.216, 0.896, -0.388 ], "quaternion": [ 0.328, -0.323, 0.768, 0.446 ] } }, { "index": 28, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -84.732, "beta": 176.559, "gamma": 71.897, "delta": 79.287, "epsilon": -143.043, "zeta": -72.329, "epsilon_zeta": -70.714, "bb_type": "BI", "chi": -171.798, "glyco_bond": "anti", "C5prime_xyz": [ -1.569, 8.671, 1.226 ], "P_xyz": [ 0.985, 9.160, 1.551 ], "form": "A", "ssZp": 4.479, "Dp": 4.578, "splay_angle": 24.688, "splay_distance": 3.935, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 166.611, "theta": -142.234, "eta_prime": -168.875, "theta_prime": -142.091, "eta_base": -172.701, "theta_base": -111.899, "v0": -0.307, "v1": -22.682, "v2": 36.044, "v3": -37.102, "v4": 23.503, "amplitude": 38.125, "phase_angle": 19.015, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.272, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -13.666, 2.423, -19.434 ], "x_axis": [ 0.986, -0.167, 0.007 ], "y_axis": [ 0.069, 0.446, 0.892 ], "z_axis": [ -0.152, -0.879, 0.451 ], "quaternion": [ 0.849, 0.522, -0.047, -0.070 ] } }, { "index": 29, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -57.731, "beta": 175.107, "gamma": 50.050, "delta": 76.376, "epsilon": -152.455, "zeta": -63.536, "epsilon_zeta": -88.918, "bb_type": "BI", "chi": -164.984, "glyco_bond": "anti", "C5prime_xyz": [ -1.335, 8.745, 0.768 ], "P_xyz": [ 1.171, 9.264, 1.196 ], "form": "A", "ssZp": 4.512, "Dp": 4.660, "splay_angle": 21.958, "splay_distance": 3.611, "splay_ratio": 0.197, "d22": 4.239, "d64": 4.605, "eta": 167.886, "theta": -145.656, "eta_prime": -178.058, "theta_prime": -144.573, "eta_base": -130.965, "theta_base": -119.232, "v0": 1.095, "v1": -25.825, "v2": 39.394, "v3": -39.807, "v4": 24.461, "amplitude": 41.220, "phase_angle": 17.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.892, "filter_rmsd": 0.065, "frame": { "rmsd": 0.010, "origin": [ -13.115, -1.468, -19.224 ], "x_axis": [ 0.831, 0.144, 0.537 ], "y_axis": [ -0.535, 0.469, 0.702 ], "z_axis": [ -0.151, -0.871, 0.467 ], "quaternion": [ 0.832, 0.473, -0.207, 0.204 ] } }, { "index": 30, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -69.588, "beta": 171.311, "gamma": 66.673, "delta": 78.505, "epsilon": -146.194, "zeta": -74.682, "epsilon_zeta": -71.511, "bb_type": "BI", "chi": -165.287, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.834, 0.719 ], "P_xyz": [ 1.108, 9.544, 0.725 ], "form": "A", "ssZp": 4.420, "Dp": 4.563, "splay_angle": 23.997, "splay_distance": 3.762, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 173.230, "theta": -150.354, "eta_prime": -171.891, "theta_prime": -149.331, "eta_base": -132.205, "theta_base": -119.276, "v0": -3.692, "v1": -19.309, "v2": 33.587, "v3": -36.652, "v4": 25.433, "amplitude": 36.825, "phase_angle": 24.205, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.656, "filter_rmsd": 0.056, "frame": { "rmsd": 0.018, "origin": [ -11.680, -4.703, -18.507 ], "x_axis": [ 0.435, 0.385, 0.814 ], "y_axis": [ -0.898, 0.246, 0.365 ], "z_axis": [ -0.060, -0.890, 0.453 ], "quaternion": [ 0.730, 0.429, -0.299, 0.439 ] } }, { "index": 31, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -67.731, "beta": 171.918, "gamma": 53.808, "delta": 81.220, "epsilon": -114.938, "zeta": -79.018, "epsilon_zeta": -35.921, "bb_type": "--", "chi": -162.353, "glyco_bond": "anti", "C5prime_xyz": [ -1.378, 8.555, 0.609 ], "P_xyz": [ 1.178, 9.014, 0.498 ], "form": ".", "ssZp": 4.324, "Dp": 4.806, "splay_angle": 33.247, "splay_distance": 5.084, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 170.350, "theta": -122.791, "eta_prime": -178.904, "theta_prime": -117.617, "eta_base": -138.194, "theta_base": -68.066, "v0": 5.532, "v1": -28.026, "v2": 38.374, "v3": -36.332, "v4": 19.340, "amplitude": 39.041, "phase_angle": 10.605, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.966, "filter_rmsd": 0.038, "frame": { "rmsd": 0.019, "origin": [ -10.642, -7.731, -16.531 ], "x_axis": [ -0.130, 0.480, 0.868 ], "y_axis": [ -0.991, -0.049, -0.121 ], "z_axis": [ -0.016, -0.876, 0.482 ], "quaternion": [ 0.571, 0.330, -0.387, 0.644 ] } }, { "index": 32, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -54.555, "beta": 165.386, "gamma": 44.979, "delta": 83.337, "epsilon": -139.278, "zeta": -69.348, "epsilon_zeta": -69.930, "bb_type": "BI", "chi": -159.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.185, 8.585, 0.458 ], "P_xyz": [ 1.435, 8.764, 0.400 ], "form": ".", "ssZp": 4.417, "Dp": 4.729, "splay_angle": 28.535, "splay_distance": 4.298, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 158.159, "theta": -132.550, "eta_prime": -179.416, "theta_prime": -129.020, "eta_base": -112.100, "theta_base": -80.545, "v0": 8.306, "v1": -28.819, "v2": 37.376, "v3": -33.583, "v4": 15.978, "amplitude": 37.593, "phase_angle": 6.170, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.379, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ -12.772, -7.794, -11.915 ], "x_axis": [ -0.854, 0.517, 0.053 ], "y_axis": [ -0.427, -0.638, -0.641 ], "z_axis": [ -0.297, -0.570, 0.766 ], "quaternion": [ 0.261, -0.068, -0.335, 0.903 ] } }, { "index": 33, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -65.329, "beta": 164.311, "gamma": 59.688, "delta": 83.912, "epsilon": -113.588, "zeta": -114.492, "epsilon_zeta": 0.903, "bb_type": "--", "chi": -160.670, "glyco_bond": "anti", "C5prime_xyz": [ -0.941, 8.486, 0.634 ], "P_xyz": [ 1.629, 8.417, 0.340 ], "form": ".", "ssZp": 4.309, "Dp": 4.819, "splay_angle": 138.347, "splay_distance": 16.638, "splay_ratio": 0.935, "d22": null, "d64": null, "eta": 173.635, "theta": -138.446, "eta_prime": -167.871, "theta_prime": -167.831, "eta_base": -103.804, "theta_base": 169.082, "v0": 8.469, "v1": -29.266, "v2": 37.764, "v3": -34.029, "v4": 16.224, "amplitude": 37.982, "phase_angle": 6.147, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.036, "frame": { "rmsd": 0.013, "origin": [ -16.646, -8.286, -10.119 ], "x_axis": [ -0.814, -0.111, -0.570 ], "y_axis": [ 0.333, -0.893, -0.303 ], "z_axis": [ -0.475, -0.437, 0.764 ], "quaternion": [ -0.119, -0.280, -0.199, 0.932 ] } }, { "index": 34, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": 57.098, "beta": -151.684, "gamma": 63.588, "delta": 87.371, "epsilon": -148.181, "zeta": -73.806, "epsilon_zeta": -74.375, "bb_type": "BI", "chi": -171.502, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.444, 1.255 ], "P_xyz": [ 1.189, 8.281, 2.337 ], "form": "A", "ssZp": 4.488, "Dp": 4.553, "splay_angle": 22.752, "splay_distance": 3.590, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -38.309, "theta": -141.756, "eta_prime": -27.279, "theta_prime": -139.737, "eta_base": -35.186, "theta_base": -128.789, "v0": 6.494, "v1": -25.060, "v2": 33.121, "v3": -30.388, "v4": 15.099, "amplitude": 33.428, "phase_angle": 7.783, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.343, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -11.295, -21.244, -1.159 ], "x_axis": [ -0.174, -0.782, -0.598 ], "y_axis": [ -0.575, 0.574, -0.583 ], "z_axis": [ 0.799, 0.243, -0.550 ], "quaternion": [ 0.461, -0.448, 0.758, -0.112 ] } }, { "index": 35, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.551, "beta": -166.284, "gamma": 38.879, "delta": 84.077, "epsilon": -158.753, "zeta": -77.932, "epsilon_zeta": -80.821, "bb_type": "BI", "chi": -155.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.184, 8.627, 0.253 ], "P_xyz": [ 1.230, 9.129, 1.078 ], "form": "A", "ssZp": 4.260, "Dp": 4.546, "splay_angle": 20.509, "splay_distance": 3.543, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.443, "theta": -127.818, "eta_prime": 170.831, "theta_prime": -131.338, "eta_base": -165.866, "theta_base": -101.255, "v0": 5.579, "v1": -26.581, "v2": 36.119, "v3": -34.104, "v4": 17.868, "amplitude": 36.688, "phase_angle": 10.106, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.539, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -7.710, -21.346, -1.312 ], "x_axis": [ -0.598, -0.438, -0.671 ], "y_axis": [ -0.352, 0.896, -0.272 ], "z_axis": [ 0.720, 0.074, -0.690 ], "quaternion": [ 0.390, -0.222, 0.892, -0.055 ] } }, { "index": 36, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 154.349, "beta": -153.028, "gamma": 177.670, "delta": 79.430, "epsilon": -130.110, "zeta": -69.765, "epsilon_zeta": -60.345, "bb_type": "BI", "chi": -164.766, "glyco_bond": "anti", "C5prime_xyz": [ -1.059, 8.613, 0.854 ], "P_xyz": [ 0.356, 9.954, -0.818 ], "form": "A", "ssZp": 4.453, "Dp": 4.727, "splay_angle": 25.731, "splay_distance": 4.265, "splay_ratio": 0.228, "d22": 4.158, "d64": 4.630, "eta": 166.949, "theta": -155.533, "eta_prime": -175.028, "theta_prime": -155.741, "eta_base": -126.920, "theta_base": -130.752, "v0": 4.510, "v1": -27.357, "v2": 38.786, "v3": -37.345, "v4": 20.711, "amplitude": 39.708, "phase_angle": 12.374, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.845, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -6.570, -23.305, -4.034 ], "x_axis": [ -0.618, 0.066, -0.784 ], "y_axis": [ 0.183, 0.981, -0.061 ], "z_axis": [ 0.765, -0.182, -0.618 ], "quaternion": [ 0.432, 0.070, 0.897, -0.068 ] } }, { "index": 37, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.236, "beta": 172.225, "gamma": 43.054, "delta": 71.893, "epsilon": -155.370, "zeta": -81.928, "epsilon_zeta": -73.442, "bb_type": "BI", "chi": -164.940, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.796, 0.736 ], "P_xyz": [ 0.988, 9.742, 0.777 ], "form": ".", "ssZp": 4.580, "Dp": 4.671, "splay_angle": 30.232, "splay_distance": 4.648, "splay_ratio": 0.267, "d22": 4.668, "d64": 5.245, "eta": 156.332, "theta": -169.291, "eta_prime": 172.560, "theta_prime": -164.027, "eta_base": -143.352, "theta_base": -144.096, "v0": 3.041, "v1": -29.357, "v2": 43.096, "v3": -42.415, "v4": 24.750, "amplitude": 44.552, "phase_angle": 14.688, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.568, "filter_rmsd": 0.064, "frame": { "rmsd": 0.012, "origin": [ -5.261, -25.303, -7.567 ], "x_axis": [ -0.565, 0.600, -0.566 ], "y_axis": [ 0.506, 0.794, 0.337 ], "z_axis": [ 0.652, -0.096, -0.752 ], "quaternion": [ 0.345, 0.313, 0.882, 0.068 ] } }, { "index": 38, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -49.445, "beta": 178.024, "gamma": 46.312, "delta": 79.454, "epsilon": -150.752, "zeta": -74.229, "epsilon_zeta": -76.524, "bb_type": "BI", "chi": -171.393, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.607, 1.183 ], "P_xyz": [ 1.255, 8.966, 1.734 ], "form": "A", "ssZp": 4.713, "Dp": 4.694, "splay_angle": 18.897, "splay_distance": 3.150, "splay_ratio": 0.176, "d22": 4.642, "d64": 4.842, "eta": 178.674, "theta": -147.855, "eta_prime": -176.910, "theta_prime": -144.808, "eta_base": -154.223, "theta_base": -124.591, "v0": 4.709, "v1": -27.248, "v2": 38.354, "v3": -36.493, "v4": 20.060, "amplitude": 39.177, "phase_angle": 11.770, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.583, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ -4.057, -27.367, -11.554 ], "x_axis": [ -0.488, 0.860, -0.150 ], "y_axis": [ 0.645, 0.471, 0.602 ], "z_axis": [ 0.588, 0.197, -0.784 ], "quaternion": [ 0.223, 0.454, 0.828, 0.241 ] } }, { "index": 39, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -50.004, "beta": 170.524, "gamma": 49.487, "delta": 78.426, "epsilon": -128.799, "zeta": -80.347, "epsilon_zeta": -48.452, "bb_type": "BI", "chi": -151.406, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.828, -0.033 ], "P_xyz": [ 1.078, 9.456, -0.197 ], "form": ".", "ssZp": 3.969, "Dp": 4.701, "splay_angle": 65.482, "splay_distance": 10.770, "splay_ratio": 0.543, "d22": 9.624, "d64": 11.520, "eta": 179.330, "theta": -140.711, "eta_prime": -170.264, "theta_prime": -143.790, "eta_base": -141.358, "theta_base": -135.547, "v0": -1.621, "v1": -21.214, "v2": 34.812, "v3": -36.733, "v4": 24.138, "amplitude": 37.306, "phase_angle": 21.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.779, "filter_rmsd": 0.101, "frame": { "rmsd": 0.009, "origin": [ -4.529, -27.282, -14.667 ], "x_axis": [ -0.066, 0.997, 0.041 ], "y_axis": [ 0.931, 0.047, 0.362 ], "z_axis": [ 0.359, 0.062, -0.931 ], "quaternion": [ 0.111, 0.674, 0.715, 0.148 ] } }, { "index": 40, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -62.250, "beta": 138.522, "gamma": 178.485, "delta": 144.479, "epsilon": -94.769, "zeta": -152.364, "epsilon_zeta": 57.596, "bb_type": "BII", "chi": -120.884, "glyco_bond": "anti", "C5prime_xyz": [ -2.132, 8.535, -1.199 ], "P_xyz": [ -1.756, 9.756, -3.463 ], "form": ".", "ssZp": 0.901, "Dp": 0.866, "splay_angle": 121.214, "splay_distance": 17.464, "splay_ratio": 0.871, "d22": 12.552, "d64": 16.048, "eta": -35.245, "theta": 172.171, "eta_prime": -45.425, "theta_prime": 155.047, "eta_base": -60.476, "theta_base": 139.918, "v0": -23.692, "v1": 35.815, "v2": -33.746, "v3": 21.014, "v4": 1.489, "amplitude": 36.160, "phase_angle": 158.945, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ -0.137, -25.888, -24.402 ], "x_axis": [ 0.779, 0.380, -0.499 ], "y_axis": [ 0.627, -0.491, 0.605 ], "z_axis": [ -0.016, -0.784, -0.621 ], "quaternion": [ 0.408, 0.850, 0.296, -0.151 ] } }, { "index": 41, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 49.361, "beta": -171.827, "gamma": 69.787, "delta": 142.577, "epsilon": -84.438, "zeta": -73.708, "epsilon_zeta": -10.731, "bb_type": "--", "chi": -142.206, "glyco_bond": "anti", "C5prime_xyz": [ -2.633, 8.700, -0.178 ], "P_xyz": [ -0.650, 9.839, 1.040 ], "form": ".", "ssZp": 0.465, "Dp": 0.660, "splay_angle": 90.866, "splay_distance": 14.207, "splay_ratio": 0.713, "d22": 7.546, "d64": 9.020, "eta": -11.843, "theta": -48.290, "eta_prime": 20.195, "theta_prime": -62.944, "eta_base": 30.671, "theta_base": -49.211, "v0": -28.151, "v1": 39.277, "v2": -34.692, "v3": 19.483, "v4": 5.142, "amplitude": 38.744, "phase_angle": 153.564, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.394, "filter_rmsd": 0.094, "frame": { "rmsd": 0.013, "origin": [ -7.951, -36.957, -13.385 ], "x_axis": [ 0.409, -0.177, 0.895 ], "y_axis": [ 0.887, 0.306, -0.345 ], "z_axis": [ -0.213, 0.935, 0.282 ], "quaternion": [ 0.707, -0.453, -0.392, -0.376 ] } }, { "index": 42, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -61.035, "beta": 179.386, "gamma": 35.020, "delta": 138.113, "epsilon": -93.969, "zeta": 122.620, "epsilon_zeta": 143.410, "bb_type": "--", "chi": -128.311, "glyco_bond": "anti", "C5prime_xyz": [ -2.622, 8.610, -0.861 ], "P_xyz": [ -0.865, 10.201, 0.247 ], "form": ".", "ssZp": 1.058, "Dp": 0.968, "splay_angle": 148.975, "splay_distance": 18.240, "splay_ratio": 0.964, "d22": 11.672, "d64": 15.174, "eta": 157.955, "theta": 138.664, "eta_prime": -152.058, "theta_prime": 102.193, "eta_base": -128.192, "theta_base": 134.454, "v0": -28.151, "v1": 38.363, "v2": -33.425, "v3": 18.070, "v4": 5.993, "amplitude": 37.816, "phase_angle": 152.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.226, "filter_rmsd": 0.106, "frame": { "rmsd": 0.014, "origin": [ -1.071, -24.934, -16.537 ], "x_axis": [ 0.611, -0.513, 0.603 ], "y_axis": [ -0.295, -0.854, -0.428 ], "z_axis": [ 0.734, 0.084, -0.674 ], "quaternion": [ -0.144, 0.886, -0.228, 0.377 ] } }, { "index": 43, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,hairpin-loop,phosphate,splayed-apart", "alpha": -1.014, "beta": -172.379, "gamma": 96.523, "delta": 148.215, "epsilon": -121.869, "zeta": -17.128, "epsilon_zeta": -104.741, "bb_type": "--", "chi": -107.942, "glyco_bond": "anti", "C5prime_xyz": [ -2.196, 8.284, -1.812 ], "P_xyz": [ 0.339, 8.657, -2.336 ], "form": ".", "ssZp": 1.285, "Dp": 1.391, "splay_angle": 130.775, "splay_distance": 17.091, "splay_ratio": 0.910, "d22": null, "d64": null, "eta": -17.797, "theta": -15.775, "eta_prime": -2.834, "theta_prime": -33.467, "eta_base": -41.385, "theta_base": 5.644, "v0": -22.975, "v1": 37.048, "v2": -36.369, "v3": 23.995, "v4": -0.810, "amplitude": 38.126, "phase_angle": 162.534, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -13.860, -27.553, -29.276 ], "x_axis": [ 0.458, -0.566, -0.685 ], "y_axis": [ 0.693, -0.255, 0.674 ], "z_axis": [ -0.556, -0.784, 0.276 ], "quaternion": [ 0.608, 0.599, 0.053, -0.518 ] } }, { "index": 44, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -82.050, "beta": -171.995, "gamma": 70.148, "delta": 85.206, "epsilon": -159.303, "zeta": -77.594, "epsilon_zeta": -81.709, "bb_type": "BI", "chi": -167.901, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.499, 1.022 ], "P_xyz": [ 1.302, 8.561, 1.214 ], "form": "A", "ssZp": 4.519, "Dp": 4.545, "splay_angle": 24.791, "splay_distance": 3.794, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 165.711, "theta": -149.433, "eta_prime": -141.380, "theta_prime": -150.581, "eta_base": -129.931, "theta_base": -135.059, "v0": 5.120, "v1": -26.143, "v2": 36.163, "v3": -34.246, "v4": 18.321, "amplitude": 36.819, "phase_angle": 10.837, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.046, "frame": { "rmsd": 0.015, "origin": [ -3.795, -27.368, -15.464 ], "x_axis": [ -0.128, 0.988, -0.083 ], "y_axis": [ -0.804, -0.152, -0.574 ], "z_axis": [ -0.580, -0.007, 0.814 ], "quaternion": [ 0.619, -0.229, -0.201, 0.724 ] } }, { "index": 45, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.362, "beta": -179.183, "gamma": 46.383, "delta": 81.559, "epsilon": -150.478, "zeta": -67.894, "epsilon_zeta": -82.584, "bb_type": "BI", "chi": -165.150, "glyco_bond": "anti", "C5prime_xyz": [ -1.206, 8.679, 0.860 ], "P_xyz": [ 1.334, 8.796, 1.477 ], "form": ".", "ssZp": 4.521, "Dp": 4.614, "splay_angle": 25.261, "splay_distance": 4.238, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 170.846, "theta": -142.747, "eta_prime": 178.420, "theta_prime": -142.145, "eta_base": -152.245, "theta_base": -134.520, "v0": 4.346, "v1": -27.031, "v2": 38.435, "v3": -36.848, "v4": 20.325, "amplitude": 39.338, "phase_angle": 12.302, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.822, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -4.070, -27.298, -11.680 ], "x_axis": [ -0.448, 0.787, -0.424 ], "y_axis": [ -0.636, -0.614, -0.468 ], "z_axis": [ -0.629, 0.060, 0.775 ], "quaternion": [ 0.422, -0.313, -0.121, 0.842 ] } }, { "index": 46, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.053, "beta": 164.535, "gamma": 80.839, "delta": 73.442, "epsilon": -147.537, "zeta": -87.566, "epsilon_zeta": -59.971, "bb_type": "BI", "chi": -172.326, "glyco_bond": "anti", "C5prime_xyz": [ -1.980, 8.714, 1.153 ], "P_xyz": [ 0.287, 9.873, 0.620 ], "form": ".", "ssZp": 4.687, "Dp": 4.685, "splay_angle": 29.683, "splay_distance": 4.661, "splay_ratio": 0.262, "d22": null, "d64": null, "eta": 173.928, "theta": -163.025, "eta_prime": -171.090, "theta_prime": -161.683, "eta_base": -146.940, "theta_base": -141.029, "v0": -2.033, "v1": -23.541, "v2": 38.981, "v3": -41.198, "v4": 27.262, "amplitude": 41.860, "phase_angle": 21.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.100, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -4.523, -25.444, -7.897 ], "x_axis": [ -0.692, 0.580, -0.430 ], "y_axis": [ -0.509, -0.814, -0.279 ], "z_axis": [ -0.512, 0.025, 0.859 ], "quaternion": [ 0.297, -0.257, -0.069, 0.917 ] } }, { "index": 47, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.108, "beta": 169.428, "gamma": 43.618, "delta": 79.225, "epsilon": -152.618, "zeta": -75.543, "epsilon_zeta": -77.075, "bb_type": "BI", "chi": -169.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.761, 8.652, 1.074 ], "P_xyz": [ 0.698, 9.211, 1.724 ], "form": "A", "ssZp": 4.571, "Dp": 4.616, "splay_angle": 22.063, "splay_distance": 3.406, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 179.067, "theta": -152.843, "eta_prime": -173.306, "theta_prime": -149.592, "eta_base": -144.109, "theta_base": -119.682, "v0": 1.439, "v1": -24.712, "v2": 37.263, "v3": -37.500, "v4": 22.704, "amplitude": 38.871, "phase_angle": 16.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.372, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -5.768, -23.107, -4.062 ], "x_axis": [ -0.763, 0.148, -0.629 ], "y_axis": [ -0.082, -0.988, -0.133 ], "z_axis": [ -0.641, -0.050, 0.766 ], "quaternion": [ 0.061, -0.338, -0.049, 0.938 ] } }, { "index": 48, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.248, "beta": -174.525, "gamma": 50.183, "delta": 82.081, "epsilon": -148.832, "zeta": -68.694, "epsilon_zeta": -80.138, "bb_type": "BI", "chi": -157.001, "glyco_bond": "anti", "C5prime_xyz": [ -1.079, 8.693, 0.368 ], "P_xyz": [ 1.492, 8.902, 0.764 ], "form": "A", "ssZp": 4.371, "Dp": 4.671, "splay_angle": 20.730, "splay_distance": 3.312, "splay_ratio": 0.181, "d22": 3.957, "d64": 4.054, "eta": 170.253, "theta": -141.592, "eta_prime": 177.807, "theta_prime": -140.374, "eta_base": -143.215, "theta_base": -113.443, "v0": 5.702, "v1": -27.712, "v2": 37.943, "v3": -35.681, "v4": 18.908, "amplitude": 38.562, "phase_angle": 10.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.062, "frame": { "rmsd": 0.010, "origin": [ -8.126, -21.661, -2.073 ], "x_axis": [ -0.585, -0.484, -0.651 ], "y_axis": [ 0.324, -0.875, 0.360 ], "z_axis": [ -0.744, -0.000, 0.668 ], "quaternion": [ -0.228, -0.394, 0.102, 0.884 ] } }, { "index": 49, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -65.032, "beta": 168.556, "gamma": 54.671, "delta": 77.806, "epsilon": -147.273, "zeta": -75.819, "epsilon_zeta": -71.454, "bb_type": "BI", "chi": -160.616, "glyco_bond": "anti", "C5prime_xyz": [ -1.392, 8.764, 0.540 ], "P_xyz": [ 1.164, 9.258, 0.371 ], "form": "A", "ssZp": 4.465, "Dp": 4.680, "splay_angle": 25.084, "splay_distance": 3.934, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 162.869, "theta": -146.985, "eta_prime": 178.865, "theta_prime": -145.904, "eta_base": -136.513, "theta_base": -117.839, "v0": 2.301, "v1": -26.421, "v2": 39.244, "v3": -38.969, "v4": 23.007, "amplitude": 40.704, "phase_angle": 15.394, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.960, "filter_rmsd": 0.057, "frame": { "rmsd": 0.008, "origin": [ -11.330, -21.317, -1.309 ], "x_axis": [ -0.264, -0.865, -0.427 ], "y_axis": [ 0.474, -0.502, 0.724 ], "z_axis": [ -0.840, -0.011, 0.542 ], "quaternion": [ -0.441, -0.417, 0.234, 0.760 ] } }, { "index": 50, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -49.175, "beta": 164.161, "gamma": 50.942, "delta": 78.645, "epsilon": -150.493, "zeta": -66.135, "epsilon_zeta": -84.358, "bb_type": "BI", "chi": -170.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.611, 1.112 ], "P_xyz": [ 1.045, 9.095, 1.343 ], "form": "A", "ssZp": 4.672, "Dp": 4.674, "splay_angle": 24.583, "splay_distance": 3.858, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 172.182, "theta": -142.303, "eta_prime": -173.227, "theta_prime": -140.691, "eta_base": -128.687, "theta_base": -107.533, "v0": 1.370, "v1": -24.177, "v2": 36.536, "v3": -36.809, "v4": 22.363, "amplitude": 38.134, "phase_angle": 16.648, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.744, "filter_rmsd": 0.045, "frame": { "rmsd": 0.013, "origin": [ -15.163, -22.170, -1.068 ], "x_axis": [ 0.166, -0.985, -0.048 ], "y_axis": [ 0.547, 0.052, 0.836 ], "z_axis": [ -0.821, -0.165, 0.547 ], "quaternion": [ 0.664, 0.377, -0.291, -0.576 ] } }, { "index": 51, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -78.834, "beta": 175.725, "gamma": 69.749, "delta": 82.678, "epsilon": -148.401, "zeta": -49.357, "epsilon_zeta": -99.045, "bb_type": "BI", "chi": -165.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.322, 8.728, 0.785 ], "P_xyz": [ 1.244, 9.152, 0.782 ], "form": ".", "ssZp": 4.427, "Dp": 4.544, "splay_angle": 35.232, "splay_distance": 5.563, "splay_ratio": 0.304, "d22": 4.030, "d64": 4.409, "eta": 170.935, "theta": -121.547, "eta_prime": -172.863, "theta_prime": -121.586, "eta_base": -123.867, "theta_base": -81.953, "v0": -0.857, "v1": -21.708, "v2": 34.697, "v3": -36.207, "v4": 23.340, "amplitude": 36.905, "phase_angle": 19.919, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.506, "filter_rmsd": 0.058, "frame": { "rmsd": 0.010, "origin": [ -18.183, -24.504, -0.505 ], "x_axis": [ 0.515, -0.716, 0.470 ], "y_axis": [ 0.245, 0.649, 0.720 ], "z_axis": [ -0.821, -0.256, 0.510 ], "quaternion": [ 0.818, 0.298, -0.395, -0.294 ] } }, { "index": 52, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -86.850, "beta": -172.992, "gamma": 66.155, "delta": 80.470, "epsilon": -129.812, "zeta": -103.982, "epsilon_zeta": -25.830, "bb_type": "--", "chi": -162.032, "glyco_bond": "anti", "C5prime_xyz": [ -1.244, 8.776, 0.618 ], "P_xyz": [ 1.319, 9.287, 0.783 ], "form": ".", "ssZp": 4.431, "Dp": 4.737, "splay_angle": 20.672, "splay_distance": 3.246, "splay_ratio": 0.180, "d22": 3.878, "d64": 3.318, "eta": 168.634, "theta": -143.567, "eta_prime": -169.102, "theta_prime": -136.529, "eta_base": -109.641, "theta_base": -85.910, "v0": 2.150, "v1": -24.370, "v2": 35.941, "v3": -35.703, "v4": 21.191, "amplitude": 37.271, "phase_angle": 15.355, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.370, "filter_rmsd": 0.066, "frame": { "rmsd": 0.004, "origin": [ -19.472, -27.843, 3.754 ], "x_axis": [ 0.615, 0.153, 0.773 ], "y_axis": [ -0.260, 0.965, 0.015 ], "z_axis": [ -0.744, -0.211, 0.634 ], "quaternion": [ 0.896, 0.063, -0.423, 0.115 ] } }, { "index": 53, "index_chain": 27, "chain_name": "C", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -9.686, "beta": 134.086, "gamma": 23.783, "delta": 76.580, "epsilon": -146.321, "zeta": -15.940, "epsilon_zeta": -130.381, "bb_type": "--", "chi": -143.976, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.832, -0.453 ], "P_xyz": [ 1.300, 8.818, -0.459 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 163.343, "theta": -58.046, "eta_prime": -178.580, "theta_prime": -72.564, "eta_base": -115.267, "theta_base": null, "v0": 1.833, "v1": -24.923, "v2": 37.516, "v3": -37.409, "v4": 22.404, "amplitude": 39.024, "phase_angle": 15.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.011, "origin": [ -19.974, -27.753, 6.959 ], "x_axis": [ 0.347, 0.784, 0.514 ], "y_axis": [ -0.793, 0.538, -0.286 ], "z_axis": [ -0.501, -0.309, 0.809 ], "quaternion": [ 0.821, 0.007, -0.309, 0.481 ] } }, { "index": 54, "index_chain": 28, "chain_name": "C", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///C/28", "linked_nts": [ "///C/27", null ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,ss-non-loop", "alpha": 111.188, "beta": -160.338, "gamma": -53.308, "delta": 85.017, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.484, "v1": -19.123, "v2": 29.533, "v3": -29.941, "v4": 18.645, "amplitude": 30.997, "phase_angle": 17.683, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null } ], "num_hbonds": 237, "hbonds": [ { "index": 1, "atom1_serNum": 6, "atom2_serNum": 1701, "donAcc_type": "acceptable", "distance": 3.305, "atom1_id": "///A/185/OG", "atom2_id": "///C/1/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 2, "atom1_serNum": 24, "atom2_serNum": 40, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///A/187/OH", "atom2_id": "///A/189/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 28, "atom2_serNum": 30, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/188/O", "atom2_id": "///A/188/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 32, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/189/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 39, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 3.815, "atom1_id": "///A/189/OE1", "atom2_id": "///A/198/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 40, "atom2_serNum": 46, "donAcc_type": "standard", "distance": 3.992, "atom1_id": "///A/189/OE2", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 44, "atom2_serNum": 54, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/190/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 49, "atom2_serNum": 74, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 52, "atom2_serNum": 54, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/191/OD1", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 57, "atom2_serNum": 82, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 57, "atom2_serNum": 87, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///A/192/O", "atom2_id": "///A/196/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 64, "atom2_serNum": 87, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/193/O", "atom2_id": "///A/196/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 64, "atom2_serNum": 88, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 69, "atom2_serNum": 99, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 77, "atom2_serNum": 110, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 85, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 91, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 102, "atom2_serNum": 137, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 108, "atom2_serNum": 358, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///A/198/NH1", "atom2_id": "///A/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 108, "atom2_serNum": 379, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/198/NH1", "atom2_id": "///A/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 109, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///A/198/NH2", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 113, "atom2_serNum": 145, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/199/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 117, "atom2_serNum": 363, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/199/OE1", "atom2_id": "///A/233/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 118, "atom2_serNum": 151, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/199/NE2", "atom2_id": "///A/203/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 122, "atom2_serNum": 153, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 127, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/200/NZ", "atom2_id": "///C/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 27, "atom1_serNum": 131, "atom2_serNum": 165, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///A/201/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 136, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/201/NE2", "atom2_id": "///A/243/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 140, "atom2_serNum": 165, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/202/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 140, "atom2_serNum": 169, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 148, "atom2_serNum": 178, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/203/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 156, "atom2_serNum": 178, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/204/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 156, "atom2_serNum": 186, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///A/204/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 164, "atom2_serNum": 1979, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///A/204/OH", "atom2_id": "///C/14/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 35, "atom1_serNum": 164, "atom2_serNum": 1982, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///A/204/OH", "atom2_id": "///C/14/O4'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 36, "atom1_serNum": 168, "atom2_serNum": 191, "donAcc_type": "acceptable", "distance": 3.045, "atom1_id": "///A/205/O", "atom2_id": "///A/208/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 177, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///A/206/NZ", "atom2_id": "///A/230/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 189, "atom2_serNum": 215, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///A/208/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 191, "atom2_serNum": 203, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///A/208/OG1", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 196, "atom2_serNum": 220, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 218, "atom2_serNum": 225, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/212/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 275, "atom2_serNum": 1155, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/223/NH1", "atom2_id": "///B/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 282, "atom2_serNum": 295, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///A/224/OG1", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 282, "atom2_serNum": 309, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///A/224/OG1", "atom2_id": "///A/227/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 294, "atom2_serNum": 1505, "donAcc_type": "acceptable", "distance": 3.432, "atom1_id": "///A/225/NH2", "atom2_id": "///D/17/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 46, "atom1_serNum": 301, "atom2_serNum": 1510, "donAcc_type": "questionable", "distance": 2.795, "atom1_id": "///A/226/OD1", "atom2_id": "///D/17/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 47, "atom1_serNum": 302, "atom2_serNum": 1512, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/226/OD2", "atom2_id": "///D/17/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 48, "atom1_serNum": 303, "atom2_serNum": 309, "donAcc_type": "acceptable", "distance": 3.007, "atom1_id": "///A/227/N", "atom2_id": "///A/227/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 343, "atom2_serNum": 355, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/231/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 379, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/235/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 400, "atom2_serNum": 1802, "donAcc_type": "acceptable", "distance": 2.825, "atom1_id": "///A/237/OH", "atom2_id": "///C/5/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 404, "atom2_serNum": 434, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 406, "atom2_serNum": 429, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///A/238/OG", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 406, "atom2_serNum": 1838, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///A/238/OG", "atom2_id": "///C/7/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 406, "atom2_serNum": 1874, "donAcc_type": "acceptable", "distance": 3.360, "atom1_id": "///A/238/OG", "atom2_id": "///C/9/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 56, "atom1_serNum": 407, "atom2_serNum": 1898, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/239/N", "atom2_id": "///C/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 57, "atom1_serNum": 410, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 414, "atom2_serNum": 452, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/239/NE", "atom2_id": "///A/243/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 416, "atom2_serNum": 1918, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/239/NH1", "atom2_id": "///C/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 60, "atom1_serNum": 416, "atom2_serNum": 1919, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/239/NH1", "atom2_id": "///C/11/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 61, "atom1_serNum": 416, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/239/NH1", "atom2_id": "///C/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 62, "atom1_serNum": 417, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/239/NH2", "atom2_id": "///C/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 63, "atom1_serNum": 421, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 425, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/240/NE", "atom2_id": "///C/9/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 428, "atom2_serNum": 1867, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/240/NH2", "atom2_id": "///C/8/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 66, "atom1_serNum": 428, "atom2_serNum": 1890, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/240/NH2", "atom2_id": "///C/9/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 67, "atom1_serNum": 432, "atom2_serNum": 457, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 432, "atom2_serNum": 1816, "donAcc_type": "acceptable", "distance": 2.592, "atom1_id": "///A/241/O", "atom2_id": "///C/6/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 69, "atom1_serNum": 437, "atom2_serNum": 465, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 448, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 456, "atom2_serNum": 481, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 460, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/245/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 468, "atom2_serNum": 503, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/246/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 475, "atom2_serNum": 514, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/247/O", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 480, "atom2_serNum": 2058, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///A/247/NZ", "atom2_id": "///C/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 76, "atom1_serNum": 484, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/248/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 484, "atom2_serNum": 528, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///A/248/O", "atom2_id": "///A/252/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 492, "atom2_serNum": 529, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/249/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 506, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///A/250/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 512, "atom2_serNum": 2038, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///A/250/NH1", "atom2_id": "///C/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 513, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/250/NH2", "atom2_id": "///C/16/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 82, "atom1_serNum": 513, "atom2_serNum": 2026, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///A/250/NH2", "atom2_id": "///C/16/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 83, "atom1_serNum": 517, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/251/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 526, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/252/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 532, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/253/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 532, "atom2_serNum": 555, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/253/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 546, "atom2_serNum": 2038, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/254/NE2", "atom2_id": "///C/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 88, "atom1_serNum": 546, "atom2_serNum": 2039, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/254/NE2", "atom2_id": "///C/17/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 600, "atom2_serNum": 615, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///B/187/OH", "atom2_id": "///B/189/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 600, "atom2_serNum": 616, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///B/187/OH", "atom2_id": "///B/189/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 604, "atom2_serNum": 606, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///B/188/O", "atom2_id": "///B/188/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 608, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/189/N", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 616, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///B/189/OE2", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 625, "atom2_serNum": 650, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/191/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 628, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/191/OD1", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 628, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/191/OD1", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 628, "atom2_serNum": 642, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///B/191/OD1", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 633, "atom2_serNum": 658, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/192/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 633, "atom2_serNum": 663, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///B/192/O", "atom2_id": "///B/196/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 640, "atom2_serNum": 663, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///B/193/O", "atom2_id": "///B/196/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 640, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/193/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 645, "atom2_serNum": 675, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/194/O", "atom2_id": "///B/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 653, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/195/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 661, "atom2_serNum": 695, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/196/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 667, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/197/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 673, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/197/NH1", "atom2_id": "///D/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 107, "atom1_serNum": 674, "atom2_serNum": 1376, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///B/197/NH2", "atom2_id": "///D/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 108, "atom1_serNum": 678, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/198/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 684, "atom2_serNum": 935, "donAcc_type": "standard", "distance": 2.501, "atom1_id": "///B/198/NH1", "atom2_id": "///B/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 684, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/198/NH1", "atom2_id": "///B/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 685, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/198/NH2", "atom2_id": "///B/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 689, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/199/O", "atom2_id": "///B/199/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 689, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///B/199/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 693, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///B/199/OE1", "atom2_id": "///B/233/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 694, "atom2_serNum": 727, "donAcc_type": "standard", "distance": 2.475, "atom1_id": "///B/199/NE2", "atom2_id": "///B/203/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 698, "atom2_serNum": 729, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/200/O", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 703, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/200/NZ", "atom2_id": "///D/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 118, "atom1_serNum": 707, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///B/201/O", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 712, "atom2_serNum": 1028, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/201/NE2", "atom2_id": "///B/243/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 716, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/202/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 724, "atom2_serNum": 754, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/203/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 732, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///B/204/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 740, "atom2_serNum": 1438, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///B/204/OH", "atom2_id": "///D/14/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 124, "atom1_serNum": 744, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/205/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 744, "atom2_serNum": 767, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///B/205/O", "atom2_id": "///B/208/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 753, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/206/NZ", "atom2_id": "///B/230/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 761, "atom2_serNum": 1452, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///B/207/ND2", "atom2_id": "///D/14/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 128, "atom1_serNum": 767, "atom2_serNum": 779, "donAcc_type": "acceptable", "distance": 3.917, "atom1_id": "///B/208/OG1", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 772, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/209/O", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 772, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.411, "atom1_id": "///B/209/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 777, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/210/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 777, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/210/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 782, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/211/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 809, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/213/NH1", "atom2_id": "///B/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 822, "atom2_serNum": 866, "donAcc_type": "acceptable", "distance": 3.951, "atom1_id": "///B/214/OH", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 823, "atom2_serNum": 837, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/215/N", "atom2_id": "///B/216/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 830, "atom2_serNum": 837, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///B/216/N", "atom2_id": "///B/216/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 873, "atom2_serNum": 892, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///B/225/N", "atom2_id": "///B/227/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 884, "atom2_serNum": 2051, "donAcc_type": "questionable", "distance": 2.677, "atom1_id": "///B/226/OD1", "atom2_id": "///C/17/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 140, "atom1_serNum": 885, "atom2_serNum": 2053, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///B/226/OD2", "atom2_id": "///C/17/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 141, "atom1_serNum": 889, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/227/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 920, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/231/O", "atom2_id": "///B/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 927, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/232/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 930, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///B/232/OD1", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 930, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/232/OD1", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 956, "atom2_serNum": 966, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///B/235/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 977, "atom2_serNum": 1261, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///B/237/OH", "atom2_id": "///D/5/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 148, "atom1_serNum": 981, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/238/O", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 983, "atom2_serNum": 1006, "donAcc_type": "acceptable", "distance": 3.039, "atom1_id": "///B/238/OG", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 983, "atom2_serNum": 1297, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///B/238/OG", "atom2_id": "///D/7/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 151, "atom1_serNum": 983, "atom2_serNum": 1334, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///B/238/OG", "atom2_id": "///D/9/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 152, "atom1_serNum": 984, "atom2_serNum": 1357, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/239/N", "atom2_id": "///D/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 153, "atom1_serNum": 987, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/239/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 991, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/239/NE", "atom2_id": "///B/243/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 993, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/239/NH1", "atom2_id": "///D/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 156, "atom1_serNum": 993, "atom2_serNum": 1378, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/239/NH1", "atom2_id": "///D/11/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 157, "atom1_serNum": 994, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/239/NH2", "atom2_id": "///D/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 158, "atom1_serNum": 998, "atom2_serNum": 1030, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/240/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1002, "atom2_serNum": 1346, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/240/NE", "atom2_id": "///D/9/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 160, "atom1_serNum": 1004, "atom2_serNum": 1310, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///B/240/NH1", "atom2_id": "///D/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 161, "atom1_serNum": 1005, "atom2_serNum": 1349, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///B/240/NH2", "atom2_id": "///D/9/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 162, "atom1_serNum": 1009, "atom2_serNum": 1034, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/241/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1009, "atom2_serNum": 1275, "donAcc_type": "acceptable", "distance": 2.521, "atom1_id": "///B/241/O", "atom2_id": "///D/6/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 164, "atom1_serNum": 1014, "atom2_serNum": 1034, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/242/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1014, "atom2_serNum": 1042, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/242/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1025, "atom2_serNum": 1049, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/243/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1033, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///B/244/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1037, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/245/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1045, "atom2_serNum": 1080, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/246/O", "atom2_id": "///B/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1052, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/247/O", "atom2_id": "///B/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1057, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///B/247/NZ", "atom2_id": "///D/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 172, "atom1_serNum": 1057, "atom2_serNum": 1517, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/247/NZ", "atom2_id": "///D/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 173, "atom1_serNum": 1061, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/248/O", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1061, "atom2_serNum": 1105, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///B/248/O", "atom2_id": "///B/252/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1069, "atom2_serNum": 1106, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/249/O", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1083, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 3.647, "atom1_id": "///B/250/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1089, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///B/250/NH1", "atom2_id": "///D/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 178, "atom1_serNum": 1090, "atom2_serNum": 1485, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///B/250/NH2", "atom2_id": "///D/16/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 179, "atom1_serNum": 1090, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/250/NH2", "atom2_id": "///D/16/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 180, "atom1_serNum": 1103, "atom2_serNum": 1124, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///B/252/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1109, "atom2_serNum": 1124, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/253/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1109, "atom2_serNum": 1132, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/253/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1120, "atom2_serNum": 1150, "donAcc_type": "acceptable", "distance": 2.800, "atom1_id": "///B/254/ND1", "atom2_id": "///B/257/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1123, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/254/NE2", "atom2_id": "///D/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 185, "atom1_serNum": 1151, "atom2_serNum": 1512, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/257/OD2", "atom2_id": "///D/17/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 186, "atom1_serNum": 1160, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///D/1/O5'", "atom2_id": "///D/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1297, "atom2_serNum": 1334, "donAcc_type": "acceptable", "distance": 2.367, "atom1_id": "///D/7/O2'", "atom2_id": "///D/9/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1326, "atom2_serNum": 1643, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///D/8/O6", "atom2_id": "///D/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1327, "atom2_serNum": 1641, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///D/8/N1", "atom2_id": "///D/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1329, "atom2_serNum": 1640, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///D/8/N2", "atom2_id": "///D/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1349, "atom2_serNum": 1623, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///D/9/O6", "atom2_id": "///D/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1350, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/9/N1", "atom2_id": "///D/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1352, "atom2_serNum": 1620, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///D/9/N2", "atom2_id": "///D/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 1369, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///D/10/O2", "atom2_id": "///D/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1370, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/10/N3", "atom2_id": "///D/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1372, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///D/10/N4", "atom2_id": "///D/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1389, "atom2_serNum": 1580, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///D/11/O2", "atom2_id": "///D/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1390, "atom2_serNum": 1578, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///D/11/N3", "atom2_id": "///D/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1392, "atom2_serNum": 1577, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///D/11/N4", "atom2_id": "///D/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1409, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///D/12/O2", "atom2_id": "///D/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1410, "atom2_serNum": 1555, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///D/12/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1412, "atom2_serNum": 1554, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///D/12/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1425, "atom2_serNum": 1456, "donAcc_type": "acceptable", "distance": 2.379, "atom1_id": "///D/13/O2'", "atom2_id": "///D/15/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1430, "atom2_serNum": 1533, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///D/13/N3", "atom2_id": "///D/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1432, "atom2_serNum": 1532, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///D/13/O4", "atom2_id": "///D/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1449, "atom2_serNum": 1485, "donAcc_type": "acceptable", "distance": 2.505, "atom1_id": "///D/14/O2", "atom2_id": "///D/16/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1465, "atom2_serNum": 1525, "donAcc_type": "acceptable", "distance": 2.436, "atom1_id": "///D/15/O2'", "atom2_id": "///D/18/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1465, "atom2_serNum": 1535, "donAcc_type": "acceptable", "distance": 3.260, "atom1_id": "///D/15/O2'", "atom2_id": "///D/18/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1465, "atom2_serNum": 1543, "donAcc_type": "acceptable", "distance": 3.491, "atom1_id": "///D/15/O2'", "atom2_id": "///D/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1525, "atom2_serNum": 1543, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///D/18/O2'", "atom2_id": "///D/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1701, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/1/O5'", "atom2_id": "///C/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1838, "atom2_serNum": 1874, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///C/7/O2'", "atom2_id": "///C/9/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1838, "atom2_serNum": 1875, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///C/7/O2'", "atom2_id": "///C/9/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1867, "atom2_serNum": 2184, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///C/8/O6", "atom2_id": "///C/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1868, "atom2_serNum": 2182, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/8/N1", "atom2_id": "///C/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1870, "atom2_serNum": 2181, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///C/8/N2", "atom2_id": "///C/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1890, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///C/9/O6", "atom2_id": "///C/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1891, "atom2_serNum": 2162, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/9/N1", "atom2_id": "///C/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1893, "atom2_serNum": 2161, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/9/N2", "atom2_id": "///C/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1910, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/10/O2", "atom2_id": "///C/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1911, "atom2_serNum": 2142, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/10/N3", "atom2_id": "///C/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 1913, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///C/10/N4", "atom2_id": "///C/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 1930, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/11/O2", "atom2_id": "///C/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 1931, "atom2_serNum": 2119, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///C/11/N3", "atom2_id": "///C/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 1933, "atom2_serNum": 2118, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/11/N4", "atom2_id": "///C/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 1950, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///C/12/O2", "atom2_id": "///C/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 1951, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/12/N3", "atom2_id": "///C/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 1951, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/12/N3", "atom2_id": "///C/19/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 1953, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///C/12/N4", "atom2_id": "///C/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 1966, "atom2_serNum": 1997, "donAcc_type": "acceptable", "distance": 2.383, "atom1_id": "///C/13/O2'", "atom2_id": "///C/15/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 1971, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///C/13/N3", "atom2_id": "///C/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 1973, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/13/O4", "atom2_id": "///C/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 1990, "atom2_serNum": 2026, "donAcc_type": "acceptable", "distance": 2.506, "atom1_id": "///C/14/O2", "atom2_id": "///C/16/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 2006, "atom2_serNum": 2010, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///C/15/O2'", "atom2_id": "///C/15/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2006, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///C/15/O2'", "atom2_id": "///C/18/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2006, "atom2_serNum": 2076, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///C/15/O2'", "atom2_id": "///C/18/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 2066, "atom2_serNum": 2084, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///C/18/O2'", "atom2_id": "///C/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4tuw", "num_aaChains": 2, "aaChains": "A=71,B=70", "num_naChains": 2, "naChains": "C=28,D=26", "num_atoms": 2282, "num_waters": 0, "num_metals": 5, "metals_desc": "Ca=5", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }