{ "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///G/2019", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.256, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.789, "chi2": -94.799, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.733, "C1C1_dist": 10.926, "N1N9_dist": 9.296, "C6C8_dist": 10.298, "CNNC_torsion": 8.431, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.41],N1(imino)-N3[3.27],N2(amino)-O2(carbonyl)[3.03]", "interBase_angle": 8.694, "planarity": 0.122, "simple_Shear": -0.197, "simple_Stretch": 0.277, "simple_Buckle": -5.358, "simple_Propeller": 6.847, "bp_simpleParams": [ -0.197, 0.277, -0.375, -5.358, 6.847, 2.742 ], "bp_params": [ -0.201, 0.273, -0.375, -5.467, 6.760, 2.743 ], "frame": { "rmsd": null, "origin": [ 33.187, 55.052, 38.585 ], "x_axis": [ 0.087, 0.353, 0.931 ], "y_axis": [ -0.910, 0.408, -0.070 ], "z_axis": [ -0.405, -0.842, 0.357 ], "quaternion": [ 0.681, 0.284, -0.491, 0.464 ] } }, { "index": 2, "nt1": "///E/3", "nt2": "///G/2018", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.526, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.766, "chi2": -94.809, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.579, "C1C1_dist": 10.528, "N1N9_dist": 8.897, "C6C8_dist": 9.913, "CNNC_torsion": -6.942, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 10.855, "planarity": 0.155, "simple_Shear": 0.289, "simple_Stretch": -0.074, "simple_Buckle": 9.859, "simple_Propeller": -4.541, "bp_simpleParams": [ 0.289, -0.074, 0.133, 9.859, -4.541, 3.693 ], "bp_params": [ 0.287, -0.081, 0.133, 9.758, -4.754, 3.683 ], "frame": { "rmsd": null, "origin": [ 31.499, 52.479, 39.063 ], "x_axis": [ -0.406, 0.537, 0.740 ], "y_axis": [ -0.802, 0.179, -0.570 ], "z_axis": [ -0.438, -0.825, 0.358 ], "quaternion": [ 0.532, 0.120, -0.554, 0.630 ] } }, { "index": 3, "nt1": "///E/4", "nt2": "///G/2017", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.416, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.158, "chi2": -93.484, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.938, "C1C1_dist": 10.346, "N1N9_dist": 8.774, "C6C8_dist": 9.736, "CNNC_torsion": -9.113, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 30.261, "planarity": 0.370, "simple_Shear": 0.362, "simple_Stretch": 0.031, "simple_Buckle": 29.138, "simple_Propeller": -8.167, "bp_simpleParams": [ 0.362, 0.031, -0.277, 29.138, -8.167, 3.385 ], "bp_params": [ 0.362, 0.023, -0.277, 28.995, -8.663, 3.287 ], "frame": { "rmsd": null, "origin": [ 29.774, 50.324, 40.012 ], "x_axis": [ -0.686, 0.633, 0.360 ], "y_axis": [ -0.594, -0.200, -0.779 ], "z_axis": [ -0.421, -0.748, 0.513 ], "quaternion": [ 0.396, -0.020, -0.493, 0.774 ] } }, { "index": 4, "nt1": "///E/5", "nt2": "///G/2016", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.576, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.793, "chi2": -101.527, "conf2": "anti", "pucker2": "----", "lambda2": 56.874, "C1C1_dist": 10.513, "N1N9_dist": 8.887, "C6C8_dist": 9.817, "CNNC_torsion": 4.740, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 25.877, "planarity": 0.315, "simple_Shear": -0.182, "simple_Stretch": 0.029, "simple_Buckle": -25.808, "simple_Propeller": -1.890, "bp_simpleParams": [ -0.182, 0.029, -0.438, -25.808, -1.890, 1.180 ], "bp_params": [ -0.183, 0.027, -0.438, -25.787, -2.161, 1.151 ], "frame": { "rmsd": null, "origin": [ 24.929, 47.958, 42.160 ], "x_axis": [ -0.209, 0.894, -0.396 ], "y_axis": [ -0.418, -0.448, -0.790 ], "z_axis": [ -0.884, 0.001, 0.467 ], "quaternion": [ 0.450, -0.439, -0.271, 0.729 ] } }, { "index": 5, "nt1": "///E/6", "nt2": "///G/2015", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.540, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.288, "chi2": -108.238, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.080, "C1C1_dist": 10.773, "N1N9_dist": 9.027, "C6C8_dist": 9.952, "CNNC_torsion": 2.922, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 1.740, "planarity": 0.027, "simple_Shear": -0.133, "simple_Stretch": -0.002, "simple_Buckle": -0.350, "simple_Propeller": 1.705, "bp_simpleParams": [ -0.133, -0.002, 0.023, -0.350, 1.705, -1.265 ], "bp_params": [ -0.133, -0.004, 0.023, -0.380, 1.698, -1.265 ], "frame": { "rmsd": null, "origin": [ 22.764, 47.040, 43.977 ], "x_axis": [ -0.291, 0.609, -0.738 ], "y_axis": [ -0.217, -0.793, -0.569 ], "z_axis": [ -0.932, -0.006, 0.363 ], "quaternion": [ 0.264, -0.534, -0.184, 0.782 ] } }, { "index": 6, "nt1": "///E/7", "nt2": "///G/2014", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.145, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.452, "chi2": -162.078, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.573, "C1C1_dist": 10.130, "N1N9_dist": 8.623, "C6C8_dist": 9.732, "CNNC_torsion": -18.124, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[2.68]", "interBase_angle": 25.694, "planarity": 0.322, "simple_Shear": -0.032, "simple_Stretch": -0.201, "simple_Buckle": 1.294, "simple_Propeller": -25.661, "bp_simpleParams": [ -0.032, -0.201, 0.107, 1.294, -25.661, 7.598 ], "bp_params": [ -0.032, -0.201, 0.107, 1.237, -25.664, 7.792 ], "frame": { "rmsd": null, "origin": [ 19.537, 48.580, 44.356 ], "x_axis": [ -0.108, 0.102, -0.989 ], "y_axis": [ -0.025, -0.995, -0.100 ], "z_axis": [ -0.994, 0.014, 0.110 ], "quaternion": [ 0.043, -0.666, -0.029, 0.744 ] } }, { "index": 7, "nt1": "///E/8", "nt2": "///G/2013", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.064, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.477, "chi2": -170.359, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.144, "C1C1_dist": 10.573, "N1N9_dist": 8.884, "C6C8_dist": 9.846, "CNNC_torsion": -6.439, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 9.171, "planarity": 0.111, "simple_Shear": -0.357, "simple_Stretch": -0.178, "simple_Buckle": -2.398, "simple_Propeller": -8.852, "bp_simpleParams": [ -0.357, -0.178, 0.055, -2.398, -8.852, 1.277 ], "bp_params": [ -0.351, -0.189, 0.055, -2.125, -8.921, 1.280 ], "frame": { "rmsd": null, "origin": [ 16.273, 49.903, 45.162 ], "x_axis": [ 0.074, -0.481, -0.873 ], "y_axis": [ 0.050, -0.873, 0.485 ], "z_axis": [ -0.996, -0.080, -0.041 ], "quaternion": [ 0.200, 0.705, -0.153, -0.663 ] } }, { "index": 8, "nt1": "///E/9", "nt2": "///G/2012", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.041, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.510, "chi2": -136.822, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.485, "C1C1_dist": 10.355, "N1N9_dist": 8.780, "C6C8_dist": 9.838, "CNNC_torsion": 4.755, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.77],N2(amino)-O2(carbonyl)[2.43]", "interBase_angle": 1.807, "planarity": 0.032, "simple_Shear": -0.111, "simple_Stretch": -0.181, "simple_Buckle": -1.378, "simple_Propeller": 1.168, "bp_simpleParams": [ -0.111, -0.181, -0.041, -1.378, 1.168, 5.292 ], "bp_params": [ -0.110, -0.182, -0.041, -1.386, 1.159, 5.292 ], "frame": { "rmsd": null, "origin": [ 13.010, 50.225, 43.145 ], "x_axis": [ 0.116, -0.824, -0.555 ], "y_axis": [ -0.065, -0.564, 0.824 ], "z_axis": [ -0.991, -0.059, -0.119 ], "quaternion": [ 0.329, 0.671, -0.332, -0.576 ] } }, { "index": 9, "nt1": "///E/10", "nt2": "///G/2011", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.894, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.836, "chi2": -95.370, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.480, "C1C1_dist": 10.604, "N1N9_dist": 8.945, "C6C8_dist": 9.884, "CNNC_torsion": 11.212, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 18.093, "planarity": 0.213, "simple_Shear": -0.778, "simple_Stretch": 0.058, "simple_Buckle": 17.869, "simple_Propeller": 2.837, "bp_simpleParams": [ -0.778, 0.058, -0.637, 17.869, 2.837, -0.321 ], "bp_params": [ -0.780, -0.005, -0.637, 17.586, 4.253, -0.317 ], "frame": { "rmsd": null, "origin": [ 10.126, 50.452, 40.793 ], "x_axis": [ 0.084, -0.937, -0.338 ], "y_axis": [ -0.255, -0.349, 0.902 ], "z_axis": [ -0.963, 0.011, -0.268 ], "quaternion": [ 0.342, 0.652, -0.457, -0.499 ] } }, { "index": 10, "nt1": "///E/11", "nt2": "///G/2010", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.947, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.440, "chi2": -146.867, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.342, "C1C1_dist": 10.222, "N1N9_dist": 8.681, "C6C8_dist": 9.707, "CNNC_torsion": 7.815, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.82]", "interBase_angle": 26.024, "planarity": 0.304, "simple_Shear": 0.334, "simple_Stretch": 0.007, "simple_Buckle": -25.883, "simple_Propeller": 2.701, "bp_simpleParams": [ 0.334, 0.007, -0.522, -25.883, 2.701, 4.556 ], "bp_params": [ 0.334, -0.005, -0.522, -25.774, 3.596, 4.444 ], "frame": { "rmsd": null, "origin": [ 2.632, 51.053, 39.164 ], "x_axis": [ -0.262, -0.872, 0.413 ], "y_axis": [ -0.171, 0.463, 0.870 ], "z_axis": [ -0.950, 0.158, -0.271 ], "quaternion": [ -0.482, -0.369, 0.706, 0.364 ] } }, { "index": 11, "nt1": "///E/12", "nt2": "///G/2009", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.632, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.597, "chi2": -159.334, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.394, "C1C1_dist": 10.517, "N1N9_dist": 8.861, "C6C8_dist": 9.870, "CNNC_torsion": -10.650, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 6.964, "planarity": 0.107, "simple_Shear": 0.406, "simple_Stretch": -0.149, "simple_Buckle": -3.185, "simple_Propeller": -6.193, "bp_simpleParams": [ 0.406, -0.149, 0.372, -3.185, -6.193, 3.349 ], "bp_params": [ 0.400, -0.164, 0.372, -3.407, -6.074, 3.352 ], "frame": { "rmsd": null, "origin": [ -0.084, 51.302, 38.204 ], "x_axis": [ -0.264, -0.559, 0.786 ], "y_axis": [ 0.094, 0.796, 0.598 ], "z_axis": [ -0.960, 0.232, -0.157 ], "quaternion": [ 0.586, 0.156, -0.744, -0.279 ] } }, { "index": 12, "nt1": "///E/13", "nt2": "///F/1008", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.784, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.174, "chi2": -128.617, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.082, "C1C1_dist": 10.398, "N1N9_dist": 8.826, "C6C8_dist": 9.886, "CNNC_torsion": -8.672, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17],N1-N3(imino)[2.91]", "interBase_angle": 19.948, "planarity": 0.267, "simple_Shear": 0.413, "simple_Stretch": -0.025, "simple_Buckle": 9.886, "simple_Propeller": -17.326, "bp_simpleParams": [ 0.413, -0.025, -0.367, 9.886, -17.326, 6.115 ], "bp_params": [ 0.412, -0.042, -0.367, 9.126, -17.738, 6.170 ], "frame": { "rmsd": null, "origin": [ -2.864, 50.906, 35.077 ], "x_axis": [ -0.116, -0.401, 0.909 ], "y_axis": [ 0.044, 0.912, 0.408 ], "z_axis": [ -0.992, 0.087, -0.088 ], "quaternion": [ 0.653, 0.123, -0.727, -0.170 ] } }, { "index": 13, "nt1": "///E/14", "nt2": "///F/1007", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.378, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.404, "chi2": -169.253, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.082, "C1C1_dist": 10.347, "N1N9_dist": 8.805, "C6C8_dist": 9.888, "CNNC_torsion": -12.396, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[3.20]", "interBase_angle": 25.858, "planarity": 0.298, "simple_Shear": 0.345, "simple_Stretch": -0.077, "simple_Buckle": 11.419, "simple_Propeller": -23.200, "bp_simpleParams": [ 0.345, -0.077, -0.355, 11.419, -23.200, 8.915 ], "bp_params": [ 0.343, -0.083, -0.355, 10.867, -23.464, 9.065 ], "frame": { "rmsd": null, "origin": [ -6.157, 50.162, 35.244 ], "x_axis": [ 0.127, 0.133, 0.983 ], "y_axis": [ 0.118, 0.982, -0.148 ], "z_axis": [ -0.985, 0.135, 0.109 ], "quaternion": [ 0.745, -0.095, -0.661, 0.005 ] } }, { "index": 14, "nt1": "///E/15", "nt2": "///F/1006", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.101, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.070, "chi2": -130.248, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.222, "C1C1_dist": 10.749, "N1N9_dist": 9.008, "C6C8_dist": 9.943, "CNNC_torsion": 9.089, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 5.079, "planarity": 0.071, "simple_Shear": 0.031, "simple_Stretch": -0.090, "simple_Buckle": 0.423, "simple_Propeller": 5.061, "bp_simpleParams": [ 0.031, -0.090, -0.078, 0.423, 5.061, -0.068 ], "bp_params": [ 0.031, -0.090, -0.078, 0.416, 5.062, -0.068 ], "frame": { "rmsd": null, "origin": [ -9.990, 49.172, 35.985 ], "x_axis": [ 0.421, 0.563, 0.711 ], "y_axis": [ -0.034, 0.794, -0.607 ], "z_axis": [ -0.906, 0.231, 0.353 ], "quaternion": [ 0.801, -0.262, -0.505, 0.186 ] } }, { "index": 15, "nt1": "///E/16", "nt2": "///F/1005", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.431, "conf1": "anti", "pucker1": "----", "lambda1": 54.013, "chi2": -104.149, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.808, "C1C1_dist": 10.620, "N1N9_dist": 8.911, "C6C8_dist": 9.775, "CNNC_torsion": 2.042, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 24.081, "planarity": 0.318, "simple_Shear": -0.118, "simple_Stretch": -0.038, "simple_Buckle": 23.916, "simple_Propeller": 2.810, "bp_simpleParams": [ -0.118, -0.038, 0.119, 23.916, 2.810, -2.166 ], "bp_params": [ -0.118, -0.039, 0.119, 23.907, 2.885, -2.120 ], "frame": { "rmsd": null, "origin": [ -12.297, 50.511, 37.324 ], "x_axis": [ 0.389, 0.872, 0.298 ], "y_axis": [ -0.296, 0.425, -0.855 ], "z_axis": [ -0.872, 0.245, 0.423 ], "quaternion": [ 0.748, -0.368, -0.391, 0.390 ] } }, { "index": 16, "nt1": "///E/17", "nt2": "///F/1004", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.688, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.437, "chi2": -120.135, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.587, "C1C1_dist": 10.356, "N1N9_dist": 8.783, "C6C8_dist": 9.754, "CNNC_torsion": -9.428, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 26.341, "planarity": 0.358, "simple_Shear": 0.210, "simple_Stretch": -0.016, "simple_Buckle": -25.731, "simple_Propeller": -5.633, "bp_simpleParams": [ 0.210, -0.016, 0.288, -25.731, -5.633, 3.044 ], "bp_params": [ 0.210, -0.021, 0.288, -25.865, -4.982, 2.970 ], "frame": { "rmsd": null, "origin": [ -16.685, 53.713, 39.864 ], "x_axis": [ 0.778, 0.516, -0.360 ], "y_axis": [ -0.496, 0.152, -0.855 ], "z_axis": [ -0.387, 0.843, 0.374 ], "quaternion": [ 0.759, -0.560, -0.009, 0.333 ] } }, { "index": 17, "nt1": "///E/18", "nt2": "///F/1003", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.250, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.952, "chi2": -99.245, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.865, "C1C1_dist": 10.556, "N1N9_dist": 8.905, "C6C8_dist": 9.888, "CNNC_torsion": 1.268, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.90]", "interBase_angle": 6.267, "planarity": 0.081, "simple_Shear": -0.069, "simple_Stretch": -0.054, "simple_Buckle": -5.878, "simple_Propeller": 2.173, "bp_simpleParams": [ -0.069, -0.054, 0.008, -5.878, 2.173, 1.326 ], "bp_params": [ -0.069, -0.054, 0.008, -5.884, 2.157, 1.324 ], "frame": { "rmsd": null, "origin": [ -18.135, 56.343, 40.329 ], "x_axis": [ 0.403, 0.484, -0.777 ], "y_axis": [ -0.837, -0.148, -0.526 ], "z_axis": [ -0.370, 0.863, 0.345 ], "quaternion": [ 0.632, -0.549, 0.161, 0.522 ] } }, { "index": 18, "nt1": "///E/19", "nt2": "///F/1002", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.530, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.132, "chi2": -100.163, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.603, "C1C1_dist": 10.706, "N1N9_dist": 9.171, "C6C8_dist": 10.310, "CNNC_torsion": -14.980, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[3.23],N4(amino)-O6(carbonyl)[3.65]", "interBase_angle": 13.016, "planarity": 0.175, "simple_Shear": 0.260, "simple_Stretch": 0.314, "simple_Buckle": 2.163, "simple_Propeller": -12.835, "bp_simpleParams": [ 0.260, 0.314, 0.309, 2.163, -12.835, 9.114 ], "bp_params": [ 0.266, 0.309, 0.309, 1.904, -12.876, 9.170 ], "frame": { "rmsd": null, "origin": [ -19.487, 59.113, 41.123 ], "x_axis": [ -0.121, 0.328, -0.937 ], "y_axis": [ -0.909, -0.415, -0.028 ], "z_axis": [ -0.398, 0.849, 0.348 ], "quaternion": [ 0.451, -0.486, 0.299, 0.686 ] } }, { "index": 19, "nt1": "///E/20", "nt2": "///F/1001", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.459, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.404, "chi2": -126.825, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.663, "C1C1_dist": 10.148, "N1N9_dist": 8.702, "C6C8_dist": 9.822, "CNNC_torsion": -0.526, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.50],N1-N3(imino)[3.07]", "interBase_angle": 32.741, "planarity": 0.412, "simple_Shear": 0.114, "simple_Stretch": 0.306, "simple_Buckle": 32.740, "simple_Propeller": -0.085, "bp_simpleParams": [ 0.114, 0.306, 0.100, 32.740, -0.085, 10.108 ], "bp_params": [ 0.119, 0.304, 0.100, 32.734, -0.656, 9.701 ], "frame": { "rmsd": null, "origin": [ -21.827, 61.322, 41.568 ], "x_axis": [ -0.665, 0.049, -0.745 ], "y_axis": [ -0.692, -0.417, 0.590 ], "z_axis": [ -0.282, 0.908, 0.311 ], "quaternion": [ 0.239, -0.332, 0.484, 0.774 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCCGTAGGTACACCGCACA", "strand2": "CGGCATCCATGTGGCGTGT", "bp_type": "|||||||||||||||||||", "helix_form": "BB.B......x..B.BBB", "helical_rise": 3.043, "helical_rise_std": 1.542, "helical_radius": 10.160, "helical_radius_std": 3.389, "helical_axis": [ -0.975, 0.143, 0.169 ], "point1": [ 31.765, 46.409, 35.143 ], "point2": [ -21.467, 54.198, 44.368 ], "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///G/2019", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, 0.273, -0.375, -5.467, 6.760, 2.743 ], "step_params": [ -0.481, 0.553, 3.026, -1.966, 0.811, 32.515 ], "heli_params": [ 0.854, 0.538, 3.062, 1.446, 3.507, 32.582 ], "bp2_params": [ 0.287, -0.081, 0.133, 9.758, -4.754, 3.683 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.026, "simple_Twist": 29.741, "simple_hRise": 3.065, "simple_hTwist": 29.815 }, { "index": 2, "nt1": "///E/3", "nt2": "///G/2018", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.287, -0.081, 0.133, 9.758, -4.754, 3.683 ], "step_params": [ 0.166, 0.562, 2.860, 6.959, 7.157, 26.989 ], "heli_params": [ -0.321, 1.078, 2.865, 14.711, -14.303, 28.744 ], "bp2_params": [ 0.362, 0.023, -0.277, 28.995, -8.663, 3.287 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.860, "simple_Twist": 27.112, "simple_hRise": 2.866, "simple_hTwist": 28.859 }, { "index": 3, "nt1": "///E/4", "nt2": "///G/2017", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.362, 0.023, -0.277, 28.995, -8.663, 3.287 ], "step_params": [ 0.385, 1.127, 5.681, -1.877, 52.278, 19.399 ], "heli_params": [ -5.231, -0.644, 3.091, 71.019, 2.550, 55.554 ], "bp2_params": [ -0.183, 0.027, -0.438, -25.787, -2.161, 1.151 ], "groove_widths": [ 19.443, null, 16.639, null ], "simple_Rise": 5.681, "simple_Twist": 21.841, "simple_hRise": 3.297, "simple_hTwist": 56.390 }, { "index": 4, "nt1": "///E/5", "nt2": "///G/2016", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, 0.027, -0.438, -25.787, -2.161, 1.151 ], "step_params": [ -1.182, -0.000, 2.726, -5.280, 3.878, 25.867 ], "heli_params": [ -0.882, 1.363, 2.876, 8.490, 11.561, 26.670 ], "bp2_params": [ -0.133, -0.004, 0.023, -0.380, 1.698, -1.265 ], "groove_widths": [ 18.865, 16.370, 17.312, 13.502 ], "simple_Rise": 2.726, "simple_Twist": 25.687, "simple_hRise": 2.876, "simple_hTwist": 26.496 }, { "index": 5, "nt1": "///E/6", "nt2": "///G/2015", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.004, 0.023, -0.380, 1.698, -1.265 ], "step_params": [ 0.939, -1.268, 3.231, -4.469, 14.328, 31.605 ], "heli_params": [ -4.051, -2.169, 2.309, 24.644, 7.686, 34.905 ], "bp2_params": [ -0.032, -0.201, 0.107, 1.237, -25.664, 7.792 ], "groove_widths": [ 17.156, 14.716, 18.569, 17.014 ], "simple_Rise": 3.231, "simple_Twist": 30.936, "simple_hRise": 2.286, "simple_hTwist": 34.304 }, { "index": 6, "nt1": "///E/7", "nt2": "///G/2014", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.201, 0.107, 1.237, -25.664, 7.792 ], "step_params": [ -0.965, -1.262, 3.244, -3.557, 9.576, 35.023 ], "heli_params": [ -3.291, 1.070, 2.892, 15.509, 5.761, 36.438 ], "bp2_params": [ -0.351, -0.189, 0.055, -2.125, -8.921, 1.280 ], "groove_widths": [ 16.731, 15.136, 22.276, 21.842 ], "simple_Rise": 3.244, "simple_Twist": 36.765, "simple_hRise": 2.914, "simple_hTwist": 38.110 }, { "index": 7, "nt1": "///E/8", "nt2": "///G/2013", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.351, -0.189, 0.055, -2.125, -8.921, 1.280 ], "step_params": [ 0.918, -1.590, 3.384, 3.896, 2.536, 27.077 ], "heli_params": [ -3.993, -0.944, 3.320, 5.365, -8.244, 27.466 ], "bp2_params": [ -0.110, -0.182, -0.041, -1.386, 1.159, 5.292 ], "groove_widths": [ 16.555, 15.950, 22.245, 22.194 ], "simple_Rise": 3.384, "simple_Twist": 25.877, "simple_hRise": 3.315, "simple_hTwist": 26.284 }, { "index": 8, "nt1": "///E/9", "nt2": "///G/2012", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, -0.182, -0.041, -1.386, 1.159, 5.292 ], "step_params": [ 0.533, -1.691, 3.280, 9.580, 0.443, 14.180 ], "heli_params": [ -5.981, 4.614, 2.976, 1.581, -34.164, 17.105 ], "bp2_params": [ -0.780, -0.005, -0.637, 17.586, 4.253, -0.317 ], "groove_widths": [ 15.064, 14.491, 21.743, null ], "simple_Rise": 3.280, "simple_Twist": 17.751, "simple_hRise": 3.106, "simple_hTwist": 20.158 }, { "index": 9, "nt1": "///E/10", "nt2": "///G/2011", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.780, -0.005, -0.637, 17.586, 4.253, -0.317 ], "step_params": [ 0.077, 0.459, 7.678, -0.223, -8.452, 48.320 ], "heli_params": [ 2.047, -0.133, 7.502, -10.234, 0.271, 49.010 ], "bp2_params": [ 0.334, -0.005, -0.522, -25.774, 3.596, 4.444 ], "groove_widths": [ 14.059, 13.174, null, null ], "simple_Rise": 7.678, "simple_Twist": 42.308, "simple_hRise": 7.456, "simple_hTwist": 43.106 }, { "index": 10, "nt1": "///E/11", "nt2": "///G/2010", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.334, -0.005, -0.522, -25.774, 3.596, 4.444 ], "step_params": [ 0.007, -0.465, 2.854, -7.727, 1.046, 28.251 ], "heli_params": [ -1.116, -1.469, 2.737, 2.094, 15.461, 29.286 ], "bp2_params": [ 0.400, -0.164, 0.372, -3.407, -6.074, 3.352 ], "groove_widths": [ 15.454, 14.496, 23.468, null ], "simple_Rise": 2.854, "simple_Twist": 27.728, "simple_hRise": 2.733, "simple_hTwist": 28.782 }, { "index": 11, "nt1": "///E/12", "nt2": "///G/2009", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.400, -0.164, 0.372, -3.407, -6.074, 3.352 ], "step_params": [ -1.959, -2.135, 3.044, 5.260, 7.730, 12.041 ], "heli_params": [ -11.993, 10.068, 0.656, 31.368, -21.344, 15.235 ], "bp2_params": [ 0.412, -0.042, -0.367, 9.126, -17.738, 6.170 ], "groove_widths": [ 17.302, null, 22.994, 22.960 ], "simple_Rise": 3.044, "simple_Twist": 12.402, "simple_hRise": 0.715, "simple_hTwist": 15.520 }, { "index": 12, "nt1": "///E/13", "nt2": "///F/1008", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, -0.042, -0.367, 9.126, -17.738, 6.170 ], "step_params": [ 0.284, -1.078, 3.191, -4.260, 10.869, 32.731 ], "heli_params": [ -3.343, -1.078, 2.653, 18.567, 7.277, 34.697 ], "bp2_params": [ 0.343, -0.083, -0.355, 10.867, -23.464, 9.065 ], "groove_widths": [ null, null, 23.248, 22.574 ], "simple_Rise": 3.191, "simple_Twist": 33.280, "simple_hRise": 2.664, "simple_hTwist": 35.213 }, { "index": 13, "nt1": "///E/14", "nt2": "///F/1007", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.083, -0.355, 10.867, -23.464, 9.065 ], "step_params": [ -0.804, -1.502, 3.649, 0.190, 15.743, 30.367 ], "heli_params": [ -5.085, 1.401, 2.577, 27.828, -0.335, 34.121 ], "bp2_params": [ 0.031, -0.090, -0.078, 0.416, 5.062, -0.068 ], "groove_widths": [ null, null, 20.471, 19.572 ], "simple_Rise": 3.649, "simple_Twist": 31.518, "simple_hRise": 2.623, "simple_hTwist": 35.142 }, { "index": 14, "nt1": "///E/15", "nt2": "///F/1006", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.090, -0.078, 0.416, 5.062, -0.068 ], "step_params": [ 0.707, 0.202, 2.893, 2.882, 3.492, 29.756 ], "heli_params": [ -0.252, -0.831, 2.950, 6.750, -5.572, 30.091 ], "bp2_params": [ -0.118, -0.039, 0.119, 23.907, 2.885, -2.120 ], "groove_widths": [ 18.834, null, 16.432, 14.190 ], "simple_Rise": 2.893, "simple_Twist": 30.406, "simple_hRise": 2.950, "simple_hTwist": 30.733 }, { "index": 15, "nt1": "///E/16", "nt2": "///F/1005", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.118, -0.039, 0.119, 23.907, 2.885, -2.120 ], "step_params": [ -0.444, 0.065, 5.980, -1.470, 45.408, 21.097 ], "heli_params": [ -6.363, 0.318, 2.669, 66.346, 2.148, 49.855 ], "bp2_params": [ 0.210, -0.021, 0.288, -25.865, -4.982, 2.970 ], "groove_widths": [ 19.043, 17.124, 16.611, 12.237 ], "simple_Rise": 5.980, "simple_Twist": 18.971, "simple_hRise": 2.447, "simple_hTwist": 49.039 }, { "index": 16, "nt1": "///E/17", "nt2": "///F/1004", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.210, -0.021, 0.288, -25.865, -4.982, 2.970 ], "step_params": [ 0.206, 0.660, 2.959, -0.510, 2.131, 32.568 ], "heli_params": [ 0.838, -0.448, 2.992, 3.794, 0.908, 32.640 ], "bp2_params": [ -0.069, -0.054, 0.008, -5.884, 2.157, 1.324 ], "groove_widths": [ 18.304, null, 17.749, null ], "simple_Rise": 2.959, "simple_Twist": 34.653, "simple_hRise": 2.990, "simple_hTwist": 34.720 }, { "index": 17, "nt1": "///E/18", "nt2": "///F/1003", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.054, 0.008, -5.884, 2.157, 1.324 ], "step_params": [ 0.278, 0.195, 3.165, -1.651, -0.731, 33.079 ], "heli_params": [ 0.460, -0.756, 3.142, -1.282, 2.897, 33.127 ], "bp2_params": [ 0.266, 0.309, 0.309, 1.904, -12.876, 9.170 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.165, "simple_Twist": 31.310, "simple_hRise": 3.141, "simple_hTwist": 31.360 }, { "index": 18, "nt1": "///E/19", "nt2": "///F/1002", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.266, 0.309, 0.309, 1.904, -12.876, 9.170 ], "step_params": [ 0.949, 1.144, 2.889, 7.768, -0.210, 37.445 ], "heli_params": [ 1.772, -0.558, 3.013, -0.323, -11.942, 38.215 ], "bp2_params": [ 0.119, 0.304, 0.100, 32.734, -0.656, 9.701 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.889, "simple_Twist": 38.198, "simple_hRise": 3.011, "simple_hTwist": 38.952 }, { "index": 19, "nt1": "///E/20", "nt2": "///F/1001", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCCGTAGGTAC", "strand2": "CGGCATCCATG", "bp_type": "|||||||||||", "helix_form": "BB.B......", "helical_rise": 3.143, "helical_rise_std": 1.180, "helical_radius": 10.359, "helical_radius_std": 1.576, "helical_axis": [ -0.945, -0.321, 0.063 ], "point1": [ 33.172, 54.762, 39.390 ], "point2": [ 3.812, 44.793, 41.354 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///G/2019", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, 0.273, -0.375, -5.467, 6.760, 2.743 ], "step_params": [ -0.481, 0.553, 3.026, -1.966, 0.811, 32.515 ], "heli_params": [ 0.854, 0.538, 3.062, 1.446, 3.507, 32.582 ], "bp2_params": [ 0.287, -0.081, 0.133, 9.758, -4.754, 3.683 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.026, "simple_Twist": 29.741, "simple_hRise": 3.065, "simple_hTwist": 29.815 }, { "index": 2, "nt1": "///E/3", "nt2": "///G/2018", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.287, -0.081, 0.133, 9.758, -4.754, 3.683 ], "step_params": [ 0.166, 0.562, 2.860, 6.959, 7.157, 26.989 ], "heli_params": [ -0.321, 1.078, 2.865, 14.711, -14.303, 28.744 ], "bp2_params": [ 0.362, 0.023, -0.277, 28.995, -8.663, 3.287 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.860, "simple_Twist": 27.112, "simple_hRise": 2.866, "simple_hTwist": 28.859 }, { "index": 3, "nt1": "///E/4", "nt2": "///G/2017", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.362, 0.023, -0.277, 28.995, -8.663, 3.287 ], "step_params": [ 0.385, 1.127, 5.681, -1.877, 52.278, 19.399 ], "heli_params": [ -5.231, -0.644, 3.091, 71.019, 2.550, 55.554 ], "bp2_params": [ -0.183, 0.027, -0.438, -25.787, -2.161, 1.151 ], "groove_widths": [ 19.443, null, 16.639, null ], "simple_Rise": 5.681, "simple_Twist": 21.841, "simple_hRise": 3.297, "simple_hTwist": 56.390 }, { "index": 4, "nt1": "///E/5", "nt2": "///G/2016", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, 0.027, -0.438, -25.787, -2.161, 1.151 ], "step_params": [ -1.182, -0.000, 2.726, -5.280, 3.878, 25.867 ], "heli_params": [ -0.882, 1.363, 2.876, 8.490, 11.561, 26.670 ], "bp2_params": [ -0.133, -0.004, 0.023, -0.380, 1.698, -1.265 ], "groove_widths": [ 18.865, 16.370, 17.312, 13.502 ], "simple_Rise": 2.726, "simple_Twist": 25.687, "simple_hRise": 2.876, "simple_hTwist": 26.496 }, { "index": 5, "nt1": "///E/6", "nt2": "///G/2015", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.004, 0.023, -0.380, 1.698, -1.265 ], "step_params": [ 0.939, -1.268, 3.231, -4.469, 14.328, 31.605 ], "heli_params": [ -4.051, -2.169, 2.309, 24.644, 7.686, 34.905 ], "bp2_params": [ -0.032, -0.201, 0.107, 1.237, -25.664, 7.792 ], "groove_widths": [ 17.156, 14.716, 18.569, 17.014 ], "simple_Rise": 3.231, "simple_Twist": 30.936, "simple_hRise": 2.286, "simple_hTwist": 34.304 }, { "index": 6, "nt1": "///E/7", "nt2": "///G/2014", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.201, 0.107, 1.237, -25.664, 7.792 ], "step_params": [ -0.965, -1.262, 3.244, -3.557, 9.576, 35.023 ], "heli_params": [ -3.291, 1.070, 2.892, 15.509, 5.761, 36.438 ], "bp2_params": [ -0.351, -0.189, 0.055, -2.125, -8.921, 1.280 ], "groove_widths": [ 16.731, 15.136, 22.276, 21.842 ], "simple_Rise": 3.244, "simple_Twist": 36.765, "simple_hRise": 2.914, "simple_hTwist": 38.110 }, { "index": 7, "nt1": "///E/8", "nt2": "///G/2013", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.351, -0.189, 0.055, -2.125, -8.921, 1.280 ], "step_params": [ 0.918, -1.590, 3.384, 3.896, 2.536, 27.077 ], "heli_params": [ -3.993, -0.944, 3.320, 5.365, -8.244, 27.466 ], "bp2_params": [ -0.110, -0.182, -0.041, -1.386, 1.159, 5.292 ], "groove_widths": [ 16.555, 15.950, 22.245, 22.194 ], "simple_Rise": 3.384, "simple_Twist": 25.877, "simple_hRise": 3.315, "simple_hTwist": 26.284 }, { "index": 8, "nt1": "///E/9", "nt2": "///G/2012", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, -0.182, -0.041, -1.386, 1.159, 5.292 ], "step_params": [ 0.533, -1.691, 3.280, 9.580, 0.443, 14.180 ], "heli_params": [ -5.981, 4.614, 2.976, 1.581, -34.164, 17.105 ], "bp2_params": [ -0.780, -0.005, -0.637, 17.586, 4.253, -0.317 ], "groove_widths": [ 15.064, null, 21.743, null ], "simple_Rise": 3.280, "simple_Twist": 17.751, "simple_hRise": 3.106, "simple_hTwist": 20.158 }, { "index": 9, "nt1": "///E/10", "nt2": "///G/2011", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.780, -0.005, -0.637, 17.586, 4.253, -0.317 ], "step_params": [ 0.077, 0.459, 7.678, -0.223, -8.452, 48.320 ], "heli_params": [ 2.047, -0.133, 7.502, -10.234, 0.271, 49.010 ], "bp2_params": [ 0.334, -0.005, -0.522, -25.774, 3.596, 4.444 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.678, "simple_Twist": 42.308, "simple_hRise": 7.456, "simple_hTwist": 43.106 }, { "index": 10, "nt1": "///E/11", "nt2": "///G/2010", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.334, -0.005, -0.522, -25.774, 3.596, 4.444 ], "step_params": [ 0.007, -0.465, 2.854, -7.727, 1.046, 28.251 ], "heli_params": [ -1.116, -1.469, 2.737, 2.094, 15.461, 29.286 ], "bp2_params": [ 0.400, -0.164, 0.372, -3.407, -6.074, 3.352 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.854, "simple_Twist": 27.728, "simple_hRise": 2.733, "simple_hTwist": 28.782 }, { "index": 11, "nt1": "///E/12", "nt2": "///G/2009", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "ACCGCACA", "strand2": "TGGCGTGT", "bp_type": "||||||||", "helix_form": "..B.BBB", "helical_rise": 2.985, "helical_rise_std": 1.027, "helical_radius": 9.931, "helical_radius_std": 1.009, "helical_axis": [ -0.840, 0.542, 0.025 ], "point1": [ -4.442, 49.413, 38.620 ], "point2": [ -21.694, 60.547, 39.142 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///E/13", "nt2": "///F/1008", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.412, -0.042, -0.367, 9.126, -17.738, 6.170 ], "step_params": [ 0.284, -1.078, 3.191, -4.260, 10.869, 32.731 ], "heli_params": [ -3.343, -1.078, 2.653, 18.567, 7.277, 34.697 ], "bp2_params": [ 0.343, -0.083, -0.355, 10.867, -23.464, 9.065 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.191, "simple_Twist": 33.280, "simple_hRise": 2.664, "simple_hTwist": 35.213 }, { "index": 2, "nt1": "///E/14", "nt2": "///F/1007", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.083, -0.355, 10.867, -23.464, 9.065 ], "step_params": [ -0.804, -1.502, 3.649, 0.190, 15.743, 30.367 ], "heli_params": [ -5.085, 1.401, 2.577, 27.828, -0.335, 34.121 ], "bp2_params": [ 0.031, -0.090, -0.078, 0.416, 5.062, -0.068 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.649, "simple_Twist": 31.518, "simple_hRise": 2.623, "simple_hTwist": 35.142 }, { "index": 3, "nt1": "///E/15", "nt2": "///F/1006", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.090, -0.078, 0.416, 5.062, -0.068 ], "step_params": [ 0.707, 0.202, 2.893, 2.882, 3.492, 29.756 ], "heli_params": [ -0.252, -0.831, 2.950, 6.750, -5.572, 30.091 ], "bp2_params": [ -0.118, -0.039, 0.119, 23.907, 2.885, -2.120 ], "groove_widths": [ 18.834, null, 16.432, null ], "simple_Rise": 2.893, "simple_Twist": 30.406, "simple_hRise": 2.950, "simple_hTwist": 30.733 }, { "index": 4, "nt1": "///E/16", "nt2": "///F/1005", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.118, -0.039, 0.119, 23.907, 2.885, -2.120 ], "step_params": [ -0.444, 0.065, 5.980, -1.470, 45.408, 21.097 ], "heli_params": [ -6.363, 0.318, 2.669, 66.346, 2.148, 49.855 ], "bp2_params": [ 0.210, -0.021, 0.288, -25.865, -4.982, 2.970 ], "groove_widths": [ 19.043, 17.124, 16.611, 12.237 ], "simple_Rise": 5.980, "simple_Twist": 18.971, "simple_hRise": 2.447, "simple_hTwist": 49.039 }, { "index": 5, "nt1": "///E/17", "nt2": "///F/1004", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.210, -0.021, 0.288, -25.865, -4.982, 2.970 ], "step_params": [ 0.206, 0.660, 2.959, -0.510, 2.131, 32.568 ], "heli_params": [ 0.838, -0.448, 2.992, 3.794, 0.908, 32.640 ], "bp2_params": [ -0.069, -0.054, 0.008, -5.884, 2.157, 1.324 ], "groove_widths": [ 18.304, null, 17.749, null ], "simple_Rise": 2.959, "simple_Twist": 34.653, "simple_hRise": 2.990, "simple_hTwist": 34.720 }, { "index": 6, "nt1": "///E/18", "nt2": "///F/1003", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.054, 0.008, -5.884, 2.157, 1.324 ], "step_params": [ 0.278, 0.195, 3.165, -1.651, -0.731, 33.079 ], "heli_params": [ 0.460, -0.756, 3.142, -1.282, 2.897, 33.127 ], "bp2_params": [ 0.266, 0.309, 0.309, 1.904, -12.876, 9.170 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.165, "simple_Twist": 31.310, "simple_hRise": 3.141, "simple_hTwist": 31.360 }, { "index": 7, "nt1": "///E/19", "nt2": "///F/1002", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.266, 0.309, 0.309, 1.904, -12.876, 9.170 ], "step_params": [ 0.949, 1.144, 2.889, 7.768, -0.210, 37.445 ], "heli_params": [ 1.772, -0.558, 3.013, -0.323, -11.942, 38.215 ], "bp2_params": [ 0.119, 0.304, 0.100, 32.734, -0.656, 9.701 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.889, "simple_Twist": 38.198, "simple_hRise": 3.011, "simple_hTwist": 38.952 }, { "index": 8, "nt1": "///E/20", "nt2": "///F/1001", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///E/1,///E/2" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///E/13,///G/2009" } ], "nonStack": { "num_nts": 1, "nts_short": "T", "nts_long": "///F/1001" }, "num_atom2bases": 4, "atom2bases": [ { "index": 1, "type": "other", "atom": "///E/101/N10", "nt": "///E/10", "vert_dist": 3.395 }, { "index": 2, "type": "other", "atom": "///E/101/O9", "nt": "///E/10", "vert_dist": 2.620 }, { "index": 3, "type": "sugar", "atom": "///G/2009/O4'", "nt": "///F/1008", "vert_dist": 3.291 }, { "index": 4, "type": "other", "atom": "///E/101/F1", "nt": "///G/2010", "vert_dist": 2.982 } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///E/1" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///G/2020" } ], "dbn": { "all_chains": { "num_nts": 40, "num_chars": 42, "bseq": "AGCCGTAGGTACACCGCACA&TGTGCGGT>ACCTACGGCT", "sstr": ".(((((((((((((((((((&))))))))&))))))))))).", "form": ".BB.B.AAA...AAB.BB.-&.BB.B.A-&....AA..BB--" }, "chain_E": { "num_nts": 20, "num_chars": 20, "bseq": "AGCCGTAGGTACACCGCACA", "sstr": ".(((((((((((((((((((", "form": ".BB.B.AAA...AAB.BB.-" }, "chain_F": { "num_nts": 8, "num_chars": 8, "bseq": "TGTGCGGT", "sstr": "))))))))", "form": ".BB.B.A-" }, "chain_G": { "num_nts": 12, "num_chars": 12, "bseq": "GTACCTACGGCT", "sstr": "))))))))))).", "form": "....AA..BB--" } }, "chains": { "chain_E": { "num_nts": 20, "bseq": "AGCCGTAGGTACACCGCACA", "sstr": ".(((((((((((((((((((", "form": ".BB.B.AAA...AAB.BB.-", "helical_rise": 2.933, "helical_rise_std": 1.396, "helical_axis": [ -0.959, -0.152, 0.240 ], "point1": [ 32.028, 52.952, 35.039 ], "point2": [ -21.033, 44.552, 48.337 ], "num_chars": 58, "suite": "A!!G!!C!!C1bG!!T!!A1aG!!G!!T!!A!!C1cA1aC1bC2aG1bC!!A4nC1aA" }, "chain_F": { "num_nts": 8, "bseq": "TGTGCGGT", "sstr": "))))))))", "form": ".BB.B.A-", "helical_rise": 3.072, "helical_rise_std": 1.094, "helical_axis": [ 0.846, -0.520, -0.120 ], "point1": [ -20.843, 58.261, 39.537 ], "point2": [ -2.899, 47.240, 36.997 ], "num_chars": 22, "suite": "T!!G!!T!!G1bC!!G!!G1bT" }, "chain_G": { "num_nts": 12, "bseq": "GTACCTACGGCT", "sstr": "))))))))))).", "form": "....AA..BB--", "helical_rise": 3.728, "helical_rise_std": 1.227, "helical_axis": [ 0.981, 0.188, -0.049 ], "point1": [ 1.384, 45.669, 42.152 ], "point2": [ null, null, null ], "num_chars": 34, "suite": "G!!T!!A!!C!!C1aT1[A!!C1bG!!G!!C__T" } }, "num_nts": 40, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 70.476, "delta": 142.963, "epsilon": -177.141, "zeta": -78.072, "epsilon_zeta": -99.070, "bb_type": "BI", "chi": 58.232, "glyco_bond": "syn", "C5prime_xyz": [ -5.393, 4.016, 1.290 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -1.893, "Dp": 2.072, "splay_angle": 21.496, "splay_distance": 3.510, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -23.888, "v1": 37.164, "v2": -35.760, "v3": 22.812, "v4": 0.516, "amplitude": 37.913, "phase_angle": 160.601, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 35.743, 57.249, 37.226 ], "x_axis": [ 0.331, -0.697, -0.636 ], "y_axis": [ -0.739, 0.227, -0.634 ], "z_axis": [ 0.586, 0.680, -0.440 ], "quaternion": [ 0.529, -0.621, 0.578, 0.020 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -69.840, "beta": -179.165, "gamma": 59.776, "delta": 159.990, "epsilon": -116.254, "zeta": -164.497, "epsilon_zeta": 48.243, "bb_type": "BII", "chi": -80.256, "glyco_bond": "anti", "C5prime_xyz": [ -2.631, 7.456, -2.667 ], "P_xyz": [ -0.134, 8.253, -3.043 ], "form": "B", "ssZp": 0.711, "Dp": 0.819, "splay_angle": 19.426, "splay_distance": 3.311, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 179.794, "theta": -148.970, "eta_prime": -126.064, "theta_prime": -176.171, "eta_base": -119.987, "theta_base": -131.346, "v0": -17.442, "v1": 36.420, "v2": -40.756, "v3": 31.819, "v4": -9.091, "amplitude": 40.972, "phase_angle": 174.105, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 33.130, 55.230, 38.414 ], "x_axis": [ 0.091, 0.412, 0.907 ], "y_axis": [ -0.892, 0.438, -0.110 ], "z_axis": [ -0.442, -0.799, 0.408 ], "quaternion": [ 0.696, 0.248, -0.485, 0.469 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.688, "beta": 137.849, "gamma": 41.856, "delta": 110.513, "epsilon": -154.589, "zeta": -110.057, "epsilon_zeta": -44.532, "bb_type": "BI", "chi": -109.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.919, 8.230, -2.248 ], "P_xyz": [ -0.611, 9.185, -3.072 ], "form": "B", "ssZp": 2.124, "Dp": 2.696, "splay_angle": 15.317, "splay_distance": 2.732, "splay_ratio": 0.138, "d22": 4.378, "d64": 3.248, "eta": 166.422, "theta": -151.200, "eta_prime": 174.604, "theta_prime": -159.835, "eta_base": -140.947, "theta_base": -126.309, "v0": -35.486, "v1": 28.021, "v2": -10.783, "v3": -9.575, "v4": 28.346, "amplitude": 34.675, "phase_angle": 108.118, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 31.444, 52.494, 39.216 ], "x_axis": [ -0.449, 0.505, 0.737 ], "y_axis": [ -0.822, 0.091, -0.563 ], "z_axis": [ -0.351, -0.858, 0.374 ], "quaternion": [ 0.504, 0.147, -0.540, 0.658 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.959, "beta": 150.417, "gamma": 58.086, "delta": 90.189, "epsilon": -140.188, "zeta": -83.889, "epsilon_zeta": -56.299, "bb_type": "BI", "chi": -109.416, "glyco_bond": "anti", "C5prime_xyz": [ -3.046, 8.163, -2.255 ], "P_xyz": [ -0.890, 8.712, -3.688 ], "form": ".", "ssZp": 1.684, "Dp": 3.431, "splay_angle": 32.006, "splay_distance": 5.686, "splay_ratio": 0.279, "d22": null, "d64": null, "eta": 168.675, "theta": -134.551, "eta_prime": 179.684, "theta_prime": -129.841, "eta_base": -142.716, "theta_base": -116.678, "v0": -30.292, "v1": 10.291, "v2": 11.898, "v3": -29.801, "v4": 37.966, "amplitude": 37.161, "phase_angle": 71.327, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 29.701, 50.540, 39.997 ], "x_axis": [ -0.729, 0.566, 0.386 ], "y_axis": [ -0.653, -0.403, -0.641 ], "z_axis": [ -0.207, -0.719, 0.663 ], "quaternion": [ 0.364, 0.054, -0.407, 0.836 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.132, "beta": 171.204, "gamma": 46.858, "delta": 149.850, "epsilon": -97.943, "zeta": -173.404, "epsilon_zeta": 75.461, "bb_type": "BII", "chi": -98.576, "glyco_bond": "anti", "C5prime_xyz": [ -2.866, 8.069, -2.145 ], "P_xyz": [ -0.637, 9.493, -2.255 ], "form": "B", "ssZp": 0.910, "Dp": 0.972, "splay_angle": 18.396, "splay_distance": 3.183, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 178.673, "theta": -136.949, "eta_prime": -148.290, "theta_prime": -164.561, "eta_base": -137.856, "theta_base": -142.395, "v0": -30.013, "v1": 42.135, "v2": -37.708, "v3": 21.572, "v4": 5.049, "amplitude": 41.816, "phase_angle": 154.391, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.656, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 25.136, 47.871, 42.084 ], "x_axis": [ -0.228, 0.889, -0.398 ], "y_axis": [ -0.208, -0.444, -0.872 ], "z_axis": [ -0.951, -0.116, 0.286 ], "quaternion": [ 0.392, -0.482, -0.353, 0.700 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 66.515, "beta": -143.164, "gamma": -160.491, "delta": 137.094, "epsilon": -161.616, "zeta": -105.043, "epsilon_zeta": -56.574, "bb_type": "BI", "chi": -125.540, "glyco_bond": "anti", "C5prime_xyz": [ -2.245, 8.664, -1.048 ], "P_xyz": [ -1.098, 9.431, -3.292 ], "form": ".", "ssZp": 2.363, "Dp": 2.189, "splay_angle": 19.296, "splay_distance": 3.706, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 172.209, "theta": -158.062, "eta_prime": 175.625, "theta_prime": -174.737, "eta_base": -160.481, "theta_base": -123.551, "v0": -26.916, "v1": 35.909, "v2": -30.807, "v3": 15.839, "v4": 6.816, "amplitude": 35.421, "phase_angle": 150.427, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 22.773, 47.001, 44.032 ], "x_axis": [ -0.275, 0.618, -0.737 ], "y_axis": [ -0.217, -0.786, -0.579 ], "z_axis": [ -0.937, 0.001, 0.350 ], "quaternion": [ 0.269, -0.539, -0.186, 0.776 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 98.210, "beta": -157.148, "gamma": -158.491, "delta": 80.505, "epsilon": -146.912, "zeta": -80.091, "epsilon_zeta": -66.821, "bb_type": "BI", "chi": -164.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.681, 8.785, 0.708 ], "P_xyz": [ -1.091, 10.848, -0.871 ], "form": "A", "ssZp": 4.434, "Dp": 4.570, "splay_angle": 22.742, "splay_distance": 3.651, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 147.177, "theta": 168.229, "eta_prime": 155.198, "theta_prime": 179.532, "eta_base": -141.613, "theta_base": -153.857, "v0": -1.061, "v1": -23.427, "v2": 37.202, "v3": -38.952, "v4": 25.239, "amplitude": 39.606, "phase_angle": 20.067, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 19.488, 48.679, 44.388 ], "x_axis": [ -0.328, 0.036, -0.944 ], "y_axis": [ -0.014, -0.999, -0.034 ], "z_axis": [ -0.945, 0.002, 0.328 ], "quaternion": [ 0.015, -0.580, -0.010, 0.815 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -64.359, "beta": -178.264, "gamma": 36.329, "delta": 87.152, "epsilon": -157.677, "zeta": -78.085, "epsilon_zeta": -79.592, "bb_type": "BI", "chi": -154.064, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 8.749, 0.106 ], "P_xyz": [ 1.362, 9.254, 0.589 ], "form": "A", "ssZp": 4.286, "Dp": 4.581, "splay_angle": 22.134, "splay_distance": 3.871, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 163.661, "theta": -126.360, "eta_prime": 172.284, "theta_prime": -133.900, "eta_base": -157.417, "theta_base": -110.493, "v0": 5.677, "v1": -27.754, "v2": 37.672, "v3": -35.259, "v4": 18.724, "amplitude": 38.260, "phase_angle": 10.052, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.479, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 16.228, 50.067, 45.268 ], "x_axis": [ -0.002, -0.496, -0.868 ], "y_axis": [ 0.069, -0.866, 0.495 ], "z_axis": [ -0.998, -0.058, 0.036 ], "quaternion": [ -0.205, -0.676, 0.158, 0.690 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 106.381, "beta": -162.576, "gamma": -140.844, "delta": 95.670, "epsilon": -126.281, "zeta": -103.737, "epsilon_zeta": -22.544, "bb_type": "--", "chi": -164.041, "glyco_bond": "anti", "C5prime_xyz": [ -0.701, 8.135, 0.899 ], "P_xyz": [ 0.585, 10.221, 0.013 ], "form": "A", "ssZp": 4.459, "Dp": 4.738, "splay_angle": 19.869, "splay_distance": 3.398, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 171.879, "theta": -166.785, "eta_prime": -176.194, "theta_prime": -151.459, "eta_base": -135.429, "theta_base": -144.695, "v0": 19.956, "v1": -32.425, "v2": 32.032, "v3": -21.307, "v4": 0.943, "amplitude": 33.495, "phase_angle": 343.005, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 13.030, 50.323, 43.103 ], "x_axis": [ 0.124, -0.848, -0.515 ], "y_axis": [ -0.059, -0.524, 0.850 ], "z_axis": [ -0.991, -0.075, -0.115 ], "quaternion": [ 0.348, 0.664, -0.342, -0.567 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-acceptor,phosphate", "alpha": 0.253, "beta": 117.454, "gamma": 66.305, "delta": 106.957, "epsilon": -170.738, "zeta": -136.715, "epsilon_zeta": -34.023, "bb_type": "--", "chi": -137.894, "glyco_bond": "anti", "C5prime_xyz": [ -3.370, 8.667, -1.135 ], "P_xyz": [ -1.003, 9.784, -1.614 ], "form": ".", "ssZp": 2.653, "Dp": 2.615, "splay_angle": 50.349, "splay_distance": 7.754, "splay_ratio": 0.426, "d22": null, "d64": null, "eta": -175.018, "theta": -152.380, "eta_prime": -137.098, "theta_prime": -157.642, "eta_base": -130.289, "theta_base": -118.700, "v0": -45.481, "v1": 38.501, "v2": -16.872, "v3": -9.106, "v4": 33.963, "amplitude": 44.596, "phase_angle": 112.230, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 10.400, 50.815, 41.008 ], "x_axis": [ 0.120, -0.937, -0.328 ], "y_axis": [ -0.399, -0.348, 0.848 ], "z_axis": [ -0.909, 0.029, -0.415 ], "quaternion": [ 0.298, 0.686, -0.487, -0.451 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 60.185, "beta": 148.993, "gamma": -12.722, "delta": 154.957, "epsilon": 169.737, "zeta": -83.149, "epsilon_zeta": -107.114, "bb_type": "BI", "chi": -91.947, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 7.483, -2.257 ], "P_xyz": [ 0.654, 8.809, -1.480 ], "form": ".", "ssZp": 1.483, "Dp": 1.715, "splay_angle": 18.580, "splay_distance": 3.334, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -162.065, "theta": -127.434, "eta_prime": -140.735, "theta_prime": -156.899, "eta_base": -107.208, "theta_base": -124.633, "v0": 0.367, "v1": 20.836, "v2": -32.629, "v3": 33.563, "v4": -21.451, "amplitude": 34.506, "phase_angle": 198.983, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 2.836, 50.865, 39.301 ], "x_axis": [ -0.230, -0.862, 0.453 ], "y_axis": [ 0.055, 0.453, 0.890 ], "z_axis": [ -0.972, 0.230, -0.057 ], "quaternion": [ 0.540, 0.306, -0.659, -0.424 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -126.314, "beta": 150.972, "gamma": 125.304, "delta": 90.440, "epsilon": -157.556, "zeta": -92.748, "epsilon_zeta": -64.808, "bb_type": "BI", "chi": -153.632, "glyco_bond": "anti", "C5prime_xyz": [ -2.290, 9.040, -0.241 ], "P_xyz": [ -0.631, 10.229, -1.888 ], "form": ".", "ssZp": 3.254, "Dp": 3.442, "splay_angle": 20.814, "splay_distance": 3.859, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 177.914, "theta": -156.406, "eta_prime": -179.376, "theta_prime": -173.436, "eta_base": -138.069, "theta_base": -175.105, "v0": -27.161, "v1": 7.456, "v2": 13.406, "v3": -29.535, "v4": 35.748, "amplitude": 35.119, "phase_angle": 67.559, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -0.323, 51.168, 38.283 ], "x_axis": [ -0.310, -0.522, 0.794 ], "y_axis": [ 0.132, 0.804, 0.580 ], "z_axis": [ -0.942, 0.285, -0.181 ], "quaternion": [ 0.573, 0.129, -0.757, -0.285 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 118.612, "beta": -171.189, "gamma": -164.433, "delta": 86.096, "epsilon": -149.788, "zeta": -79.534, "epsilon_zeta": -70.254, "bb_type": "BI", "chi": -151.784, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.788, 0.006 ], "P_xyz": [ -1.053, 10.616, -1.844 ], "form": "A", "ssZp": 4.099, "Dp": 4.494, "splay_angle": 20.478, "splay_distance": 3.328, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 150.307, "theta": 172.155, "eta_prime": 155.068, "theta_prime": -177.359, "eta_base": 165.242, "theta_base": -139.158, "v0": -1.036, "v1": -21.663, "v2": 34.516, "v3": -35.946, "v4": 23.398, "amplitude": 36.737, "phase_angle": 20.025, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.072, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -2.707, 50.788, 35.271 ], "x_axis": [ -0.269, -0.338, 0.902 ], "y_axis": [ -0.020, 0.938, 0.346 ], "z_axis": [ -0.963, 0.076, -0.259 ], "quaternion": [ 0.594, 0.114, -0.785, -0.134 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.414, "beta": 160.334, "gamma": 51.744, "delta": 80.053, "epsilon": -150.905, "zeta": -74.537, "epsilon_zeta": -76.368, "bb_type": "BI", "chi": -157.378, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.881, 0.311 ], "P_xyz": [ 1.017, 9.337, 0.249 ], "form": "A", "ssZp": 4.308, "Dp": 4.527, "splay_angle": 25.479, "splay_distance": 4.146, "splay_ratio": 0.221, "d22": 4.535, "d64": 4.289, "eta": 164.820, "theta": -148.021, "eta_prime": -179.520, "theta_prime": -140.398, "eta_base": -133.072, "theta_base": -128.450, "v0": -4.072, "v1": -19.946, "v2": 34.706, "v3": -38.053, "v4": 26.542, "amplitude": 38.145, "phase_angle": 24.519, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -5.965, 50.120, 35.400 ], "x_axis": [ -0.074, 0.226, 0.971 ], "y_axis": [ 0.029, 0.974, -0.224 ], "z_axis": [ -0.997, 0.012, -0.079 ], "quaternion": [ 0.675, -0.088, -0.729, 0.073 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.977, "beta": -165.822, "gamma": 54.098, "delta": 136.143, "epsilon": -145.475, "zeta": -89.149, "epsilon_zeta": -56.326, "bb_type": "BI", "chi": -123.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.710, 8.622, -1.157 ], "P_xyz": [ 0.596, 9.510, -0.230 ], "form": "B", "ssZp": 1.926, "Dp": 1.987, "splay_angle": 17.532, "splay_distance": 3.068, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": -171.673, "theta": -112.353, "eta_prime": -151.765, "theta_prime": -126.027, "eta_base": -138.108, "theta_base": -94.210, "v0": -18.148, "v1": 28.399, "v2": -27.520, "v3": 17.434, "v4": 0.367, "amplitude": 29.140, "phase_angle": 160.809, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.702, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -9.946, 49.136, 36.010 ], "x_axis": [ 0.461, 0.552, 0.695 ], "y_axis": [ -0.037, 0.795, -0.606 ], "z_axis": [ -0.887, 0.253, 0.387 ], "quaternion": [ 0.813, -0.264, -0.487, 0.181 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -78.564, "beta": 158.942, "gamma": 55.082, "delta": 94.679, "epsilon": -157.831, "zeta": -84.784, "epsilon_zeta": -73.047, "bb_type": "BI", "chi": -110.431, "glyco_bond": "anti", "C5prime_xyz": [ -3.262, 8.185, -2.163 ], "P_xyz": [ -1.281, 9.295, -3.506 ], "form": ".", "ssZp": 2.151, "Dp": 3.030, "splay_angle": 33.980, "splay_distance": 6.045, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 152.550, "theta": -149.991, "eta_prime": 177.824, "theta_prime": -148.415, "eta_base": -140.799, "theta_base": -128.683, "v0": -35.038, "v1": 18.736, "v2": 3.281, "v3": -23.846, "v4": 37.256, "amplitude": 37.470, "phase_angle": 84.976, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "2a", "suiteness": 0.034, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -12.366, 50.466, 37.348 ], "x_axis": [ 0.419, 0.857, 0.299 ], "y_axis": [ -0.462, 0.485, -0.743 ], "z_axis": [ -0.782, 0.173, 0.599 ], "quaternion": [ 0.791, -0.290, -0.342, 0.417 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.033, "beta": -177.297, "gamma": 41.083, "delta": 124.934, "epsilon": -174.508, "zeta": -98.075, "epsilon_zeta": -76.433, "bb_type": "BI", "chi": -112.688, "glyco_bond": "anti", "C5prime_xyz": [ -2.238, 8.442, -1.978 ], "P_xyz": [ -0.206, 10.099, -1.702 ], "form": "B", "ssZp": 1.787, "Dp": 2.113, "splay_angle": 17.134, "splay_distance": 2.897, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 171.784, "theta": -153.300, "eta_prime": -164.834, "theta_prime": -157.158, "eta_base": -143.292, "theta_base": -118.442, "v0": -27.935, "v1": 32.254, "v2": -24.538, "v3": 8.786, "v4": 11.992, "amplitude": 32.037, "phase_angle": 139.988, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.076, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ -16.654, 53.887, 39.889 ], "x_axis": [ 0.747, 0.551, -0.371 ], "y_axis": [ -0.413, -0.053, -0.909 ], "z_axis": [ -0.521, 0.833, 0.188 ], "quaternion": [ 0.686, -0.635, -0.055, 0.351 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.535, "beta": 178.013, "gamma": 52.150, "delta": 142.583, "epsilon": -112.466, "zeta": -158.831, "epsilon_zeta": 46.365, "bb_type": "BII", "chi": -97.250, "glyco_bond": "anti", "C5prime_xyz": [ -2.791, 7.938, -2.304 ], "P_xyz": [ -0.564, 9.287, -2.641 ], "form": "B", "ssZp": 1.034, "Dp": 1.141, "splay_angle": 19.214, "splay_distance": 3.361, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -174.636, "theta": -141.531, "eta_prime": -154.705, "theta_prime": -172.730, "eta_base": -117.552, "theta_base": -118.199, "v0": -28.663, "v1": 39.361, "v2": -34.754, "v3": 19.068, "v4": 5.828, "amplitude": 39.047, "phase_angle": 152.879, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -18.127, 56.334, 40.372 ], "x_axis": [ 0.401, 0.465, -0.789 ], "y_axis": [ -0.822, -0.198, -0.534 ], "z_axis": [ -0.405, 0.863, 0.303 ], "quaternion": [ 0.614, -0.569, 0.157, 0.525 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 54.591, "beta": -120.556, "gamma": -156.466, "delta": 91.503, "epsilon": -134.739, "zeta": -86.622, "epsilon_zeta": -48.117, "bb_type": "BI", "chi": -151.530, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.825, 0.033 ], "P_xyz": [ -0.576, 9.803, -2.291 ], "form": ".", "ssZp": 3.806, "Dp": 4.342, "splay_angle": 17.714, "splay_distance": 3.144, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 161.708, "theta": 179.543, "eta_prime": 158.630, "theta_prime": -170.231, "eta_base": -138.857, "theta_base": -125.373, "v0": -0.490, "v1": -18.689, "v2": 29.452, "v3": -30.264, "v4": 19.515, "amplitude": 31.188, "phase_angle": 19.208, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.366, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -19.705, 59.223, 41.048 ], "x_axis": [ -0.237, 0.388, -0.891 ], "y_axis": [ -0.900, -0.434, 0.050 ], "z_axis": [ -0.367, 0.813, 0.452 ], "quaternion": [ 0.442, -0.432, 0.296, 0.728 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/20", "linked_nts": [ "///E/19", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -61.675, "beta": 168.411, "gamma": 43.695, "delta": 90.193, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -115.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.032, -2.002 ], "P_xyz": [ 1.170, 7.827, -2.827 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 10.979, "v1": -29.089, "v2": 35.051, "v3": -29.449, "v4": 11.728, "amplitude": 35.053, "phase_angle": 0.589, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.477, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -21.986, 61.307, 41.629 ], "x_axis": [ -0.726, 0.042, -0.686 ], "y_axis": [ -0.684, -0.149, 0.715 ], "z_axis": [ -0.072, 0.988, 0.137 ], "quaternion": [ 0.256, -0.267, 0.600, 0.709 ] } }, { "index": 21, "index_chain": 1, "chain_name": "F", "nt_resnum": 1001, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1001", "linked_nts": [ null, "///F/1002" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,non-stack,canonical,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 46.152, "delta": 139.764, "epsilon": -154.637, "zeta": -135.628, "epsilon_zeta": -19.009, "bb_type": "--", "chi": -126.825, "glyco_bond": "anti", "C5prime_xyz": [ -1.765, 8.623, -0.918 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.071, "Dp": 2.042, "splay_angle": 19.931, "splay_distance": 3.362, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -18.715, "v1": 30.695, "v2": -30.451, "v3": 20.170, "v4": -1.039, "amplitude": 31.799, "phase_angle": 163.253, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -21.668, 61.337, 41.507 ], "x_axis": [ -0.611, 0.100, -0.785 ], "y_axis": [ 0.638, 0.650, -0.414 ], "z_axis": [ 0.469, -0.754, -0.461 ], "quaternion": [ 0.380, 0.224, 0.825, -0.354 ] } }, { "index": 22, "index_chain": 2, "chain_name": "F", "nt_resnum": 1002, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1002", "linked_nts": [ "///F/1001", "///F/1003" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.628, "beta": 162.875, "gamma": 47.199, "delta": 151.457, "epsilon": -170.444, "zeta": -100.799, "epsilon_zeta": -69.646, "bb_type": "BI", "chi": -100.163, "glyco_bond": "anti", "C5prime_xyz": [ -1.763, 8.027, -2.051 ], "P_xyz": [ 0.834, 8.469, -1.770 ], "form": "B", "ssZp": 1.533, "Dp": 1.711, "splay_angle": 17.747, "splay_distance": 3.020, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 168.547, "theta": -117.121, "eta_prime": -159.376, "theta_prime": -145.974, "eta_base": -123.430, "theta_base": -115.867, "v0": -9.976, "v1": 28.615, "v2": -35.398, "v3": 30.356, "v4": -12.905, "amplitude": 35.430, "phase_angle": 182.455, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -19.269, 59.002, 41.198 ], "x_axis": [ -0.002, 0.265, -0.964 ], "y_axis": [ 0.906, 0.410, 0.110 ], "z_axis": [ 0.424, -0.873, -0.241 ], "quaternion": [ 0.540, 0.455, 0.643, -0.297 ] } }, { "index": 23, "index_chain": 3, "chain_name": "F", "nt_resnum": 1003, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1003", "linked_nts": [ "///F/1002", "///F/1004" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -82.352, "beta": 178.295, "gamma": 56.469, "delta": 129.549, "epsilon": -148.860, "zeta": -135.937, "epsilon_zeta": -12.923, "bb_type": "--", "chi": -99.245, "glyco_bond": "anti", "C5prime_xyz": [ -2.969, 7.987, -2.328 ], "P_xyz": [ -0.820, 9.373, -3.001 ], "form": "B", "ssZp": 1.931, "Dp": 2.101, "splay_angle": 18.283, "splay_distance": 3.185, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 163.913, "theta": -165.903, "eta_prime": -174.492, "theta_prime": -175.715, "eta_base": -138.066, "theta_base": -137.483, "v0": -31.325, "v1": 37.433, "v2": -29.107, "v3": 11.710, "v4": 12.164, "amplitude": 36.782, "phase_angle": 142.310, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -18.142, 56.352, 40.287 ], "x_axis": [ 0.406, 0.501, -0.764 ], "y_axis": [ 0.851, 0.098, 0.516 ], "z_axis": [ 0.334, -0.860, -0.386 ], "quaternion": [ 0.529, 0.651, 0.519, -0.165 ] } }, { "index": 24, "index_chain": 4, "chain_name": "F", "nt_resnum": 1004, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1004", "linked_nts": [ "///F/1003", "///F/1005" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -72.500, "beta": 150.485, "gamma": 51.806, "delta": 94.946, "epsilon": -146.673, "zeta": -71.678, "epsilon_zeta": -74.996, "bb_type": "BI", "chi": -120.135, "glyco_bond": "anti", "C5prime_xyz": [ -2.273, 8.442, -1.801 ], "P_xyz": [ 0.182, 8.618, -2.826 ], "form": ".", "ssZp": 2.535, "Dp": 4.091, "splay_angle": 33.946, "splay_distance": 5.957, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 161.448, "theta": -122.359, "eta_prime": 165.388, "theta_prime": -121.261, "eta_base": -151.790, "theta_base": -114.348, "v0": -13.245, "v1": -6.967, "v2": 22.807, "v3": -30.884, "v4": 27.898, "amplitude": 31.098, "phase_angle": 42.827, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -16.716, 53.539, 39.839 ], "x_axis": [ 0.805, 0.471, -0.360 ], "y_axis": [ 0.545, -0.351, 0.761 ], "z_axis": [ 0.232, -0.809, -0.540 ], "quaternion": [ 0.478, 0.821, 0.309, -0.039 ] } }, { "index": 25, "index_chain": 5, "chain_name": "F", "nt_resnum": 1005, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/1005", "linked_nts": [ "///F/1004", "///F/1006" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.836, "beta": -174.239, "gamma": 51.422, "delta": 144.290, "epsilon": -102.152, "zeta": -170.002, "epsilon_zeta": 67.849, "bb_type": "BII", "chi": -104.149, "glyco_bond": "anti", "C5prime_xyz": [ -2.933, 8.230, -2.028 ], "P_xyz": [ -0.908, 9.950, -1.892 ], "form": "B", "ssZp": 1.003, "Dp": 1.135, "splay_angle": 16.932, "splay_distance": 2.903, "splay_ratio": 0.147, "d22": null, "d64": null, "eta": -171.760, "theta": -141.274, "eta_prime": -141.602, "theta_prime": -164.916, "eta_base": -132.872, "theta_base": -134.891, "v0": -35.222, "v1": 44.335, "v2": -36.333, "v3": 17.162, "v4": 10.989, "amplitude": 43.458, "phase_angle": 146.725, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.649, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ -12.228, 50.556, 37.299 ], "x_axis": [ 0.364, 0.885, 0.289 ], "y_axis": [ 0.115, -0.351, 0.929 ], "z_axis": [ 0.924, -0.306, -0.229 ], "quaternion": [ 0.443, 0.697, 0.358, 0.435 ] } }, { "index": 26, "index_chain": 6, "chain_name": "F", "nt_resnum": 1006, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1006", "linked_nts": [ "///F/1005", "///F/1007" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 66.204, "beta": -147.213, "gamma": -159.612, "delta": 136.657, "epsilon": 176.798, "zeta": -80.159, "epsilon_zeta": -103.043, "bb_type": "BI", "chi": -130.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.693, 8.642, -0.811 ], "P_xyz": [ -0.466, 9.407, -3.001 ], "form": ".", "ssZp": 2.631, "Dp": 2.370, "splay_angle": 21.050, "splay_distance": 3.915, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 162.199, "theta": -150.845, "eta_prime": 171.627, "theta_prime": -172.010, "eta_base": -153.025, "theta_base": -129.399, "v0": -17.525, "v1": 27.804, "v2": -26.878, "v3": 17.228, "v4": 0.110, "amplitude": 28.398, "phase_angle": 161.170, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -10.033, 49.208, 35.961 ], "x_axis": [ 0.380, 0.573, 0.726 ], "y_axis": [ 0.031, -0.792, 0.609 ], "z_axis": [ 0.924, -0.209, -0.319 ], "quaternion": [ 0.259, 0.789, 0.191, 0.523 ] } }, { "index": 27, "index_chain": 7, "chain_name": "F", "nt_resnum": 1007, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/1007", "linked_nts": [ "///F/1006", "///F/1008" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 150.572, "beta": 172.364, "gamma": 164.764, "delta": 79.419, "epsilon": -161.680, "zeta": -67.324, "epsilon_zeta": -94.356, "bb_type": "BI", "chi": -169.253, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.744, 1.012 ], "P_xyz": [ -0.429, 10.706, -0.395 ], "form": "A", "ssZp": 4.578, "Dp": 4.563, "splay_angle": 21.730, "splay_distance": 3.433, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 141.275, "theta": 178.208, "eta_prime": 156.118, "theta_prime": -167.187, "eta_base": -144.164, "theta_base": -140.948, "v0": 0.737, "v1": -25.109, "v2": 38.367, "v3": -38.945, "v4": 24.069, "amplitude": 40.223, "phase_angle": 17.472, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -6.349, 50.204, 35.089 ], "x_axis": [ 0.306, 0.017, 0.952 ], "y_axis": [ -0.233, -0.968, 0.093 ], "z_axis": [ 0.923, -0.250, -0.292 ], "quaternion": [ 0.107, 0.801, -0.067, 0.585 ] } }, { "index": 28, "index_chain": 8, "chain_name": "F", "nt_resnum": 1008, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/1008", "linked_nts": [ "///F/1007", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-acceptor,phosphate", "alpha": -76.833, "beta": -170.109, "gamma": 77.078, "delta": 136.618, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -128.617, "glyco_bond": "anti", "C5prime_xyz": [ -1.935, 8.676, -0.887 ], "P_xyz": [ 0.631, 9.238, -0.498 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.431, "v1": 30.703, "v2": -27.878, "v3": 15.953, "v4": 3.360, "amplitude": 30.696, "phase_angle": 155.257, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.298, "filter_rmsd": 0.108, "frame": { "rmsd": 0.006, "origin": [ -3.021, 51.024, 34.882 ], "x_axis": [ 0.031, -0.463, 0.886 ], "y_axis": [ -0.125, -0.881, -0.456 ], "z_axis": [ 0.992, -0.097, -0.085 ], "quaternion": [ -0.127, 0.707, -0.208, 0.664 ] } }, { "index": 29, "index_chain": 1, "chain_name": "G", "nt_resnum": 2009, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/2009", "linked_nts": [ null, "///G/2010" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-donor", "alpha": null, "beta": null, "gamma": 56.877, "delta": 93.966, "epsilon": -145.442, "zeta": -106.147, "epsilon_zeta": -39.294, "bb_type": "BI", "chi": -159.334, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.655, 0.590 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.181, "Dp": 4.402, "splay_angle": 14.996, "splay_distance": 2.453, "splay_ratio": 0.131, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.633, "v1": -23.731, "v2": 30.744, "v3": -27.471, "v4": 13.246, "amplitude": 30.927, "phase_angle": 6.244, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 0.155, 51.436, 38.125 ], "x_axis": [ -0.214, -0.593, 0.776 ], "y_axis": [ -0.059, -0.785, -0.617 ], "z_axis": [ 0.975, -0.178, 0.133 ], "quaternion": [ -0.183, 0.600, -0.272, 0.730 ] } }, { "index": 30, "index_chain": 2, "chain_name": "G", "nt_resnum": 2010, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/2010", "linked_nts": [ "///G/2009", "///G/2011" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-acceptor,phosphate", "alpha": 139.929, "beta": -140.446, "gamma": -177.867, "delta": 128.853, "epsilon": -161.678, "zeta": -75.840, "epsilon_zeta": -85.838, "bb_type": "BI", "chi": -146.867, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.631, 0.169 ], "P_xyz": [ 0.550, 9.154, -1.490 ], "form": ".", "ssZp": 2.773, "Dp": 2.642, "splay_angle": 49.243, "splay_distance": 7.671, "splay_ratio": 0.420, "d22": null, "d64": null, "eta": 174.072, "theta": -148.389, "eta_prime": -158.156, "theta_prime": -147.477, "eta_base": -126.801, "theta_base": -112.997, "v0": -10.674, "v1": 18.076, "v2": -18.231, "v3": 12.250, "v4": -1.068, "amplitude": 18.908, "phase_angle": 164.622, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 2.428, 51.241, 39.026 ], "x_axis": [ -0.276, -0.887, 0.370 ], "y_axis": [ 0.389, -0.455, -0.801 ], "z_axis": [ 0.879, -0.077, 0.470 ], "quaternion": [ -0.430, 0.421, -0.296, 0.742 ] } }, { "index": 31, "index_chain": 3, "chain_name": "G", "nt_resnum": 2011, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/2011", "linked_nts": [ "///G/2010", "///G/2012" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.562, "beta": -141.963, "gamma": 62.217, "delta": 152.714, "epsilon": 176.916, "zeta": -99.631, "epsilon_zeta": -83.453, "bb_type": "BI", "chi": -95.370, "glyco_bond": "anti", "C5prime_xyz": [ -1.794, 7.738, -2.236 ], "P_xyz": [ 0.640, 8.448, -1.498 ], "form": ".", "ssZp": 1.800, "Dp": 1.902, "splay_angle": 21.546, "splay_distance": 4.082, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 178.720, "theta": -123.344, "eta_prime": -142.719, "theta_prime": -156.130, "eta_base": -111.419, "theta_base": -144.927, "v0": -8.648, "v1": 26.729, "v2": -33.624, "v3": 29.294, "v4": -13.077, "amplitude": 33.701, "phase_angle": 183.866, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 9.851, 50.089, 40.578 ], "x_axis": [ 0.047, -0.938, -0.343 ], "y_axis": [ 0.105, 0.346, -0.932 ], "z_axis": [ 0.993, 0.008, 0.115 ], "quaternion": [ 0.614, -0.383, 0.544, -0.425 ] } }, { "index": 32, "index_chain": 4, "chain_name": "G", "nt_resnum": 2012, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/2012", "linked_nts": [ "///G/2011", "///G/2013" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.432, "beta": 176.890, "gamma": 42.987, "delta": 86.902, "epsilon": 165.165, "zeta": -76.907, "epsilon_zeta": -117.928, "bb_type": "BI", "chi": -136.822, "glyco_bond": "anti", "C5prime_xyz": [ -2.879, 8.831, -1.130 ], "P_xyz": [ -1.163, 10.803, -1.422 ], "form": ".", "ssZp": 3.461, "Dp": 3.408, "splay_angle": 22.651, "splay_distance": 3.837, "splay_ratio": 0.198, "d22": 4.440, "d64": 4.712, "eta": 163.809, "theta": 179.011, "eta_prime": 168.362, "theta_prime": 174.930, "eta_base": -167.423, "theta_base": -157.015, "v0": -32.583, "v1": 11.199, "v2": 12.880, "v3": -32.477, "v4": 41.070, "amplitude": 40.240, "phase_angle": 71.331, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 12.990, 50.128, 43.187 ], "x_axis": [ 0.110, -0.798, -0.593 ], "y_axis": [ 0.072, 0.602, -0.796 ], "z_axis": [ 0.991, 0.044, 0.123 ], "quaternion": [ 0.677, -0.310, 0.585, -0.321 ] } }, { "index": 33, "index_chain": 5, "chain_name": "G", "nt_resnum": 2013, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/2013", "linked_nts": [ "///G/2012", "///G/2014" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -110.077, "beta": 169.530, "gamma": 100.599, "delta": 78.118, "epsilon": -140.969, "zeta": -70.508, "epsilon_zeta": -70.461, "bb_type": "BI", "chi": -170.359, "glyco_bond": "anti", "C5prime_xyz": [ -1.836, 8.854, 0.988 ], "P_xyz": [ 0.523, 9.914, 0.461 ], "form": "A", "ssZp": 4.394, "Dp": 4.495, "splay_angle": 21.658, "splay_distance": 3.576, "splay_ratio": 0.190, "d22": 4.102, "d64": 4.124, "eta": 170.556, "theta": -143.990, "eta_prime": 174.607, "theta_prime": -145.482, "eta_base": -149.432, "theta_base": -108.474, "v0": -7.091, "v1": -17.870, "v2": 34.352, "v3": -39.450, "v4": 29.242, "amplitude": 39.168, "phase_angle": 28.713, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 16.319, 49.738, 45.055 ], "x_axis": [ 0.151, -0.464, -0.873 ], "y_axis": [ -0.033, 0.880, -0.474 ], "z_axis": [ 0.988, 0.101, 0.118 ], "quaternion": [ 0.733, -0.196, 0.635, -0.147 ] } }, { "index": 34, "index_chain": 6, "chain_name": "G", "nt_resnum": 2014, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/2014", "linked_nts": [ "///G/2013", "///G/2015" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -72.997, "beta": 164.969, "gamma": 63.639, "delta": 75.891, "epsilon": -168.742, "zeta": -65.425, "epsilon_zeta": -103.317, "bb_type": "BI", "chi": -162.078, "glyco_bond": "anti", "C5prime_xyz": [ -1.883, 8.854, 0.510 ], "P_xyz": [ 0.592, 9.666, 0.155 ], "form": "A", "ssZp": 4.480, "Dp": 4.501, "splay_angle": 22.342, "splay_distance": 3.489, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 157.622, "theta": -156.645, "eta_prime": 178.699, "theta_prime": -147.412, "eta_base": -124.706, "theta_base": -135.154, "v0": -5.840, "v1": -21.331, "v2": 38.407, "v3": -43.044, "v4": 30.791, "amplitude": 42.830, "phase_angle": 26.270, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.740, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 19.585, 48.481, 44.324 ], "x_axis": [ 0.116, 0.165, -0.979 ], "y_axis": [ 0.007, 0.986, 0.167 ], "z_axis": [ 0.993, -0.026, 0.113 ], "quaternion": [ 0.744, 0.065, 0.663, 0.053 ] } }, { "index": 35, "index_chain": 7, "chain_name": "G", "nt_resnum": 2015, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/2015", "linked_nts": [ "///G/2014", "///G/2016" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -77.553, "beta": -148.095, "gamma": 63.501, "delta": 145.222, "epsilon": -151.522, "zeta": -90.915, "epsilon_zeta": -60.607, "bb_type": "BI", "chi": -108.238, "glyco_bond": "anti", "C5prime_xyz": [ -1.849, 8.233, -1.775 ], "P_xyz": [ 0.498, 9.085, -0.912 ], "form": ".", "ssZp": 1.618, "Dp": 1.753, "splay_angle": 15.458, "splay_distance": 2.765, "splay_ratio": 0.136, "d22": null, "d64": null, "eta": -171.613, "theta": -102.911, "eta_prime": -150.070, "theta_prime": -124.529, "eta_base": -138.578, "theta_base": -86.184, "v0": -15.900, "v1": 30.010, "v2": -32.098, "v3": 23.472, "v4": -4.901, "amplitude": 32.600, "phase_angle": 169.933, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.404, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 22.755, 47.079, 43.923 ], "x_axis": [ -0.307, 0.600, -0.738 ], "y_axis": [ 0.217, 0.800, 0.560 ], "z_axis": [ 0.927, 0.012, -0.376 ], "quaternion": [ 0.528, 0.259, 0.788, 0.182 ] } }, { "index": 36, "index_chain": 8, "chain_name": "G", "nt_resnum": 2016, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/2016", "linked_nts": [ "///G/2015", "///G/2017" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.204, "beta": 154.582, "gamma": 33.427, "delta": 86.846, "epsilon": -168.766, "zeta": -85.412, "epsilon_zeta": -83.354, "bb_type": "BI", "chi": -101.527, "glyco_bond": "anti", "C5prime_xyz": [ -3.782, 7.815, -2.356 ], "P_xyz": [ -2.342, 9.277, -4.005 ], "form": ".", "ssZp": 1.993, "Dp": 3.164, "splay_angle": 34.371, "splay_distance": 5.950, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 148.823, "theta": -169.932, "eta_prime": 171.859, "theta_prime": -159.056, "eta_base": -139.684, "theta_base": -140.028, "v0": -37.665, "v1": 17.429, "v2": 7.930, "v3": -30.324, "v4": 42.941, "amplitude": 42.454, "phase_angle": 79.235, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 24.722, 48.046, 42.237 ], "x_axis": [ -0.187, 0.897, -0.400 ], "y_axis": [ 0.607, 0.426, 0.671 ], "z_axis": [ 0.773, -0.117, -0.624 ], "quaternion": [ 0.392, 0.503, 0.748, 0.185 ] } }, { "index": 37, "index_chain": 9, "chain_name": "G", "nt_resnum": 2017, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/2017", "linked_nts": [ "///G/2016", "///G/2018" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.826, "beta": -162.134, "gamma": 49.740, "delta": 135.584, "epsilon": 174.901, "zeta": -88.182, "epsilon_zeta": -96.918, "bb_type": "BI", "chi": -93.484, "glyco_bond": "anti", "C5prime_xyz": [ -2.011, 7.844, -2.479 ], "P_xyz": [ 0.236, 9.170, -2.249 ], "form": "B", "ssZp": 1.221, "Dp": 1.632, "splay_angle": 18.017, "splay_distance": 3.117, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 175.077, "theta": -138.648, "eta_prime": -159.632, "theta_prime": -154.631, "eta_base": -144.682, "theta_base": -120.016, "v0": -13.302, "v1": 26.601, "v2": -29.262, "v3": 22.064, "v4": -5.671, "amplitude": 29.528, "phase_angle": 172.306, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.433, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 29.847, 50.108, 40.026 ], "x_axis": [ -0.633, 0.689, 0.353 ], "y_axis": [ 0.482, -0.007, 0.876 ], "z_axis": [ 0.606, 0.725, -0.327 ], "quaternion": [ 0.090, 0.419, 0.699, 0.573 ] } }, { "index": 38, "index_chain": 10, "chain_name": "G", "nt_resnum": 2018, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/2018", "linked_nts": [ "///G/2017", "///G/2019" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.915, "beta": -173.529, "gamma": 45.882, "delta": 140.216, "epsilon": -145.997, "zeta": -155.639, "epsilon_zeta": 9.642, "bb_type": "--", "chi": -94.809, "glyco_bond": "anti", "C5prime_xyz": [ -2.932, 7.906, -2.433 ], "P_xyz": [ -0.959, 9.619, -2.799 ], "form": "B", "ssZp": 1.719, "Dp": 1.843, "splay_angle": 17.315, "splay_distance": 2.947, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 169.865, "theta": -155.842, "eta_prime": -169.263, "theta_prime": -161.789, "eta_base": -132.907, "theta_base": -115.225, "v0": -30.471, "v1": 39.615, "v2": -33.317, "v3": 16.548, "v4": 8.526, "amplitude": 38.944, "phase_angle": 148.815, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 31.554, 52.464, 38.910 ], "x_axis": [ -0.361, 0.562, 0.744 ], "y_axis": [ 0.773, -0.265, 0.576 ], "z_axis": [ 0.521, 0.783, -0.338 ], "quaternion": [ -0.093, 0.557, 0.599, 0.568 ] } }, { "index": 39, "index_chain": 11, "chain_name": "G", "nt_resnum": 2019, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/2019", "linked_nts": [ "///G/2018", "///G/2020" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -17.665, "beta": 126.751, "gamma": 24.842, "delta": 126.056, "epsilon": -141.902, "zeta": -37.464, "epsilon_zeta": -104.438, "bb_type": "BI", "chi": -94.799, "glyco_bond": "anti", "C5prime_xyz": [ -3.372, 7.857, -2.413 ], "P_xyz": [ -1.119, 9.191, -2.848 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 173.478, "theta": -29.624, "eta_prime": -168.616, "theta_prime": null, "eta_base": -121.703, "theta_base": null, "v0": -36.475, "v1": 39.412, "v2": -27.331, "v3": 7.038, "v4": 18.212, "amplitude": 39.335, "phase_angle": 134.015, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 33.244, 54.874, 38.755 ], "x_axis": [ 0.087, 0.294, 0.952 ], "y_axis": [ 0.927, -0.375, 0.031 ], "z_axis": [ 0.366, 0.880, -0.304 ], "quaternion": [ -0.319, 0.664, 0.459, 0.496 ] } }, { "index": 40, "index_chain": 12, "chain_name": "G", "nt_resnum": 2020, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/2020", "linked_nts": [ "///G/2019", null ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,ss-non-loop", "alpha": 102.597, "beta": -153.829, "gamma": null, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": null, "v1": null, "v2": null, "v3": null, "v4": null, "amplitude": null, "phase_angle": null, "puckering": "", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": null } ], "num_hbonds": 1627, "hbonds": [ { "index": 1, "atom1_serNum": 25, "atom2_serNum": 330, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/419/N", "atom2_id": "///B/454/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 28, "atom2_serNum": 280, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/419/O", "atom2_id": "///B/447/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 28, "atom2_serNum": 327, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/419/O", "atom2_id": "///B/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 36, "atom2_serNum": 38, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///B/420/OD1", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 36, "atom2_serNum": 728, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///B/420/OD1", "atom2_id": "///B/500/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 37, "atom2_serNum": 716, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/420/OD2", "atom2_id": "///B/499/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 41, "atom2_serNum": 64, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///B/421/O", "atom2_id": "///B/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 44, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/422/N", "atom2_id": "///B/449/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 50, "atom2_serNum": 298, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/423/N", "atom2_id": "///B/450/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 55, "atom2_serNum": 65, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///B/423/OG", "atom2_id": "///B/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 55, "atom2_serNum": 104, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///B/423/OG", "atom2_id": "///B/428/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 68, "atom2_serNum": 96, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/425/O", "atom2_id": "///B/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 68, "atom2_serNum": 105, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///B/425/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 74, "atom2_serNum": 105, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/426/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 74, "atom2_serNum": 729, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/426/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 104, "atom2_serNum": 304, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/428/OE2", "atom2_id": "///B/450/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 108, "atom2_serNum": 729, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///B/429/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 108, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///B/429/O", "atom2_id": "///B/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 111, "atom2_serNum": 309, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/430/N", "atom2_id": "///B/451/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 114, "atom2_serNum": 322, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/430/O", "atom2_id": "///B/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 118, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///B/430/OE1", "atom2_id": "///B/601/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 119, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/430/OE2", "atom2_id": "///B/452/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 119, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/430/OE2", "atom2_id": "///B/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 120, "atom2_serNum": 742, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/431/N", "atom2_id": "///B/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 123, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/431/O", "atom2_id": "///B/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 128, "atom2_serNum": 325, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/432/N", "atom2_id": "///B/453/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 131, "atom2_serNum": 335, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/432/O", "atom2_id": "///B/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 139, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/433/N", "atom2_id": "///B/504/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 142, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/433/O", "atom2_id": "///B/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 147, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/434/N", "atom2_id": "///B/455/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 153, "atom2_serNum": 350, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///B/434/O", "atom2_id": "///B/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 167, "atom2_serNum": 388, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/435/O", "atom2_id": "///B/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 175, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/435/OE1", "atom2_id": "///B/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 177, "atom2_serNum": 11798, "donAcc_type": "questionable", "distance": 3.076, "atom1_id": "///B/435/OE2", "atom2_id": "///E/8/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 35, "atom1_serNum": 185, "atom2_serNum": 214, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/436/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 193, "atom2_serNum": 218, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/437/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 193, "atom2_serNum": 8265, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///B/437/O", "atom2_id": "///C/109/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 203, "atom2_serNum": 11872, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///B/438/N", "atom2_id": "///E/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 39, "atom1_serNum": 206, "atom2_serNum": 8265, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/438/O", "atom2_id": "///C/109/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 208, "atom2_serNum": 8337, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///B/438/OG", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 208, "atom2_serNum": 11872, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///B/438/OG", "atom2_id": "///E/10/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 42, "atom1_serNum": 212, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/439/O", "atom2_id": "///B/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 212, "atom2_serNum": 238, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///B/439/O", "atom2_id": "///B/443/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 217, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/440/O", "atom2_id": "///B/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 221, "atom2_serNum": 260, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/441/O", "atom2_id": "///B/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 225, "atom2_serNum": 266, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/442/O", "atom2_id": "///B/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 227, "atom2_serNum": 1171, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///B/442/OG", "atom2_id": "///B/583/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 227, "atom2_serNum": 1210, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///B/442/OG", "atom2_id": "///B/586/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 234, "atom2_serNum": 270, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/443/O", "atom2_id": "///B/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 248, "atom2_serNum": 277, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///B/444/O", "atom2_id": "///B/447/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 258, "atom2_serNum": 8310, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/444/NZ", "atom2_id": "///C/114/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 258, "atom2_serNum": 8322, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///B/444/NZ", "atom2_id": "///C/116/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 269, "atom2_serNum": 9820, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///B/446/O", "atom2_id": "///C/299/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 269, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/446/O", "atom2_id": "///C/299/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 273, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/447/O", "atom2_id": "///C/299/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 280, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/447/NH2", "atom2_id": "///B/452/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 281, "atom2_serNum": 320, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/448/N", "atom2_id": "///B/452/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 284, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/448/O", "atom2_id": "///B/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 284, "atom2_serNum": 313, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/448/O", "atom2_id": "///B/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 287, "atom2_serNum": 295, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/448/OD1", "atom2_id": "///B/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 294, "atom2_serNum": 9776, "donAcc_type": "acceptable", "distance": 3.769, "atom1_id": "///B/449/OG", "atom2_id": "///C/294/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 321, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/452/NE2", "atom2_id": "///B/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 356, "atom2_serNum": 388, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/457/O", "atom2_id": "///B/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 372, "atom2_serNum": 11820, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///B/458/O", "atom2_id": "///E/8/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 386, "atom2_serNum": 11916, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/458/NH2", "atom2_id": "///E/11/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 66, "atom1_serNum": 396, "atom2_serNum": 11822, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/460/N", "atom2_id": "///E/8/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 67, "atom1_serNum": 404, "atom2_serNum": 855, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/460/NZ", "atom2_id": "///B/512/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 404, "atom2_serNum": 872, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///B/460/NZ", "atom2_id": "///B/515/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 416, "atom2_serNum": 429, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///B/462/O", "atom2_id": "///B/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 421, "atom2_serNum": 12864, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///B/463/N", "atom2_id": "///G/2015/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 71, "atom1_serNum": 424, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/463/O", "atom2_id": "///B/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 424, "atom2_serNum": 454, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/463/O", "atom2_id": "///B/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 427, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/463/OD1", "atom2_id": "///B/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 428, "atom2_serNum": 1539, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/463/ND2", "atom2_id": "///B/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 428, "atom2_serNum": 12908, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///B/463/ND2", "atom2_id": "///G/2016/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 76, "atom1_serNum": 432, "atom2_serNum": 457, "donAcc_type": "questionable", "distance": 3.161, "atom1_id": "///B/464/O", "atom2_id": "///B/467/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 443, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/465/OE1", "atom2_id": "///B/526/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 444, "atom2_serNum": 974, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/465/OE2", "atom2_id": "///B/526/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 453, "atom2_serNum": 12908, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/466/NZ", "atom2_id": "///G/2016/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 80, "atom1_serNum": 453, "atom2_serNum": 12910, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/466/NZ", "atom2_id": "///G/2016/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 453, "atom2_serNum": 12946, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/466/NZ", "atom2_id": "///G/2017/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 82, "atom1_serNum": 462, "atom2_serNum": 494, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/468/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 462, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/468/O", "atom2_id": "///B/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 473, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/469/O", "atom2_id": "///B/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 478, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/470/N", "atom2_id": "///B/470/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 484, "atom2_serNum": 521, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/470/O", "atom2_id": "///B/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 484, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/470/O", "atom2_id": "///B/474/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 497, "atom2_serNum": 529, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///B/471/O", "atom2_id": "///B/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 504, "atom2_serNum": 12824, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/471/NH2", "atom2_id": "///G/2014/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 90, "atom1_serNum": 504, "atom2_serNum": 12826, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///B/471/NH2", "atom2_id": "///G/2014/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 91, "atom1_serNum": 508, "atom2_serNum": 529, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/472/O", "atom2_id": "///B/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 532, "atom2_serNum": 562, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/475/O", "atom2_id": "///B/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 535, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/475/OD1", "atom2_id": "///B/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 540, "atom2_serNum": 573, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/476/O", "atom2_id": "///B/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 543, "atom2_serNum": 571, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///B/476/OD1", "atom2_id": "///B/479/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 548, "atom2_serNum": 582, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///B/477/O", "atom2_id": "///B/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 557, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/478/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 565, "atom2_serNum": 598, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/479/O", "atom2_id": "///B/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 565, "atom2_serNum": 603, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///B/479/O", "atom2_id": "///B/483/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 576, "atom2_serNum": 605, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/480/O", "atom2_id": "///B/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 585, "atom2_serNum": 610, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/481/O", "atom2_id": "///B/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 593, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/482/O", "atom2_id": "///B/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 608, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/484/O", "atom2_id": "///B/499/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 613, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/485/O", "atom2_id": "///B/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 628, "atom2_serNum": 671, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/487/O", "atom2_id": "///B/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 630, "atom2_serNum": 635, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///B/487/OG1", "atom2_id": "///B/488/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 639, "atom2_serNum": 652, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/489/O", "atom2_id": "///B/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 644, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/490/N", "atom2_id": "///B/527/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 647, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/490/O", "atom2_id": "///B/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 674, "atom2_serNum": 692, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/494/O", "atom2_id": "///B/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 677, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/494/OD1", "atom2_id": "///B/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 682, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/495/O", "atom2_id": "///B/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 715, "atom2_serNum": 728, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///B/499/NH1", "atom2_id": "///B/500/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 748, "atom2_serNum": 1052, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/503/N", "atom2_id": "///B/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 751, "atom2_serNum": 1068, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/503/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 759, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///B/504/O", "atom2_id": "///B/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 763, "atom2_serNum": 1071, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/505/N", "atom2_id": "///B/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 766, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/505/O", "atom2_id": "///B/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 789, "atom2_serNum": 799, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///B/507/OG1", "atom2_id": "///B/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 789, "atom2_serNum": 893, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///B/507/OG1", "atom2_id": "///B/517/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 799, "atom2_serNum": 819, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/508/O", "atom2_id": "///B/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 805, "atom2_serNum": 1165, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/508/OD1", "atom2_id": "///B/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 807, "atom2_serNum": 11828, "donAcc_type": "questionable", "distance": 2.976, "atom1_id": "///B/508/OD2", "atom2_id": "///E/9/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 124, "atom1_serNum": 825, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/510/O", "atom2_id": "///B/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 825, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/510/O", "atom2_id": "///B/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 831, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/510/OD1", "atom2_id": "///B/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 833, "atom2_serNum": 1145, "donAcc_type": "questionable", "distance": 3.156, "atom1_id": "///B/510/OD2", "atom2_id": "///B/581/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 841, "atom2_serNum": 866, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/511/O", "atom2_id": "///B/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 852, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/512/O", "atom2_id": "///B/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 855, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/512/OD1", "atom2_id": "///A/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 856, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/512/OD2", "atom2_id": "///A/33/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 860, "atom2_serNum": 884, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/513/O", "atom2_id": "///B/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 864, "atom2_serNum": 895, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/514/O", "atom2_id": "///B/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 869, "atom2_serNum": 900, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///B/515/O", "atom2_id": "///B/518/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 869, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/515/O", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 875, "atom2_serNum": 12878, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/515/NE2", "atom2_id": "///G/2015/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 137, "atom1_serNum": 875, "atom2_serNum": 12906, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/515/NE2", "atom2_id": "///G/2016/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 138, "atom1_serNum": 879, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/516/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 887, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/517/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 891, "atom2_serNum": 1778, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///B/517/NE", "atom2_id": "///A/17/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 894, "atom2_serNum": 1812, "donAcc_type": "acceptable", "distance": 3.368, "atom1_id": "///B/517/NH2", "atom2_id": "///A/21/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 898, "atom2_serNum": 926, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/518/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 898, "atom2_serNum": 931, "donAcc_type": "acceptable", "distance": 2.627, "atom1_id": "///B/518/O", "atom2_id": "///B/522/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 905, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/519/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 913, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/520/O", "atom2_id": "///B/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 921, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/521/O", "atom2_id": "///B/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 929, "atom2_serNum": 967, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/522/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 936, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/523/O", "atom2_id": "///B/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 947, "atom2_serNum": 989, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/524/O", "atom2_id": "///B/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 947, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/524/O", "atom2_id": "///B/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 966, "atom2_serNum": 1435, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///B/525/OH", "atom2_id": "///B/611/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 966, "atom2_serNum": 1465, "donAcc_type": "acceptable", "distance": 2.481, "atom1_id": "///B/525/OH", "atom2_id": "///B/615/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 977, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///B/526/NH2", "atom2_id": "///B/615/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 992, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/528/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1000, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/529/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1000, "atom2_serNum": 1031, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/529/O", "atom2_id": "///B/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1011, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/530/O", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1018, "atom2_serNum": 1049, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/531/O", "atom2_id": "///B/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1026, "atom2_serNum": 1045, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/532/O", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1048, "atom2_serNum": 1079, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///B/535/O", "atom2_id": "///B/538/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1048, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/535/O", "atom2_id": "///B/605/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1064, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/537/O", "atom2_id": "///B/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1080, "atom2_serNum": 1368, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/539/N", "atom2_id": "///B/604/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1083, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/539/O", "atom2_id": "///B/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1100, "atom2_serNum": 1355, "donAcc_type": "questionable", "distance": 3.062, "atom1_id": "///B/541/OE1", "atom2_id": "///B/602/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1139, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///B/581/N", "atom2_id": "///B/585/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1155, "atom2_serNum": 1203, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///B/581/NZ", "atom2_id": "///B/585/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1155, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/581/NZ", "atom2_id": "///B/585/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1163, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/582/O", "atom2_id": "///B/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1171, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/583/O", "atom2_id": "///B/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1187, "atom2_serNum": 8258, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/584/O", "atom2_id": "///C/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1195, "atom2_serNum": 8253, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/585/O", "atom2_id": "///C/107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1215, "atom2_serNum": 1243, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/587/N", "atom2_id": "///B/590/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1218, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/587/O", "atom2_id": "///B/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1221, "atom2_serNum": 8254, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/587/OD1", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1226, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/588/O", "atom2_id": "///B/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1228, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/589/N", "atom2_id": "///B/589/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1231, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/589/O", "atom2_id": "///B/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1234, "atom2_serNum": 1236, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/589/OD1", "atom2_id": "///B/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1239, "atom2_serNum": 1276, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/590/O", "atom2_id": "///B/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1239, "atom2_serNum": 1281, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///B/590/O", "atom2_id": "///B/594/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1243, "atom2_serNum": 8253, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/590/OE1", "atom2_id": "///C/107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1248, "atom2_serNum": 1283, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/591/O", "atom2_id": "///B/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1248, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/591/O", "atom2_id": "///B/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1256, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/592/O", "atom2_id": "///B/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1256, "atom2_serNum": 1298, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///B/592/O", "atom2_id": "///B/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1274, "atom2_serNum": 1304, "donAcc_type": "questionable", "distance": 3.115, "atom1_id": "///B/593/OE1", "atom2_id": "///B/597/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1274, "atom2_serNum": 1337, "donAcc_type": "acceptable", "distance": 3.235, "atom1_id": "///B/593/OE1", "atom2_id": "///B/600/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1281, "atom2_serNum": 1288, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///B/594/OG1", "atom2_id": "///B/595/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1293, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/596/O", "atom2_id": "///B/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1293, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/596/O", "atom2_id": "///B/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1301, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/597/O", "atom2_id": "///B/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1301, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/597/O", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1373, "atom2_serNum": 1719, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/605/N", "atom2_id": "///A/10/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1376, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/605/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1389, "atom2_serNum": 1733, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/607/N", "atom2_id": "///A/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1392, "atom2_serNum": 1749, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/607/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1427, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/610/O", "atom2_id": "///B/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1430, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/610/OD1", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1430, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/610/OD1", "atom2_id": "///B/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1435, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/611/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1440, "atom2_serNum": 1467, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/612/O", "atom2_id": "///B/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1448, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/613/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1448, "atom2_serNum": 1481, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///B/613/O", "atom2_id": "///B/617/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1457, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/614/O", "atom2_id": "///B/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1462, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/615/O", "atom2_id": "///B/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1470, "atom2_serNum": 1512, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/616/O", "atom2_id": "///B/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1479, "atom2_serNum": 1528, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/617/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1486, "atom2_serNum": 1536, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/618/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1500, "atom2_serNum": 1544, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/619/O", "atom2_id": "///B/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1518, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///B/620/O", "atom2_id": "///B/629/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1547, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/623/O", "atom2_id": "///B/629/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1547, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/623/O", "atom2_id": "///B/629/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1551, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///B/624/O", "atom2_id": "///B/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1554, "atom2_serNum": 1556, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/624/OD1", "atom2_id": "///B/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1559, "atom2_serNum": 1587, "donAcc_type": "standard", "distance": 3.814, "atom1_id": "///B/625/O", "atom2_id": "///B/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1566, "atom2_serNum": 1587, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/626/O", "atom2_id": "///B/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1566, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/626/O", "atom2_id": "///B/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1573, "atom2_serNum": 1609, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/627/O", "atom2_id": "///B/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1577, "atom2_serNum": 1605, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/627/OE1", "atom2_id": "///B/630/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1578, "atom2_serNum": 1608, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/627/OE2", "atom2_id": "///B/630/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1582, "atom2_serNum": 1618, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/628/O", "atom2_id": "///B/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1590, "atom2_serNum": 1629, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/629/O", "atom2_id": "///B/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1594, "atom2_serNum": 12944, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/629/NE", "atom2_id": "///G/2017/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 225, "atom1_serNum": 1597, "atom2_serNum": 12946, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/629/NH2", "atom2_id": "///G/2017/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 226, "atom1_serNum": 1601, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/630/O", "atom2_id": "///B/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1612, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/631/O", "atom2_id": "///B/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1617, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/631/NE2", "atom2_id": "///B/634/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1617, "atom2_serNum": 1652, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/631/NE2", "atom2_id": "///B/635/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1621, "atom2_serNum": 1654, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/632/O", "atom2_id": "///B/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1621, "atom2_serNum": 1661, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/632/O", "atom2_id": "///B/636/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1632, "atom2_serNum": 1662, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/633/O", "atom2_id": "///B/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1657, "atom2_serNum": 1667, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/636/O", "atom2_id": "///B/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1660, "atom2_serNum": 1797, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///B/636/OD1", "atom2_id": "///A/19/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1673, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/638/O", "atom2_id": "///B/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1737, "atom2_serNum": 1777, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///A/12/NE", "atom2_id": "///A/17/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1739, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/12/NH1", "atom2_id": "///A/20/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1740, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/12/NH2", "atom2_id": "///A/20/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1744, "atom2_serNum": 1770, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1747, "atom2_serNum": 1764, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/13/OD1", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1752, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1760, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1767, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1773, "atom2_serNum": 1807, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1773, "atom2_serNum": 1812, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/17/O", "atom2_id": "///A/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1778, "atom2_serNum": 1812, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///A/17/OE2", "atom2_id": "///A/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1782, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1790, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1801, "atom2_serNum": 1832, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1810, "atom2_serNum": 1848, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1816, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1827, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1838, "atom2_serNum": 1881, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1851, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1863, "atom2_serNum": 1894, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1871, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1884, "atom2_serNum": 1909, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1890, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/29/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1941, "atom2_serNum": 4399, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/36/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1945, "atom2_serNum": 1986, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/37/N", "atom2_id": "///A/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1948, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1951, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/37/OD1", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1951, "atom2_serNum": 1967, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/37/OD1", "atom2_id": "///A/39/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1952, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/37/OD2", "atom2_id": "///A/39/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1953, "atom2_serNum": 4402, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/38/N", "atom2_id": "///A/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1974, "atom2_serNum": 3031, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/40/O", "atom2_id": "///A/166/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1977, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/40/OD1", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1977, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/40/OD1", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1977, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/40/OD1", "atom2_id": "///A/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1978, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/40/OD2", "atom2_id": "///A/47/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 1978, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/40/OD2", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1994, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1999, "atom2_serNum": 3073, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/43/NZ", "atom2_id": "///A/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 1999, "atom2_serNum": 11702, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/43/NZ", "atom2_id": "///E/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 275, "atom1_serNum": 2003, "atom2_serNum": 2035, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2010, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2017, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2023, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/46/NE2", "atom2_id": "///E/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 279, "atom1_serNum": 2027, "atom2_serNum": 2062, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2033, "atom2_serNum": 13104, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///A/47/NH1", "atom2_id": "///A/502/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 281, "atom1_serNum": 2038, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2042, "atom2_serNum": 2954, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/48/NE", "atom2_id": "///A/156/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2044, "atom2_serNum": 2329, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///A/48/NH1", "atom2_id": "///A/79/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2045, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/48/NH2", "atom2_id": "///A/156/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2049, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2057, "atom2_serNum": 2086, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2065, "atom2_serNum": 2094, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2077, "atom2_serNum": 2103, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2081, "atom2_serNum": 2125, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/53/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2089, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/54/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2102, "atom2_serNum": 13126, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///A/55/OE2", "atom2_id": "///A/505/O3", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 292, "atom1_serNum": 2119, "atom2_serNum": 2310, "donAcc_type": "questionable", "distance": 2.901, "atom1_id": "///A/56/NE2", "atom2_id": "///A/77/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2124, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/57/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2131, "atom2_serNum": 2712, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/58/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2144, "atom2_serNum": 2163, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/59/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2146, "atom2_serNum": 2161, "donAcc_type": "acceptable", "distance": 2.498, "atom1_id": "///A/59/OG1", "atom2_id": "///A/61/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2155, "atom2_serNum": 2161, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/61/N", "atom2_id": "///A/61/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2166, "atom2_serNum": 2710, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/62/O", "atom2_id": "///A/127/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2177, "atom2_serNum": 2206, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/63/OG", "atom2_id": "///A/65/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2189, "atom2_serNum": 2544, "donAcc_type": "acceptable", "distance": 2.686, "atom1_id": "///A/64/OH", "atom2_id": "///A/105/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2190, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/65/N", "atom2_id": "///A/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2196, "atom2_serNum": 2696, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/65/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2214, "atom2_serNum": 2237, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/66/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2214, "atom2_serNum": 2248, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2226, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/67/N", "atom2_id": "///A/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2229, "atom2_serNum": 2256, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2231, "atom2_serNum": 2685, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///A/67/OG", "atom2_id": "///A/124/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2235, "atom2_serNum": 2263, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2240, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2244, "atom2_serNum": 7974, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/69/NE", "atom2_id": "///C/73/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2251, "atom2_serNum": 2283, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2259, "atom2_serNum": 2290, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2266, "atom2_serNum": 2298, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2273, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2279, "atom2_serNum": 7942, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/73/OD1", "atom2_id": "///C/69/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2286, "atom2_serNum": 2311, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2286, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/74/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2293, "atom2_serNum": 2905, "donAcc_type": "acceptable", "distance": 3.746, "atom1_id": "///A/75/O", "atom2_id": "///A/150/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2301, "atom2_serNum": 2905, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///A/76/O", "atom2_id": "///A/150/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2305, "atom2_serNum": 2893, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/77/O", "atom2_id": "///A/149/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2326, "atom2_serNum": 2340, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/79/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2332, "atom2_serNum": 11744, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/79/NE2", "atom2_id": "///E/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 323, "atom1_serNum": 2346, "atom2_serNum": 11784, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///A/81/ND1", "atom2_id": "///E/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 324, "atom1_serNum": 2350, "atom2_serNum": 11786, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/82/N", "atom2_id": "///E/8/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 325, "atom1_serNum": 2353, "atom2_serNum": 2374, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2357, "atom2_serNum": 2382, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2365, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2371, "atom2_serNum": 2403, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2377, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2385, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2393, "atom2_serNum": 2632, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///A/87/OH", "atom2_id": "///A/119/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2393, "atom2_serNum": 2685, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///A/87/OH", "atom2_id": "///A/124/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2397, "atom2_serNum": 2423, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2406, "atom2_serNum": 2434, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2411, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2419, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/91/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2419, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2426, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/92/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2430, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/92/NE", "atom2_id": "///E/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 340, "atom1_serNum": 2432, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/92/NH1", "atom2_id": "///E/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 341, "atom1_serNum": 2437, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/93/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2437, "atom2_serNum": 2531, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/93/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2450, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/95/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2450, "atom2_serNum": 2481, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2454, "atom2_serNum": 2480, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/95/OE1", "atom2_id": "///A/98/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2455, "atom2_serNum": 2574, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/95/NE2", "atom2_id": "///A/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2462, "atom2_serNum": 2464, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/96/OD1", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2493, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/100/N", "atom2_id": "///A/170/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2496, "atom2_serNum": 2502, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/100/O", "atom2_id": "///A/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2502, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/100/NH1", "atom2_id": "///A/482/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2503, "atom2_serNum": 3404, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/100/NH2", "atom2_id": "///A/217/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2503, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/100/NH2", "atom2_id": "///A/482/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2503, "atom2_serNum": 5675, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/100/NH2", "atom2_id": "///A/483/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2504, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/101/N", "atom2_id": "///A/170/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2507, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/101/O", "atom2_id": "///A/170/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2515, "atom2_serNum": 3157, "donAcc_type": "acceptable", "distance": 3.951, "atom1_id": "///A/101/OH", "atom2_id": "///A/186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2515, "atom2_serNum": 3172, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///A/101/OH", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2515, "atom2_serNum": 5670, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///A/101/OH", "atom2_id": "///A/482/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2519, "atom2_serNum": 2725, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///A/102/O", "atom2_id": "///A/129/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2526, "atom2_serNum": 2749, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///A/103/O", "atom2_id": "///A/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2538, "atom2_serNum": 2704, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/105/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2541, "atom2_serNum": 2701, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/105/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2545, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/105/OD2", "atom2_id": "///A/127/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2545, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///A/105/OD2", "atom2_id": "///A/127/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2550, "atom2_serNum": 2690, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/107/N", "atom2_id": "///A/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2553, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/107/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2558, "atom2_serNum": 6947, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/107/NE2", "atom2_id": "///D/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2558, "atom2_serNum": 6995, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/107/NE2", "atom2_id": "///D/590/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2559, "atom2_serNum": 6973, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/108/N", "atom2_id": "///D/587/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2562, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/108/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2563, "atom2_serNum": 6939, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/109/N", "atom2_id": "///D/584/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2566, "atom2_serNum": 2629, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/109/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2569, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/109/OD1", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2570, "atom2_serNum": 5928, "donAcc_type": "standard", "distance": 3.856, "atom1_id": "///A/109/ND2", "atom2_id": "///D/437/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2570, "atom2_serNum": 5941, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/109/ND2", "atom2_id": "///D/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2586, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/112/N", "atom2_id": "///A/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2589, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/112/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2589, "atom2_serNum": 13098, "donAcc_type": "acceptable", "distance": 3.269, "atom1_id": "///A/112/O", "atom2_id": "///A/501/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 379, "atom1_serNum": 2591, "atom2_serNum": 2600, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/112/OG", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2591, "atom2_serNum": 2619, "donAcc_type": "acceptable", "distance": 2.661, "atom1_id": "///A/112/OG", "atom2_id": "///A/116/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2595, "atom2_serNum": 3838, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/113/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2606, "atom2_serNum": 3846, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/114/OD1", "atom2_id": "///A/270/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2634, "atom2_serNum": 5943, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///A/120/N", "atom2_id": "///D/438/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2637, "atom2_serNum": 2669, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2637, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 3.592, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2665, "atom2_serNum": 12589, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/122/NH1", "atom2_id": "///F/1008/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 387, "atom1_serNum": 2667, "atom2_serNum": 12587, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/122/NH2", "atom2_id": "///F/1008/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 388, "atom1_serNum": 2723, "atom2_serNum": 2751, "donAcc_type": "standard", "distance": 3.670, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2725, "atom2_serNum": 2749, "donAcc_type": "acceptable", "distance": 3.335, "atom1_id": "///A/129/OG1", "atom2_id": "///A/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2730, "atom2_serNum": 2751, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/130/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2739, "atom2_serNum": 2759, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/131/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2747, "atom2_serNum": 2768, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/132/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2747, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2754, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2762, "atom2_serNum": 2995, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/134/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2766, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/134/OE1", "atom2_id": "///A/479/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2766, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/134/OE1", "atom2_id": "///A/479/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2767, "atom2_serNum": 2793, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/134/OE2", "atom2_id": "///A/137/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2771, "atom2_serNum": 2990, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/135/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2779, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/136/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2798, "atom2_serNum": 2819, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/138/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2798, "atom2_serNum": 2841, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///A/138/O", "atom2_id": "///A/143/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 2801, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/138/OD1", "atom2_id": "///A/141/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 2802, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/138/OD2", "atom2_id": "///A/163/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 2802, "atom2_serNum": 4668, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/138/OD2", "atom2_id": "///A/366/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 2818, "atom2_serNum": 13126, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///A/140/ND2", "atom2_id": "///A/505/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 407, "atom1_serNum": 2831, "atom2_serNum": 4655, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/142/O", "atom2_id": "///A/365/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2834, "atom2_serNum": 4658, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/142/OD1", "atom2_id": "///A/365/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 2835, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/142/OD2", "atom2_id": "///A/372/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 2854, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/145/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 2854, "atom2_serNum": 2967, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///A/145/O", "atom2_id": "///A/158/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 2857, "atom2_serNum": 4657, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/145/OD1", "atom2_id": "///A/365/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 2857, "atom2_serNum": 4658, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/145/OD1", "atom2_id": "///A/365/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 2870, "atom2_serNum": 2949, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/147/N", "atom2_id": "///A/156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 2873, "atom2_serNum": 2946, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/147/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 2884, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/148/OD1", "atom2_id": "///A/155/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 2886, "atom2_serNum": 2929, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/149/N", "atom2_id": "///A/154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 2892, "atom2_serNum": 2914, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/149/OD1", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 2892, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/149/OD1", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 2892, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/149/OD1", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 2893, "atom2_serNum": 2912, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/149/ND2", "atom2_id": "///A/151/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 2912, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/151/OD1", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 2978, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/160/O", "atom2_id": "///A/358/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 2986, "atom2_serNum": 4606, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/161/O", "atom2_id": "///A/359/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 2993, "atom2_serNum": 4570, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///A/162/O", "atom2_id": "///A/355/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 2993, "atom2_serNum": 4606, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/162/O", "atom2_id": "///A/359/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 2998, "atom2_serNum": 4570, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///A/163/O", "atom2_id": "///A/355/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3002, "atom2_serNum": 4605, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/163/NE", "atom2_id": "///A/359/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3004, "atom2_serNum": 4668, "donAcc_type": "questionable", "distance": 3.368, "atom1_id": "///A/163/NH1", "atom2_id": "///A/366/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3004, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/163/NH1", "atom2_id": "///A/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3005, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/163/NH2", "atom2_id": "///A/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3009, "atom2_serNum": 3024, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/164/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3020, "atom2_serNum": 3048, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3027, "atom2_serNum": 3053, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3030, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/166/OD1", "atom2_id": "///A/170/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3035, "atom2_serNum": 3061, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3043, "atom2_serNum": 3154, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/168/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3043, "atom2_serNum": 3160, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///A/168/O", "atom2_id": "///A/186/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3051, "atom2_serNum": 3154, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/169/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3065, "atom2_serNum": 3135, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/172/N", "atom2_id": "///A/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3068, "atom2_serNum": 3132, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/172/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3076, "atom2_serNum": 3120, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/174/N", "atom2_id": "///A/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3079, "atom2_serNum": 3117, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/174/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3083, "atom2_serNum": 11694, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///A/175/O", "atom2_id": "///E/5/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 445, "atom1_serNum": 3088, "atom2_serNum": 3107, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/176/N", "atom2_id": "///A/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3100, "atom2_serNum": 12944, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/178/N", "atom2_id": "///G/2017/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 447, "atom1_serNum": 3122, "atom2_serNum": 4373, "donAcc_type": "acceptable", "distance": 3.189, "atom1_id": "///A/181/OG1", "atom2_id": "///A/334/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3122, "atom2_serNum": 4386, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///A/181/OG1", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3122, "atom2_serNum": 4389, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///A/181/OG1", "atom2_id": "///A/336/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3124, "atom2_serNum": 4373, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/182/N", "atom2_id": "///A/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3127, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/182/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3131, "atom2_serNum": 4362, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/182/ND2", "atom2_id": "///A/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3143, "atom2_serNum": 3160, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///A/184/O", "atom2_id": "///A/186/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3150, "atom2_serNum": 3397, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/185/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3163, "atom2_serNum": 3554, "donAcc_type": "acceptable", "distance": 2.639, "atom1_id": "///A/186/NE2", "atom2_id": "///A/234/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3167, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3170, "atom2_serNum": 3187, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/187/OD1", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3171, "atom2_serNum": 3404, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/187/ND2", "atom2_id": "///A/217/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3171, "atom2_serNum": 5667, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/187/ND2", "atom2_id": "///A/482/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3171, "atom2_serNum": 5675, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/187/ND2", "atom2_id": "///A/483/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3175, "atom2_serNum": 3204, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3183, "atom2_serNum": 3212, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3190, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3194, "atom2_serNum": 3368, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/190/OE1", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3194, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/190/OE1", "atom2_id": "///A/484/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3195, "atom2_serNum": 5687, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/190/OE2", "atom2_id": "///A/484/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3199, "atom2_serNum": 3224, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3207, "atom2_serNum": 3231, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3215, "atom2_serNum": 3239, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3215, "atom2_serNum": 3244, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///A/193/O", "atom2_id": "///A/197/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3218, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/193/OD1", "atom2_id": "///A/477/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3223, "atom2_serNum": 3245, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3227, "atom2_serNum": 3253, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3234, "atom2_serNum": 3258, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///A/196/O", "atom2_id": "///A/199/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3234, "atom2_serNum": 3259, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3242, "atom2_serNum": 3259, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/197/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3242, "atom2_serNum": 3268, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3244, "atom2_serNum": 3359, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///A/197/OG", "atom2_id": "///A/212/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3248, "atom2_serNum": 3268, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/198/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3256, "atom2_serNum": 5560, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/199/O", "atom2_id": "///A/470/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3258, "atom2_serNum": 5557, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///A/199/OG", "atom2_id": "///A/470/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3271, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/201/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3274, "atom2_serNum": 3283, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/201/OD1", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3279, "atom2_serNum": 4510, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/202/O", "atom2_id": "///A/349/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3294, "atom2_serNum": 4510, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/204/O", "atom2_id": "///A/349/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3299, "atom2_serNum": 3326, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/205/N", "atom2_id": "///A/208/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3302, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/205/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3304, "atom2_serNum": 3318, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///A/205/OG", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3308, "atom2_serNum": 3335, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/206/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3321, "atom2_serNum": 3343, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/208/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3330, "atom2_serNum": 3352, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/209/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3330, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3374, "atom2_serNum": 3475, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///A/214/O", "atom2_id": "///A/227/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3389, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/215/O", "atom2_id": "///A/484/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3393, "atom2_serNum": 5689, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/216/O", "atom2_id": "///A/484/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3403, "atom2_serNum": 5691, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/217/OD1", "atom2_id": "///A/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3403, "atom2_serNum": 5702, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/217/OD1", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3405, "atom2_serNum": 5707, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/218/N", "atom2_id": "///A/486/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3408, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/218/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3419, "atom2_serNum": 5700, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/219/O", "atom2_id": "///A/485/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3426, "atom2_serNum": 3435, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/220/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3433, "atom2_serNum": 5707, "donAcc_type": "acceptable", "distance": 2.749, "atom1_id": "///A/221/O", "atom2_id": "///A/486/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3435, "atom2_serNum": 3787, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/222/N", "atom2_id": "///A/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3438, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/222/O", "atom2_id": "///A/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3439, "atom2_serNum": 3633, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/223/N", "atom2_id": "///A/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3442, "atom2_serNum": 3630, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/223/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3447, "atom2_serNum": 5712, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/224/N", "atom2_id": "///A/487/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3450, "atom2_serNum": 5726, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/224/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3455, "atom2_serNum": 3616, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/225/N", "atom2_id": "///A/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3463, "atom2_serNum": 5729, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/226/N", "atom2_id": "///A/489/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3470, "atom2_serNum": 3494, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3479, "atom2_serNum": 3516, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3485, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3489, "atom2_serNum": 3543, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3500, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3522, "atom2_serNum": 3573, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 3522, "atom2_serNum": 3578, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/232/O", "atom2_id": "///A/236/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 3541, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 3546, "atom2_serNum": 4494, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/234/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3578, "atom2_serNum": 3584, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///A/236/OG1", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3578, "atom2_serNum": 3587, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///A/236/OG1", "atom2_id": "///A/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3583, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/237/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 3591, "atom2_serNum": 4376, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/238/NE", "atom2_id": "///A/334/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 3594, "atom2_serNum": 4376, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/238/NH2", "atom2_id": "///A/334/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 3595, "atom2_serNum": 4366, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/239/N", "atom2_id": "///A/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 3598, "atom2_serNum": 4363, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/239/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 3605, "atom2_serNum": 4351, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/241/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 3608, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/241/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 3620, "atom2_serNum": 4334, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/242/OE1", "atom2_id": "///A/328/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 3622, "atom2_serNum": 4338, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/243/N", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 3625, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/243/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 3637, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/244/NE", "atom2_id": "///A/328/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 3640, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/244/NH2", "atom2_id": "///A/328/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 3641, "atom2_serNum": 4321, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/245/N", "atom2_id": "///A/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 3646, "atom2_serNum": 4321, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/245/OG", "atom2_id": "///A/327/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 3647, "atom2_serNum": 3782, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/246/N", "atom2_id": "///A/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 3650, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/246/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 3654, "atom2_serNum": 3787, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/246/NE", "atom2_id": "///A/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 3657, "atom2_serNum": 5716, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/246/NH2", "atom2_id": "///A/487/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 3663, "atom2_serNum": 3761, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/248/N", "atom2_id": "///A/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 3666, "atom2_serNum": 3758, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/248/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 3678, "atom2_serNum": 3742, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/250/N", "atom2_id": "///A/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 3681, "atom2_serNum": 3739, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/250/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 3685, "atom2_serNum": 13116, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///A/250/OE1", "atom2_id": "///A/504/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 545, "atom1_serNum": 3686, "atom2_serNum": 3746, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/250/OE2", "atom2_id": "///A/258/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 3686, "atom2_serNum": 3749, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/250/OE2", "atom2_id": "///A/258/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 3686, "atom2_serNum": 4128, "donAcc_type": "standard", "distance": 3.494, "atom1_id": "///A/250/OE2", "atom2_id": "///A/303/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 3686, "atom2_serNum": 13116, "donAcc_type": "acceptable", "distance": 3.087, "atom1_id": "///A/250/OE2", "atom2_id": "///A/504/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 549, "atom1_serNum": 3696, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/252/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 3703, "atom2_serNum": 3733, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/252/NE", "atom2_id": "///A/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 3705, "atom2_serNum": 4162, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/252/NH1", "atom2_id": "///A/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 3710, "atom2_serNum": 3719, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/253/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 3733, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/257/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 3750, "atom2_serNum": 4146, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/259/N", "atom2_id": "///A/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 3753, "atom2_serNum": 4143, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/259/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 3765, "atom2_serNum": 4132, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/261/N", "atom2_id": "///A/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 3768, "atom2_serNum": 4129, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/261/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 3799, "atom2_serNum": 3823, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/265/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 3822, "atom2_serNum": 11658, "donAcc_type": "standard", "distance": 3.777, "atom1_id": "///A/267/NE2", "atom2_id": "///E/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 560, "atom1_serNum": 3833, "atom2_serNum": 3863, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 3836, "atom2_serNum": 3847, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/269/OD1", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 3836, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/269/OD1", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 3841, "atom2_serNum": 3871, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 3846, "atom2_serNum": 4058, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/270/NZ", "atom2_id": "///A/294/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 3850, "atom2_serNum": 3879, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 3855, "atom2_serNum": 3897, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 3861, "atom2_serNum": 11596, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/272/NH1", "atom2_id": "///E/3/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 568, "atom1_serNum": 3861, "atom2_serNum": 11620, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/272/NH1", "atom2_id": "///E/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 569, "atom1_serNum": 3866, "atom2_serNum": 3906, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 3874, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/274/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 3885, "atom2_serNum": 3919, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/275/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 3895, "atom2_serNum": 3962, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///A/275/OE2", "atom2_id": "///A/282/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 3900, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/276/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 3909, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/277/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 3917, "atom2_serNum": 3952, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 3925, "atom2_serNum": 3963, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/279/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 3940, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/280/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 3948, "atom2_serNum": 3971, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/281/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 3983, "atom2_serNum": 4302, "donAcc_type": "questionable", "distance": 2.983, "atom1_id": "///A/285/O", "atom2_id": "///A/324/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4003, "atom2_serNum": 4175, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///A/287/OD1", "atom2_id": "///A/309/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4004, "atom2_serNum": 4176, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/287/OD2", "atom2_id": "///A/309/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4008, "atom2_serNum": 4166, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/288/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4017, "atom2_serNum": 4154, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/290/N", "atom2_id": "///A/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4027, "atom2_serNum": 4151, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/291/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4031, "atom2_serNum": 4049, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/291/OD2", "atom2_id": "///A/293/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4040, "atom2_serNum": 4139, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/293/N", "atom2_id": "///A/305/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4043, "atom2_serNum": 4136, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/293/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4047, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/293/NE", "atom2_id": "///A/295/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4049, "atom2_serNum": 4158, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/293/NH1", "atom2_id": "///A/307/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4050, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/293/NH2", "atom2_id": "///A/295/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4054, "atom2_serNum": 6020, "donAcc_type": "acceptable", "distance": 3.607, "atom1_id": "///A/294/O", "atom2_id": "///D/449/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4057, "atom2_serNum": 4068, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/294/OD1", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4057, "atom2_serNum": 4073, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///A/294/OD1", "atom2_id": "///A/296/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4059, "atom2_serNum": 4121, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///A/295/N", "atom2_id": "///A/303/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4062, "atom2_serNum": 4105, "donAcc_type": "acceptable", "distance": 3.627, "atom1_id": "///A/295/O", "atom2_id": "///A/300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4066, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/295/OE1", "atom2_id": "///A/303/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4073, "atom2_serNum": 4118, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///A/296/OG1", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4075, "atom2_serNum": 4110, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/297/N", "atom2_id": "///A/301/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4078, "atom2_serNum": 4107, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4080, "atom2_serNum": 4100, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///A/297/OG", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4080, "atom2_serNum": 4105, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///A/297/OG", "atom2_id": "///A/300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4098, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/299/NH1", "atom2_id": "///D/446/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4099, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/299/NH2", "atom2_id": "///D/446/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4105, "atom2_serNum": 4110, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/300/OG1", "atom2_id": "///A/301/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4127, "atom2_serNum": 13116, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///A/303/NH1", "atom2_id": "///A/504/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 606, "atom1_serNum": 4169, "atom2_serNum": 4194, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/309/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4197, "atom2_serNum": 4207, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/312/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4202, "atom2_serNum": 4218, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/313/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4202, "atom2_serNum": 4225, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/313/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4205, "atom2_serNum": 4212, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/313/OD1", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4205, "atom2_serNum": 4218, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/313/OD1", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4206, "atom2_serNum": 13132, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///A/313/ND2", "atom2_id": "///A/506/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 613, "atom1_serNum": 4210, "atom2_serNum": 4233, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/314/O", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4215, "atom2_serNum": 4241, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/315/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4221, "atom2_serNum": 4249, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/316/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4228, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/317/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4236, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/318/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4244, "atom2_serNum": 4277, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/319/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4252, "atom2_serNum": 4295, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/320/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4252, "atom2_serNum": 4303, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/320/O", "atom2_id": "///A/324/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4260, "atom2_serNum": 4304, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4260, "atom2_serNum": 4309, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///A/321/O", "atom2_id": "///A/325/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4307, "atom2_serNum": 4329, "donAcc_type": "questionable", "distance": 3.201, "atom1_id": "///A/325/O", "atom2_id": "///A/328/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4309, "atom2_serNum": 4318, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///A/325/OG1", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4314, "atom2_serNum": 4340, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///A/326/O", "atom2_id": "///A/329/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4351, "atom2_serNum": 4363, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/331/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4373, "atom2_serNum": 4386, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/334/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4381, "atom2_serNum": 4478, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/335/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4394, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/337/N", "atom2_id": "///A/344/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4397, "atom2_serNum": 4452, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/337/O", "atom2_id": "///A/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4407, "atom2_serNum": 4437, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/339/N", "atom2_id": "///A/342/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4410, "atom2_serNum": 4434, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/339/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4420, "atom2_serNum": 4444, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/340/O", "atom2_id": "///A/342/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4468, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/344/NZ", "atom2_id": "///A/350/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4489, "atom2_serNum": 4529, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/347/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4492, "atom2_serNum": 4502, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/347/OD1", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4492, "atom2_serNum": 4511, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/347/OD1", "atom2_id": "///A/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4497, "atom2_serNum": 4534, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4505, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/349/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4517, "atom2_serNum": 4549, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/350/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4527, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/350/OE2", "atom2_id": "///A/354/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4532, "atom2_serNum": 4559, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4537, "atom2_serNum": 4571, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4545, "atom2_serNum": 4579, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4552, "atom2_serNum": 4588, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 4562, "atom2_serNum": 4598, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/355/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 4574, "atom2_serNum": 4607, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/356/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 4582, "atom2_serNum": 4616, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/357/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 4582, "atom2_serNum": 4621, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///A/357/O", "atom2_id": "///A/361/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 4587, "atom2_serNum": 4615, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/357/OE2", "atom2_id": "///A/360/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 4591, "atom2_serNum": 4623, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/358/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 4601, "atom2_serNum": 4630, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/359/O", "atom2_id": "///A/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 4610, "atom2_serNum": 4637, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/360/O", "atom2_id": "///A/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 4619, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/361/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 4626, "atom2_serNum": 4659, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/362/O", "atom2_id": "///A/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 4633, "atom2_serNum": 4670, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/363/O", "atom2_id": "///A/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 4633, "atom2_serNum": 4675, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///A/363/O", "atom2_id": "///A/367/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 4640, "atom2_serNum": 4677, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/364/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 4647, "atom2_serNum": 5492, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/364/NH2", "atom2_id": "///A/462/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 4651, "atom2_serNum": 4686, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/365/O", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 4662, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/366/O", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 4668, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/366/NH1", "atom2_id": "///A/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 4668, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/366/NH1", "atom2_id": "///A/472/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 4669, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/366/NH2", "atom2_id": "///A/472/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 4673, "atom2_serNum": 4706, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/367/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 4680, "atom2_serNum": 4714, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/368/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 4689, "atom2_serNum": 4725, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/369/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 4701, "atom2_serNum": 4734, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/370/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 4709, "atom2_serNum": 4739, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 4717, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 4728, "atom2_serNum": 4756, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 4737, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 4742, "atom2_serNum": 4772, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 4747, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///A/375/NZ", "atom2_id": "///A/456/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 4751, "atom2_serNum": 4782, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 4759, "atom2_serNum": 4790, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 4763, "atom2_serNum": 5333, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/377/NE", "atom2_id": "///A/444/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 4766, "atom2_serNum": 5334, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/377/NH2", "atom2_id": "///A/444/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 4770, "atom2_serNum": 4798, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 4775, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 4775, "atom2_serNum": 5147, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/379/O", "atom2_id": "///A/421/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 4781, "atom2_serNum": 5120, "donAcc_type": "acceptable", "distance": 2.601, "atom1_id": "///A/379/NE2", "atom2_id": "///A/418/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 4785, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/380/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 4785, "atom2_serNum": 4811, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 4793, "atom2_serNum": 4819, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 4801, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/382/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 4806, "atom2_serNum": 5346, "donAcc_type": "acceptable", "distance": 2.504, "atom1_id": "///A/382/OE2", "atom2_id": "///A/445/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 4810, "atom2_serNum": 4838, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/383/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 4814, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/384/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 4822, "atom2_serNum": 4851, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/385/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 4826, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/385/NE", "atom2_id": "///A/442/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 4829, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/385/NH2", "atom2_id": "///A/442/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 4833, "atom2_serNum": 4859, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/386/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 4841, "atom2_serNum": 4859, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/387/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 4841, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 4857, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/389/OD1", "atom2_id": "///A/438/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 4858, "atom2_serNum": 5286, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/389/OD2", "atom2_id": "///A/438/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 4862, "atom2_serNum": 4885, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/390/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 4862, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 4872, "atom2_serNum": 4902, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 4880, "atom2_serNum": 4910, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/392/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 4880, "atom2_serNum": 4915, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///A/392/O", "atom2_id": "///A/396/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 4884, "atom2_serNum": 10691, "donAcc_type": "standard", "distance": 3.668, "atom1_id": "///A/392/OD2", "atom2_id": "///C/399/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 4888, "atom2_serNum": 4915, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/393/O", "atom2_id": "///A/396/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 4888, "atom2_serNum": 4916, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/393/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 4888, "atom2_serNum": 4921, "donAcc_type": "acceptable", "distance": 2.868, "atom1_id": "///A/393/O", "atom2_id": "///A/397/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 4897, "atom2_serNum": 4923, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 4905, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/395/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 4913, "atom2_serNum": 4942, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/396/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 4919, "atom2_serNum": 4965, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///A/397/O", "atom2_id": "///A/401/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 4921, "atom2_serNum": 5085, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///A/397/OG1", "atom2_id": "///A/414/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 4926, "atom2_serNum": 4960, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/398/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 4934, "atom2_serNum": 11028, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/399/O", "atom2_id": "///C/438/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 4941, "atom2_serNum": 10624, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/399/NH2", "atom2_id": "///C/392/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 4956, "atom2_serNum": 5085, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/400/OE1", "atom2_id": "///A/414/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 4963, "atom2_serNum": 10997, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/401/O", "atom2_id": "///C/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 4972, "atom2_serNum": 11001, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/402/O", "atom2_id": "///C/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 4978, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/402/OD1", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 4985, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 4987, "atom2_serNum": 4997, "donAcc_type": "acceptable", "distance": 3.258, "atom1_id": "///A/403/OG1", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 4987, "atom2_serNum": 5006, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///A/403/OG1", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 4989, "atom2_serNum": 4995, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/404/N", "atom2_id": "///A/404/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 4992, "atom2_serNum": 5018, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 4995, "atom2_serNum": 4997, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/404/OD1", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 4996, "atom2_serNum": 10969, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///A/404/OD2", "atom2_id": "///C/431/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5000, "atom2_serNum": 5026, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5009, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5016, "atom2_serNum": 5050, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5021, "atom2_serNum": 5058, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/408/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5032, "atom2_serNum": 5067, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/409/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5047, "atom2_serNum": 5076, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/410/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5053, "atom2_serNum": 5087, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5061, "atom2_serNum": 5107, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/412/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5115, "atom2_serNum": 5146, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/418/N", "atom2_id": "///A/421/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5118, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5120, "atom2_serNum": 5139, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///A/418/OG", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5124, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5133, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5142, "atom2_serNum": 5167, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/421/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5151, "atom2_serNum": 5175, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5156, "atom2_serNum": 5183, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/423/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5160, "atom2_serNum": 10970, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///A/423/OE1", "atom2_id": "///C/431/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5165, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/424/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 5170, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/425/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5178, "atom2_serNum": 10960, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/426/O", "atom2_id": "///C/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5186, "atom2_serNum": 10950, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/427/O", "atom2_id": "///C/429/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5189, "atom2_serNum": 10967, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/427/OD1", "atom2_id": "///C/431/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5189, "atom2_serNum": 10970, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///A/427/OD1", "atom2_id": "///C/431/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 5194, "atom2_serNum": 10952, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/428/O", "atom2_id": "///C/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 5202, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/429/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5208, "atom2_serNum": 10928, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/429/NH1", "atom2_id": "///C/427/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 5210, "atom2_serNum": 10936, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/430/N", "atom2_id": "///C/428/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 5213, "atom2_serNum": 5240, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/430/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 5218, "atom2_serNum": 10920, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/431/N", "atom2_id": "///C/426/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 5221, "atom2_serNum": 5253, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///A/431/O", "atom2_id": "///A/434/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 5225, "atom2_serNum": 10931, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/431/NE", "atom2_id": "///C/427/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 5227, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///A/431/NH1", "atom2_id": "///C/404/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 5228, "atom2_serNum": 10900, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/431/NH2", "atom2_id": "///C/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 5228, "atom2_serNum": 10931, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/431/NH2", "atom2_id": "///C/427/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 5251, "atom2_serNum": 5267, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/434/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 5253, "atom2_serNum": 10737, "donAcc_type": "acceptable", "distance": 3.696, "atom1_id": "///A/434/OG1", "atom2_id": "///C/404/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 5255, "atom2_serNum": 10713, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/435/N", "atom2_id": "///C/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 5259, "atom2_serNum": 10719, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///A/436/N", "atom2_id": "///C/402/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 5262, "atom2_serNum": 5295, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 5270, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 5279, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/438/O", "atom2_id": "///A/438/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 5279, "atom2_serNum": 5312, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 5285, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/438/NH1", "atom2_id": "///A/442/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 5290, "atom2_serNum": 5321, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 5298, "atom2_serNum": 5326, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 5307, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 5315, "atom2_serNum": 5347, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 5324, "atom2_serNum": 5355, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 5329, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 5338, "atom2_serNum": 5381, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 5350, "atom2_serNum": 5389, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/446/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 5361, "atom2_serNum": 5397, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/447/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 5376, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/448/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 5384, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/449/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 5392, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 5400, "atom2_serNum": 5432, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/451/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 5412, "atom2_serNum": 5440, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/452/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 5420, "atom2_serNum": 5449, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/453/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 5420, "atom2_serNum": 5454, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/453/O", "atom2_id": "///A/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 5426, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 5435, "atom2_serNum": 5464, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 5443, "atom2_serNum": 5472, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 5480, "atom2_serNum": 5503, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/461/O", "atom2_id": "///A/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 5480, "atom2_serNum": 5510, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/461/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 5483, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/461/OD1", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 5488, "atom2_serNum": 5518, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/462/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 5497, "atom2_serNum": 5526, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 5501, "atom2_serNum": 5559, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/463/OE1", "atom2_id": "///A/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 5506, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 5513, "atom2_serNum": 5543, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 5521, "atom2_serNum": 5550, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 5529, "atom2_serNum": 5561, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 5533, "atom2_serNum": 5559, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/467/OE1", "atom2_id": "///A/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 5534, "atom2_serNum": 5567, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/467/NE2", "atom2_id": "///A/471/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 5538, "atom2_serNum": 5569, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/468/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 5546, "atom2_serNum": 5578, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/469/O", "atom2_id": "///A/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 5553, "atom2_serNum": 5586, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/470/O", "atom2_id": "///A/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 5553, "atom2_serNum": 5591, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///A/470/O", "atom2_id": "///A/474/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 5564, "atom2_serNum": 5593, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/471/O", "atom2_id": "///A/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 5572, "atom2_serNum": 5611, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/472/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 5581, "atom2_serNum": 5619, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 5589, "atom2_serNum": 5630, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 5599, "atom2_serNum": 5638, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/475/O", "atom2_id": "///A/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 5607, "atom2_serNum": 5645, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/475/OE1", "atom2_id": "///A/479/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 5607, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/475/OE1", "atom2_id": "///A/479/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 5609, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/475/OE2", "atom2_id": "///A/479/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 5614, "atom2_serNum": 5649, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/476/O", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 5622, "atom2_serNum": 5660, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/477/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 5626, "atom2_serNum": 5636, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/477/NE", "atom2_id": "///A/478/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 5629, "atom2_serNum": 5636, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/477/NH2", "atom2_id": "///A/478/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 5664, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/482/N", "atom2_id": "///A/482/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 5671, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 3.868, "atom1_id": "///A/482/OD2", "atom2_id": "///A/485/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 5689, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/484/NH1", "atom2_id": "///A/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 5717, "atom2_serNum": 5734, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/487/OE2", "atom2_id": "///A/489/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 5749, "atom2_serNum": 5985, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///D/417/O", "atom2_id": "///D/444/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 5760, "atom2_serNum": 6056, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/419/N", "atom2_id": "///D/454/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 5763, "atom2_serNum": 6053, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/419/O", "atom2_id": "///D/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 5768, "atom2_serNum": 6006, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/420/O", "atom2_id": "///D/447/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 5771, "atom2_serNum": 6480, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///D/420/OD1", "atom2_id": "///D/500/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 5772, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///D/420/OD2", "atom2_id": "///D/499/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 5776, "atom2_serNum": 5799, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///D/421/O", "atom2_id": "///D/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 5779, "atom2_serNum": 6018, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/422/N", "atom2_id": "///D/449/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 5785, "atom2_serNum": 6024, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/423/N", "atom2_id": "///D/450/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 5790, "atom2_serNum": 5800, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///D/423/OG", "atom2_id": "///D/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 5790, "atom2_serNum": 5839, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///D/423/OG", "atom2_id": "///D/428/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 5803, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///D/425/O", "atom2_id": "///D/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 5803, "atom2_serNum": 5840, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///D/425/O", "atom2_id": "///D/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 5805, "atom2_serNum": 5827, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///D/425/OG", "atom2_id": "///D/427/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 5809, "atom2_serNum": 6481, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///D/426/O", "atom2_id": "///D/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 5813, "atom2_serNum": 5827, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///D/427/N", "atom2_id": "///D/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 5839, "atom2_serNum": 6031, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///D/428/OE2", "atom2_id": "///D/450/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 5843, "atom2_serNum": 6481, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///D/429/O", "atom2_id": "///D/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 5843, "atom2_serNum": 6491, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///D/429/O", "atom2_id": "///D/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 5846, "atom2_serNum": 6035, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/430/N", "atom2_id": "///D/451/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 5849, "atom2_serNum": 6048, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/430/O", "atom2_id": "///D/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 5853, "atom2_serNum": 7094, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///D/430/OE1", "atom2_id": "///D/601/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 5854, "atom2_serNum": 6047, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/430/OE2", "atom2_id": "///D/452/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 5854, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///D/430/OE2", "atom2_id": "///D/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 5855, "atom2_serNum": 6494, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/431/N", "atom2_id": "///D/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 5858, "atom2_serNum": 6508, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/431/O", "atom2_id": "///D/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 5863, "atom2_serNum": 6051, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///D/432/N", "atom2_id": "///D/453/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 5866, "atom2_serNum": 6061, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/432/O", "atom2_id": "///D/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 5874, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///D/433/N", "atom2_id": "///D/504/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 5877, "atom2_serNum": 6523, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/433/O", "atom2_id": "///D/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 5882, "atom2_serNum": 6064, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///D/434/N", "atom2_id": "///D/455/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 5888, "atom2_serNum": 5914, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///D/434/O", "atom2_id": "///D/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 5888, "atom2_serNum": 6076, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/434/O", "atom2_id": "///D/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 5896, "atom2_serNum": 6526, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///D/435/N", "atom2_id": "///D/506/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 5902, "atom2_serNum": 5944, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///D/435/O", "atom2_id": "///D/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 5910, "atom2_serNum": 6545, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///D/435/OE1", "atom2_id": "///D/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 5912, "atom2_serNum": 12601, "donAcc_type": "questionable", "distance": 2.582, "atom1_id": "///D/435/OE2", "atom2_id": "///F/1008/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 857, "atom1_serNum": 5914, "atom2_serNum": 6082, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/436/N", "atom2_id": "///D/457/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 5920, "atom2_serNum": 5949, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///D/436/O", "atom2_id": "///D/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 5928, "atom2_serNum": 5953, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/437/O", "atom2_id": "///D/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 5934, "atom2_serNum": 6110, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/437/OD1", "atom2_id": "///D/458/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 5941, "atom2_serNum": 5962, "donAcc_type": "acceptable", "distance": 3.969, "atom1_id": "///D/438/O", "atom2_id": "///D/442/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 5943, "atom2_serNum": 12666, "donAcc_type": "acceptable", "distance": 2.638, "atom1_id": "///D/438/OG", "atom2_id": "///G/2010/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 863, "atom1_serNum": 5947, "atom2_serNum": 5963, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///D/439/O", "atom2_id": "///D/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 5947, "atom2_serNum": 5973, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///D/439/O", "atom2_id": "///D/443/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 5952, "atom2_serNum": 5977, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/440/O", "atom2_id": "///D/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 5956, "atom2_serNum": 5986, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/441/O", "atom2_id": "///D/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 5956, "atom2_serNum": 5991, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///D/441/O", "atom2_id": "///D/445/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 5960, "atom2_serNum": 5992, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/442/O", "atom2_id": "///D/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 5962, "atom2_serNum": 6923, "donAcc_type": "acceptable", "distance": 3.622, "atom1_id": "///D/442/OG", "atom2_id": "///D/583/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 5962, "atom2_serNum": 6962, "donAcc_type": "acceptable", "distance": 3.200, "atom1_id": "///D/442/OG", "atom2_id": "///D/586/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 5969, "atom2_serNum": 5996, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///D/443/O", "atom2_id": "///D/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 5980, "atom2_serNum": 6003, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///D/444/O", "atom2_id": "///D/447/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 6006, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/447/NH2", "atom2_id": "///D/452/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 6007, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/448/N", "atom2_id": "///D/452/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 6010, "atom2_serNum": 6032, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/448/O", "atom2_id": "///D/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 6010, "atom2_serNum": 6039, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///D/448/O", "atom2_id": "///D/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 6013, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///D/448/OD1", "atom2_id": "///D/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 6047, "atom2_serNum": 7045, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///D/452/NE2", "atom2_id": "///D/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 6082, "atom2_serNum": 6114, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///D/457/O", "atom2_id": "///D/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 6118, "atom2_serNum": 12611, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///D/460/N", "atom2_id": "///F/1008/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 881, "atom1_serNum": 6126, "atom2_serNum": 6607, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/460/NZ", "atom2_id": "///D/512/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 6126, "atom2_serNum": 6624, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///D/460/NZ", "atom2_id": "///D/515/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 6143, "atom2_serNum": 12072, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/463/N", "atom2_id": "///E/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 884, "atom1_serNum": 6146, "atom2_serNum": 6167, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///D/463/O", "atom2_id": "///D/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 6146, "atom2_serNum": 6176, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///D/463/O", "atom2_id": "///D/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 6149, "atom2_serNum": 6158, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/463/OD1", "atom2_id": "///D/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 6150, "atom2_serNum": 7252, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/463/ND2", "atom2_id": "///D/622/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 6150, "atom2_serNum": 12112, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///D/463/ND2", "atom2_id": "///E/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 889, "atom1_serNum": 6165, "atom2_serNum": 6726, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/465/OE1", "atom2_id": "///D/526/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 6166, "atom2_serNum": 6729, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/465/OE2", "atom2_id": "///D/526/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 6175, "atom2_serNum": 12112, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///D/466/NZ", "atom2_id": "///E/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 892, "atom1_serNum": 6175, "atom2_serNum": 12114, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///D/466/NZ", "atom2_id": "///E/16/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 893, "atom1_serNum": 6175, "atom2_serNum": 12156, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///D/466/NZ", "atom2_id": "///E/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 894, "atom1_serNum": 6187, "atom2_serNum": 6227, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/468/O", "atom2_id": "///D/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 6187, "atom2_serNum": 6238, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///D/468/O", "atom2_id": "///D/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 6206, "atom2_serNum": 6246, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///D/469/O", "atom2_id": "///D/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 6223, "atom2_serNum": 6227, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///D/470/OD1", "atom2_id": "///D/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 6230, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/471/O", "atom2_id": "///D/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 6237, "atom2_serNum": 12034, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///D/471/NH2", "atom2_id": "///E/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 900, "atom1_serNum": 6237, "atom2_serNum": 12074, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///D/471/NH2", "atom2_id": "///E/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 901, "atom1_serNum": 6241, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///D/472/O", "atom2_id": "///D/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 6265, "atom2_serNum": 6303, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/475/O", "atom2_id": "///D/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 6268, "atom2_serNum": 6286, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///D/475/OD1", "atom2_id": "///D/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 6268, "atom2_serNum": 6295, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/475/OD1", "atom2_id": "///D/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 6276, "atom2_serNum": 6284, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/476/O", "atom2_id": "///D/476/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 6276, "atom2_serNum": 6325, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/476/O", "atom2_id": "///D/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 6284, "atom2_serNum": 6333, "donAcc_type": "questionable", "distance": 2.978, "atom1_id": "///D/476/ND2", "atom2_id": "///D/480/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 6289, "atom2_serNum": 6334, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///D/477/O", "atom2_id": "///D/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 6298, "atom2_serNum": 6342, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///D/478/O", "atom2_id": "///D/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 6309, "atom2_serNum": 6350, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///D/479/O", "atom2_id": "///D/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 6309, "atom2_serNum": 6355, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///D/479/O", "atom2_id": "///D/483/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 6328, "atom2_serNum": 6357, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/480/O", "atom2_id": "///D/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 6337, "atom2_serNum": 6362, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/481/O", "atom2_id": "///D/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 6345, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/482/O", "atom2_id": "///D/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 6360, "atom2_serNum": 6465, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/484/O", "atom2_id": "///D/499/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 6360, "atom2_serNum": 6468, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///D/484/O", "atom2_id": "///D/499/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 6365, "atom2_serNum": 6458, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/485/O", "atom2_id": "///D/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 6380, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/487/O", "atom2_id": "///D/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 6382, "atom2_serNum": 6387, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///D/487/OG1", "atom2_id": "///D/488/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 6391, "atom2_serNum": 6400, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///D/489/O", "atom2_id": "///D/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 6391, "atom2_serNum": 6404, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/489/O", "atom2_id": "///D/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 6396, "atom2_serNum": 6733, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/490/N", "atom2_id": "///D/527/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 6404, "atom2_serNum": 6410, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///D/492/N", "atom2_id": "///D/492/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 6407, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///D/492/O", "atom2_id": "///D/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 6426, "atom2_serNum": 6444, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/494/O", "atom2_id": "///D/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 6429, "atom2_serNum": 6439, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///D/494/OD1", "atom2_id": "///D/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 6434, "atom2_serNum": 6453, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///D/495/O", "atom2_id": "///D/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 6500, "atom2_serNum": 6804, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///D/503/N", "atom2_id": "///D/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 6503, "atom2_serNum": 6820, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///D/503/O", "atom2_id": "///D/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 6515, "atom2_serNum": 6823, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/505/N", "atom2_id": "///D/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 6518, "atom2_serNum": 6840, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///D/505/O", "atom2_id": "///D/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 6541, "atom2_serNum": 6645, "donAcc_type": "acceptable", "distance": 3.454, "atom1_id": "///D/507/OG1", "atom2_id": "///D/517/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 6551, "atom2_serNum": 6571, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///D/508/O", "atom2_id": "///D/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 6557, "atom2_serNum": 6917, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///D/508/OD1", "atom2_id": "///D/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 6577, "atom2_serNum": 6613, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///D/510/O", "atom2_id": "///D/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 6583, "atom2_serNum": 6609, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/510/OD1", "atom2_id": "///D/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 6593, "atom2_serNum": 6618, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/511/O", "atom2_id": "///D/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 6604, "atom2_serNum": 6628, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/512/O", "atom2_id": "///D/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 6607, "atom2_serNum": 7618, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/512/OD1", "atom2_id": "///C/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 6608, "atom2_serNum": 7619, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/512/OD2", "atom2_id": "///C/33/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 6612, "atom2_serNum": 6636, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/513/O", "atom2_id": "///D/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 6616, "atom2_serNum": 6647, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///D/514/O", "atom2_id": "///D/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 6621, "atom2_serNum": 6652, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///D/515/O", "atom2_id": "///D/518/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 6621, "atom2_serNum": 6654, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///D/515/O", "atom2_id": "///D/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 6627, "atom2_serNum": 12086, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///D/515/NE2", "atom2_id": "///E/15/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 946, "atom1_serNum": 6627, "atom2_serNum": 12110, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/515/NE2", "atom2_id": "///E/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 947, "atom1_serNum": 6631, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/516/O", "atom2_id": "///D/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 6639, "atom2_serNum": 6670, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/517/O", "atom2_id": "///D/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 6643, "atom2_serNum": 7473, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///D/517/NE", "atom2_id": "///C/17/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 6646, "atom2_serNum": 7507, "donAcc_type": "acceptable", "distance": 3.127, "atom1_id": "///D/517/NH2", "atom2_id": "///C/21/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 6650, "atom2_serNum": 6678, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/518/O", "atom2_id": "///D/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 6650, "atom2_serNum": 6683, "donAcc_type": "acceptable", "distance": 2.694, "atom1_id": "///D/518/O", "atom2_id": "///D/522/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 6657, "atom2_serNum": 6685, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///D/519/O", "atom2_id": "///D/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 6665, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/520/O", "atom2_id": "///D/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 6673, "atom2_serNum": 6707, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/521/O", "atom2_id": "///D/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 6681, "atom2_serNum": 6719, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///D/522/O", "atom2_id": "///D/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 6688, "atom2_serNum": 6730, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/523/O", "atom2_id": "///D/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 6699, "atom2_serNum": 6741, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///D/524/O", "atom2_id": "///D/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 6699, "atom2_serNum": 6749, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///D/524/O", "atom2_id": "///D/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 6718, "atom2_serNum": 7165, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///D/525/OH", "atom2_id": "///D/611/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 6718, "atom2_serNum": 7195, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///D/525/OH", "atom2_id": "///D/615/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 6729, "atom2_serNum": 7192, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///D/526/NH2", "atom2_id": "///D/615/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 6744, "atom2_serNum": 6767, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/528/O", "atom2_id": "///D/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 6752, "atom2_serNum": 6775, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///D/529/O", "atom2_id": "///D/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 6752, "atom2_serNum": 6783, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/529/O", "atom2_id": "///D/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 6763, "atom2_serNum": 6792, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/530/O", "atom2_id": "///D/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 6770, "atom2_serNum": 6801, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///D/531/O", "atom2_id": "///D/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 6778, "atom2_serNum": 6797, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/532/O", "atom2_id": "///D/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 6800, "atom2_serNum": 6831, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///D/535/O", "atom2_id": "///D/538/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 6800, "atom2_serNum": 7124, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///D/535/O", "atom2_id": "///D/605/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 6816, "atom2_serNum": 7125, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/537/O", "atom2_id": "///D/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 6832, "atom2_serNum": 7111, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///D/539/N", "atom2_id": "///D/604/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 6835, "atom2_serNum": 7108, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/539/O", "atom2_id": "///D/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 6853, "atom2_serNum": 7098, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///D/541/NE2", "atom2_id": "///D/602/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 6871, "atom2_serNum": 6907, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///D/544/O", "atom2_id": "///D/581/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 6882, "atom2_serNum": 6909, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///D/580/O", "atom2_id": "///D/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 6915, "atom2_serNum": 6941, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///D/582/O", "atom2_id": "///D/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 6967, "atom2_serNum": 6995, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/587/N", "atom2_id": "///D/590/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 6970, "atom2_serNum": 6997, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/587/O", "atom2_id": "///D/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 6978, "atom2_serNum": 7005, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/588/O", "atom2_id": "///D/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 6980, "atom2_serNum": 6986, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///D/589/N", "atom2_id": "///D/589/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 6983, "atom2_serNum": 7019, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///D/589/O", "atom2_id": "///D/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 6991, "atom2_serNum": 7028, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/590/O", "atom2_id": "///D/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 6991, "atom2_serNum": 7033, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///D/590/O", "atom2_id": "///D/594/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 7000, "atom2_serNum": 7035, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/591/O", "atom2_id": "///D/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 7000, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///D/591/O", "atom2_id": "///D/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 7008, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///D/592/O", "atom2_id": "///D/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 7008, "atom2_serNum": 7050, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///D/592/O", "atom2_id": "///D/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 7026, "atom2_serNum": 7057, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///D/593/OE1", "atom2_id": "///D/597/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 7026, "atom2_serNum": 7080, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///D/593/OE1", "atom2_id": "///D/600/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 7033, "atom2_serNum": 7040, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///D/594/OG1", "atom2_id": "///D/595/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 7045, "atom2_serNum": 7058, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///D/596/O", "atom2_id": "///D/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 7045, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///D/596/O", "atom2_id": "///D/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 7053, "atom2_serNum": 7074, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///D/597/O", "atom2_id": "///D/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 7053, "atom2_serNum": 7084, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/597/O", "atom2_id": "///D/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 7056, "atom2_serNum": 7065, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///D/597/OD1", "atom2_id": "///D/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 7116, "atom2_serNum": 7411, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///D/605/N", "atom2_id": "///C/10/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 7119, "atom2_serNum": 7425, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///D/605/O", "atom2_id": "///C/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 7132, "atom2_serNum": 7428, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///D/607/N", "atom2_id": "///C/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 7135, "atom2_serNum": 7444, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///D/607/O", "atom2_id": "///C/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 7157, "atom2_serNum": 7184, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/610/O", "atom2_id": "///D/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 7160, "atom2_serNum": 7167, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/610/OD1", "atom2_id": "///D/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 7160, "atom2_serNum": 7175, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///D/610/OD1", "atom2_id": "///D/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 7165, "atom2_serNum": 7189, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///D/611/O", "atom2_id": "///D/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 7170, "atom2_serNum": 7197, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/612/O", "atom2_id": "///D/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 7178, "atom2_serNum": 7206, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/613/O", "atom2_id": "///D/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 7178, "atom2_serNum": 7211, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///D/613/O", "atom2_id": "///D/617/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 7187, "atom2_serNum": 7213, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/614/O", "atom2_id": "///D/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 7192, "atom2_serNum": 7224, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///D/615/O", "atom2_id": "///D/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 7200, "atom2_serNum": 7233, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///D/616/O", "atom2_id": "///D/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 7209, "atom2_serNum": 7241, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/617/O", "atom2_id": "///D/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 7216, "atom2_serNum": 7249, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/618/O", "atom2_id": "///D/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 7227, "atom2_serNum": 7257, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/619/O", "atom2_id": "///D/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 7244, "atom2_serNum": 7317, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///D/621/O", "atom2_id": "///D/629/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 7260, "atom2_serNum": 7317, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///D/623/O", "atom2_id": "///D/629/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 7260, "atom2_serNum": 7318, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///D/623/O", "atom2_id": "///D/629/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 7267, "atom2_serNum": 7284, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///D/624/O", "atom2_id": "///D/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 7273, "atom2_serNum": 7277, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///D/624/OD1", "atom2_id": "///D/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 7280, "atom2_serNum": 7308, "donAcc_type": "standard", "distance": 3.883, "atom1_id": "///D/625/O", "atom2_id": "///D/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 7287, "atom2_serNum": 7308, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/626/O", "atom2_id": "///D/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 7287, "atom2_serNum": 7319, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/626/O", "atom2_id": "///D/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 7294, "atom2_serNum": 7330, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/627/O", "atom2_id": "///D/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 7298, "atom2_serNum": 7326, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/627/OE1", "atom2_id": "///D/630/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 7299, "atom2_serNum": 7329, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///D/627/OE2", "atom2_id": "///D/630/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 7303, "atom2_serNum": 7339, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/628/O", "atom2_id": "///D/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 7311, "atom2_serNum": 7350, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/629/O", "atom2_id": "///D/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 7315, "atom2_serNum": 12154, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///D/629/NE", "atom2_id": "///E/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1028, "atom1_serNum": 7318, "atom2_serNum": 12156, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///D/629/NH2", "atom2_id": "///E/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1029, "atom1_serNum": 7322, "atom2_serNum": 7358, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/630/O", "atom2_id": "///D/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 7333, "atom2_serNum": 7367, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/631/O", "atom2_id": "///D/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 7338, "atom2_serNum": 7373, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///D/631/NE2", "atom2_id": "///D/635/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 7342, "atom2_serNum": 7375, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///D/632/O", "atom2_id": "///D/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 7342, "atom2_serNum": 7382, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/632/O", "atom2_id": "///D/636/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 7353, "atom2_serNum": 7383, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///D/633/O", "atom2_id": "///D/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 7381, "atom2_serNum": 7492, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///D/636/OD1", "atom2_id": "///C/19/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 7432, "atom2_serNum": 7472, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///C/12/NE", "atom2_id": "///C/17/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 7434, "atom2_serNum": 7501, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/12/NH1", "atom2_id": "///C/20/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 7435, "atom2_serNum": 7501, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///C/12/NH2", "atom2_id": "///C/20/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 7439, "atom2_serNum": 7465, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/13/O", "atom2_id": "///C/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 7442, "atom2_serNum": 7459, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/13/OD1", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 7447, "atom2_serNum": 7474, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/14/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 7455, "atom2_serNum": 7482, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/15/O", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 7462, "atom2_serNum": 7493, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/16/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 7468, "atom2_serNum": 7502, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 7468, "atom2_serNum": 7507, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///C/17/O", "atom2_id": "///C/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 7477, "atom2_serNum": 7508, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 7485, "atom2_serNum": 7519, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/19/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 7496, "atom2_serNum": 7527, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/20/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 7505, "atom2_serNum": 7543, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 7511, "atom2_serNum": 7555, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 7522, "atom2_serNum": 7560, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/23/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 7533, "atom2_serNum": 7576, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 7546, "atom2_serNum": 7582, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///C/25/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 7558, "atom2_serNum": 7589, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 7566, "atom2_serNum": 7597, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 7579, "atom2_serNum": 7604, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 7585, "atom2_serNum": 7620, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/29/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 7623, "atom2_serNum": 7694, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///C/34/O", "atom2_id": "///C/43/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 7636, "atom2_serNum": 10120, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/36/O", "atom2_id": "///C/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 7640, "atom2_serNum": 7681, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/37/N", "atom2_id": "///C/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 7643, "atom2_serNum": 7674, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/37/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 7646, "atom2_serNum": 7655, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/37/OD1", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 7646, "atom2_serNum": 7662, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/37/OD1", "atom2_id": "///C/39/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 7647, "atom2_serNum": 7665, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///C/37/OD2", "atom2_id": "///C/39/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 7648, "atom2_serNum": 10123, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/38/N", "atom2_id": "///C/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 7669, "atom2_serNum": 8734, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/40/O", "atom2_id": "///C/166/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 7672, "atom2_serNum": 7674, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/40/OD1", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 7672, "atom2_serNum": 7678, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/40/OD1", "atom2_id": "///C/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 7672, "atom2_serNum": 7729, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/40/OD1", "atom2_id": "///C/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 7673, "atom2_serNum": 7726, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/40/OD2", "atom2_id": "///C/47/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 7673, "atom2_serNum": 7729, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///C/40/OD2", "atom2_id": "///C/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 7673, "atom2_serNum": 8678, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///C/40/OD2", "atom2_id": "///C/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 7689, "atom2_serNum": 7719, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///C/43/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 7694, "atom2_serNum": 8776, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/43/NZ", "atom2_id": "///C/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 7694, "atom2_serNum": 12499, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///C/43/NZ", "atom2_id": "///F/1006/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1076, "atom1_serNum": 7698, "atom2_serNum": 7730, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 7705, "atom2_serNum": 7741, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 7712, "atom2_serNum": 7749, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 7718, "atom2_serNum": 12501, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///C/46/NE2", "atom2_id": "///F/1006/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1080, "atom1_serNum": 7722, "atom2_serNum": 7757, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 7728, "atom2_serNum": 13140, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///C/47/NH1", "atom2_id": "///C/502/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1082, "atom1_serNum": 7728, "atom2_serNum": 13142, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///C/47/NH1", "atom2_id": "///C/502/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1083, "atom1_serNum": 7733, "atom2_serNum": 7769, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 7737, "atom2_serNum": 8657, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///C/48/NE", "atom2_id": "///C/156/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 7739, "atom2_serNum": 8024, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///C/48/NH1", "atom2_id": "///C/79/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 7740, "atom2_serNum": 8656, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/48/NH2", "atom2_id": "///C/156/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 7744, "atom2_serNum": 7773, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 7752, "atom2_serNum": 7781, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/50/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 7760, "atom2_serNum": 7789, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/51/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 7768, "atom2_serNum": 8641, "donAcc_type": "acceptable", "distance": 3.887, "atom1_id": "///C/51/OH", "atom2_id": "///C/155/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 7772, "atom2_serNum": 7798, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 7776, "atom2_serNum": 7820, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/53/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 7784, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/54/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 7788, "atom2_serNum": 7797, "donAcc_type": "standard", "distance": 3.799, "atom1_id": "///C/54/ND2", "atom2_id": "///C/55/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 7814, "atom2_serNum": 8005, "donAcc_type": "questionable", "distance": 3.324, "atom1_id": "///C/56/NE2", "atom2_id": "///C/77/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 7819, "atom2_serNum": 7836, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/57/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 7826, "atom2_serNum": 8415, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/58/O", "atom2_id": "///C/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 7839, "atom2_serNum": 7858, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///C/59/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 7841, "atom2_serNum": 7856, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///C/59/OG1", "atom2_id": "///C/61/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 7850, "atom2_serNum": 7856, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///C/61/N", "atom2_id": "///C/61/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 7857, "atom2_serNum": 7866, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/61/OD2", "atom2_id": "///C/62/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 7861, "atom2_serNum": 8413, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///C/62/O", "atom2_id": "///C/127/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 7872, "atom2_serNum": 7901, "donAcc_type": "acceptable", "distance": 2.812, "atom1_id": "///C/63/OG", "atom2_id": "///C/65/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 7884, "atom2_serNum": 8239, "donAcc_type": "acceptable", "distance": 2.688, "atom1_id": "///C/64/OH", "atom2_id": "///C/105/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 7885, "atom2_serNum": 8402, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/65/N", "atom2_id": "///C/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 7891, "atom2_serNum": 8399, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/65/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 7909, "atom2_serNum": 7932, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/66/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 7909, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 7921, "atom2_serNum": 8386, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/67/N", "atom2_id": "///C/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 7924, "atom2_serNum": 7951, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 7926, "atom2_serNum": 8388, "donAcc_type": "acceptable", "distance": 2.753, "atom1_id": "///C/67/OG", "atom2_id": "///C/124/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 7930, "atom2_serNum": 7958, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 7935, "atom2_serNum": 7962, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///C/69/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 7946, "atom2_serNum": 7978, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/70/O", "atom2_id": "///C/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 7954, "atom2_serNum": 7985, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/71/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 7961, "atom2_serNum": 7993, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/72/O", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 7968, "atom2_serNum": 7997, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///C/73/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 7981, "atom2_serNum": 8006, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/74/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 7981, "atom2_serNum": 8018, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/74/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 7988, "atom2_serNum": 8608, "donAcc_type": "acceptable", "distance": 3.603, "atom1_id": "///C/75/O", "atom2_id": "///C/150/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 7996, "atom2_serNum": 8608, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///C/76/O", "atom2_id": "///C/150/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 8000, "atom2_serNum": 8596, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///C/77/O", "atom2_id": "///C/149/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 8021, "atom2_serNum": 8035, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///C/79/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 8027, "atom2_serNum": 12545, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///C/79/NE2", "atom2_id": "///F/1007/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1125, "atom1_serNum": 8041, "atom2_serNum": 12587, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///C/81/ND1", "atom2_id": "///F/1008/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1126, "atom1_serNum": 8045, "atom2_serNum": 12589, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///C/82/N", "atom2_id": "///F/1008/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1127, "atom1_serNum": 8048, "atom2_serNum": 8069, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 8052, "atom2_serNum": 8077, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 8060, "atom2_serNum": 8089, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 8066, "atom2_serNum": 8098, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 8072, "atom2_serNum": 8103, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/86/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 8080, "atom2_serNum": 8111, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/87/O", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 8088, "atom2_serNum": 8335, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///C/87/OH", "atom2_id": "///C/119/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 8088, "atom2_serNum": 8388, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///C/87/OH", "atom2_id": "///C/124/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 8092, "atom2_serNum": 8118, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///C/88/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 8101, "atom2_serNum": 8129, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///C/89/O", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 8106, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///C/90/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 8114, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/91/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 8114, "atom2_serNum": 8142, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///C/91/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 8121, "atom2_serNum": 8142, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/92/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 8125, "atom2_serNum": 12501, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/92/NE", "atom2_id": "///F/1006/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1142, "atom1_serNum": 8128, "atom2_serNum": 12501, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///C/92/NH2", "atom2_id": "///F/1006/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1143, "atom1_serNum": 8132, "atom2_serNum": 8218, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/93/O", "atom2_id": "///C/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 8132, "atom2_serNum": 8226, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/93/O", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 8145, "atom2_serNum": 8170, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///C/95/O", "atom2_id": "///C/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 8145, "atom2_serNum": 8176, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/95/O", "atom2_id": "///C/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 8149, "atom2_serNum": 8175, "donAcc_type": "acceptable", "distance": 2.654, "atom1_id": "///C/95/OE1", "atom2_id": "///C/98/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 8150, "atom2_serNum": 8269, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/95/NE2", "atom2_id": "///C/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 8157, "atom2_serNum": 8159, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/96/OD1", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 8188, "atom2_serNum": 8762, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/100/N", "atom2_id": "///C/170/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 8191, "atom2_serNum": 8197, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/100/O", "atom2_id": "///C/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 8197, "atom2_serNum": 11427, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/100/NH1", "atom2_id": "///C/482/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 8198, "atom2_serNum": 9116, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/100/NH2", "atom2_id": "///C/217/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 8198, "atom2_serNum": 11426, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///C/100/NH2", "atom2_id": "///C/482/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 8198, "atom2_serNum": 11427, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///C/100/NH2", "atom2_id": "///C/482/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 8198, "atom2_serNum": 11431, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/100/NH2", "atom2_id": "///C/483/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 8199, "atom2_serNum": 8762, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/101/N", "atom2_id": "///C/170/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 8202, "atom2_serNum": 8763, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/101/O", "atom2_id": "///C/170/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 8210, "atom2_serNum": 8875, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///C/101/OH", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 8210, "atom2_serNum": 11426, "donAcc_type": "acceptable", "distance": 2.602, "atom1_id": "///C/101/OH", "atom2_id": "///C/482/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 8214, "atom2_serNum": 8428, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///C/102/O", "atom2_id": "///C/129/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 8221, "atom2_serNum": 8452, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///C/103/O", "atom2_id": "///C/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 8233, "atom2_serNum": 8407, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/105/N", "atom2_id": "///C/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 8236, "atom2_serNum": 8404, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/105/O", "atom2_id": "///C/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 8240, "atom2_serNum": 8411, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/105/OD2", "atom2_id": "///C/127/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 8240, "atom2_serNum": 8414, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///C/105/OD2", "atom2_id": "///C/127/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 8245, "atom2_serNum": 8393, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///C/107/N", "atom2_id": "///C/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 8248, "atom2_serNum": 8390, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/107/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 8257, "atom2_serNum": 8266, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///C/108/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 8261, "atom2_serNum": 8332, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/109/O", "atom2_id": "///C/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 8264, "atom2_serNum": 8277, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/109/OD1", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 8281, "atom2_serNum": 8318, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///C/112/N", "atom2_id": "///C/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 8284, "atom2_serNum": 8311, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/112/O", "atom2_id": "///C/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 8286, "atom2_serNum": 8303, "donAcc_type": "acceptable", "distance": 3.100, "atom1_id": "///C/112/OG", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 8286, "atom2_serNum": 8322, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///C/112/OG", "atom2_id": "///C/116/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 8293, "atom2_serNum": 9550, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/113/O", "atom2_id": "///C/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 8309, "atom2_serNum": 9558, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/114/OD1", "atom2_id": "///C/270/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 8310, "atom2_serNum": 9558, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///C/114/OD2", "atom2_id": "///C/270/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 8340, "atom2_serNum": 8372, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/120/O", "atom2_id": "///C/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 8340, "atom2_serNum": 8383, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///C/120/O", "atom2_id": "///C/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 8370, "atom2_serNum": 11830, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/122/NH2", "atom2_id": "///E/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1182, "atom1_serNum": 8370, "atom2_serNum": 11874, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///C/122/NH2", "atom2_id": "///E/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1183, "atom1_serNum": 8426, "atom2_serNum": 8454, "donAcc_type": "standard", "distance": 3.650, "atom1_id": "///C/129/O", "atom2_id": "///C/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 8428, "atom2_serNum": 8452, "donAcc_type": "acceptable", "distance": 3.339, "atom1_id": "///C/129/OG1", "atom2_id": "///C/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 8433, "atom2_serNum": 8454, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/130/O", "atom2_id": "///C/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 8442, "atom2_serNum": 8462, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/131/O", "atom2_id": "///C/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 8450, "atom2_serNum": 8471, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/132/O", "atom2_id": "///C/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 8450, "atom2_serNum": 8479, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/132/O", "atom2_id": "///C/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 8457, "atom2_serNum": 8487, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///C/133/O", "atom2_id": "///C/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 8465, "atom2_serNum": 8698, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/134/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 8469, "atom2_serNum": 11404, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/134/OE1", "atom2_id": "///C/479/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 8470, "atom2_serNum": 8497, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/134/OE2", "atom2_id": "///C/137/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 8474, "atom2_serNum": 8693, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/135/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 8482, "atom2_serNum": 8506, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///C/136/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 8501, "atom2_serNum": 8522, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/138/O", "atom2_id": "///C/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 8501, "atom2_serNum": 8544, "donAcc_type": "acceptable", "distance": 2.682, "atom1_id": "///C/138/O", "atom2_id": "///C/143/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 8504, "atom2_serNum": 8530, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///C/138/OD1", "atom2_id": "///C/141/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 8505, "atom2_serNum": 8707, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///C/138/OD2", "atom2_id": "///C/163/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 8505, "atom2_serNum": 10400, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/138/OD2", "atom2_id": "///C/366/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 8534, "atom2_serNum": 10387, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/142/O", "atom2_id": "///C/365/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 8537, "atom2_serNum": 10390, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/142/OD1", "atom2_id": "///C/365/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 8538, "atom2_serNum": 10456, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///C/142/OD2", "atom2_id": "///C/372/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 8557, "atom2_serNum": 8665, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/145/O", "atom2_id": "///C/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 8557, "atom2_serNum": 8670, "donAcc_type": "acceptable", "distance": 2.684, "atom1_id": "///C/145/O", "atom2_id": "///C/158/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 8560, "atom2_serNum": 10389, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///C/145/OD1", "atom2_id": "///C/365/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 8560, "atom2_serNum": 10390, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/145/OD1", "atom2_id": "///C/365/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 8573, "atom2_serNum": 8652, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/147/N", "atom2_id": "///C/156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 8576, "atom2_serNum": 8649, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/147/O", "atom2_id": "///C/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 8587, "atom2_serNum": 8647, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/148/OD1", "atom2_id": "///C/155/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 8589, "atom2_serNum": 8632, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/149/N", "atom2_id": "///C/154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 8595, "atom2_serNum": 8617, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/149/OD1", "atom2_id": "///C/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 8595, "atom2_serNum": 8621, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/149/OD1", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 8595, "atom2_serNum": 8629, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/149/OD1", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 8596, "atom2_serNum": 8615, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/149/ND2", "atom2_id": "///C/151/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 8615, "atom2_serNum": 8621, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/151/OD1", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 8661, "atom2_serNum": 13142, "donAcc_type": "acceptable", "distance": 3.922, "atom1_id": "///C/157/O", "atom2_id": "///C/502/O3", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1217, "atom1_serNum": 8681, "atom2_serNum": 10329, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/160/O", "atom2_id": "///C/358/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 8689, "atom2_serNum": 10338, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/161/O", "atom2_id": "///C/359/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 8696, "atom2_serNum": 10293, "donAcc_type": "acceptable", "distance": 2.850, "atom1_id": "///C/162/O", "atom2_id": "///C/355/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 8701, "atom2_serNum": 10293, "donAcc_type": "acceptable", "distance": 3.241, "atom1_id": "///C/163/O", "atom2_id": "///C/355/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 8705, "atom2_serNum": 10337, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/163/NE", "atom2_id": "///C/359/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 8707, "atom2_serNum": 10400, "donAcc_type": "questionable", "distance": 3.364, "atom1_id": "///C/163/NH1", "atom2_id": "///C/366/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 8707, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/163/NH1", "atom2_id": "///C/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 8708, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/163/NH2", "atom2_id": "///C/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 8712, "atom2_serNum": 8727, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///C/164/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 8723, "atom2_serNum": 8751, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 8730, "atom2_serNum": 8756, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/166/O", "atom2_id": "///C/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 8733, "atom2_serNum": 8763, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/166/OD1", "atom2_id": "///C/170/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 8738, "atom2_serNum": 8764, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/167/O", "atom2_id": "///C/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 8746, "atom2_serNum": 8857, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/168/O", "atom2_id": "///C/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 8746, "atom2_serNum": 8863, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///C/168/O", "atom2_id": "///C/186/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 8754, "atom2_serNum": 8857, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/169/O", "atom2_id": "///C/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 8768, "atom2_serNum": 8838, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/172/N", "atom2_id": "///C/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 8771, "atom2_serNum": 8835, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/172/O", "atom2_id": "///C/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 8779, "atom2_serNum": 8823, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/174/N", "atom2_id": "///C/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 8782, "atom2_serNum": 8820, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/174/O", "atom2_id": "///C/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 8786, "atom2_serNum": 12146, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///C/175/O", "atom2_id": "///E/16/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1238, "atom1_serNum": 8791, "atom2_serNum": 8810, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/176/N", "atom2_id": "///C/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 8803, "atom2_serNum": 12154, "donAcc_type": "standard", "distance": 2.427, "atom1_id": "///C/178/N", "atom2_id": "///E/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1240, "atom1_serNum": 8825, "atom2_serNum": 10094, "donAcc_type": "acceptable", "distance": 3.211, "atom1_id": "///C/181/OG1", "atom2_id": "///C/334/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 8825, "atom2_serNum": 10107, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///C/181/OG1", "atom2_id": "///C/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 8825, "atom2_serNum": 10110, "donAcc_type": "acceptable", "distance": 2.667, "atom1_id": "///C/181/OG1", "atom2_id": "///C/336/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 8827, "atom2_serNum": 10094, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/182/N", "atom2_id": "///C/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 8830, "atom2_serNum": 10091, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/182/O", "atom2_id": "///C/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 8834, "atom2_serNum": 10083, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/182/ND2", "atom2_id": "///C/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 8846, "atom2_serNum": 8863, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///C/184/O", "atom2_id": "///C/186/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 8853, "atom2_serNum": 9109, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/185/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 8866, "atom2_serNum": 9266, "donAcc_type": "acceptable", "distance": 2.602, "atom1_id": "///C/186/NE2", "atom2_id": "///C/234/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 8870, "atom2_serNum": 8899, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 8873, "atom2_serNum": 8883, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/187/OD1", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 8873, "atom2_serNum": 8890, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///C/187/OD1", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 8874, "atom2_serNum": 9116, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/187/ND2", "atom2_id": "///C/217/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 8874, "atom2_serNum": 11423, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/187/ND2", "atom2_id": "///C/482/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 8878, "atom2_serNum": 8907, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 8886, "atom2_serNum": 8915, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 8893, "atom2_serNum": 8923, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/190/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 8897, "atom2_serNum": 9080, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/190/OE1", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 8897, "atom2_serNum": 11446, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/190/OE1", "atom2_id": "///C/484/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 8898, "atom2_serNum": 11443, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///C/190/OE2", "atom2_id": "///C/484/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 8902, "atom2_serNum": 8927, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/191/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 8910, "atom2_serNum": 8934, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/192/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 8918, "atom2_serNum": 8942, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/193/O", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 8918, "atom2_serNum": 8947, "donAcc_type": "acceptable", "distance": 3.178, "atom1_id": "///C/193/O", "atom2_id": "///C/197/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 8921, "atom2_serNum": 11384, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/193/OD1", "atom2_id": "///C/477/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 8926, "atom2_serNum": 8948, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/194/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 8930, "atom2_serNum": 8956, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/195/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 8937, "atom2_serNum": 8961, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///C/196/O", "atom2_id": "///C/199/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 8937, "atom2_serNum": 8962, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///C/196/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 8945, "atom2_serNum": 8962, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///C/197/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 8945, "atom2_serNum": 8971, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///C/197/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 8947, "atom2_serNum": 9071, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///C/197/OG", "atom2_id": "///C/212/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 8951, "atom2_serNum": 8971, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/198/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 8959, "atom2_serNum": 11316, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/199/O", "atom2_id": "///C/470/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 8961, "atom2_serNum": 11313, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///C/199/OG", "atom2_id": "///C/470/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 8974, "atom2_serNum": 8994, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///C/201/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 8977, "atom2_serNum": 8986, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///C/201/OD1", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 8982, "atom2_serNum": 10233, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///C/202/O", "atom2_id": "///C/349/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 8997, "atom2_serNum": 10233, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///C/204/O", "atom2_id": "///C/349/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 9002, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/205/N", "atom2_id": "///C/208/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 9005, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/205/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 9007, "atom2_serNum": 9021, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///C/205/OG", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 9011, "atom2_serNum": 9047, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/206/O", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 9027, "atom2_serNum": 9055, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/208/O", "atom2_id": "///C/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 9042, "atom2_serNum": 9064, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/209/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 9042, "atom2_serNum": 9072, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/209/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 9086, "atom2_serNum": 9187, "donAcc_type": "standard", "distance": 3.885, "atom1_id": "///C/214/O", "atom2_id": "///C/227/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 9101, "atom2_serNum": 11446, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/215/O", "atom2_id": "///C/484/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 9105, "atom2_serNum": 11445, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/216/O", "atom2_id": "///C/484/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 9115, "atom2_serNum": 11447, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///C/217/OD1", "atom2_id": "///C/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 9115, "atom2_serNum": 11458, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/217/OD1", "atom2_id": "///C/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 9117, "atom2_serNum": 11463, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///C/218/N", "atom2_id": "///C/486/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 9120, "atom2_serNum": 9142, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/218/O", "atom2_id": "///C/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 9131, "atom2_serNum": 11456, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///C/219/O", "atom2_id": "///C/485/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 9138, "atom2_serNum": 9147, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///C/220/O", "atom2_id": "///C/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 9145, "atom2_serNum": 11463, "donAcc_type": "acceptable", "distance": 2.758, "atom1_id": "///C/221/O", "atom2_id": "///C/486/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 9147, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/222/N", "atom2_id": "///C/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 9150, "atom2_serNum": 11465, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/222/O", "atom2_id": "///C/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 9151, "atom2_serNum": 9345, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/223/N", "atom2_id": "///C/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 9154, "atom2_serNum": 9342, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/223/O", "atom2_id": "///C/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 9159, "atom2_serNum": 11468, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/224/N", "atom2_id": "///C/487/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 9162, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///C/224/O", "atom2_id": "///C/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 9167, "atom2_serNum": 9328, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/225/N", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 9175, "atom2_serNum": 11485, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///C/226/N", "atom2_id": "///C/489/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 9182, "atom2_serNum": 9206, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/227/O", "atom2_id": "///C/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 9191, "atom2_serNum": 9228, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/228/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 9197, "atom2_serNum": 9250, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/229/O", "atom2_id": "///C/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 9201, "atom2_serNum": 9255, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/230/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 9212, "atom2_serNum": 9267, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/231/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 9220, "atom2_serNum": 9281, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///C/231/NE", "atom2_id": "///C/235/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 9226, "atom2_serNum": 9281, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///C/231/NH2", "atom2_id": "///C/235/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 9234, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/232/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 9234, "atom2_serNum": 9290, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///C/232/O", "atom2_id": "///C/236/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 9253, "atom2_serNum": 9292, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///C/233/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 9258, "atom2_serNum": 10217, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/234/O", "atom2_id": "///C/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 9290, "atom2_serNum": 9296, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///C/236/OG1", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 9290, "atom2_serNum": 9299, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///C/236/OG1", "atom2_id": "///C/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 9295, "atom2_serNum": 10099, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/237/O", "atom2_id": "///C/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 9305, "atom2_serNum": 12234, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/238/NH1", "atom2_id": "///E/19/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1319, "atom1_serNum": 9306, "atom2_serNum": 12236, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/238/NH2", "atom2_id": "///E/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1320, "atom1_serNum": 9307, "atom2_serNum": 10087, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///C/239/N", "atom2_id": "///C/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 9310, "atom2_serNum": 10084, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///C/239/O", "atom2_id": "///C/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 9316, "atom2_serNum": 9333, "donAcc_type": "acceptable", "distance": 3.578, "atom1_id": "///C/240/OG", "atom2_id": "///C/242/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 9316, "atom2_serNum": 12272, "donAcc_type": "acceptable", "distance": 3.442, "atom1_id": "///C/240/OG", "atom2_id": "///E/20/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1324, "atom1_serNum": 9317, "atom2_serNum": 10072, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/241/N", "atom2_id": "///C/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 9320, "atom2_serNum": 10069, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///C/241/O", "atom2_id": "///C/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 9332, "atom2_serNum": 10055, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/242/OE1", "atom2_id": "///C/328/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 9334, "atom2_serNum": 10059, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///C/243/N", "atom2_id": "///C/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 9337, "atom2_serNum": 10056, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/243/O", "atom2_id": "///C/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 9349, "atom2_serNum": 10054, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///C/244/NE", "atom2_id": "///C/328/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 9352, "atom2_serNum": 10054, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///C/244/NH2", "atom2_id": "///C/328/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 9353, "atom2_serNum": 10037, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/245/N", "atom2_id": "///C/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 9358, "atom2_serNum": 10037, "donAcc_type": "acceptable", "distance": 2.935, "atom1_id": "///C/245/OG", "atom2_id": "///C/327/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 9359, "atom2_serNum": 9494, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/246/N", "atom2_id": "///C/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 9362, "atom2_serNum": 9484, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/246/O", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 9366, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/246/NE", "atom2_id": "///C/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 9369, "atom2_serNum": 11472, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///C/246/NH2", "atom2_id": "///C/487/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 9375, "atom2_serNum": 9473, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/248/N", "atom2_id": "///C/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 9378, "atom2_serNum": 9470, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/248/O", "atom2_id": "///C/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 9390, "atom2_serNum": 9454, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/250/N", "atom2_id": "///C/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 9393, "atom2_serNum": 9451, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/250/O", "atom2_id": "///C/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 9398, "atom2_serNum": 9458, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/250/OE2", "atom2_id": "///C/258/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 9398, "atom2_serNum": 9461, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///C/250/OE2", "atom2_id": "///C/258/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 9398, "atom2_serNum": 9850, "donAcc_type": "standard", "distance": 3.472, "atom1_id": "///C/250/OE2", "atom2_id": "///C/303/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 9408, "atom2_serNum": 9434, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/252/N", "atom2_id": "///C/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 9415, "atom2_serNum": 9445, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/252/NE", "atom2_id": "///C/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 9418, "atom2_serNum": 9884, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/252/NH2", "atom2_id": "///C/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 9422, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///C/253/O", "atom2_id": "///C/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 9445, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/257/O", "atom2_id": "///C/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 9462, "atom2_serNum": 9868, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/259/N", "atom2_id": "///C/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 9465, "atom2_serNum": 9865, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/259/O", "atom2_id": "///C/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 9477, "atom2_serNum": 9854, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/261/N", "atom2_id": "///C/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 9480, "atom2_serNum": 9851, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/261/O", "atom2_id": "///C/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 9511, "atom2_serNum": 9535, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///C/265/O", "atom2_id": "///C/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 9545, "atom2_serNum": 9586, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/269/O", "atom2_id": "///C/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 9548, "atom2_serNum": 9559, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/269/OD1", "atom2_id": "///C/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 9548, "atom2_serNum": 9564, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/269/OD1", "atom2_id": "///C/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 9553, "atom2_serNum": 9602, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/270/O", "atom2_id": "///C/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 9558, "atom2_serNum": 9780, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///C/270/NZ", "atom2_id": "///C/294/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 9562, "atom2_serNum": 9610, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/271/O", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 9570, "atom2_serNum": 9628, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/272/O", "atom2_id": "///C/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 9582, "atom2_serNum": 12417, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/272/NH1", "atom2_id": "///F/1004/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1362, "atom1_serNum": 9584, "atom2_serNum": 12377, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///C/272/NH2", "atom2_id": "///F/1003/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1363, "atom1_serNum": 9592, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/273/O", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 9605, "atom2_serNum": 9645, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/274/O", "atom2_id": "///C/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 9616, "atom2_serNum": 9650, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/275/O", "atom2_id": "///C/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 9626, "atom2_serNum": 9683, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///C/275/OE2", "atom2_id": "///C/282/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 9631, "atom2_serNum": 9659, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/276/O", "atom2_id": "///C/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 9640, "atom2_serNum": 9667, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/277/O", "atom2_id": "///C/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 9648, "atom2_serNum": 9674, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/278/O", "atom2_id": "///C/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 9653, "atom2_serNum": 9685, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/279/O", "atom2_id": "///C/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 9662, "atom2_serNum": 9702, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///C/280/O", "atom2_id": "///C/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 9670, "atom2_serNum": 9693, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/281/O", "atom2_id": "///C/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 9692, "atom2_serNum": 9710, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///C/283/OD2", "atom2_id": "///C/285/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 9705, "atom2_serNum": 10015, "donAcc_type": "questionable", "distance": 3.278, "atom1_id": "///C/285/O", "atom2_id": "///C/324/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 9725, "atom2_serNum": 9897, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///C/287/OD1", "atom2_id": "///C/309/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 9726, "atom2_serNum": 9898, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///C/287/OD2", "atom2_id": "///C/309/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 9730, "atom2_serNum": 9888, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///C/288/O", "atom2_id": "///C/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 9739, "atom2_serNum": 9876, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/290/N", "atom2_id": "///C/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 9749, "atom2_serNum": 9873, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/291/O", "atom2_id": "///C/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 9753, "atom2_serNum": 9771, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/291/OD2", "atom2_id": "///C/293/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 9762, "atom2_serNum": 9861, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/293/N", "atom2_id": "///C/305/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 9765, "atom2_serNum": 9858, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///C/293/O", "atom2_id": "///C/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 9769, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/293/NE", "atom2_id": "///C/295/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 9771, "atom2_serNum": 9880, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/293/NH1", "atom2_id": "///C/307/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 9772, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/293/NH2", "atom2_id": "///C/295/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 9779, "atom2_serNum": 9781, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///C/294/OD1", "atom2_id": "///C/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 9779, "atom2_serNum": 9790, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/294/OD1", "atom2_id": "///C/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 9779, "atom2_serNum": 9795, "donAcc_type": "acceptable", "distance": 2.577, "atom1_id": "///C/294/OD1", "atom2_id": "///C/296/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 9781, "atom2_serNum": 9843, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///C/295/N", "atom2_id": "///C/303/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 9784, "atom2_serNum": 9827, "donAcc_type": "acceptable", "distance": 3.518, "atom1_id": "///C/295/O", "atom2_id": "///C/300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 9788, "atom2_serNum": 9847, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/295/OE1", "atom2_id": "///C/303/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 9795, "atom2_serNum": 9840, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///C/296/OG1", "atom2_id": "///C/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 9797, "atom2_serNum": 9832, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///C/297/N", "atom2_id": "///C/301/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 9800, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///C/297/O", "atom2_id": "///C/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 9802, "atom2_serNum": 9822, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///C/297/OG", "atom2_id": "///C/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 9827, "atom2_serNum": 9832, "donAcc_type": "acceptable", "distance": 3.051, "atom1_id": "///C/300/OG1", "atom2_id": "///C/301/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 9891, "atom2_serNum": 9916, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/309/O", "atom2_id": "///C/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 9919, "atom2_serNum": 9929, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///C/312/O", "atom2_id": "///C/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 9924, "atom2_serNum": 9947, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///C/313/O", "atom2_id": "///C/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 9927, "atom2_serNum": 9934, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/313/OD1", "atom2_id": "///C/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 9927, "atom2_serNum": 9940, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/313/OD1", "atom2_id": "///C/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 9932, "atom2_serNum": 9955, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/314/O", "atom2_id": "///C/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 9937, "atom2_serNum": 9963, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/315/O", "atom2_id": "///C/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 9943, "atom2_serNum": 9971, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/316/O", "atom2_id": "///C/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 9950, "atom2_serNum": 9979, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/317/O", "atom2_id": "///C/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 9958, "atom2_serNum": 9987, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/318/O", "atom2_id": "///C/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 9966, "atom2_serNum": 9999, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/319/O", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 9974, "atom2_serNum": 10008, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/320/O", "atom2_id": "///C/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 9974, "atom2_serNum": 10016, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///C/320/O", "atom2_id": "///C/324/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 9977, "atom2_serNum": 10007, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///C/320/OD1", "atom2_id": "///C/323/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 9982, "atom2_serNum": 10017, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/321/O", "atom2_id": "///C/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 9982, "atom2_serNum": 10022, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///C/321/O", "atom2_id": "///C/325/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 10020, "atom2_serNum": 10050, "donAcc_type": "questionable", "distance": 3.186, "atom1_id": "///C/325/O", "atom2_id": "///C/328/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 10022, "atom2_serNum": 10031, "donAcc_type": "acceptable", "distance": 3.126, "atom1_id": "///C/325/OG1", "atom2_id": "///C/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 10027, "atom2_serNum": 10061, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///C/326/O", "atom2_id": "///C/329/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 10072, "atom2_serNum": 10084, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///C/331/O", "atom2_id": "///C/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 10094, "atom2_serNum": 10107, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/334/O", "atom2_id": "///C/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 10102, "atom2_serNum": 10201, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///C/335/O", "atom2_id": "///C/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 10115, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/337/N", "atom2_id": "///C/344/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 10118, "atom2_serNum": 10184, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/337/O", "atom2_id": "///C/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 10128, "atom2_serNum": 10161, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/339/N", "atom2_id": "///C/342/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 10131, "atom2_serNum": 10155, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/339/O", "atom2_id": "///C/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 10192, "atom2_serNum": 10196, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///C/344/NZ", "atom2_id": "///C/345/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 10192, "atom2_serNum": 10248, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/344/NZ", "atom2_id": "///C/350/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 10209, "atom2_serNum": 10250, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/347/N", "atom2_id": "///C/350/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 10212, "atom2_serNum": 10252, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///C/347/O", "atom2_id": "///C/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 10215, "atom2_serNum": 10225, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///C/347/OD1", "atom2_id": "///C/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 10215, "atom2_serNum": 10234, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/347/OD1", "atom2_id": "///C/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 10220, "atom2_serNum": 10257, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///C/348/O", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 10228, "atom2_serNum": 10265, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///C/349/O", "atom2_id": "///C/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 10240, "atom2_serNum": 10272, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/350/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 10255, "atom2_serNum": 10282, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/351/O", "atom2_id": "///C/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 10260, "atom2_serNum": 10294, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///C/352/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 10268, "atom2_serNum": 10302, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/353/O", "atom2_id": "///C/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 10275, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///C/354/O", "atom2_id": "///C/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 10285, "atom2_serNum": 10330, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/355/O", "atom2_id": "///C/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 10297, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/356/O", "atom2_id": "///C/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 10308, "atom2_serNum": 10348, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/357/O", "atom2_id": "///C/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 10308, "atom2_serNum": 10353, "donAcc_type": "acceptable", "distance": 3.194, "atom1_id": "///C/357/O", "atom2_id": "///C/361/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 10318, "atom2_serNum": 10353, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///C/357/OE2", "atom2_id": "///C/361/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 10323, "atom2_serNum": 10355, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/358/O", "atom2_id": "///C/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 10333, "atom2_serNum": 10362, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/359/O", "atom2_id": "///C/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 10342, "atom2_serNum": 10369, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/360/O", "atom2_id": "///C/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 10351, "atom2_serNum": 10380, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/361/O", "atom2_id": "///C/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 10358, "atom2_serNum": 10391, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/362/O", "atom2_id": "///C/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 10365, "atom2_serNum": 10402, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/363/O", "atom2_id": "///C/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 10365, "atom2_serNum": 10407, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///C/363/O", "atom2_id": "///C/367/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 10372, "atom2_serNum": 10409, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/364/O", "atom2_id": "///C/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 10378, "atom2_serNum": 11240, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///C/364/NH1", "atom2_id": "///C/462/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 10383, "atom2_serNum": 10418, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///C/365/O", "atom2_id": "///C/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 10394, "atom2_serNum": 10430, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/366/O", "atom2_id": "///C/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 10400, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/366/NH1", "atom2_id": "///C/472/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 10401, "atom2_serNum": 11333, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/366/NH2", "atom2_id": "///C/472/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 10405, "atom2_serNum": 10438, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/367/O", "atom2_id": "///C/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 10412, "atom2_serNum": 10446, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/368/O", "atom2_id": "///C/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 10421, "atom2_serNum": 10457, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///C/369/O", "atom2_id": "///C/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 10433, "atom2_serNum": 10475, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/370/O", "atom2_id": "///C/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 10441, "atom2_serNum": 10480, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/371/O", "atom2_id": "///C/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 10449, "atom2_serNum": 10489, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/372/O", "atom2_id": "///C/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 10463, "atom2_serNum": 10497, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/373/O", "atom2_id": "///C/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 10478, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/374/O", "atom2_id": "///C/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 10483, "atom2_serNum": 10513, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/375/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 10492, "atom2_serNum": 10523, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/376/O", "atom2_id": "///C/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 10500, "atom2_serNum": 10531, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/377/O", "atom2_id": "///C/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 10504, "atom2_serNum": 11075, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/377/NE", "atom2_id": "///C/444/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 10507, "atom2_serNum": 11076, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/377/NH2", "atom2_id": "///C/444/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 10511, "atom2_serNum": 10539, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/378/O", "atom2_id": "///C/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 10516, "atom2_serNum": 10548, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///C/379/O", "atom2_id": "///C/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 10516, "atom2_serNum": 10880, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/379/O", "atom2_id": "///C/421/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 10522, "atom2_serNum": 10853, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///C/379/NE2", "atom2_id": "///C/418/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 10526, "atom2_serNum": 10548, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/380/O", "atom2_id": "///C/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 10526, "atom2_serNum": 10552, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/380/O", "atom2_id": "///C/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 10534, "atom2_serNum": 10560, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/381/O", "atom2_id": "///C/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 10542, "atom2_serNum": 10571, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///C/382/O", "atom2_id": "///C/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 10547, "atom2_serNum": 11088, "donAcc_type": "acceptable", "distance": 2.518, "atom1_id": "///C/382/OE2", "atom2_id": "///C/445/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 10551, "atom2_serNum": 10579, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/383/O", "atom2_id": "///C/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 10555, "atom2_serNum": 10584, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/384/O", "atom2_id": "///C/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1478, "atom1_serNum": 10563, "atom2_serNum": 10592, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/385/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 10567, "atom2_serNum": 11061, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/385/NE", "atom2_id": "///C/442/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 10569, "atom2_serNum": 13156, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///C/385/NH1", "atom2_id": "///C/504/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1481, "atom1_serNum": 10574, "atom2_serNum": 10600, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/386/O", "atom2_id": "///C/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 10603, "atom2_serNum": 10644, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/390/O", "atom2_id": "///C/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 10606, "atom2_serNum": 10640, "donAcc_type": "acceptable", "distance": 3.624, "atom1_id": "///C/390/ND1", "atom2_id": "///C/393/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 10613, "atom2_serNum": 10652, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/391/O", "atom2_id": "///C/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 10621, "atom2_serNum": 10660, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/392/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 10632, "atom2_serNum": 10666, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/393/O", "atom2_id": "///C/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 10632, "atom2_serNum": 10671, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///C/393/O", "atom2_id": "///C/397/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 10642, "atom2_serNum": 10819, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/393/OE2", "atom2_id": "///C/414/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 10647, "atom2_serNum": 10673, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/394/O", "atom2_id": "///C/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 10655, "atom2_serNum": 10681, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/395/O", "atom2_id": "///C/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 10663, "atom2_serNum": 10692, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/396/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 10669, "atom2_serNum": 10715, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///C/397/O", "atom2_id": "///C/401/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 10676, "atom2_serNum": 10710, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///C/398/O", "atom2_id": "///C/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 10727, "atom2_serNum": 10755, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/403/O", "atom2_id": "///C/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 10729, "atom2_serNum": 10748, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///C/403/OG1", "atom2_id": "///C/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 10734, "atom2_serNum": 10760, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/404/O", "atom2_id": "///C/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 10742, "atom2_serNum": 10768, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/405/O", "atom2_id": "///C/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 10747, "atom2_serNum": 10775, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/405/NZ", "atom2_id": "///C/409/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 10751, "atom2_serNum": 10777, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/406/O", "atom2_id": "///C/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 10758, "atom2_serNum": 10783, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/407/O", "atom2_id": "///C/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 10763, "atom2_serNum": 10791, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/408/O", "atom2_id": "///C/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 10763, "atom2_serNum": 10799, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///C/408/O", "atom2_id": "///C/412/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 10771, "atom2_serNum": 10800, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/409/O", "atom2_id": "///C/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 10780, "atom2_serNum": 10809, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///C/410/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 10786, "atom2_serNum": 10820, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/411/O", "atom2_id": "///C/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 10794, "atom2_serNum": 10840, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/412/O", "atom2_id": "///C/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 10848, "atom2_serNum": 10879, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/418/N", "atom2_id": "///C/421/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 10851, "atom2_serNum": 10881, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///C/418/O", "atom2_id": "///C/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 10853, "atom2_serNum": 10872, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///C/418/OG", "atom2_id": "///C/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 10857, "atom2_serNum": 10886, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/419/O", "atom2_id": "///C/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 10866, "atom2_serNum": 10904, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/420/O", "atom2_id": "///C/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 10875, "atom2_serNum": 10909, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/421/O", "atom2_id": "///C/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 10884, "atom2_serNum": 10917, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/422/O", "atom2_id": "///C/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 10892, "atom2_serNum": 10925, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/423/O", "atom2_id": "///C/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 10907, "atom2_serNum": 10933, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/424/O", "atom2_id": "///C/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 10912, "atom2_serNum": 10933, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/425/O", "atom2_id": "///C/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 10944, "atom2_serNum": 10971, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/429/O", "atom2_id": "///C/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 10955, "atom2_serNum": 10982, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/430/O", "atom2_id": "///C/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 10963, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///C/431/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 10963, "atom2_serNum": 10995, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///C/431/O", "atom2_id": "///C/434/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 10985, "atom2_serNum": 11028, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/433/O", "atom2_id": "///C/438/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 10993, "atom2_serNum": 11018, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/434/O", "atom2_id": "///C/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 11000, "atom2_serNum": 11029, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/435/O", "atom2_id": "///C/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 11004, "atom2_serNum": 11037, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/436/O", "atom2_id": "///C/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 11012, "atom2_serNum": 11046, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/437/O", "atom2_id": "///C/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 11016, "atom2_serNum": 11045, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///C/437/OE1", "atom2_id": "///C/440/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 11021, "atom2_serNum": 11054, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///C/438/O", "atom2_id": "///C/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 11032, "atom2_serNum": 11063, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///C/439/O", "atom2_id": "///C/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 11040, "atom2_serNum": 11068, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/440/O", "atom2_id": "///C/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 11049, "atom2_serNum": 11077, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/441/O", "atom2_id": "///C/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 11057, "atom2_serNum": 11089, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/442/O", "atom2_id": "///C/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 11062, "atom2_serNum": 11096, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/442/OE2", "atom2_id": "///C/446/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 11066, "atom2_serNum": 11097, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///C/443/O", "atom2_id": "///C/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 11071, "atom2_serNum": 11106, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/444/O", "atom2_id": "///C/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 11080, "atom2_serNum": 11114, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/445/O", "atom2_id": "///C/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 11092, "atom2_serNum": 11122, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///C/446/O", "atom2_id": "///C/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 11100, "atom2_serNum": 11138, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/447/O", "atom2_id": "///C/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 11109, "atom2_serNum": 11150, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/448/O", "atom2_id": "///C/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 11117, "atom2_serNum": 11158, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///C/449/O", "atom2_id": "///C/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 11128, "atom2_serNum": 11170, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/450/O", "atom2_id": "///C/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 11141, "atom2_serNum": 11179, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/451/O", "atom2_id": "///C/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 11153, "atom2_serNum": 11187, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/452/O", "atom2_id": "///C/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 11164, "atom2_serNum": 11196, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///C/453/O", "atom2_id": "///C/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 11164, "atom2_serNum": 11201, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///C/453/O", "atom2_id": "///C/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 11173, "atom2_serNum": 11203, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///C/454/O", "atom2_id": "///C/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 11182, "atom2_serNum": 11211, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/455/O", "atom2_id": "///C/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 11190, "atom2_serNum": 11219, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/456/O", "atom2_id": "///C/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 11199, "atom2_serNum": 11224, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///C/457/O", "atom2_id": "///C/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 11227, "atom2_serNum": 11259, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/461/O", "atom2_id": "///C/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 11227, "atom2_serNum": 11266, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///C/461/O", "atom2_id": "///C/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 11230, "atom2_serNum": 11241, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///C/461/OD1", "atom2_id": "///C/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 11235, "atom2_serNum": 11274, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/462/O", "atom2_id": "///C/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 11247, "atom2_serNum": 11282, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/463/O", "atom2_id": "///C/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 11257, "atom2_serNum": 11315, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/463/OE2", "atom2_id": "///C/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 11262, "atom2_serNum": 11291, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/464/O", "atom2_id": "///C/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 11269, "atom2_serNum": 11299, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/465/O", "atom2_id": "///C/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 11277, "atom2_serNum": 11306, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/466/O", "atom2_id": "///C/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 11285, "atom2_serNum": 11317, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/467/O", "atom2_id": "///C/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 11289, "atom2_serNum": 11315, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/467/OE1", "atom2_id": "///C/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 11290, "atom2_serNum": 11323, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/467/NE2", "atom2_id": "///C/471/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 11294, "atom2_serNum": 11325, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/468/O", "atom2_id": "///C/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 11302, "atom2_serNum": 11334, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/469/O", "atom2_id": "///C/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 11309, "atom2_serNum": 11342, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/470/O", "atom2_id": "///C/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 11309, "atom2_serNum": 11347, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///C/470/O", "atom2_id": "///C/474/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 11320, "atom2_serNum": 11349, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/471/O", "atom2_id": "///C/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 11328, "atom2_serNum": 11367, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/472/O", "atom2_id": "///C/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 11337, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///C/473/O", "atom2_id": "///C/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 11345, "atom2_serNum": 11386, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/474/O", "atom2_id": "///C/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 11355, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/475/O", "atom2_id": "///C/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 11370, "atom2_serNum": 11405, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/476/O", "atom2_id": "///C/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 11378, "atom2_serNum": 11416, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///C/477/O", "atom2_id": "///C/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 11385, "atom2_serNum": 11392, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/477/NH2", "atom2_id": "///C/478/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 11420, "atom2_serNum": 11426, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///C/482/N", "atom2_id": "///C/482/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 11445, "atom2_serNum": 11461, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/484/NH1", "atom2_id": "///C/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 11473, "atom2_serNum": 11490, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///C/487/OE2", "atom2_id": "///C/489/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 11568, "atom2_serNum": 13062, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///E/2/O6", "atom2_id": "///G/2019/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1577, "atom1_serNum": 11570, "atom2_serNum": 13058, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///E/2/N1", "atom2_id": "///G/2019/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1578, "atom1_serNum": 11574, "atom2_serNum": 13056, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///E/2/N2", "atom2_id": "///G/2019/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1579, "atom1_serNum": 11606, "atom2_serNum": 13024, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///E/3/O2", "atom2_id": "///G/2018/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1580, "atom1_serNum": 11608, "atom2_serNum": 13020, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///E/3/N3", "atom2_id": "///G/2018/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1581, "atom1_serNum": 11612, "atom2_serNum": 13018, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///E/3/N4", "atom2_id": "///G/2018/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1582, "atom1_serNum": 11620, "atom2_serNum": 13102, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///E/4/OP1", "atom2_id": "///A/501/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1583, "atom1_serNum": 11644, "atom2_serNum": 12980, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///E/4/O2", "atom2_id": "///G/2017/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1584, "atom1_serNum": 11646, "atom2_serNum": 12976, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/4/N3", "atom2_id": "///G/2017/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1585, "atom1_serNum": 11650, "atom2_serNum": 12974, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///E/4/N4", "atom2_id": "///G/2017/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1586, "atom1_serNum": 11688, "atom2_serNum": 12936, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///E/5/O6", "atom2_id": "///G/2016/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1587, "atom1_serNum": 11690, "atom2_serNum": 12932, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///E/5/N1", "atom2_id": "///G/2016/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1588, "atom1_serNum": 11694, "atom2_serNum": 12930, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///E/5/N2", "atom2_id": "///G/2016/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1589, "atom1_serNum": 11728, "atom2_serNum": 12896, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///E/6/N3", "atom2_id": "///G/2015/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1590, "atom1_serNum": 11732, "atom2_serNum": 12894, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///E/6/O4", "atom2_id": "///G/2015/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1591, "atom1_serNum": 11772, "atom2_serNum": 12854, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///E/7/N6", "atom2_id": "///G/2014/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1592, "atom1_serNum": 11774, "atom2_serNum": 12850, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///E/7/N1", "atom2_id": "///G/2014/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1593, "atom1_serNum": 11814, "atom2_serNum": 12816, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/8/O6", "atom2_id": "///G/2013/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1594, "atom1_serNum": 11816, "atom2_serNum": 12812, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///E/8/N1", "atom2_id": "///G/2013/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1595, "atom1_serNum": 11820, "atom2_serNum": 12810, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///E/8/N2", "atom2_id": "///G/2013/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1596, "atom1_serNum": 11858, "atom2_serNum": 12778, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///E/9/O6", "atom2_id": "///G/2012/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1597, "atom1_serNum": 11860, "atom2_serNum": 12774, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///E/9/N1", "atom2_id": "///G/2012/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1598, "atom1_serNum": 11864, "atom2_serNum": 12772, "donAcc_type": "standard", "distance": 2.433, "atom1_id": "///E/9/N2", "atom2_id": "///G/2012/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1599, "atom1_serNum": 11898, "atom2_serNum": 12738, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/10/N3", "atom2_id": "///G/2011/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1600, "atom1_serNum": 11902, "atom2_serNum": 12736, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///E/10/O4", "atom2_id": "///G/2011/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1601, "atom1_serNum": 11942, "atom2_serNum": 12696, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///E/11/N6", "atom2_id": "///G/2010/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1602, "atom1_serNum": 11944, "atom2_serNum": 12692, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///E/11/N1", "atom2_id": "///G/2010/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1603, "atom1_serNum": 11978, "atom2_serNum": 12658, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///E/12/O2", "atom2_id": "///G/2009/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1604, "atom1_serNum": 11980, "atom2_serNum": 12654, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///E/12/N3", "atom2_id": "///G/2009/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1605, "atom1_serNum": 11984, "atom2_serNum": 12652, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///E/12/N4", "atom2_id": "///G/2009/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1606, "atom1_serNum": 12022, "atom2_serNum": 12617, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///E/13/N6", "atom2_id": "///F/1008/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1607, "atom1_serNum": 12024, "atom2_serNum": 12613, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///E/13/N1", "atom2_id": "///F/1008/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1608, "atom1_serNum": 12058, "atom2_serNum": 12579, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///E/14/O2", "atom2_id": "///F/1007/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1609, "atom1_serNum": 12060, "atom2_serNum": 12575, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///E/14/N3", "atom2_id": "///F/1007/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1610, "atom1_serNum": 12064, "atom2_serNum": 12573, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///E/14/N4", "atom2_id": "///F/1007/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1611, "atom1_serNum": 12096, "atom2_serNum": 12535, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///E/15/O2", "atom2_id": "///F/1006/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1612, "atom1_serNum": 12098, "atom2_serNum": 12531, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///E/15/N3", "atom2_id": "///F/1006/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1613, "atom1_serNum": 12102, "atom2_serNum": 12529, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/15/N4", "atom2_id": "///F/1006/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1614, "atom1_serNum": 12140, "atom2_serNum": 12491, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///E/16/O6", "atom2_id": "///F/1005/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1615, "atom1_serNum": 12142, "atom2_serNum": 12487, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/16/N1", "atom2_id": "///F/1005/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1616, "atom1_serNum": 12146, "atom2_serNum": 12485, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/16/N2", "atom2_id": "///F/1005/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1617, "atom1_serNum": 12178, "atom2_serNum": 12453, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///E/17/O2", "atom2_id": "///F/1004/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1618, "atom1_serNum": 12180, "atom2_serNum": 12449, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/17/N3", "atom2_id": "///F/1004/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1619, "atom1_serNum": 12184, "atom2_serNum": 12447, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///E/17/N4", "atom2_id": "///F/1004/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1620, "atom1_serNum": 12222, "atom2_serNum": 12407, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///E/18/N6", "atom2_id": "///F/1003/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1621, "atom1_serNum": 12224, "atom2_serNum": 12403, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/18/N1", "atom2_id": "///F/1003/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1622, "atom1_serNum": 12258, "atom2_serNum": 12369, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///E/19/O2", "atom2_id": "///F/1002/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1623, "atom1_serNum": 12260, "atom2_serNum": 12365, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///E/19/N3", "atom2_id": "///F/1002/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1624, "atom1_serNum": 12264, "atom2_serNum": 12363, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///E/19/N4", "atom2_id": "///F/1002/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1625, "atom1_serNum": 12291, "atom2_serNum": 12323, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///E/20/N6", "atom2_id": "///F/1001/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1626, "atom1_serNum": 12292, "atom2_serNum": 12319, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///E/20/N1", "atom2_id": "///F/1001/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1627, "atom1_serNum": 12417, "atom2_serNum": 13162, "donAcc_type": "acceptable", "distance": 3.433, "atom1_id": "///F/1004/OP1", "atom2_id": "///C/505/O1", "atom_pair": "O:O", "residue_pair": "nt:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "5iwi", "num_aaChains": 4, "aaChains": "A=483,B=192,C=481,D=189", "num_naChains": 3, "naChains": "E=20,F=8,G=12", "num_atoms": 12478, "num_waters": 949, "num_metals": 3, "metals_desc": "Mn=3", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }