{ "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.038, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.134, "chi2": -155.610, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.130, "C1C1_dist": 10.724, "N1N9_dist": 9.022, "C6C8_dist": 9.932, "CNNC_torsion": -4.238, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 6.966, "planarity": 0.077, "simple_Shear": -0.428, "simple_Stretch": -0.106, "simple_Buckle": -3.943, "simple_Propeller": -5.742, "bp_simpleParams": [ -0.428, -0.106, -0.118, -3.943, -5.742, -0.436 ], "bp_params": [ -0.424, -0.122, -0.118, -3.726, -5.885, -0.436 ], "frame": { "rmsd": null, "origin": [ 4.368, 13.031, 2.350 ], "x_axis": [ -0.168, -0.958, -0.234 ], "y_axis": [ 0.983, -0.181, 0.037 ], "z_axis": [ -0.078, -0.224, 0.971 ], "quaternion": [ 0.637, 0.102, 0.061, -0.762 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.521, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.559, "chi2": -159.434, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.936, "C1C1_dist": 10.699, "N1N9_dist": 9.022, "C6C8_dist": 9.955, "CNNC_torsion": -8.279, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 9.865, "planarity": 0.117, "simple_Shear": -0.356, "simple_Stretch": -0.092, "simple_Buckle": -1.830, "simple_Propeller": -9.694, "bp_simpleParams": [ -0.356, -0.092, -0.033, -1.830, -9.694, 0.331 ], "bp_params": [ -0.353, -0.103, -0.033, -1.530, -9.745, 0.332 ], "frame": { "rmsd": null, "origin": [ 2.324, 11.602, 5.129 ], "x_axis": [ 0.342, -0.870, -0.354 ], "y_axis": [ 0.939, 0.300, 0.169 ], "z_axis": [ -0.041, -0.390, 0.920 ], "quaternion": [ 0.800, 0.175, 0.098, -0.565 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.924, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.626, "chi2": -161.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.960, "C1C1_dist": 10.685, "N1N9_dist": 9.010, "C6C8_dist": 9.948, "CNNC_torsion": -10.640, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.90]", "interBase_angle": 12.029, "planarity": 0.149, "simple_Shear": -0.076, "simple_Stretch": -0.036, "simple_Buckle": -5.653, "simple_Propeller": -10.618, "bp_simpleParams": [ -0.076, -0.036, 0.058, -5.653, -10.618, -1.305 ], "bp_params": [ -0.076, -0.036, 0.058, -5.646, -10.622, -1.309 ], "frame": { "rmsd": null, "origin": [ 0.711, 9.048, 7.584 ], "x_axis": [ 0.779, -0.518, -0.354 ], "y_axis": [ 0.623, 0.706, 0.338 ], "z_axis": [ 0.075, -0.484, 0.872 ], "quaternion": [ 0.916, 0.224, 0.117, -0.311 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.733, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.850, "chi2": -164.956, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.381, "C1C1_dist": 10.723, "N1N9_dist": 9.039, "C6C8_dist": 9.972, "CNNC_torsion": -9.665, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 9.703, "planarity": 0.124, "simple_Shear": 0.019, "simple_Stretch": -0.019, "simple_Buckle": -5.841, "simple_Propeller": -7.748, "bp_simpleParams": [ 0.019, -0.019, 0.310, -5.841, -7.748, -1.794 ], "bp_params": [ 0.019, -0.019, 0.310, -5.827, -7.758, -1.796 ], "frame": { "rmsd": null, "origin": [ 0.183, 5.621, 9.536 ], "x_axis": [ 0.980, -0.052, -0.191 ], "y_axis": [ 0.138, 0.871, 0.472 ], "z_axis": [ 0.142, -0.489, 0.861 ], "quaternion": [ 0.963, 0.249, 0.086, -0.049 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.936, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.428, "chi2": -155.668, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.929, "C1C1_dist": 10.716, "N1N9_dist": 8.992, "C6C8_dist": 9.890, "CNNC_torsion": -15.560, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 16.242, "planarity": 0.207, "simple_Shear": 0.431, "simple_Stretch": -0.139, "simple_Buckle": -2.346, "simple_Propeller": -16.072, "bp_simpleParams": [ 0.431, -0.139, 0.118, -2.346, -16.072, -0.371 ], "bp_params": [ 0.425, -0.157, 0.118, -2.979, -15.967, -0.375 ], "frame": { "rmsd": null, "origin": [ 0.894, 2.414, 11.231 ], "x_axis": [ 0.914, 0.402, 0.064 ], "y_axis": [ -0.368, 0.750, 0.550 ], "z_axis": [ 0.173, -0.526, 0.833 ], "quaternion": [ 0.935, 0.288, 0.029, 0.206 ] } }, { "index": 6, "nt1": "///A/7", "nt2": "///A/36", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -59.950, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 67.639, "chi2": -91.164, "conf2": "anti", "pucker2": "----", "lambda2": 71.632, "C1C1_dist": 9.134, "N1N9_dist": 8.203, "C6C8_dist": 9.902, "CNNC_torsion": -63.397, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.12]", "interBase_angle": 70.064, "planarity": 0.876, "simple_Shear": 0.048, "simple_Stretch": 0.950, "simple_Buckle": 11.724, "simple_Propeller": -69.076, "bp_simpleParams": [ 0.048, 0.950, 0.573, 11.724, -69.076, 49.575 ], "bp_params": [ 0.040, 0.950, 0.573, 10.943, -69.204, 58.415 ], "frame": { "rmsd": null, "origin": [ 5.793, -1.455, 16.750 ], "x_axis": [ 0.702, 0.587, 0.402 ], "y_axis": [ -0.094, -0.483, 0.870 ], "z_axis": [ 0.705, -0.649, -0.284 ], "quaternion": [ 0.483, 0.786, 0.157, 0.352 ] } }, { "index": 7, "nt1": "///A/12", "nt2": "///A/35", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.808, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.624, "chi2": -132.978, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.553, "C1C1_dist": 10.890, "N1N9_dist": 9.107, "C6C8_dist": 9.955, "CNNC_torsion": -5.466, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.85],N1-N3(imino)[2.95]", "interBase_angle": 7.609, "planarity": 0.093, "simple_Shear": -0.116, "simple_Stretch": -0.032, "simple_Buckle": 1.176, "simple_Propeller": -7.518, "bp_simpleParams": [ -0.116, -0.032, 0.077, 1.176, -7.518, -5.347 ], "bp_params": [ -0.116, -0.032, 0.077, 1.227, -7.509, -5.358 ], "frame": { "rmsd": null, "origin": [ 3.129, -12.390, 9.482 ], "x_axis": [ 0.130, -0.917, -0.376 ], "y_axis": [ -0.912, -0.259, 0.318 ], "z_axis": [ -0.389, 0.302, -0.870 ], "quaternion": [ 0.005, 0.752, -0.608, -0.254 ] } }, { "index": 8, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.150, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.754, "chi2": -156.044, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.274, "C1C1_dist": 10.671, "N1N9_dist": 8.993, "C6C8_dist": 9.927, "CNNC_torsion": -17.516, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 19.680, "planarity": 0.234, "simple_Shear": -0.339, "simple_Stretch": -0.117, "simple_Buckle": -3.651, "simple_Propeller": -19.339, "bp_simpleParams": [ -0.339, -0.117, -0.010, -3.651, -19.339, 0.717 ], "bp_params": [ -0.335, -0.126, -0.010, -3.091, -19.436, 0.727 ], "frame": { "rmsd": null, "origin": [ 3.275, -12.571, 5.607 ], "x_axis": [ -0.171, -0.982, 0.081 ], "y_axis": [ -0.917, 0.189, 0.351 ], "z_axis": [ -0.360, -0.014, -0.933 ], "quaternion": [ -0.145, -0.627, 0.757, 0.111 ] } }, { "index": 9, "nt1": "///A/14", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.018, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.323, "chi2": -153.228, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.346, "C1C1_dist": 10.730, "N1N9_dist": 8.994, "C6C8_dist": 9.866, "CNNC_torsion": -16.236, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 24.326, "planarity": 0.276, "simple_Shear": -0.300, "simple_Stretch": -0.093, "simple_Buckle": -15.433, "simple_Propeller": -18.804, "bp_simpleParams": [ -0.300, -0.093, -0.056, -15.433, -18.804, -1.178 ], "bp_params": [ -0.299, -0.098, -0.056, -15.135, -19.044, -1.185 ], "frame": { "rmsd": null, "origin": [ 3.355, -13.548, 1.786 ], "x_axis": [ -0.555, -0.717, 0.421 ], "y_axis": [ -0.698, 0.677, 0.232 ], "z_axis": [ -0.452, -0.165, -0.877 ], "quaternion": [ -0.248, -0.402, 0.882, 0.019 ] } }, { "index": 10, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.967, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.614, "chi2": -153.454, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.502, "C1C1_dist": 10.528, "N1N9_dist": 8.932, "C6C8_dist": 9.941, "CNNC_torsion": -13.862, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 15.793, "planarity": 0.193, "simple_Shear": -0.019, "simple_Stretch": -0.022, "simple_Buckle": -9.718, "simple_Propeller": -12.449, "bp_simpleParams": [ -0.019, -0.022, 0.329, -9.718, -12.449, 1.477 ], "bp_params": [ -0.019, -0.023, 0.329, -9.675, -12.483, 1.481 ], "frame": { "rmsd": null, "origin": [ 2.625, -15.594, -1.195 ], "x_axis": [ -0.824, -0.271, 0.498 ], "y_axis": [ -0.306, 0.952, 0.012 ], "z_axis": [ -0.477, -0.143, -0.867 ], "quaternion": [ -0.255, -0.151, 0.954, -0.034 ] } }, { "index": 11, "nt1": "///A/16", "nt2": "///A/31", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.464, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.505, "chi2": -151.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.925, "C1C1_dist": 10.542, "N1N9_dist": 8.957, "C6C8_dist": 9.896, "CNNC_torsion": -16.510, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.92],N1(imino)-O2(carbonyl)[2.80]", "interBase_angle": 16.486, "planarity": 0.209, "simple_Shear": -2.336, "simple_Stretch": 0.118, "simple_Buckle": -8.712, "simple_Propeller": -13.995, "bp_simpleParams": [ -2.336, 0.118, 0.244, -8.712, -13.995, 0.714 ], "bp_params": [ -2.303, -0.408, 0.244, -5.333, -15.599, 0.720 ], "frame": { "rmsd": null, "origin": [ 1.249, -17.892, -3.647 ], "x_axis": [ -0.835, 0.112, 0.539 ], "y_axis": [ 0.029, 0.987, -0.161 ], "z_axis": [ -0.550, -0.119, -0.827 ], "quaternion": [ -0.285, 0.037, 0.955, -0.073 ] } }, { "index": 12, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.812, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.120, "chi2": -159.102, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.161, "C1C1_dist": 10.539, "N1N9_dist": 8.950, "C6C8_dist": 9.978, "CNNC_torsion": -15.972, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 15.586, "planarity": 0.199, "simple_Shear": -0.018, "simple_Stretch": -0.021, "simple_Buckle": -0.342, "simple_Propeller": -15.583, "bp_simpleParams": [ -0.018, -0.021, 0.270, -0.342, -15.583, 2.127 ], "bp_params": [ -0.018, -0.021, 0.270, -0.226, -15.585, 2.146 ], "frame": { "rmsd": null, "origin": [ -1.120, -19.572, -5.792 ], "x_axis": [ -0.594, 0.715, 0.369 ], "y_axis": [ 0.550, 0.695, -0.462 ], "z_axis": [ -0.587, -0.071, -0.806 ], "quaternion": [ -0.272, 0.360, 0.880, -0.152 ] } }, { "index": 13, "nt1": "///A/18", "nt2": "///A/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.211, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.970, "chi2": -158.582, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.501, "C1C1_dist": 10.741, "N1N9_dist": 9.004, "C6C8_dist": 9.888, "CNNC_torsion": -16.715, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 15.698, "planarity": 0.198, "simple_Shear": -0.432, "simple_Stretch": -0.152, "simple_Buckle": 1.237, "simple_Propeller": -15.650, "bp_simpleParams": [ -0.432, -0.152, 0.259, 1.237, -15.650, -1.481 ], "bp_params": [ -0.426, -0.169, 0.259, 1.851, -15.589, -1.495 ], "frame": { "rmsd": null, "origin": [ -4.107, -21.124, -7.573 ], "x_axis": [ -0.211, 0.958, 0.193 ], "y_axis": [ 0.770, 0.285, -0.571 ], "z_axis": [ -0.602, 0.028, -0.798 ], "quaternion": [ -0.262, 0.571, 0.757, -0.179 ] } }, { "index": 14, "nt1": "///A/19", "nt2": "///A/28", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.344, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.812, "chi2": -156.440, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.143, "C1C1_dist": 10.559, "N1N9_dist": 8.968, "C6C8_dist": 9.894, "CNNC_torsion": -18.067, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.93],N1(imino)-O2(carbonyl)[2.80]", "interBase_angle": 14.621, "planarity": 0.207, "simple_Shear": -2.341, "simple_Stretch": 0.111, "simple_Buckle": 4.397, "simple_Propeller": -13.945, "bp_simpleParams": [ -2.341, 0.111, 0.682, 4.397, -13.945, -0.179 ], "bp_params": [ -2.303, -0.434, 0.682, 7.489, -12.558, -0.179 ], "frame": { "rmsd": null, "origin": [ -7.387, -21.007, -8.841 ], "x_axis": [ 0.140, 0.989, 0.040 ], "y_axis": [ 0.851, -0.099, -0.516 ], "z_axis": [ -0.507, 0.106, -0.855 ], "quaternion": [ -0.215, 0.724, 0.636, -0.161 ] } }, { "index": 15, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.481, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.624, "chi2": -171.950, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.864, "C1C1_dist": 10.738, "N1N9_dist": 9.024, "C6C8_dist": 9.910, "CNNC_torsion": -17.590, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 22.796, "planarity": 0.292, "simple_Shear": 0.112, "simple_Stretch": -0.075, "simple_Buckle": 14.202, "simple_Propeller": -17.832, "bp_simpleParams": [ 0.112, -0.075, 0.276, 14.202, -17.832, -2.036 ], "bp_params": [ 0.112, -0.075, 0.276, 14.223, -17.815, -2.045 ], "frame": { "rmsd": null, "origin": [ -10.269, -20.063, -10.712 ], "x_axis": [ 0.686, 0.661, -0.304 ], "y_axis": [ 0.526, -0.739, -0.421 ], "z_axis": [ -0.503, 0.129, -0.854 ], "quaternion": [ -0.152, 0.905, 0.328, -0.223 ] } }, { "index": 16, "nt1": "///A/21", "nt2": "///A/26", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -148.236, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.384, "chi2": -149.328, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 79.951, "C1C1_dist": 11.438, "N1N9_dist": 10.300, "C6C8_dist": 11.461, "CNNC_torsion": 6.077, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N1[3.22]", "interBase_angle": 6.008, "planarity": 0.338, "simple_Shear": -2.321, "simple_Stretch": 1.920, "simple_Buckle": 3.469, "simple_Propeller": -4.905, "bp_simpleParams": [ -2.321, 1.920, -1.607, 3.469, -4.905, 17.713 ], "bp_params": [ -2.713, 1.309, -1.607, 4.542, -3.933, 17.710 ], "frame": { "rmsd": null, "origin": [ -11.723, -16.962, -13.219 ], "x_axis": [ 0.914, 0.376, -0.154 ], "y_axis": [ 0.262, -0.835, -0.484 ], "z_axis": [ -0.311, 0.402, -0.861 ], "quaternion": [ -0.233, 0.950, 0.168, -0.122 ] } }, { "index": 17, "nt1": "///A/22", "nt2": "///A/25", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -148.917, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.595, "chi2": -165.787, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 20.204, "C1C1_dist": 10.134, "N1N9_dist": 8.330, "C6C8_dist": 8.178, "CNNC_torsion": -122.624, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.00]", "interBase_angle": 38.090, "planarity": 0.466, "simple_Shear": 6.662, "simple_Stretch": 2.891, "simple_Buckle": 23.275, "simple_Propeller": 30.152, "bp_simpleParams": [ 6.662, 2.891, -0.070, 23.275, 30.152, -58.642 ], "bp_params": [ 6.401, -3.430, -0.070, 38.085, 0.641, -55.930 ], "frame": { "rmsd": null, "origin": [ -16.652, -14.574, -13.746 ], "x_axis": [ 0.700, -0.612, -0.370 ], "y_axis": [ -0.664, -0.747, -0.021 ], "z_axis": [ -0.263, 0.260, -0.929 ], "quaternion": [ -0.077, 0.919, -0.347, -0.172 ] } }, { "index": 18, "nt1": "///A/22", "nt2": "///A/26", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -148.917, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.922, "chi2": -149.328, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 90.687, "C1C1_dist": 8.867, "N1N9_dist": 8.141, "C6C8_dist": 9.803, "CNNC_torsion": 8.025, "hbonds_num": 1, "hbonds_desc": "N4(amino)-N1[3.23]", "interBase_angle": 15.094, "planarity": 0.380, "simple_Shear": -2.108, "simple_Stretch": 0.547, "simple_Buckle": 8.014, "simple_Propeller": 12.791, "bp_simpleParams": [ -2.108, 0.547, 1.431, 8.014, 12.791, 41.756 ], "bp_params": [ -2.178, 0.038, 1.431, 4.780, 14.317, 42.023 ], "frame": { "rmsd": null, "origin": [ -12.084, -15.421, -14.331 ], "x_axis": [ 0.987, 0.124, -0.105 ], "y_axis": [ 0.064, -0.890, -0.451 ], "z_axis": [ -0.150, 0.438, -0.887 ], "quaternion": [ -0.229, 0.970, 0.048, -0.066 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGAUC", "strand2": "CCUAG", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.656, "helical_rise_std": 0.164, "helical_radius": 10.143, "helical_radius_std": 0.383, "helical_axis": [ 0.193, -0.293, 0.937 ], "point1": [ 3.909, 7.795, 0.541 ], "point2": [ 5.948, 4.698, 10.450 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.424, -0.122, -0.118, -3.726, -5.885, -0.436 ], "step_params": [ 0.330, -1.895, 3.201, -1.197, 10.123, 29.127 ], "heli_params": [ -5.307, -0.827, 2.407, 19.394, 2.293, 30.823 ], "bp2_params": [ -0.353, -0.103, -0.033, -1.530, -9.745, 0.332 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.201, "simple_Twist": 28.851, "simple_hRise": 2.398, "simple_hTwist": 30.563 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.353, -0.103, -0.033, -1.530, -9.745, 0.332 ], "step_params": [ 0.014, -2.067, 3.298, -1.855, 8.795, 31.408 ], "heli_params": [ -5.091, -0.322, 2.633, 15.844, 3.341, 32.637 ], "bp2_params": [ -0.076, -0.036, 0.058, -5.646, -10.622, -1.309 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.298, "simple_Twist": 29.665, "simple_hRise": 2.588, "simple_hTwist": 30.967 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.036, 0.058, -5.646, -10.622, -1.309 ], "step_params": [ -0.015, -2.219, 3.302, -1.014, 3.775, 30.709 ], "heli_params": [ -4.865, -0.163, 3.014, 7.092, 1.905, 30.951 ], "bp2_params": [ 0.019, -0.019, 0.310, -5.827, -7.758, -1.796 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 30.422, "simple_hRise": 3.011, "simple_hTwist": 30.667 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.019, -0.019, 0.310, -5.827, -7.758, -1.796 ], "step_params": [ -0.016, -1.892, 3.176, 2.825, 1.469, 30.368 ], "heli_params": [ -3.872, 0.568, 3.069, 2.795, -5.373, 30.531 ], "bp2_params": [ 0.425, -0.157, 0.118, -2.979, -15.967, -0.375 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.176, "simple_Twist": 28.119, "simple_hRise": 3.059, "simple_hTwist": 28.295 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "AGGUGUGGC", "strand2": "UCCAUACUG", "bp_type": "|||||||||", "helix_form": "AAA..A..", "helical_rise": 3.188, "helical_rise_std": 0.264, "helical_radius": 9.948, "helical_radius_std": 0.309, "helical_axis": [ -0.501, -0.014, -0.865 ], "point1": [ 4.526, -16.664, 9.423 ], "point2": [ -8.394, -17.030, -12.887 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/12", "nt2": "///A/35", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.116, -0.032, 0.077, 1.227, -7.509, -5.358 ], "step_params": [ 0.758, -1.590, 3.459, 2.188, 18.459, 26.220 ], "heli_params": [ -5.949, -1.010, 1.993, 35.561, -4.215, 32.046 ], "bp2_params": [ -0.335, -0.126, -0.010, -3.091, -19.436, 0.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.459, "simple_Twist": 27.358, "simple_hRise": 2.058, "simple_hTwist": 32.975 }, { "index": 2, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.335, -0.126, -0.010, -3.091, -19.436, 0.727 ], "step_params": [ -0.153, -1.759, 3.527, -1.532, 10.565, 31.904 ], "heli_params": [ -4.767, 0.015, 2.822, 18.582, 2.695, 33.598 ], "bp2_params": [ -0.299, -0.098, -0.056, -15.135, -19.044, -1.185 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.527, "simple_Twist": 31.202, "simple_hRise": 2.803, "simple_hTwist": 32.935 }, { "index": 3, "nt1": "///A/14", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.299, -0.098, -0.056, -15.135, -19.044, -1.185 ], "step_params": [ 0.163, -1.730, 3.254, -1.914, 0.621, 30.566 ], "heli_params": [ -3.395, -0.682, 3.203, 1.176, 3.626, 30.630 ], "bp2_params": [ -0.019, -0.023, 0.329, -9.675, -12.483, 1.481 ], "groove_widths": [ 16.407, null, 19.258, null ], "simple_Rise": 3.254, "simple_Twist": 29.434, "simple_hRise": 3.201, "simple_hTwist": 29.501 }, { "index": 4, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.019, -0.023, 0.329, -9.675, -12.483, 1.481 ], "step_params": [ 0.062, -1.912, 3.087, -1.762, 4.624, 21.707 ], "heli_params": [ -6.488, -0.746, 2.614, 12.077, 4.601, 22.257 ], "bp2_params": [ -2.303, -0.408, 0.244, -5.333, -15.599, 0.720 ], "groove_widths": [ 16.570, 15.469, 19.151, 18.312 ], "simple_Rise": 3.087, "simple_Twist": 34.192, "simple_hRise": 2.805, "simple_hTwist": 34.538 }, { "index": 5, "nt1": "///A/16", "nt2": "///A/31", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.303, -0.408, 0.244, -5.333, -15.599, 0.720 ], "step_params": [ 0.039, -1.552, 3.259, -1.386, 3.401, 39.092 ], "heli_params": [ -2.706, -0.219, 3.115, 5.069, 2.066, 39.258 ], "bp2_params": [ -0.018, -0.021, 0.270, -0.226, -15.585, 2.146 ], "groove_widths": [ 16.760, 15.626, 19.261, 18.839 ], "simple_Rise": 3.259, "simple_Twist": 26.824, "simple_hRise": 3.037, "simple_hTwist": 27.070 }, { "index": 6, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.018, -0.021, 0.270, -0.226, -15.585, 2.146 ], "step_params": [ -0.602, -1.904, 3.243, -2.027, 5.389, 27.639 ], "heli_params": [ -5.090, 0.789, 2.863, 11.127, 4.184, 28.221 ], "bp2_params": [ -0.426, -0.169, 0.259, 1.851, -15.589, -1.495 ], "groove_widths": [ 16.591, null, 19.064, null ], "simple_Rise": 3.243, "simple_Twist": 29.770, "simple_hRise": 2.895, "simple_hTwist": 30.309 }, { "index": 7, "nt1": "///A/18", "nt2": "///A/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.426, -0.169, 0.259, 1.851, -15.589, -1.495 ], "step_params": [ 0.116, -2.016, 2.881, -6.773, 3.847, 21.846 ], "heli_params": [ -6.116, -2.225, 2.354, 9.759, 17.185, 23.177 ], "bp2_params": [ -2.303, -0.434, 0.682, 7.489, -12.558, -0.179 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.881, "simple_Twist": 32.383, "simple_hRise": 2.556, "simple_hTwist": 33.283 }, { "index": 8, "nt1": "///A/19", "nt2": "///A/28", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.303, -0.434, 0.682, 7.489, -12.558, -0.179 ], "step_params": [ -0.180, -1.625, 3.167, 0.476, 1.287, 42.441 ], "heli_params": [ -2.369, 0.295, 3.116, 1.777, -0.657, 42.462 ], "bp2_params": [ 0.112, -0.075, 0.276, 14.223, -17.815, -2.045 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.167, "simple_Twist": 29.545, "simple_hRise": 3.091, "simple_hTwist": 29.576 }, { "index": 9, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGAUC", "strand2": "CCUAG", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.656, "helical_rise_std": 0.164, "helical_radius": 10.143, "helical_radius_std": 0.383, "helical_axis": [ 0.193, -0.293, 0.937 ], "point1": [ 3.909, 7.795, 0.541 ], "point2": [ 5.948, 4.698, 10.450 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.424, -0.122, -0.118, -3.726, -5.885, -0.436 ], "step_params": [ 0.330, -1.895, 3.201, -1.197, 10.123, 29.127 ], "heli_params": [ -5.307, -0.827, 2.407, 19.394, 2.293, 30.823 ], "bp2_params": [ -0.353, -0.103, -0.033, -1.530, -9.745, 0.332 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.201, "simple_Twist": 28.851, "simple_hRise": 2.398, "simple_hTwist": 30.563 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.353, -0.103, -0.033, -1.530, -9.745, 0.332 ], "step_params": [ 0.014, -2.067, 3.298, -1.855, 8.795, 31.408 ], "heli_params": [ -5.091, -0.322, 2.633, 15.844, 3.341, 32.637 ], "bp2_params": [ -0.076, -0.036, 0.058, -5.646, -10.622, -1.309 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.298, "simple_Twist": 29.665, "simple_hRise": 2.588, "simple_hTwist": 30.967 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.036, 0.058, -5.646, -10.622, -1.309 ], "step_params": [ -0.015, -2.219, 3.302, -1.014, 3.775, 30.709 ], "heli_params": [ -4.865, -0.163, 3.014, 7.092, 1.905, 30.951 ], "bp2_params": [ 0.019, -0.019, 0.310, -5.827, -7.758, -1.796 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 30.422, "simple_hRise": 3.011, "simple_hTwist": 30.667 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.019, -0.019, 0.310, -5.827, -7.758, -1.796 ], "step_params": [ -0.016, -1.892, 3.176, 2.825, 1.469, 30.368 ], "heli_params": [ -3.872, 0.568, 3.069, 2.795, -5.373, 30.531 ], "bp2_params": [ 0.425, -0.157, 0.118, -2.979, -15.967, -0.375 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.176, "simple_Twist": 28.119, "simple_hRise": 3.059, "simple_hTwist": 28.295 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "AGGUGUGGC", "strand2": "UCCAUACUG", "bp_type": "|||||||||", "helix_form": "AAA..A..", "helical_rise": 3.188, "helical_rise_std": 0.264, "helical_radius": 9.948, "helical_radius_std": 0.309, "helical_axis": [ -0.501, -0.014, -0.865 ], "point1": [ 4.526, -16.664, 9.423 ], "point2": [ -8.394, -17.030, -12.887 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/12", "nt2": "///A/35", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.116, -0.032, 0.077, 1.227, -7.509, -5.358 ], "step_params": [ 0.758, -1.590, 3.459, 2.188, 18.459, 26.220 ], "heli_params": [ -5.949, -1.010, 1.993, 35.561, -4.215, 32.046 ], "bp2_params": [ -0.335, -0.126, -0.010, -3.091, -19.436, 0.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.459, "simple_Twist": 27.358, "simple_hRise": 2.058, "simple_hTwist": 32.975 }, { "index": 2, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.335, -0.126, -0.010, -3.091, -19.436, 0.727 ], "step_params": [ -0.153, -1.759, 3.527, -1.532, 10.565, 31.904 ], "heli_params": [ -4.767, 0.015, 2.822, 18.582, 2.695, 33.598 ], "bp2_params": [ -0.299, -0.098, -0.056, -15.135, -19.044, -1.185 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.527, "simple_Twist": 31.202, "simple_hRise": 2.803, "simple_hTwist": 32.935 }, { "index": 3, "nt1": "///A/14", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.299, -0.098, -0.056, -15.135, -19.044, -1.185 ], "step_params": [ 0.163, -1.730, 3.254, -1.914, 0.621, 30.566 ], "heli_params": [ -3.395, -0.682, 3.203, 1.176, 3.626, 30.630 ], "bp2_params": [ -0.019, -0.023, 0.329, -9.675, -12.483, 1.481 ], "groove_widths": [ 16.407, null, 19.258, null ], "simple_Rise": 3.254, "simple_Twist": 29.434, "simple_hRise": 3.201, "simple_hTwist": 29.501 }, { "index": 4, "nt1": "///A/15", "nt2": "///A/32", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.019, -0.023, 0.329, -9.675, -12.483, 1.481 ], "step_params": [ 0.062, -1.912, 3.087, -1.762, 4.624, 21.707 ], "heli_params": [ -6.488, -0.746, 2.614, 12.077, 4.601, 22.257 ], "bp2_params": [ -2.303, -0.408, 0.244, -5.333, -15.599, 0.720 ], "groove_widths": [ 16.570, 15.469, 19.151, 18.312 ], "simple_Rise": 3.087, "simple_Twist": 34.192, "simple_hRise": 2.805, "simple_hTwist": 34.538 }, { "index": 5, "nt1": "///A/16", "nt2": "///A/31", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.303, -0.408, 0.244, -5.333, -15.599, 0.720 ], "step_params": [ 0.039, -1.552, 3.259, -1.386, 3.401, 39.092 ], "heli_params": [ -2.706, -0.219, 3.115, 5.069, 2.066, 39.258 ], "bp2_params": [ -0.018, -0.021, 0.270, -0.226, -15.585, 2.146 ], "groove_widths": [ 16.760, 15.626, 19.261, 18.839 ], "simple_Rise": 3.259, "simple_Twist": 26.824, "simple_hRise": 3.037, "simple_hTwist": 27.070 }, { "index": 6, "nt1": "///A/17", "nt2": "///A/30", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.018, -0.021, 0.270, -0.226, -15.585, 2.146 ], "step_params": [ -0.602, -1.904, 3.243, -2.027, 5.389, 27.639 ], "heli_params": [ -5.090, 0.789, 2.863, 11.127, 4.184, 28.221 ], "bp2_params": [ -0.426, -0.169, 0.259, 1.851, -15.589, -1.495 ], "groove_widths": [ 16.591, null, 19.064, null ], "simple_Rise": 3.243, "simple_Twist": 29.770, "simple_hRise": 2.895, "simple_hTwist": 30.309 }, { "index": 7, "nt1": "///A/18", "nt2": "///A/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.426, -0.169, 0.259, 1.851, -15.589, -1.495 ], "step_params": [ 0.116, -2.016, 2.881, -6.773, 3.847, 21.846 ], "heli_params": [ -6.116, -2.225, 2.354, 9.759, 17.185, 23.177 ], "bp2_params": [ -2.303, -0.434, 0.682, 7.489, -12.558, -0.179 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.881, "simple_Twist": 32.383, "simple_hRise": 2.556, "simple_hTwist": 33.283 }, { "index": 8, "nt1": "///A/19", "nt2": "///A/28", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.303, -0.434, 0.682, 7.489, -12.558, -0.179 ], "step_params": [ -0.180, -1.625, 3.167, 0.476, 1.287, 42.441 ], "heli_params": [ -2.369, 0.295, 3.116, 1.777, -0.657, 42.462 ], "bp2_params": [ 0.112, -0.075, 0.276, 14.223, -17.815, -2.045 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.167, "simple_Twist": 29.545, "simple_hRise": 3.091, "simple_hTwist": 29.576 }, { "index": 9, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/6,///A/37" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/9,///A/10" }, { "index": 3, "num_nts": 3, "nts_short": "CAG", "nts_long": "///A/22,///A/21,///A/27" }, { "index": 4, "num_nts": 4, "nts_short": "ACCA", "nts_long": "///A/23,///A/24,///A/25,///A/26" } ], "nonStack": { "num_nts": 4, "nts_short": "AUCU", "nts_long": "///A/7,///A/8,///A/11,///A/36" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/10/O4'", "nt": "///A/12", "vert_dist": 3.370 }, { "index": 2, "type": "phosphate", "atom": "///A/24/OP2", "nt": "///A/22", "vert_dist": 3.018 }, { "index": 3, "type": "sugar", "atom": "///A/26/O4'", "nt": "///A/25", "vert_dist": 3.199 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 6 ], "stem_indices": [ 2 ], "summary": "[1] 6 [A.20 A.27] 9", "num_nts": 8, "nts_short": "CACACCAG", "nts_long": "///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "ACACCA", "nts_long": "///A/21,///A/22,///A/23,///A/24,///A/25,///A/26" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 6, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 6 1 [A.5 A.37 A.12 A.35] 5 9", "num_nts": 11, "nts_short": "CAAUAGCAUUG", "nts_long": "///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/35,///A/36,///A/37", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "AAUAGC", "nts_long": "///A/6,///A/7,///A/8,///A/9,///A/10,///A/11" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///A/36" } ] } ], "num_Aminors": 1, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs A-U (--)", "desc_long": "///A/6 vs ///A/7,///A/36", "A_nt1": { "desc": "///A/6 vs ///A/7", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/6 vs ///A/36", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.90]" } } ], "num_splayUnits": 3, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "AUA", "nts_long": "///A/7,///A/8,///A/9" }, { "index": 2, "num_nts": 3, "nts_short": "GCA", "nts_long": "///A/10,///A/11,///A/12" }, { "index": 3, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/35,///A/36" } ], "dbn": { "all_chains": { "num_nts": 41, "num_chars": 41, "bseq": "GGAUCAAUAGCAGGUGUGGCACACCAGUCAUACCUUGAUCC", "sstr": "(((((......(((((((((......))))))))).)))))", "form": "AAAA.......AAAAAAAAAA.A...AAAAAAAA..AAAA-" }, "m1_chain_A": { "num_nts": 41, "num_chars": 41, "bseq": "GGAUCAAUAGCAGGUGUGGCACACCAGUCAUACCUUGAUCC", "sstr": "(((((......(((((((((......))))))))).)))))", "form": "AAAA.......AAAAAAAAAA.A...AAAAAAAA..AAAA-" } }, "chains": { "m1_chain_A": { "num_nts": 41, "bseq": "GGAUCAAUAGCAGGUGUGGCACACCAGUCAUACCUUGAUCC", "sstr": "(((((......(((((((((......))))))))).)))))", "form": "AAAA.......AAAAAAAAAA.A...AAAAAAAA..AAAA-", "helical_rise": 0.101, "helical_rise_std": 2.925, "helical_axis": [ -0.426, -0.195, -0.884 ], "point1": [ 1.280, -6.987, 11.860 ], "point2": [ -0.566, -7.832, 8.030 ], "num_chars": 121, "suite": "G1aG1aA1aU1cC!!A!!A1oU2hA1aG5pC2aA1aG1aG1aU1aG1aU1aG1aG1aC1aA1aC1gA1aC1aC!!A1aG1aU1aC1aA1aU1aA1aC1aC1bU!!U!!G1aA1aU1aC1aC" } }, "num_nts": 41, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 57.824, "delta": 77.307, "epsilon": -157.011, "zeta": -62.870, "epsilon_zeta": -94.141, "bb_type": "BI", "chi": -160.038, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.806, 0.568 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.494, "Dp": 4.700, "splay_angle": 23.325, "splay_distance": 3.850, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.059, "v1": -30.491, "v2": 40.047, "v3": -37.803, "v4": 19.777, "amplitude": 40.572, "phase_angle": 9.231, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 4.349, 13.258, 2.341 ], "x_axis": [ -0.174, -0.967, -0.184 ], "y_axis": [ 0.984, -0.178, 0.004 ], "z_axis": [ -0.037, -0.180, 0.983 ], "quaternion": [ 0.638, 0.072, 0.058, -0.764 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.386, "beta": 174.636, "gamma": 62.929, "delta": 72.254, "epsilon": -159.660, "zeta": -63.898, "epsilon_zeta": -95.762, "bb_type": "BI", "chi": -164.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.822, 0.848 ], "P_xyz": [ 0.859, 9.632, 0.852 ], "form": "A", "ssZp": 4.611, "Dp": 4.710, "splay_angle": 24.665, "splay_distance": 3.963, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 165.102, "theta": -151.806, "eta_prime": 179.465, "theta_prime": -150.628, "eta_base": -140.603, "theta_base": -125.663, "v0": 3.323, "v1": -29.033, "v2": 41.294, "v3": -41.376, "v4": 24.384, "amplitude": 42.697, "phase_angle": 14.726, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.638, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 2.216, 11.747, 5.168 ], "x_axis": [ 0.341, -0.899, -0.274 ], "y_axis": [ 0.938, 0.308, 0.158 ], "z_axis": [ -0.057, -0.311, 0.949 ], "quaternion": [ 0.806, 0.145, 0.067, -0.570 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.160, "beta": 175.185, "gamma": 63.051, "delta": 76.591, "epsilon": -156.159, "zeta": -65.174, "epsilon_zeta": -90.985, "bb_type": "BI", "chi": -168.924, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.669, 1.061 ], "P_xyz": [ 0.884, 9.357, 1.334 ], "form": "A", "ssZp": 4.598, "Dp": 4.694, "splay_angle": 24.758, "splay_distance": 4.083, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 171.920, "theta": -146.426, "eta_prime": -175.914, "theta_prime": -145.562, "eta_base": -136.830, "theta_base": -123.490, "v0": 4.184, "v1": -28.561, "v2": 39.739, "v3": -39.142, "v4": 22.437, "amplitude": 40.829, "phase_angle": 13.265, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.631, "filter_rmsd": 0.052, "frame": { "rmsd": 0.027, "origin": [ 0.672, 9.040, 7.617 ], "x_axis": [ 0.777, -0.567, -0.275 ], "y_axis": [ 0.629, 0.721, 0.291 ], "z_axis": [ 0.033, -0.399, 0.916 ], "quaternion": [ 0.924, 0.187, 0.083, -0.324 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.454, "beta": 178.388, "gamma": 61.453, "delta": 73.741, "epsilon": -173.692, "zeta": -75.462, "epsilon_zeta": -98.229, "bb_type": "BI", "chi": -163.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.757, 8.814, 0.807 ], "P_xyz": [ 0.742, 9.640, 1.013 ], "form": "A", "ssZp": 4.541, "Dp": 4.583, "splay_angle": 21.985, "splay_distance": 3.625, "splay_ratio": 0.199, "d22": 4.447, "d64": 4.897, "eta": 167.884, "theta": -144.614, "eta_prime": -177.936, "theta_prime": -151.459, "eta_base": -140.090, "theta_base": -125.911, "v0": 2.176, "v1": -27.197, "v2": 39.431, "v3": -39.951, "v4": 24.298, "amplitude": 41.028, "phase_angle": 16.034, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.096, "frame": { "rmsd": 0.025, "origin": [ 0.213, 5.537, 9.663 ], "x_axis": [ 0.986, -0.097, -0.138 ], "y_axis": [ 0.148, 0.893, 0.425 ], "z_axis": [ 0.082, -0.439, 0.894 ], "quaternion": [ 0.971, 0.223, 0.057, -0.063 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": 162.247, "beta": -163.313, "gamma": 166.185, "delta": 81.976, "epsilon": 175.518, "zeta": 49.473, "epsilon_zeta": 126.045, "bb_type": "--", "chi": 179.936, "glyco_bond": "anti", "C5prime_xyz": [ -0.990, 8.084, 1.705 ], "P_xyz": [ 0.881, 9.577, 0.575 ], "form": ".", "ssZp": 4.484, "Dp": 4.581, "splay_angle": 43.120, "splay_distance": 6.873, "splay_ratio": 0.383, "d22": null, "d64": null, "eta": 162.386, "theta": -62.668, "eta_prime": -179.035, "theta_prime": -105.792, "eta_base": -129.358, "theta_base": -169.044, "v0": 22.280, "v1": -40.765, "v2": 42.138, "v3": -30.401, "v4": 5.476, "amplitude": 43.053, "phase_angle": 348.168, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.620, "filter_rmsd": 0.059, "frame": { "rmsd": 0.015, "origin": [ 1.127, 2.409, 11.251 ], "x_axis": [ 0.929, 0.324, 0.178 ], "y_axis": [ -0.368, 0.765, 0.529 ], "z_axis": [ 0.035, -0.557, 0.830 ], "quaternion": [ 0.939, 0.289, -0.038, 0.184 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,internal-loop,A-minor,phosphate", "alpha": 159.787, "beta": 169.452, "gamma": 51.802, "delta": 102.241, "epsilon": -59.022, "zeta": 85.526, "epsilon_zeta": 215.452, "bb_type": "--", "chi": -53.592, "glyco_bond": "--", "C5prime_xyz": [ -5.614, 6.023, -1.559 ], "P_xyz": [ -6.445, 6.525, -4.010 ], "form": ".", "ssZp": 1.407, "Dp": 1.380, "splay_angle": 54.772, "splay_distance": 8.331, "splay_ratio": 0.487, "d22": null, "d64": null, "eta": 87.110, "theta": 123.294, "eta_prime": 125.109, "theta_prime": 125.595, "eta_base": 93.571, "theta_base": -153.835, "v0": -56.725, "v1": 47.083, "v2": -19.498, "v3": -13.142, "v4": 43.909, "amplitude": 55.785, "phase_angle": 110.458, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.034, "origin": [ 0.127, -4.375, 11.705 ], "x_axis": [ 0.694, 0.064, -0.717 ], "y_axis": [ 0.394, 0.800, 0.452 ], "z_axis": [ 0.603, -0.596, 0.530 ], "quaternion": [ 0.869, 0.302, 0.380, -0.095 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-stack,non-canonical,internal-loop,A-minor,splayed-apart", "alpha": 97.957, "beta": -156.582, "gamma": -164.974, "delta": 89.946, "epsilon": -168.733, "zeta": -86.532, "epsilon_zeta": -82.202, "bb_type": "BI", "chi": -59.950, "glyco_bond": "--", "C5prime_xyz": [ -2.560, 5.211, -3.485 ], "P_xyz": [ -3.439, 3.307, -5.134 ], "form": ".", "ssZp": -1.851, "Dp": 4.626, "splay_angle": 127.567, "splay_distance": 19.150, "splay_ratio": 0.898, "d22": null, "d64": null, "eta": -158.974, "theta": 159.904, "eta_prime": -162.352, "theta_prime": 138.873, "eta_base": -87.984, "theta_base": 104.259, "v0": 26.279, "v1": -40.447, "v2": 38.186, "v3": -24.294, "v4": -0.976, "amplitude": 40.707, "phase_angle": 339.728, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.057, "frame": { "rmsd": 0.033, "origin": [ 5.965, -1.859, 17.090 ], "x_axis": [ 0.832, -0.159, 0.532 ], "y_axis": [ -0.522, -0.548, 0.653 ], "z_axis": [ 0.188, -0.821, -0.539 ], "quaternion": [ 0.432, 0.854, -0.199, 0.211 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -89.520, "beta": -160.800, "gamma": -69.642, "delta": 150.537, "epsilon": -91.680, "zeta": -84.964, "epsilon_zeta": -6.716, "bb_type": "--", "chi": -133.763, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.769, -0.372 ], "P_xyz": [ -2.307, 11.431, -0.399 ], "form": ".", "ssZp": 0.825, "Dp": 0.959, "splay_angle": 125.098, "splay_distance": 18.711, "splay_ratio": 0.888, "d22": null, "d64": null, "eta": 79.872, "theta": -95.985, "eta_prime": 66.381, "theta_prime": -102.669, "eta_base": 60.271, "theta_base": -119.880, "v0": -25.185, "v1": 41.994, "v2": -41.165, "v3": 28.200, "v4": -2.252, "amplitude": 42.860, "phase_angle": 163.833, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "1o", "suiteness": 0.241, "filter_rmsd": 0.096, "frame": { "rmsd": 0.025, "origin": [ -8.960, -12.860, 21.882 ], "x_axis": [ -0.797, 0.599, 0.076 ], "y_axis": [ 0.603, 0.786, 0.134 ], "z_axis": [ 0.021, 0.153, -0.988 ], "quaternion": [ -0.014, 0.318, 0.945, 0.076 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": -82.923, "beta": 170.613, "gamma": 174.248, "delta": 72.228, "epsilon": -122.071, "zeta": -68.488, "epsilon_zeta": -53.584, "bb_type": "--", "chi": 160.699, "glyco_bond": "anti", "C5prime_xyz": [ -2.785, 8.648, 1.690 ], "P_xyz": [ -1.781, 11.062, 1.253 ], "form": ".", "ssZp": 3.719, "Dp": 4.028, "splay_angle": 21.118, "splay_distance": 3.609, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -100.035, "theta": -163.027, "eta_prime": -69.973, "theta_prime": -155.679, "eta_base": -31.921, "theta_base": -100.865, "v0": -25.587, "v1": -3.400, "v2": 28.084, "v3": -44.258, "v4": 44.425, "amplitude": 45.678, "phase_angle": 52.060, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.345, "filter_rmsd": 0.055, "frame": { "rmsd": 0.028, "origin": [ 6.972, -10.892, 12.269 ], "x_axis": [ 0.884, 0.224, 0.410 ], "y_axis": [ -0.448, 0.156, 0.880 ], "z_axis": [ 0.133, -0.962, 0.238 ], "quaternion": [ 0.755, 0.610, -0.092, 0.223 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart", "alpha": -78.026, "beta": 161.644, "gamma": 56.262, "delta": 80.808, "epsilon": -98.544, "zeta": 89.286, "epsilon_zeta": 172.170, "bb_type": "--", "chi": -155.517, "glyco_bond": "anti", "C5prime_xyz": [ -2.042, 8.981, 0.208 ], "P_xyz": [ 0.359, 10.009, -0.102 ], "form": ".", "ssZp": 3.903, "Dp": 4.592, "splay_angle": 133.253, "splay_distance": 17.715, "splay_ratio": 0.918, "d22": null, "d64": null, "eta": 153.319, "theta": 77.196, "eta_prime": 172.227, "theta_prime": 36.871, "eta_base": -124.552, "theta_base": -39.134, "v0": -5.155, "v1": -19.540, "v2": 34.220, "v3": -38.910, "v4": 28.264, "amplitude": 38.278, "phase_angle": 26.621, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.473, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 9.022, -13.700, 13.235 ], "x_axis": [ 0.284, 0.209, 0.936 ], "y_axis": [ -0.943, -0.115, 0.312 ], "z_axis": [ 0.172, -0.971, 0.165 ], "quaternion": [ 0.578, 0.555, -0.330, 0.499 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": 72.631, "beta": 168.344, "gamma": 60.429, "delta": 146.757, "epsilon": -85.170, "zeta": -71.923, "epsilon_zeta": -13.248, "bb_type": "--", "chi": -131.914, "glyco_bond": "anti", "C5prime_xyz": [ -1.964, 8.788, -0.434 ], "P_xyz": [ 0.478, 9.411, 0.382 ], "form": ".", "ssZp": 0.735, "Dp": 0.731, "splay_angle": 115.705, "splay_distance": 16.467, "splay_ratio": 0.847, "d22": null, "d64": null, "eta": 12.239, "theta": -38.343, "eta_prime": 48.520, "theta_prime": -60.678, "eta_base": 114.649, "theta_base": -32.256, "v0": -22.385, "v1": 39.516, "v2": -39.778, "v3": 28.383, "v4": -4.215, "amplitude": 40.902, "phase_angle": 166.539, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5p", "suiteness": 0.069, "filter_rmsd": 0.055, "frame": { "rmsd": 0.013, "origin": [ -5.369, -20.785, 20.754 ], "x_axis": [ 0.759, -0.415, 0.501 ], "y_axis": [ 0.605, 0.165, -0.779 ], "z_axis": [ 0.241, 0.895, 0.376 ], "quaternion": [ 0.758, -0.552, -0.086, -0.336 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,cap-acceptor,splayed-apart", "alpha": -70.105, "beta": -178.038, "gamma": 58.254, "delta": 78.658, "epsilon": -155.166, "zeta": -62.082, "epsilon_zeta": -93.083, "bb_type": "BI", "chi": -149.808, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.760, -0.059 ], "P_xyz": [ 1.243, 9.294, -0.214 ], "form": "A", "ssZp": 4.205, "Dp": 4.712, "splay_angle": 23.435, "splay_distance": 3.898, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 150.333, "theta": -141.456, "eta_prime": -164.845, "theta_prime": -141.022, "eta_base": -140.807, "theta_base": -117.426, "v0": 6.462, "v1": -29.528, "v2": 38.952, "v3": -36.855, "v4": 19.626, "amplitude": 39.517, "phase_angle": 9.699, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.788, "filter_rmsd": 0.054, "frame": { "rmsd": 0.028, "origin": [ 3.121, -12.321, 9.465 ], "x_axis": [ 0.147, -0.883, -0.446 ], "y_axis": [ -0.910, -0.297, 0.288 ], "z_axis": [ -0.387, 0.364, -0.847 ], "quaternion": [ -0.025, 0.757, -0.592, -0.275 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.768, "beta": 169.552, "gamma": 67.568, "delta": 76.010, "epsilon": -162.465, "zeta": -65.298, "epsilon_zeta": -97.167, "bb_type": "BI", "chi": -160.150, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.883, 0.560 ], "P_xyz": [ 0.708, 9.772, 0.188 ], "form": "A", "ssZp": 4.502, "Dp": 4.634, "splay_angle": 24.530, "splay_distance": 3.982, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 164.123, "theta": -151.600, "eta_prime": -177.602, "theta_prime": -153.323, "eta_base": -135.827, "theta_base": -127.902, "v0": 3.121, "v1": -28.673, "v2": 40.765, "v3": -40.741, "v4": 24.179, "amplitude": 42.162, "phase_angle": 14.791, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.587, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 3.363, -12.419, 5.576 ], "x_axis": [ -0.237, -0.969, -0.075 ], "y_axis": [ -0.906, 0.193, 0.376 ], "z_axis": [ -0.350, 0.157, -0.923 ], "quaternion": [ -0.090, -0.611, 0.767, 0.174 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.579, "beta": 176.073, "gamma": 63.162, "delta": 76.273, "epsilon": -155.579, "zeta": -65.735, "epsilon_zeta": -89.844, "bb_type": "BI", "chi": -168.018, "glyco_bond": "anti", "C5prime_xyz": [ -1.617, 8.765, 1.041 ], "P_xyz": [ 0.927, 9.464, 1.251 ], "form": "A", "ssZp": 4.645, "Dp": 4.712, "splay_angle": 23.657, "splay_distance": 3.872, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 168.218, "theta": -146.443, "eta_prime": 179.865, "theta_prime": -145.519, "eta_base": -138.760, "theta_base": -119.812, "v0": 4.236, "v1": -28.820, "v2": 40.051, "v3": -39.431, "v4": 22.574, "amplitude": 41.140, "phase_angle": 13.216, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.672, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 3.484, -13.469, 1.737 ], "x_axis": [ -0.623, -0.734, 0.270 ], "y_axis": [ -0.646, 0.677, 0.353 ], "z_axis": [ -0.442, 0.045, -0.896 ], "quaternion": [ -0.199, -0.386, 0.894, 0.111 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.361, "beta": 173.648, "gamma": 64.511, "delta": 73.448, "epsilon": -165.424, "zeta": -67.969, "epsilon_zeta": -97.455, "bb_type": "BI", "chi": -164.967, "glyco_bond": "anti", "C5prime_xyz": [ -1.688, 8.773, 0.852 ], "P_xyz": [ 0.835, 9.558, 0.760 ], "form": "A", "ssZp": 4.612, "Dp": 4.673, "splay_angle": 24.386, "splay_distance": 3.994, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 166.216, "theta": -158.362, "eta_prime": -178.419, "theta_prime": -159.672, "eta_base": -135.119, "theta_base": -148.275, "v0": 4.709, "v1": -30.172, "v2": 41.820, "v3": -40.916, "v4": 23.263, "amplitude": 42.890, "phase_angle": 12.824, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.646, "filter_rmsd": 0.098, "frame": { "rmsd": 0.024, "origin": [ 2.558, -15.625, -1.343 ], "x_axis": [ -0.876, -0.268, 0.402 ], "y_axis": [ -0.257, 0.963, 0.082 ], "z_axis": [ -0.409, -0.032, -0.912 ], "quaternion": [ -0.209, -0.135, 0.968, 0.013 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.308, "beta": 171.873, "gamma": 66.952, "delta": 78.279, "epsilon": -155.539, "zeta": -60.442, "epsilon_zeta": -95.097, "bb_type": "BI", "chi": -168.464, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.762, 1.039 ], "P_xyz": [ 0.814, 9.538, 1.096 ], "form": "A", "ssZp": 4.610, "Dp": 4.676, "splay_angle": 23.901, "splay_distance": 3.928, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 174.907, "theta": -139.422, "eta_prime": -175.790, "theta_prime": -139.315, "eta_base": -152.134, "theta_base": -104.480, "v0": 3.325, "v1": -27.492, "v2": 38.850, "v3": -38.681, "v4": 22.712, "amplitude": 40.100, "phase_angle": 14.344, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.538, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 2.138, -18.237, -4.336 ], "x_axis": [ -0.901, 0.104, 0.420 ], "y_axis": [ 0.057, 0.991, -0.123 ], "z_axis": [ -0.429, -0.087, -0.899 ], "quaternion": [ -0.218, 0.041, 0.974, -0.054 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.467, "beta": 178.108, "gamma": 60.801, "delta": 74.484, "epsilon": -165.560, "zeta": -67.270, "epsilon_zeta": -98.290, "bb_type": "BI", "chi": -158.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.672, 8.843, 0.515 ], "P_xyz": [ 0.862, 9.621, 0.536 ], "form": "A", "ssZp": 4.481, "Dp": 4.640, "splay_angle": 24.060, "splay_distance": 3.904, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 164.519, "theta": -157.056, "eta_prime": -177.751, "theta_prime": -157.222, "eta_base": -123.630, "theta_base": -139.731, "v0": 3.324, "v1": -27.888, "v2": 39.561, "v3": -39.438, "v4": 23.147, "amplitude": 40.853, "phase_angle": 14.449, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.719, "filter_rmsd": 0.098, "frame": { "rmsd": 0.024, "origin": [ -1.200, -19.595, -5.899 ], "x_axis": [ -0.657, 0.712, 0.248 ], "y_axis": [ 0.564, 0.682, -0.465 ], "z_axis": [ -0.500, -0.166, -0.850 ], "quaternion": [ -0.209, 0.357, 0.893, -0.177 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.591, "beta": 175.480, "gamma": 62.090, "delta": 73.456, "epsilon": -162.407, "zeta": -65.695, "epsilon_zeta": -96.711, "bb_type": "BI", "chi": -161.211, "glyco_bond": "anti", "C5prime_xyz": [ -1.464, 8.841, 0.626 ], "P_xyz": [ 1.093, 9.492, 0.634 ], "form": "A", "ssZp": 4.494, "Dp": 4.684, "splay_angle": 24.625, "splay_distance": 4.024, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 170.031, "theta": -154.294, "eta_prime": 179.175, "theta_prime": -153.564, "eta_base": -151.265, "theta_base": -138.492, "v0": 4.828, "v1": -29.523, "v2": 40.707, "v3": -39.765, "v4": 22.466, "amplitude": 41.703, "phase_angle": 12.546, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.608, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ -4.205, -21.348, -7.669 ], "x_axis": [ -0.302, 0.949, 0.091 ], "y_axis": [ 0.756, 0.296, -0.583 ], "z_axis": [ -0.580, -0.107, -0.807 ], "quaternion": [ -0.216, 0.550, 0.775, -0.222 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.322, "beta": 170.867, "gamma": 66.672, "delta": 79.042, "epsilon": -154.614, "zeta": -60.958, "epsilon_zeta": -93.656, "bb_type": "BI", "chi": -168.344, "glyco_bond": "anti", "C5prime_xyz": [ -1.825, 8.780, 1.012 ], "P_xyz": [ 0.684, 9.548, 1.242 ], "form": "A", "ssZp": 4.482, "Dp": 4.601, "splay_angle": 21.990, "splay_distance": 3.659, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 175.977, "theta": -138.403, "eta_prime": -172.112, "theta_prime": -138.583, "eta_base": -144.817, "theta_base": -101.520, "v0": 1.752, "v1": -25.176, "v2": 36.816, "v3": -37.568, "v4": 22.935, "amplitude": 38.398, "phase_angle": 16.506, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.573, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ -7.905, -22.089, -9.066 ], "x_axis": [ 0.079, 0.996, -0.051 ], "y_axis": [ 0.815, -0.094, -0.571 ], "z_axis": [ -0.573, 0.003, -0.819 ], "quaternion": [ -0.203, 0.706, 0.641, -0.221 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -76.519, "beta": 179.265, "gamma": 58.121, "delta": 75.213, "epsilon": -148.558, "zeta": -71.274, "epsilon_zeta": -77.284, "bb_type": "BI", "chi": -151.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.938, 0.057 ], "P_xyz": [ 0.926, 9.707, 0.040 ], "form": "A", "ssZp": 4.162, "Dp": 4.695, "splay_angle": 19.793, "splay_distance": 3.298, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 166.348, "theta": -148.204, "eta_prime": -178.752, "theta_prime": -147.205, "eta_base": -126.361, "theta_base": -133.998, "v0": -0.090, "v1": -24.093, "v2": 36.819, "v3": -38.701, "v4": 24.821, "amplitude": 38.994, "phase_angle": 19.226, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.056, "frame": { "rmsd": 0.016, "origin": [ -10.320, -19.980, -10.831 ], "x_axis": [ 0.587, 0.693, -0.419 ], "y_axis": [ 0.463, -0.712, -0.528 ], "z_axis": [ -0.664, 0.116, -0.739 ], "quaternion": [ -0.185, 0.871, 0.332, -0.311 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -79.879, "beta": 173.780, "gamma": 58.256, "delta": 76.274, "epsilon": -159.305, "zeta": -68.477, "epsilon_zeta": -90.828, "bb_type": "BI", "chi": -148.236, "glyco_bond": "anti", "C5prime_xyz": [ -1.858, 8.823, -0.124 ], "P_xyz": [ 0.599, 9.703, -0.447 ], "form": "A", "ssZp": 4.155, "Dp": 4.619, "splay_angle": 22.904, "splay_distance": 3.869, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 156.904, "theta": -152.192, "eta_prime": 168.357, "theta_prime": -153.012, "eta_base": -167.052, "theta_base": -139.211, "v0": -0.138, "v1": -24.701, "v2": 37.543, "v3": -39.844, "v4": 25.500, "amplitude": 39.813, "phase_angle": 19.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.051, "frame": { "rmsd": 0.029, "origin": [ -12.541, -18.341, -12.635 ], "x_axis": [ 0.930, 0.260, -0.261 ], "y_axis": [ 0.107, -0.869, -0.484 ], "z_axis": [ -0.352, 0.422, -0.836 ], "quaternion": [ -0.238, 0.953, 0.096, -0.161 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -80.079, "beta": 178.567, "gamma": 62.156, "delta": 74.000, "epsilon": -129.794, "zeta": -59.261, "epsilon_zeta": -70.533, "bb_type": "BI", "chi": -148.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.731, 8.981, -0.106 ], "P_xyz": [ 0.729, 9.904, -0.395 ], "form": ".", "ssZp": 3.918, "Dp": 4.734, "splay_angle": 68.304, "splay_distance": 10.292, "splay_ratio": 0.562, "d22": null, "d64": null, "eta": 168.729, "theta": -110.856, "eta_prime": 174.857, "theta_prime": -150.992, "eta_base": -163.598, "theta_base": 148.675, "v0": -2.607, "v1": -22.575, "v2": 36.779, "v3": -40.196, "v4": 27.380, "amplitude": 39.899, "phase_angle": 22.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.630, "filter_rmsd": 0.055, "frame": { "rmsd": 0.015, "origin": [ -13.264, -15.260, -14.859 ], "x_axis": [ 0.953, -0.250, -0.170 ], "y_axis": [ -0.302, -0.837, -0.457 ], "z_axis": [ -0.028, 0.487, -0.873 ], "quaternion": [ -0.246, 0.957, -0.144, -0.052 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 178.179, "beta": 152.629, "gamma": 55.011, "delta": 84.286, "epsilon": -159.729, "zeta": -71.702, "epsilon_zeta": -88.027, "bb_type": "BI", "chi": -139.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.660, -0.632 ], "P_xyz": [ 1.121, 8.614, -1.283 ], "form": "A", "ssZp": 3.783, "Dp": 4.558, "splay_angle": 19.701, "splay_distance": 3.237, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 26.126, "theta": -142.966, "eta_prime": 57.092, "theta_prime": -151.096, "eta_base": 31.833, "theta_base": -140.949, "v0": 7.467, "v1": -26.880, "v2": 34.070, "v3": -31.353, "v4": 15.422, "amplitude": 34.308, "phase_angle": 6.760, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.738, "filter_rmsd": 0.053, "frame": { "rmsd": 0.028, "origin": [ -22.150, -12.594, -19.318 ], "x_axis": [ -0.470, -0.634, 0.614 ], "y_axis": [ 0.644, -0.722, -0.253 ], "z_axis": [ 0.604, 0.276, 0.748 ], "quaternion": [ -0.373, 0.355, 0.007, 0.857 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -78.690, "beta": 164.086, "gamma": 68.623, "delta": 81.672, "epsilon": -153.983, "zeta": -60.172, "epsilon_zeta": -93.811, "bb_type": "BI", "chi": -149.955, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.917, -0.086 ], "P_xyz": [ 0.880, 9.442, -0.933 ], "form": ".", "ssZp": 4.221, "Dp": 4.661, "splay_angle": 30.382, "splay_distance": 4.859, "splay_ratio": 0.262, "d22": 3.499, "d64": 3.802, "eta": 161.156, "theta": -133.315, "eta_prime": 174.508, "theta_prime": -135.029, "eta_base": -156.492, "theta_base": -94.636, "v0": 1.754, "v1": -25.252, "v2": 36.764, "v3": -36.964, "v4": 22.770, "amplitude": 38.271, "phase_angle": 16.133, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.528, "filter_rmsd": 0.056, "frame": { "rmsd": 0.014, "origin": [ -20.981, -11.261, -16.610 ], "x_axis": [ -0.266, -0.893, 0.362 ], "y_axis": [ 0.867, -0.386, -0.315 ], "z_axis": [ 0.421, 0.230, 0.877 ], "quaternion": [ 0.553, -0.246, 0.027, -0.795 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -75.792, "beta": 167.246, "gamma": 68.257, "delta": 76.808, "epsilon": 162.528, "zeta": 39.606, "epsilon_zeta": 122.922, "bb_type": "--", "chi": -165.787, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.755, 0.872 ], "P_xyz": [ 1.168, 9.276, 0.662 ], "form": ".", "ssZp": 4.298, "Dp": 4.348, "splay_angle": 63.353, "splay_distance": 9.365, "splay_ratio": 0.525, "d22": null, "d64": null, "eta": 165.674, "theta": -80.058, "eta_prime": -166.445, "theta_prime": -76.578, "eta_base": -101.290, "theta_base": -35.586, "v0": 8.797, "v1": -30.165, "v2": 37.923, "v3": -34.145, "v4": 16.553, "amplitude": 38.115, "phase_angle": 5.742, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.562, "filter_rmsd": 0.058, "frame": { "rmsd": 0.014, "origin": [ -20.040, -13.889, -12.632 ], "x_axis": [ 0.362, -0.911, -0.198 ], "y_axis": [ 0.805, 0.413, -0.425 ], "z_axis": [ 0.469, -0.006, 0.883 ], "quaternion": [ 0.815, -0.129, 0.205, -0.526 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -113.250, "beta": 149.381, "gamma": 69.916, "delta": 77.300, "epsilon": -169.487, "zeta": -75.018, "epsilon_zeta": -94.469, "bb_type": "BI", "chi": -149.328, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.740, -0.046 ], "P_xyz": [ 0.859, 8.955, -1.281 ], "form": ".", "ssZp": 4.266, "Dp": 4.633, "splay_angle": 34.618, "splay_distance": 5.621, "splay_ratio": 0.301, "d22": null, "d64": null, "eta": 145.574, "theta": -160.887, "eta_prime": -155.121, "theta_prime": -169.644, "eta_base": -69.719, "theta_base": -171.352, "v0": 6.575, "v1": -29.562, "v2": 39.026, "v3": -36.939, "v4": 19.646, "amplitude": 39.587, "phase_angle": 9.662, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.052, "frame": { "rmsd": 0.027, "origin": [ -10.904, -15.582, -13.803 ], "x_axis": [ 0.871, 0.489, -0.053 ], "y_axis": [ -0.412, 0.784, 0.464 ], "z_axis": [ 0.269, -0.382, 0.884 ], "quaternion": [ 0.941, 0.225, 0.086, 0.240 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -69.656, "beta": 170.093, "gamma": 69.876, "delta": 77.135, "epsilon": -155.015, "zeta": -60.526, "epsilon_zeta": -94.489, "bb_type": "BI", "chi": -171.950, "glyco_bond": "anti", "C5prime_xyz": [ -1.933, 8.770, 1.174 ], "P_xyz": [ 0.528, 9.692, 1.316 ], "form": "A", "ssZp": 4.584, "Dp": 4.644, "splay_angle": 23.719, "splay_distance": 3.896, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 178.079, "theta": -139.901, "eta_prime": -176.909, "theta_prime": -139.751, "eta_base": -166.732, "theta_base": -99.506, "v0": -0.261, "v1": -24.916, "v2": 38.184, "v3": -40.133, "v4": 25.875, "amplitude": 40.479, "phase_angle": 19.387, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.439, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ -10.218, -20.145, -10.593 ], "x_axis": [ 0.761, 0.627, -0.170 ], "y_axis": [ -0.563, 0.767, 0.307 ], "z_axis": [ 0.322, -0.138, 0.937 ], "quaternion": [ 0.931, 0.119, 0.132, 0.320 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.908, "beta": 178.536, "gamma": 59.337, "delta": 75.138, "epsilon": -166.653, "zeta": -68.782, "epsilon_zeta": -97.871, "bb_type": "BI", "chi": -156.440, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.860, 0.389 ], "P_xyz": [ 0.897, 9.618, 0.376 ], "form": "A", "ssZp": 4.447, "Dp": 4.641, "splay_angle": 19.334, "splay_distance": 3.228, "splay_ratio": 0.175, "d22": 4.552, "d64": 4.862, "eta": 162.704, "theta": -158.752, "eta_prime": -179.279, "theta_prime": -160.801, "eta_base": -119.632, "theta_base": -151.684, "v0": 3.317, "v1": -27.760, "v2": 39.176, "v3": -38.828, "v4": 22.873, "amplitude": 40.420, "phase_angle": 14.251, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.097, "frame": { "rmsd": 0.025, "origin": [ -6.869, -19.926, -8.615 ], "x_axis": [ 0.192, 0.972, 0.134 ], "y_axis": [ -0.881, 0.111, 0.460 ], "z_axis": [ 0.432, -0.206, 0.878 ], "quaternion": [ 0.738, 0.226, 0.101, 0.627 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.283, "beta": 167.548, "gamma": 66.451, "delta": 75.385, "epsilon": -158.839, "zeta": -62.842, "epsilon_zeta": -95.996, "bb_type": "BI", "chi": -158.582, "glyco_bond": "anti", "C5prime_xyz": [ -1.578, 8.897, 0.418 ], "P_xyz": [ 0.912, 9.639, -0.041 ], "form": "A", "ssZp": 4.444, "Dp": 4.687, "splay_angle": 22.428, "splay_distance": 3.722, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 166.574, "theta": -146.884, "eta_prime": 176.798, "theta_prime": -147.819, "eta_base": -160.330, "theta_base": -124.940, "v0": 5.459, "v1": -31.110, "v2": 42.475, "v3": -40.716, "v4": 22.796, "amplitude": 43.367, "phase_angle": 11.646, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.541, "filter_rmsd": 0.057, "frame": { "rmsd": 0.015, "origin": [ -4.009, -20.899, -7.477 ], "x_axis": [ -0.118, 0.949, 0.293 ], "y_axis": [ -0.781, -0.271, 0.562 ], "z_axis": [ 0.613, -0.162, 0.773 ], "quaternion": [ 0.588, 0.308, 0.136, 0.735 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "A", "nt_code": "A", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.014, "beta": 171.741, "gamma": 69.448, "delta": 78.597, "epsilon": -159.513, "zeta": -61.965, "epsilon_zeta": -97.548, "bb_type": "BI", "chi": -159.102, "glyco_bond": "anti", "C5prime_xyz": [ -1.810, 8.828, 0.421 ], "P_xyz": [ 0.670, 9.707, 0.177 ], "form": "A", "ssZp": 4.362, "Dp": 4.597, "splay_angle": 22.285, "splay_distance": 3.660, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 173.018, "theta": -143.580, "eta_prime": -171.186, "theta_prime": -143.964, "eta_base": -132.556, "theta_base": -108.384, "v0": 0.757, "v1": -24.937, "v2": 37.225, "v3": -38.398, "v4": 24.203, "amplitude": 39.109, "phase_angle": 17.856, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.514, "filter_rmsd": 0.053, "frame": { "rmsd": 0.030, "origin": [ -1.040, -19.549, -5.684 ], "x_axis": [ -0.519, 0.705, 0.484 ], "y_axis": [ -0.539, -0.709, 0.455 ], "z_axis": [ 0.663, -0.025, 0.748 ], "quaternion": [ 0.361, 0.333, 0.125, 0.862 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.446, "beta": 174.052, "gamma": 62.918, "delta": 76.420, "epsilon": -166.418, "zeta": -72.524, "epsilon_zeta": -93.894, "bb_type": "BI", "chi": -151.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.712, 8.884, 0.094 ], "P_xyz": [ 0.822, 9.615, -0.196 ], "form": "A", "ssZp": 4.276, "Dp": 4.585, "splay_angle": 22.385, "splay_distance": 3.610, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 165.713, "theta": -159.960, "eta_prime": -176.554, "theta_prime": -161.093, "eta_base": -124.181, "theta_base": -149.382, "v0": 1.932, "v1": -25.100, "v2": 36.485, "v3": -37.041, "v4": 22.568, "amplitude": 37.989, "phase_angle": 16.178, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.096, "frame": { "rmsd": 0.026, "origin": [ 0.361, -17.547, -2.959 ], "x_axis": [ -0.753, 0.124, 0.647 ], "y_axis": [ 0.004, -0.981, 0.193 ], "z_axis": [ 0.659, 0.148, 0.738 ], "quaternion": [ 0.032, 0.350, 0.092, 0.932 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.544, "beta": 172.261, "gamma": 64.229, "delta": 78.166, "epsilon": -165.210, "zeta": -65.092, "epsilon_zeta": -100.119, "bb_type": "BI", "chi": -153.454, "glyco_bond": "anti", "C5prime_xyz": [ -1.619, 8.789, 0.132 ], "P_xyz": [ 0.936, 9.395, -0.144 ], "form": "A", "ssZp": 4.255, "Dp": 4.602, "splay_angle": 21.443, "splay_distance": 3.514, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.994, "theta": -149.950, "eta_prime": 178.434, "theta_prime": -152.110, "eta_base": -158.838, "theta_base": -130.586, "v0": 3.541, "v1": -26.607, "v2": 37.182, "v3": -36.860, "v4": 21.485, "amplitude": 38.294, "phase_angle": 13.843, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.629, "filter_rmsd": 0.052, "frame": { "rmsd": 0.030, "origin": [ 2.692, -15.562, -1.048 ], "x_axis": [ -0.764, -0.261, 0.590 ], "y_axis": [ 0.358, -0.932, 0.052 ], "z_axis": [ 0.536, 0.251, 0.806 ], "quaternion": [ -0.166, 0.301, 0.081, 0.936 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.463, "beta": 168.294, "gamma": 66.051, "delta": 77.363, "epsilon": -157.360, "zeta": -64.401, "epsilon_zeta": -92.960, "bb_type": "BI", "chi": -153.228, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.927, 0.127 ], "P_xyz": [ 1.005, 9.554, -0.292 ], "form": "A", "ssZp": 4.230, "Dp": 4.637, "splay_angle": 23.714, "splay_distance": 3.908, "splay_ratio": 0.208, "d22": 4.066, "d64": 4.229, "eta": 171.546, "theta": -145.260, "eta_prime": -175.083, "theta_prime": -145.609, "eta_base": -138.913, "theta_base": -119.626, "v0": 2.636, "v1": -26.478, "v2": 38.130, "v3": -37.965, "v4": 22.766, "amplitude": 39.490, "phase_angle": 15.079, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.613, "filter_rmsd": 0.058, "frame": { "rmsd": 0.014, "origin": [ 3.225, -13.627, 1.836 ], "x_axis": [ -0.488, -0.666, 0.564 ], "y_axis": [ 0.753, -0.648, -0.114 ], "z_axis": [ 0.442, 0.369, 0.818 ], "quaternion": [ -0.413, 0.293, 0.074, 0.859 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.079, "beta": 172.923, "gamma": 63.665, "delta": 76.818, "epsilon": -154.541, "zeta": -70.714, "epsilon_zeta": -83.826, "bb_type": "BI", "chi": -156.044, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.923, 0.280 ], "P_xyz": [ 0.888, 9.651, 0.266 ], "form": "A", "ssZp": 4.224, "Dp": 4.601, "splay_angle": 23.273, "splay_distance": 3.870, "splay_ratio": 0.203, "d22": 4.096, "d64": 4.166, "eta": 171.432, "theta": -149.945, "eta_prime": -174.214, "theta_prime": -142.456, "eta_base": -134.756, "theta_base": -128.624, "v0": 1.207, "v1": -24.907, "v2": 36.893, "v3": -37.867, "v4": 23.562, "amplitude": 38.636, "phase_angle": 17.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.735, "filter_rmsd": 0.057, "frame": { "rmsd": 0.015, "origin": [ 3.186, -12.724, 5.638 ], "x_axis": [ -0.104, -0.966, 0.236 ], "y_axis": [ 0.928, -0.180, -0.327 ], "z_axis": [ 0.359, 0.185, 0.915 ], "quaternion": [ 0.639, -0.200, 0.048, -0.741 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "U", "nt_code": "U", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -66.408, "beta": 176.669, "gamma": 65.789, "delta": 134.242, "epsilon": -82.061, "zeta": 172.957, "epsilon_zeta": 104.981, "bb_type": "BII", "chi": -132.978, "glyco_bond": "anti", "C5prime_xyz": [ -2.323, 8.805, -0.488 ], "P_xyz": [ 0.040, 9.767, 0.147 ], "form": ".", "ssZp": 1.236, "Dp": 1.114, "splay_angle": 88.814, "splay_distance": 13.568, "splay_ratio": 0.701, "d22": 11.977, "d64": 14.870, "eta": -154.832, "theta": -176.448, "eta_prime": -136.642, "theta_prime": 171.647, "eta_base": -123.194, "theta_base": -167.308, "v0": -27.770, "v1": 37.660, "v2": -31.987, "v3": 16.990, "v4": 6.548, "amplitude": 36.639, "phase_angle": 150.813, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.584, "filter_rmsd": 0.093, "frame": { "rmsd": 0.024, "origin": [ 3.137, -12.459, 9.499 ], "x_axis": [ 0.113, -0.946, -0.303 ], "y_axis": [ 0.914, 0.218, -0.342 ], "z_axis": [ 0.389, -0.238, 0.890 ], "quaternion": [ 0.745, -0.035, 0.232, -0.624 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BI,non-stack,non-canonical,non-pair-contact,internal-loop,A-minor,splayed-apart", "alpha": -72.197, "beta": 80.487, "gamma": -176.379, "delta": 111.469, "epsilon": -145.221, "zeta": -80.485, "epsilon_zeta": -64.735, "bb_type": "BI", "chi": -91.164, "glyco_bond": "anti", "C5prime_xyz": [ -1.560, 7.066, -2.704 ], "P_xyz": [ -2.795, 7.180, -5.049 ], "form": ".", "ssZp": 0.441, "Dp": 4.169, "splay_angle": 46.836, "splay_distance": 7.979, "splay_ratio": 0.402, "d22": null, "d64": null, "eta": -48.953, "theta": 159.297, "eta_prime": -68.018, "theta_prime": 176.098, "eta_base": -64.874, "theta_base": -159.771, "v0": 23.181, "v1": -23.953, "v2": 15.742, "v3": -2.724, "v4": -12.881, "amplitude": 24.379, "phase_angle": 310.221, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.097, "frame": { "rmsd": 0.028, "origin": [ 5.622, -1.051, 16.410 ], "x_axis": [ 0.244, 0.970, -0.022 ], "y_axis": [ 0.066, -0.039, -0.997 ], "z_axis": [ -0.968, 0.242, -0.073 ], "quaternion": [ 0.532, -0.582, -0.445, 0.425 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -88.201, "beta": 166.486, "gamma": 65.413, "delta": 80.412, "epsilon": -161.449, "zeta": -62.692, "epsilon_zeta": -98.756, "bb_type": "BI", "chi": -155.668, "glyco_bond": "anti", "C5prime_xyz": [ -1.288, 8.784, 0.254 ], "P_xyz": [ 1.263, 9.157, -0.371 ], "form": "A", "ssZp": 4.395, "Dp": 4.664, "splay_angle": 23.538, "splay_distance": 3.784, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 150.303, "theta": -143.321, "eta_prime": 168.542, "theta_prime": -147.189, "eta_base": -160.883, "theta_base": -127.580, "v0": 10.248, "v1": -32.784, "v2": 40.777, "v3": -36.337, "v4": 16.953, "amplitude": 40.913, "phase_angle": 4.673, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 0.661, 2.418, 11.212 ], "x_axis": [ 0.879, 0.475, -0.050 ], "y_axis": [ 0.365, -0.735, -0.571 ], "z_axis": [ -0.308, 0.484, -0.819 ], "quaternion": [ -0.285, 0.926, 0.226, -0.096 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.512, "beta": 172.567, "gamma": 67.742, "delta": 78.240, "epsilon": -158.255, "zeta": -65.540, "epsilon_zeta": -92.715, "bb_type": "BI", "chi": -164.956, "glyco_bond": "anti", "C5prime_xyz": [ -1.544, 8.712, 0.831 ], "P_xyz": [ 1.015, 9.389, 0.754 ], "form": "A", "ssZp": 4.549, "Dp": 4.675, "splay_angle": 23.742, "splay_distance": 3.876, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 170.059, "theta": -146.757, "eta_prime": -174.538, "theta_prime": -147.194, "eta_base": -135.317, "theta_base": -125.458, "v0": 5.568, "v1": -28.952, "v2": 39.141, "v3": -37.527, "v4": 20.594, "amplitude": 39.885, "phase_angle": 11.085, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.575, "filter_rmsd": 0.054, "frame": { "rmsd": 0.029, "origin": [ 0.153, 5.706, 9.409 ], "x_axis": [ 0.971, -0.004, -0.240 ], "y_axis": [ -0.131, -0.845, -0.519 ], "z_axis": [ -0.201, 0.535, -0.821 ], "quaternion": [ -0.276, 0.953, -0.035, -0.116 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.861, "beta": 176.550, "gamma": 62.599, "delta": 75.175, "epsilon": -158.833, "zeta": -64.585, "epsilon_zeta": -94.248, "bb_type": "BI", "chi": -161.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.683, 8.811, 0.654 ], "P_xyz": [ 0.859, 9.554, 0.697 ], "form": "A", "ssZp": 4.523, "Dp": 4.680, "splay_angle": 23.286, "splay_distance": 3.828, "splay_ratio": 0.208, "d22": 4.331, "d64": 4.590, "eta": 167.969, "theta": -148.450, "eta_prime": -178.598, "theta_prime": -147.802, "eta_base": -141.348, "theta_base": -123.324, "v0": 3.710, "v1": -27.940, "v2": 39.288, "v3": -39.032, "v4": 22.635, "amplitude": 40.480, "phase_angle": 13.942, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.096, "frame": { "rmsd": 0.024, "origin": [ 0.750, 9.055, 7.551 ], "x_axis": [ 0.777, -0.461, -0.428 ], "y_axis": [ -0.619, -0.685, -0.385 ], "z_axis": [ -0.116, 0.564, -0.818 ], "quaternion": [ -0.262, 0.905, -0.298, -0.150 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.506, "beta": 177.318, "gamma": 60.517, "delta": 77.372, "epsilon": -157.710, "zeta": -67.919, "epsilon_zeta": -89.791, "bb_type": "BI", "chi": -159.434, "glyco_bond": "anti", "C5prime_xyz": [ -1.600, 8.884, 0.504 ], "P_xyz": [ 0.936, 9.611, 0.633 ], "form": "A", "ssZp": 4.429, "Dp": 4.648, "splay_angle": 21.807, "splay_distance": 3.618, "splay_ratio": 0.194, "d22": 4.384, "d64": 4.509, "eta": 169.289, "theta": -149.384, "eta_prime": -178.758, "theta_prime": -148.900, "eta_base": -141.072, "theta_base": -129.338, "v0": 2.218, "v1": -26.272, "v2": 37.983, "v3": -38.394, "v4": 23.232, "amplitude": 39.479, "phase_angle": 15.826, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.760, "filter_rmsd": 0.056, "frame": { "rmsd": 0.014, "origin": [ 2.432, 11.457, 5.091 ], "x_axis": [ 0.342, -0.835, -0.431 ], "y_axis": [ -0.939, -0.292, -0.180 ], "z_axis": [ 0.024, 0.467, -0.884 ], "quaternion": [ -0.204, 0.794, -0.559, -0.128 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///A/41", "linked_nts": [ "///A/40", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -78.051, "beta": 178.530, "gamma": 60.219, "delta": 78.079, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.610, "glyco_bond": "anti", "C5prime_xyz": [ -1.635, 8.918, 0.297 ], "P_xyz": [ 0.897, 9.690, 0.321 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.204, "v1": -23.277, "v2": 35.677, "v3": -37.491, "v4": 24.104, "amplitude": 37.809, "phase_angle": 19.333, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.055, "frame": { "rmsd": 0.014, "origin": [ 4.388, 12.804, 2.360 ], "x_axis": [ -0.159, -0.946, -0.284 ], "y_axis": [ -0.980, 0.185, -0.069 ], "z_axis": [ 0.118, 0.267, -0.956 ], "quaternion": [ 0.132, -0.635, 0.758, 0.065 ] } } ], "num_hbonds": 58, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 1299, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/1/O6", "atom2_id": "///A/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/1/N1", "atom2_id": "///A/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/1/N2", "atom2_id": "///A/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 50, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/2/O6", "atom2_id": "///A/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 51, "atom2_serNum": 1266, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/2/N1", "atom2_id": "///A/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 53, "atom2_serNum": 1265, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/2/N2", "atom2_id": "///A/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 84, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/3/N6", "atom2_id": "///A/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 85, "atom2_serNum": 1236, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/3/N1", "atom2_id": "///A/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 115, "atom2_serNum": 1206, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/4/N3", "atom2_id": "///A/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 117, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/4/O4", "atom2_id": "///A/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 140, "atom2_serNum": 162, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 144, "atom2_serNum": 1174, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/5/O2", "atom2_id": "///A/37/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 145, "atom2_serNum": 1172, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/5/N3", "atom2_id": "///A/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 147, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/5/N4", "atom2_id": "///A/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 178, "atom2_serNum": 1134, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///A/6/N6", "atom2_id": "///A/36/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 178, "atom2_serNum": 1160, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/6/N6", "atom2_id": "///A/37/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 212, "atom2_serNum": 1139, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/7/N1", "atom2_id": "///A/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 274, "atom2_serNum": 1104, "donAcc_type": "acceptable", "distance": 3.227, "atom1_id": "///A/9/N6", "atom2_id": "///A/35/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 291, "atom2_serNum": 334, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///A/10/OP1", "atom2_id": "///A/11/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 372, "atom2_serNum": 1111, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/12/N6", "atom2_id": "///A/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 373, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/12/N1", "atom2_id": "///A/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 398, "atom2_serNum": 1164, "donAcc_type": "acceptable", "distance": 3.413, "atom1_id": "///A/13/O2'", "atom2_id": "///A/37/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 398, "atom2_serNum": 1332, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///A/13/O2'", "atom2_id": "///A/101/NAJ", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 24, "atom1_serNum": 405, "atom2_serNum": 1080, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/13/O6", "atom2_id": "///A/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 406, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/13/N1", "atom2_id": "///A/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 408, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/13/N2", "atom2_id": "///A/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 409, "atom2_serNum": 1333, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///A/13/N3", "atom2_id": "///A/101/NAK", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 28, "atom1_serNum": 439, "atom2_serNum": 1049, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/14/O6", "atom2_id": "///A/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 440, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/14/N1", "atom2_id": "///A/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 442, "atom2_serNum": 1046, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/14/N2", "atom2_id": "///A/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 471, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/15/N3", "atom2_id": "///A/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 473, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/15/O4", "atom2_id": "///A/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 503, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/16/O6", "atom2_id": "///A/31/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 504, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/16/N1", "atom2_id": "///A/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 530, "atom2_serNum": 556, "donAcc_type": "acceptable", "distance": 3.280, "atom1_id": "///A/17/O2'", "atom2_id": "///A/18/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 535, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/17/N3", "atom2_id": "///A/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 537, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/17/O4", "atom2_id": "///A/30/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 567, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/18/O6", "atom2_id": "///A/29/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 568, "atom2_serNum": 920, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/18/N1", "atom2_id": "///A/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 570, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/18/N2", "atom2_id": "///A/29/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 601, "atom2_serNum": 890, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/19/O6", "atom2_id": "///A/28/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 602, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/19/N1", "atom2_id": "///A/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 632, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/20/O2", "atom2_id": "///A/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 633, "atom2_serNum": 859, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/20/N3", "atom2_id": "///A/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 635, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/20/N4", "atom2_id": "///A/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 666, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/21/N6", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 692, "atom2_serNum": 727, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/22/O2'", "atom2_id": "///A/23/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 696, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/22/O2", "atom2_id": "///A/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 699, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/22/N4", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 723, "atom2_serNum": 752, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 787, "atom2_serNum": 809, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///A/25/O2'", "atom2_id": "///A/26/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 818, "atom2_serNum": 847, "donAcc_type": "acceptable", "distance": 2.941, "atom1_id": "///A/26/O2'", "atom2_id": "///A/27/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 885, "atom2_serNum": 911, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 979, "atom2_serNum": 1005, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 1134, "atom2_serNum": 1160, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///A/36/O2'", "atom2_id": "///A/37/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 1134, "atom2_serNum": 1333, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///A/36/O2'", "atom2_id": "///A/101/NAK", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 57, "atom1_serNum": 1160, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/37/O4'", "atom2_id": "///A/101/NAJ", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 58, "atom1_serNum": 1332, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/101/NAJ", "atom2_id": "///A/101/OAL", "atom_pair": "N:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6xb7", "num_naChains": 1, "naChains": "A=41", "num_atoms": 1355, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }