{ "num_pairs": 200, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/197", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.463, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.362, "chi2": -115.513, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.338, "C1C1_dist": 10.595, "N1N9_dist": 8.875, "C6C8_dist": 9.832, "CNNC_torsion": 4.240, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 8.293, "planarity": 0.195, "simple_Shear": -0.195, "simple_Stretch": -0.177, "simple_Buckle": 8.246, "simple_Propeller": -0.879, "bp_simpleParams": [ -0.195, -0.177, -0.446, 8.246, -0.879, 1.386 ], "bp_params": [ -0.193, -0.179, -0.446, 8.258, -0.754, 1.383 ], "frame": { "rmsd": null, "origin": [ 195.078, 185.222, 292.308 ], "x_axis": [ 0.852, -0.426, 0.305 ], "y_axis": [ -0.514, -0.566, 0.644 ], "z_axis": [ -0.102, -0.705, -0.701 ], "quaternion": [ 0.382, 0.883, -0.266, 0.058 ] } }, { "index": 2, "nt1": "///I/2", "nt2": "///J/196", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.281, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.807, "chi2": -110.367, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.083, "C1C1_dist": 10.670, "N1N9_dist": 8.935, "C6C8_dist": 9.891, "CNNC_torsion": -7.311, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 9.742, "planarity": 0.132, "simple_Shear": -0.179, "simple_Stretch": -0.125, "simple_Buckle": 5.373, "simple_Propeller": -8.127, "bp_simpleParams": [ -0.179, -0.125, 0.163, 5.373, -8.127, 1.111 ], "bp_params": [ -0.177, -0.128, 0.163, 5.489, -8.049, 1.112 ], "frame": { "rmsd": null, "origin": [ 194.201, 182.092, 289.185 ], "x_axis": [ 0.381, -0.705, 0.598 ], "y_axis": [ -0.919, -0.217, 0.329 ], "z_axis": [ -0.102, -0.675, -0.731 ], "quaternion": [ 0.329, 0.763, -0.532, 0.162 ] } }, { "index": 3, "nt1": "///I/3", "nt2": "///J/195", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.908, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.178, "chi2": -114.982, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.263, "C1C1_dist": 10.568, "N1N9_dist": 8.862, "C6C8_dist": 9.839, "CNNC_torsion": -2.109, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 11.769, "planarity": 0.191, "simple_Shear": -0.250, "simple_Stretch": -0.197, "simple_Buckle": -4.726, "simple_Propeller": -10.778, "bp_simpleParams": [ -0.250, -0.197, -0.690, -4.726, -10.778, 3.489 ], "bp_params": [ -0.246, -0.201, -0.690, -4.523, -10.865, 3.502 ], "frame": { "rmsd": null, "origin": [ 192.205, 179.532, 285.941 ], "x_axis": [ -0.361, -0.714, 0.600 ], "y_axis": [ -0.929, 0.334, -0.162 ], "z_axis": [ -0.084, -0.615, -0.784 ], "quaternion": [ -0.217, -0.522, 0.787, -0.247 ] } }, { "index": 4, "nt1": "///I/4", "nt2": "///J/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.873, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.663, "chi2": -111.864, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.661, "C1C1_dist": 10.565, "N1N9_dist": 8.813, "C6C8_dist": 9.750, "CNNC_torsion": 3.422, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 9.489, "planarity": 0.305, "simple_Shear": 0.185, "simple_Stretch": -0.295, "simple_Buckle": -7.661, "simple_Propeller": -5.599, "bp_simpleParams": [ 0.185, -0.295, -0.919, -7.661, -5.599, 1.758 ], "bp_params": [ 0.180, -0.298, -0.919, -7.745, -5.482, 1.756 ], "frame": { "rmsd": null, "origin": [ 192.294, 178.108, 282.581 ], "x_axis": [ -0.894, -0.336, 0.297 ], "y_axis": [ -0.441, 0.777, -0.449 ], "z_axis": [ -0.080, -0.532, -0.843 ], "quaternion": [ -0.100, -0.207, 0.937, -0.262 ] } }, { "index": 5, "nt1": "///I/5", "nt2": "///J/193", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.475, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.657, "chi2": -108.035, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.468, "C1C1_dist": 10.627, "N1N9_dist": 8.871, "C6C8_dist": 9.815, "CNNC_torsion": 1.076, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 6.473, "planarity": 0.122, "simple_Shear": -0.099, "simple_Stretch": -0.129, "simple_Buckle": -6.436, "simple_Propeller": -0.694, "bp_simpleParams": [ -0.099, -0.129, -0.281, -6.436, -0.694, -0.544 ], "bp_params": [ -0.097, -0.130, -0.281, -6.426, -0.784, -0.543 ], "frame": { "rmsd": null, "origin": [ 191.608, 176.450, 279.635 ], "x_axis": [ -0.984, 0.176, -0.008 ], "y_axis": [ 0.156, 0.850, -0.502 ], "z_axis": [ -0.081, -0.496, -0.865 ], "quaternion": [ -0.019, 0.086, 0.962, -0.259 ] } }, { "index": 6, "nt1": "///I/6", "nt2": "///J/192", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.138, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.882, "chi2": -118.477, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.865, "C1C1_dist": 10.734, "N1N9_dist": 8.973, "C6C8_dist": 9.909, "CNNC_torsion": -0.533, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 1.429, "planarity": 0.040, "simple_Shear": -0.207, "simple_Stretch": -0.116, "simple_Buckle": -0.952, "simple_Propeller": 1.066, "bp_simpleParams": [ -0.207, -0.116, 0.111, -0.952, 1.066, 0.616 ], "bp_params": [ -0.206, -0.119, 0.111, -0.969, 1.051, 0.616 ], "frame": { "rmsd": null, "origin": [ 191.015, 175.086, 277.058 ], "x_axis": [ -0.695, 0.690, -0.200 ], "y_axis": [ 0.707, 0.606, -0.363 ], "z_axis": [ -0.129, -0.394, -0.910 ], "quaternion": [ 0.020, 0.390, 0.896, -0.211 ] } }, { "index": 7, "nt1": "///I/7", "nt2": "///J/191", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.966, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.693, "chi2": -119.473, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.222, "C1C1_dist": 10.757, "N1N9_dist": 8.980, "C6C8_dist": 9.899, "CNNC_torsion": 1.153, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 3.050, "planarity": 0.055, "simple_Shear": -0.188, "simple_Stretch": -0.123, "simple_Buckle": 3.038, "simple_Propeller": 0.267, "bp_simpleParams": [ -0.188, -0.123, -0.078, 3.038, 0.267, -0.121 ], "bp_params": [ -0.187, -0.125, -0.078, 3.034, 0.308, -0.121 ], "frame": { "rmsd": null, "origin": [ 190.166, 173.918, 274.175 ], "x_axis": [ -0.157, 0.914, -0.374 ], "y_axis": [ 0.976, 0.086, -0.199 ], "z_axis": [ -0.150, -0.397, -0.906 ], "quaternion": [ 0.077, 0.645, 0.733, -0.203 ] } }, { "index": 8, "nt1": "///I/8", "nt2": "///J/190", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.114, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.535, "chi2": -119.384, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.768, "C1C1_dist": 10.401, "N1N9_dist": 8.756, "C6C8_dist": 9.811, "CNNC_torsion": -3.828, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[2.78]", "interBase_angle": 5.587, "planarity": 0.072, "simple_Shear": 0.035, "simple_Stretch": -0.139, "simple_Buckle": 0.524, "simple_Propeller": -5.562, "bp_simpleParams": [ 0.035, -0.139, -0.052, 0.524, -5.562, 4.298 ], "bp_params": [ 0.034, -0.139, -0.052, 0.477, -5.566, 4.303 ], "frame": { "rmsd": null, "origin": [ 189.438, 173.396, 270.958 ], "x_axis": [ 0.500, 0.778, -0.379 ], "y_axis": [ 0.854, -0.516, 0.068 ], "z_axis": [ -0.142, -0.358, -0.923 ], "quaternion": [ 0.124, 0.857, 0.476, -0.152 ] } }, { "index": 9, "nt1": "///I/9", "nt2": "///J/189", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.624, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.820, "chi2": -118.358, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.467, "C1C1_dist": 10.705, "N1N9_dist": 8.954, "C6C8_dist": 9.900, "CNNC_torsion": -4.807, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 7.188, "planarity": 0.101, "simple_Shear": 0.198, "simple_Stretch": -0.126, "simple_Buckle": -0.135, "simple_Propeller": -7.186, "bp_simpleParams": [ 0.198, -0.126, -0.149, -0.135, -7.186, 1.084 ], "bp_params": [ 0.196, -0.129, -0.149, -0.242, -7.183, 1.086 ], "frame": { "rmsd": null, "origin": [ 188.024, 172.080, 268.253 ], "x_axis": [ 0.919, 0.286, -0.270 ], "y_axis": [ 0.365, -0.876, 0.315 ], "z_axis": [ -0.146, -0.389, -0.910 ], "quaternion": [ 0.183, 0.962, 0.169, -0.108 ] } }, { "index": 10, "nt1": "///I/10", "nt2": "///J/188", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.346, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.921, "chi2": -123.312, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.523, "C1C1_dist": 10.566, "N1N9_dist": 8.900, "C6C8_dist": 9.907, "CNNC_torsion": -3.816, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 6.689, "planarity": 0.111, "simple_Shear": 0.219, "simple_Stretch": -0.117, "simple_Buckle": -1.255, "simple_Propeller": -6.570, "bp_simpleParams": [ 0.219, -0.117, -0.209, -1.255, -6.570, 3.418 ], "bp_params": [ 0.217, -0.121, -0.209, -1.368, -6.547, 3.423 ], "frame": { "rmsd": null, "origin": [ 187.993, 171.180, 265.121 ], "x_axis": [ 0.943, -0.331, -0.036 ], "y_axis": [ -0.284, -0.855, 0.434 ], "z_axis": [ -0.174, -0.399, -0.900 ], "quaternion": [ 0.217, 0.962, -0.160, -0.055 ] } }, { "index": 11, "nt1": "///I/11", "nt2": "///J/187", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.138, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.375, "chi2": -117.936, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.033, "C1C1_dist": 10.724, "N1N9_dist": 8.955, "C6C8_dist": 9.884, "CNNC_torsion": 0.402, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 3.582, "planarity": 0.132, "simple_Shear": 0.180, "simple_Stretch": -0.153, "simple_Buckle": -1.067, "simple_Propeller": -3.420, "bp_simpleParams": [ 0.180, -0.153, -0.485, -1.067, -3.420, 0.606 ], "bp_params": [ 0.178, -0.155, -0.485, -1.112, -3.405, 0.606 ], "frame": { "rmsd": null, "origin": [ 186.444, 170.929, 262.046 ], "x_axis": [ 0.595, -0.757, 0.270 ], "y_axis": [ -0.785, -0.476, 0.396 ], "z_axis": [ -0.171, -0.448, -0.878 ], "quaternion": [ 0.246, 0.859, -0.449, 0.029 ] } }, { "index": 12, "nt1": "///I/12", "nt2": "///J/186", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.758, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.980, "chi2": -110.380, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.454, "C1C1_dist": 10.169, "N1N9_dist": 8.633, "C6C8_dist": 9.779, "CNNC_torsion": 0.633, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.75],O4(carbonyl)-N6(amino)[3.14]", "interBase_angle": 3.767, "planarity": 0.102, "simple_Shear": -0.048, "simple_Stretch": -0.166, "simple_Buckle": 0.129, "simple_Propeller": -3.765, "bp_simpleParams": [ -0.048, -0.166, -0.431, 0.129, -3.765, 8.177 ], "bp_params": [ -0.047, -0.167, -0.431, 0.167, -3.764, 8.182 ], "frame": { "rmsd": null, "origin": [ 186.578, 168.534, 259.687 ], "x_axis": [ 0.067, -0.896, 0.439 ], "y_axis": [ -0.987, 0.005, 0.161 ], "z_axis": [ -0.146, -0.444, -0.884 ], "quaternion": [ 0.217, 0.697, -0.675, 0.105 ] } }, { "index": 13, "nt1": "///I/13", "nt2": "///J/185", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.650, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.442, "chi2": -103.545, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.473, "C1C1_dist": 10.423, "N1N9_dist": 8.709, "C6C8_dist": 9.682, "CNNC_torsion": 9.881, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.82]", "interBase_angle": 4.079, "planarity": 0.228, "simple_Shear": 0.159, "simple_Stretch": -0.336, "simple_Buckle": -4.058, "simple_Propeller": -0.412, "bp_simpleParams": [ 0.159, -0.336, -1.167, -4.058, -0.412, 0.950 ], "bp_params": [ 0.152, -0.339, -1.167, -4.066, -0.329, 0.950 ], "frame": { "rmsd": null, "origin": [ 185.553, 168.352, 255.734 ], "x_axis": [ -0.539, -0.666, 0.516 ], "y_axis": [ -0.814, 0.569, -0.115 ], "z_axis": [ -0.217, -0.482, -0.849 ], "quaternion": [ -0.213, -0.430, 0.860, -0.173 ] } }, { "index": 14, "nt1": "///I/14", "nt2": "///J/184", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.566, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.707, "chi2": -98.791, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.330, "C1C1_dist": 10.189, "N1N9_dist": 8.565, "C6C8_dist": 9.618, "CNNC_torsion": 7.235, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.75],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 2.485, "planarity": 0.236, "simple_Shear": -0.101, "simple_Stretch": -0.389, "simple_Buckle": -0.536, "simple_Propeller": -2.426, "bp_simpleParams": [ -0.101, -0.389, -1.087, -0.536, -2.426, 4.714 ], "bp_params": [ -0.095, -0.391, -1.087, -0.499, -2.434, 4.715 ], "frame": { "rmsd": null, "origin": [ 185.587, 165.965, 253.265 ], "x_axis": [ -0.840, -0.303, 0.451 ], "y_axis": [ -0.474, 0.814, -0.336 ], "z_axis": [ -0.266, -0.495, -0.827 ], "quaternion": [ -0.192, -0.208, 0.933, -0.223 ] } }, { "index": 15, "nt1": "///I/15", "nt2": "///J/183", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.642, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.635, "chi2": -109.504, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.972, "C1C1_dist": 10.323, "N1N9_dist": 8.622, "C6C8_dist": 9.589, "CNNC_torsion": 7.677, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.80]", "interBase_angle": 7.044, "planarity": 0.262, "simple_Shear": 0.165, "simple_Stretch": -0.438, "simple_Buckle": -4.970, "simple_Propeller": -4.991, "bp_simpleParams": [ 0.165, -0.438, -1.305, -4.970, -4.991, 1.660 ], "bp_params": [ 0.155, -0.441, -1.305, -5.079, -4.880, 1.660 ], "frame": { "rmsd": null, "origin": [ 184.585, 165.738, 248.833 ], "x_axis": [ -0.900, 0.430, 0.065 ], "y_axis": [ 0.318, 0.752, -0.577 ], "z_axis": [ -0.297, -0.499, -0.814 ], "quaternion": [ -0.097, 0.201, 0.931, -0.289 ] } }, { "index": 16, "nt1": "///I/16", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.255, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.449, "chi2": -123.932, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.031, "C1C1_dist": 10.585, "N1N9_dist": 8.863, "C6C8_dist": 9.821, "CNNC_torsion": 5.795, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 3.887, "planarity": 0.209, "simple_Shear": 0.186, "simple_Stretch": -0.231, "simple_Buckle": -3.472, "simple_Propeller": -1.747, "bp_simpleParams": [ 0.186, -0.231, -0.763, -3.472, -1.747, 1.609 ], "bp_params": [ 0.183, -0.234, -0.763, -3.496, -1.699, 1.609 ], "frame": { "rmsd": null, "origin": [ 182.965, 164.054, 245.811 ], "x_axis": [ -0.586, 0.769, -0.256 ], "y_axis": [ 0.769, 0.427, -0.476 ], "z_axis": [ -0.257, -0.475, -0.842 ], "quaternion": [ -0.000, 0.455, 0.845, -0.282 ] } }, { "index": 17, "nt1": "///I/17", "nt2": "///J/181", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.845, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.705, "chi2": -101.239, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.086, "C1C1_dist": 10.790, "N1N9_dist": 9.008, "C6C8_dist": 9.918, "CNNC_torsion": 4.312, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 6.155, "planarity": 0.088, "simple_Shear": -0.166, "simple_Stretch": -0.105, "simple_Buckle": -6.144, "simple_Propeller": 0.368, "bp_simpleParams": [ -0.166, -0.105, -0.441, -6.144, 0.368, -0.370 ], "bp_params": [ -0.165, -0.107, -0.441, -6.148, 0.295, -0.370 ], "frame": { "rmsd": null, "origin": [ 182.639, 162.062, 242.569 ], "x_axis": [ -0.051, 0.873, -0.485 ], "y_axis": [ 0.967, -0.078, -0.243 ], "z_axis": [ -0.250, -0.481, -0.840 ], "quaternion": [ 0.087, 0.683, 0.673, -0.269 ] } }, { "index": 18, "nt1": "///I/18", "nt2": "///J/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.373, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.933, "chi2": -107.805, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.634, "C1C1_dist": 10.770, "N1N9_dist": 8.984, "C6C8_dist": 9.895, "CNNC_torsion": 4.480, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.447, "planarity": 0.078, "simple_Shear": 0.175, "simple_Stretch": -0.133, "simple_Buckle": -1.020, "simple_Propeller": 3.292, "bp_simpleParams": [ 0.175, -0.133, -0.284, -1.020, 3.292, -0.532 ], "bp_params": [ 0.174, -0.136, -0.284, -0.978, 3.305, -0.532 ], "frame": { "rmsd": null, "origin": [ 181.907, 160.172, 239.926 ], "x_axis": [ 0.539, 0.671, -0.510 ], "y_axis": [ 0.823, -0.549, 0.148 ], "z_axis": [ -0.181, -0.499, -0.848 ], "quaternion": [ 0.189, 0.857, 0.436, -0.202 ] } }, { "index": 19, "nt1": "///I/19", "nt2": "///J/179", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.460, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.365, "chi2": -116.811, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.891, "C1C1_dist": 10.623, "N1N9_dist": 8.897, "C6C8_dist": 9.852, "CNNC_torsion": -1.957, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 8.500, "planarity": 0.119, "simple_Shear": -0.249, "simple_Stretch": -0.169, "simple_Buckle": -4.889, "simple_Propeller": -6.953, "bp_simpleParams": [ -0.249, -0.169, -0.452, -4.889, -6.953, 1.890 ], "bp_params": [ -0.246, -0.173, -0.452, -4.755, -7.045, 1.892 ], "frame": { "rmsd": null, "origin": [ 181.923, 158.743, 237.088 ], "x_axis": [ 0.960, 0.230, -0.158 ], "y_axis": [ 0.273, -0.886, 0.374 ], "z_axis": [ -0.054, -0.403, -0.914 ], "quaternion": [ 0.200, 0.970, 0.130, -0.055 ] } }, { "index": 20, "nt1": "///I/20", "nt2": "///J/178", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.930, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.865, "chi2": -116.953, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.036, "C1C1_dist": 10.684, "N1N9_dist": 8.926, "C6C8_dist": 9.854, "CNNC_torsion": 2.808, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 7.614, "planarity": 0.148, "simple_Shear": -0.213, "simple_Stretch": -0.186, "simple_Buckle": -6.464, "simple_Propeller": -4.022, "bp_simpleParams": [ -0.213, -0.186, -0.763, -6.464, -4.022, 0.751 ], "bp_params": [ -0.210, -0.189, -0.763, -6.403, -4.119, 0.751 ], "frame": { "rmsd": null, "origin": [ 181.504, 157.599, 233.989 ], "x_axis": [ 0.911, -0.394, 0.120 ], "y_axis": [ -0.409, -0.825, 0.390 ], "z_axis": [ -0.055, -0.405, -0.913 ], "quaternion": [ 0.208, 0.955, -0.210, 0.017 ] } }, { "index": 21, "nt1": "///I/21", "nt2": "///J/177", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.923, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.673, "chi2": -114.430, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.311, "C1C1_dist": 10.676, "N1N9_dist": 8.921, "C6C8_dist": 9.856, "CNNC_torsion": 3.679, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 4.410, "planarity": 0.176, "simple_Shear": 0.190, "simple_Stretch": -0.180, "simple_Buckle": -4.035, "simple_Propeller": -1.780, "bp_simpleParams": [ 0.190, -0.180, -0.590, -4.035, -1.780, 0.719 ], "bp_params": [ 0.188, -0.183, -0.590, -4.060, -1.722, 0.719 ], "frame": { "rmsd": null, "origin": [ 181.801, 156.240, 231.029 ], "x_axis": [ 0.497, -0.804, 0.325 ], "y_axis": [ -0.865, -0.430, 0.261 ], "z_axis": [ -0.070, -0.411, -0.909 ], "quaternion": [ 0.199, 0.842, -0.495, 0.076 ] } }, { "index": 22, "nt1": "///I/22", "nt2": "///J/176", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.056, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.820, "chi2": -111.569, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.663, "C1C1_dist": 10.778, "N1N9_dist": 8.992, "C6C8_dist": 9.905, "CNNC_torsion": -0.893, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.064, "planarity": 0.035, "simple_Shear": 0.187, "simple_Stretch": -0.117, "simple_Buckle": -3.041, "simple_Propeller": 0.378, "bp_simpleParams": [ 0.187, -0.117, 0.152, -3.041, 0.378, -0.423 ], "bp_params": [ 0.185, -0.120, 0.152, -3.035, 0.420, -0.423 ], "frame": { "rmsd": null, "origin": [ 181.170, 154.554, 227.925 ], "x_axis": [ -0.112, -0.900, 0.421 ], "y_axis": [ -0.987, 0.150, 0.058 ], "z_axis": [ -0.116, -0.409, -0.905 ], "quaternion": [ -0.182, -0.641, 0.736, -0.119 ] } }, { "index": 23, "nt1": "///I/23", "nt2": "///J/175", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.046, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.466, "chi2": -126.920, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.386, "C1C1_dist": 10.593, "N1N9_dist": 8.858, "C6C8_dist": 9.794, "CNNC_torsion": -10.815, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 3.907, "planarity": 0.198, "simple_Shear": -0.180, "simple_Stretch": -0.274, "simple_Buckle": 3.499, "simple_Propeller": -1.738, "bp_simpleParams": [ -0.180, -0.274, 0.983, 3.499, -1.738, 0.464 ], "bp_params": [ -0.177, -0.276, 0.983, 3.522, -1.691, 0.464 ], "frame": { "rmsd": null, "origin": [ 181.222, 152.950, 225.392 ], "x_axis": [ -0.620, -0.652, 0.435 ], "y_axis": [ -0.752, 0.652, -0.094 ], "z_axis": [ -0.222, -0.386, -0.895 ], "quaternion": [ -0.185, -0.395, 0.890, -0.135 ] } }, { "index": 24, "nt1": "///I/24", "nt2": "///J/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.375, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.185, "chi2": -130.078, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.423, "C1C1_dist": 10.633, "N1N9_dist": 8.872, "C6C8_dist": 9.795, "CNNC_torsion": -10.357, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.492, "planarity": 0.215, "simple_Shear": 0.163, "simple_Stretch": -0.260, "simple_Buckle": 3.227, "simple_Propeller": -3.125, "bp_simpleParams": [ 0.163, -0.260, 0.834, 3.227, -3.125, -0.290 ], "bp_params": [ 0.160, -0.262, 0.834, 3.191, -3.161, -0.290 ], "frame": { "rmsd": null, "origin": [ 181.598, 151.181, 222.530 ], "x_axis": [ -0.955, -0.099, 0.279 ], "y_axis": [ -0.196, 0.918, -0.345 ], "z_axis": [ -0.222, -0.385, -0.896 ], "quaternion": [ -0.129, -0.076, 0.971, -0.188 ] } }, { "index": 25, "nt1": "///I/25", "nt2": "///J/173", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.595, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.196, "chi2": -129.751, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.209, "C1C1_dist": 10.748, "N1N9_dist": 8.944, "C6C8_dist": 9.831, "CNNC_torsion": -8.950, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 3.315, "planarity": 0.159, "simple_Shear": 0.147, "simple_Stretch": -0.215, "simple_Buckle": 0.301, "simple_Propeller": -3.302, "bp_simpleParams": [ 0.147, -0.215, 0.694, 0.301, -3.302, -1.586 ], "bp_params": [ 0.145, -0.216, 0.694, 0.269, -3.305, -1.586 ], "frame": { "rmsd": null, "origin": [ 180.562, 149.535, 220.003 ], "x_axis": [ -0.890, 0.455, 0.016 ], "y_axis": [ 0.396, 0.791, -0.467 ], "z_axis": [ -0.225, -0.409, -0.884 ], "quaternion": [ -0.064, 0.226, 0.944, -0.232 ] } }, { "index": 26, "nt1": "///I/26", "nt2": "///J/172", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.963, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.781, "chi2": -131.965, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.065, "C1C1_dist": 10.720, "N1N9_dist": 8.938, "C6C8_dist": 9.850, "CNNC_torsion": -7.870, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 2.671, "planarity": 0.154, "simple_Shear": 0.162, "simple_Stretch": -0.195, "simple_Buckle": 1.577, "simple_Propeller": -2.156, "bp_simpleParams": [ 0.162, -0.195, 0.629, 1.577, -2.156, -0.610 ], "bp_params": [ 0.160, -0.197, 0.629, 1.552, -2.173, -0.610 ], "frame": { "rmsd": null, "origin": [ 179.637, 147.680, 217.544 ], "x_axis": [ -0.483, 0.834, -0.265 ], "y_axis": [ 0.845, 0.366, -0.390 ], "z_axis": [ -0.228, -0.412, -0.882 ], "quaternion": [ 0.011, 0.508, 0.826, -0.243 ] } }, { "index": 27, "nt1": "///I/27", "nt2": "///J/171", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.698, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.303, "chi2": -103.099, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.066, "C1C1_dist": 10.750, "N1N9_dist": 8.903, "C6C8_dist": 9.748, "CNNC_torsion": -14.689, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 5.639, "planarity": 0.223, "simple_Shear": -0.146, "simple_Stretch": -0.240, "simple_Buckle": 1.931, "simple_Propeller": -5.298, "bp_simpleParams": [ -0.146, -0.240, 0.918, 1.931, -5.298, -4.989 ], "bp_params": [ -0.141, -0.243, 0.918, 2.030, -5.261, -4.993 ], "frame": { "rmsd": null, "origin": [ 178.577, 146.097, 214.795 ], "x_axis": [ -0.055, 0.913, -0.405 ], "y_axis": [ 0.973, -0.041, -0.226 ], "z_axis": [ -0.223, -0.406, -0.886 ], "quaternion": [ 0.066, 0.684, 0.689, -0.229 ] } }, { "index": 28, "nt1": "///I/28", "nt2": "///J/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.168, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.126, "chi2": -92.897, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.112, "C1C1_dist": 10.718, "N1N9_dist": 8.953, "C6C8_dist": 9.868, "CNNC_torsion": -5.934, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 5.245, "planarity": 0.120, "simple_Shear": -0.242, "simple_Stretch": -0.154, "simple_Buckle": -3.373, "simple_Propeller": -4.017, "bp_simpleParams": [ -0.242, -0.154, 0.374, -3.373, -4.017, -0.273 ], "bp_params": [ -0.239, -0.158, 0.374, -3.297, -4.079, -0.273 ], "frame": { "rmsd": null, "origin": [ 178.838, 144.193, 211.649 ], "x_axis": [ 0.593, 0.643, -0.485 ], "y_axis": [ 0.763, -0.640, 0.084 ], "z_axis": [ -0.256, -0.421, -0.870 ], "quaternion": [ 0.143, 0.881, 0.399, -0.211 ] } }, { "index": 29, "nt1": "///I/29", "nt2": "///J/169", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.363, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.946, "chi2": -92.874, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.695, "C1C1_dist": 10.684, "N1N9_dist": 8.962, "C6C8_dist": 9.922, "CNNC_torsion": 0.096, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 4.855, "planarity": 0.065, "simple_Shear": -0.213, "simple_Stretch": -0.097, "simple_Buckle": -4.177, "simple_Propeller": -2.474, "bp_simpleParams": [ -0.213, -0.097, -0.315, -4.177, -2.474, 1.663 ], "bp_params": [ -0.211, -0.101, -0.315, -4.136, -2.541, 1.662 ], "frame": { "rmsd": null, "origin": [ 177.645, 142.559, 208.767 ], "x_axis": [ 0.902, 0.301, -0.309 ], "y_axis": [ 0.397, -0.857, 0.327 ], "z_axis": [ -0.166, -0.418, -0.893 ], "quaternion": [ 0.195, 0.956, 0.183, -0.124 ] } }, { "index": 30, "nt1": "///I/30", "nt2": "///J/168", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.277, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.461, "chi2": -109.386, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.326, "C1C1_dist": 10.688, "N1N9_dist": 8.909, "C6C8_dist": 9.837, "CNNC_torsion": 0.349, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.86]", "interBase_angle": 2.082, "planarity": 0.062, "simple_Shear": 0.097, "simple_Stretch": -0.118, "simple_Buckle": -1.640, "simple_Propeller": -1.283, "bp_simpleParams": [ 0.097, -0.118, -0.326, -1.640, -1.283, -0.894 ], "bp_params": [ 0.095, -0.119, -0.326, -1.658, -1.260, -0.894 ], "frame": { "rmsd": null, "origin": [ 176.581, 140.770, 206.189 ], "x_axis": [ 0.959, -0.275, 0.064 ], "y_axis": [ -0.269, -0.818, 0.509 ], "z_axis": [ -0.087, -0.506, -0.858 ], "quaternion": [ 0.266, 0.953, -0.143, -0.006 ] } }, { "index": 31, "nt1": "///I/31", "nt2": "///J/167", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.425, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.587, "chi2": -114.671, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.224, "C1C1_dist": 10.659, "N1N9_dist": 8.921, "C6C8_dist": 9.863, "CNNC_torsion": 2.423, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 4.177, "planarity": 0.122, "simple_Shear": -0.146, "simple_Stretch": -0.160, "simple_Buckle": 3.552, "simple_Propeller": -2.197, "bp_simpleParams": [ -0.146, -0.160, -0.336, 3.552, -2.197, 0.736 ], "bp_params": [ -0.144, -0.162, -0.336, 3.575, -2.159, 0.736 ], "frame": { "rmsd": null, "origin": [ 177.070, 139.238, 203.321 ], "x_axis": [ 0.734, -0.600, 0.316 ], "y_axis": [ -0.675, -0.599, 0.430 ], "z_axis": [ -0.069, -0.530, -0.845 ], "quaternion": [ 0.269, 0.891, -0.358, 0.069 ] } }, { "index": 32, "nt1": "///I/32", "nt2": "///J/166", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.604, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.917, "chi2": -105.891, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.578, "C1C1_dist": 10.667, "N1N9_dist": 8.904, "C6C8_dist": 9.847, "CNNC_torsion": -2.862, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.87]", "interBase_angle": 6.750, "planarity": 0.115, "simple_Shear": 0.112, "simple_Stretch": -0.108, "simple_Buckle": 2.732, "simple_Propeller": -6.173, "bp_simpleParams": [ 0.112, -0.108, -0.325, 2.732, -6.173, -0.124 ], "bp_params": [ 0.111, -0.109, -0.325, 2.637, -6.214, -0.124 ], "frame": { "rmsd": null, "origin": [ 176.310, 137.511, 200.574 ], "x_axis": [ 0.128, -0.857, 0.500 ], "y_axis": [ -0.987, -0.061, 0.147 ], "z_axis": [ -0.095, -0.512, -0.854 ], "quaternion": [ 0.230, 0.715, -0.645, 0.142 ] } }, { "index": 33, "nt1": "///I/33", "nt2": "///J/165", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.181, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.315, "chi2": -126.014, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.440, "C1C1_dist": 10.407, "N1N9_dist": 8.729, "C6C8_dist": 9.752, "CNNC_torsion": -3.097, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.82]", "interBase_angle": 9.931, "planarity": 0.201, "simple_Shear": 0.103, "simple_Stretch": -0.224, "simple_Buckle": 0.806, "simple_Propeller": -9.898, "bp_simpleParams": [ 0.103, -0.224, -0.734, 0.806, -9.898, 3.956 ], "bp_params": [ 0.100, -0.226, -0.734, 0.656, -9.909, 3.970 ], "frame": { "rmsd": null, "origin": [ 176.285, 135.767, 197.663 ], "x_axis": [ -0.486, -0.713, 0.505 ], "y_axis": [ -0.867, 0.465, -0.178 ], "z_axis": [ -0.108, -0.525, -0.844 ], "quaternion": [ -0.184, -0.472, 0.836, -0.210 ] } }, { "index": 34, "nt1": "///I/34", "nt2": "///J/164", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.267, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.107, "chi2": -91.359, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.967, "C1C1_dist": 10.101, "N1N9_dist": 8.519, "C6C8_dist": 9.618, "CNNC_torsion": -4.151, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 12.564, "planarity": 0.246, "simple_Shear": -0.058, "simple_Stretch": -0.331, "simple_Buckle": -6.263, "simple_Propeller": -10.892, "bp_simpleParams": [ -0.058, -0.331, -0.737, -6.263, -10.892, 7.501 ], "bp_params": [ -0.055, -0.331, -0.737, -6.161, -10.950, 7.524 ], "frame": { "rmsd": null, "origin": [ 176.003, 133.785, 194.798 ], "x_axis": [ -0.884, -0.336, 0.323 ], "y_axis": [ -0.456, 0.767, -0.450 ], "z_axis": [ -0.097, -0.546, -0.832 ], "quaternion": [ -0.113, -0.212, 0.933, -0.267 ] } }, { "index": 35, "nt1": "///I/35", "nt2": "///J/163", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.045, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.584, "chi2": -143.193, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.362, "C1C1_dist": 10.651, "N1N9_dist": 8.890, "C6C8_dist": 9.823, "CNNC_torsion": 1.906, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 8.997, "planarity": 0.241, "simple_Shear": 0.168, "simple_Stretch": -0.197, "simple_Buckle": -8.196, "simple_Propeller": -3.711, "bp_simpleParams": [ 0.168, -0.197, -0.633, -8.196, -3.711, 1.085 ], "bp_params": [ 0.165, -0.199, -0.633, -8.245, -3.602, 1.082 ], "frame": { "rmsd": null, "origin": [ 175.706, 132.092, 191.855 ], "x_axis": [ -0.964, 0.266, -0.011 ], "y_axis": [ 0.234, 0.828, -0.509 ], "z_axis": [ -0.126, -0.493, -0.861 ], "quaternion": [ -0.030, 0.131, 0.956, -0.262 ] } }, { "index": 36, "nt1": "///I/36", "nt2": "///J/162", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.998, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.639, "chi2": -101.915, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.954, "C1C1_dist": 10.647, "N1N9_dist": 8.905, "C6C8_dist": 9.845, "CNNC_torsion": 2.209, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 8.745, "planarity": 0.163, "simple_Shear": 0.176, "simple_Stretch": -0.152, "simple_Buckle": -8.690, "simple_Propeller": 0.980, "bp_simpleParams": [ 0.176, -0.152, -0.272, -8.690, 0.980, 0.673 ], "bp_params": [ 0.174, -0.155, -0.272, -8.678, 1.087, 0.672 ], "frame": { "rmsd": null, "origin": [ 175.620, 130.519, 188.929 ], "x_axis": [ -0.646, 0.720, -0.255 ], "y_axis": [ 0.753, 0.544, -0.370 ], "z_axis": [ -0.128, -0.431, -0.893 ], "quaternion": [ 0.036, 0.419, 0.878, -0.228 ] } }, { "index": 37, "nt1": "///I/37", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.233, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.026, "chi2": -115.682, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.286, "C1C1_dist": 10.768, "N1N9_dist": 8.978, "C6C8_dist": 9.885, "CNNC_torsion": -2.442, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 5.044, "planarity": 0.083, "simple_Shear": 0.195, "simple_Stretch": -0.140, "simple_Buckle": -3.753, "simple_Propeller": 3.370, "bp_simpleParams": [ 0.195, -0.140, 0.393, -3.753, 3.370, -0.294 ], "bp_params": [ 0.193, -0.143, 0.393, -3.705, 3.422, -0.294 ], "frame": { "rmsd": null, "origin": [ 174.431, 128.928, 186.317 ], "x_axis": [ -0.205, 0.930, -0.304 ], "y_axis": [ 0.974, 0.163, -0.157 ], "z_axis": [ -0.096, -0.328, -0.940 ], "quaternion": [ 0.068, 0.627, 0.760, -0.160 ] } }, { "index": 38, "nt1": "///I/38", "nt2": "///J/160", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.150, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.870, "chi2": -112.920, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.399, "C1C1_dist": 10.656, "N1N9_dist": 8.893, "C6C8_dist": 9.809, "CNNC_torsion": -6.254, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 1.989, "planarity": 0.168, "simple_Shear": -0.176, "simple_Stretch": -0.238, "simple_Buckle": 1.009, "simple_Propeller": 1.714, "bp_simpleParams": [ -0.176, -0.238, 0.762, 1.009, 1.714, 0.100 ], "bp_params": [ -0.173, -0.240, 0.762, 0.987, 1.727, 0.100 ], "frame": { "rmsd": null, "origin": [ 173.673, 128.280, 183.567 ], "x_axis": [ 0.332, 0.911, -0.243 ], "y_axis": [ 0.942, -0.334, 0.032 ], "z_axis": [ -0.052, -0.240, -0.969 ], "quaternion": [ 0.084, 0.812, 0.571, -0.091 ] } }, { "index": 39, "nt1": "///I/39", "nt2": "///J/159", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.922, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.163, "chi2": -126.357, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.943, "C1C1_dist": 10.648, "N1N9_dist": 8.898, "C6C8_dist": 9.826, "CNNC_torsion": -8.396, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 2.855, "planarity": 0.173, "simple_Shear": -0.187, "simple_Stretch": -0.227, "simple_Buckle": 2.798, "simple_Propeller": 0.564, "bp_simpleParams": [ -0.187, -0.227, 0.849, 2.798, 0.564, 0.496 ], "bp_params": [ -0.184, -0.230, 0.849, 2.790, 0.602, 0.496 ], "frame": { "rmsd": null, "origin": [ 172.907, 127.866, 180.536 ], "x_axis": [ 0.834, 0.541, -0.108 ], "y_axis": [ 0.551, -0.814, 0.184 ], "z_axis": [ 0.012, -0.213, -0.977 ], "quaternion": [ 0.104, 0.952, 0.287, -0.025 ] } }, { "index": 40, "nt1": "///I/40", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.196, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.688, "chi2": -118.070, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.288, "C1C1_dist": 10.687, "N1N9_dist": 8.892, "C6C8_dist": 9.799, "CNNC_torsion": -8.443, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 4.645, "planarity": 0.148, "simple_Shear": -0.117, "simple_Stretch": -0.162, "simple_Buckle": 3.346, "simple_Propeller": -3.222, "bp_simpleParams": [ -0.117, -0.162, 0.542, 3.346, -3.222, -2.205 ], "bp_params": [ -0.114, -0.164, 0.542, 3.397, -3.168, -2.205 ], "frame": { "rmsd": null, "origin": [ 172.438, 128.053, 177.192 ], "x_axis": [ 1.000, 0.006, 0.030 ], "y_axis": [ 0.001, -0.988, 0.155 ], "z_axis": [ 0.031, -0.155, -0.987 ], "quaternion": [ 0.078, 0.997, 0.002, 0.015 ] } }, { "index": 41, "nt1": "///I/41", "nt2": "///J/157", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.320, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.146, "chi2": -105.105, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.443, "C1C1_dist": 10.604, "N1N9_dist": 8.908, "C6C8_dist": 9.877, "CNNC_torsion": -3.796, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 4.685, "planarity": 0.077, "simple_Shear": -0.216, "simple_Stretch": -0.143, "simple_Buckle": 4.196, "simple_Propeller": -2.086, "bp_simpleParams": [ -0.216, -0.143, 0.386, 4.196, -2.086, 1.625 ], "bp_params": [ -0.214, -0.147, 0.386, 4.232, -2.012, 1.624 ], "frame": { "rmsd": null, "origin": [ 173.085, 126.952, 174.183 ], "x_axis": [ 0.806, -0.582, 0.108 ], "y_axis": [ -0.589, -0.807, 0.050 ], "z_axis": [ 0.058, -0.104, -0.993 ], "quaternion": [ 0.041, 0.949, -0.308, 0.044 ] } }, { "index": 42, "nt1": "///I/42", "nt2": "///J/156", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.360, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.178, "chi2": -101.080, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.392, "C1C1_dist": 10.729, "N1N9_dist": 8.950, "C6C8_dist": 9.860, "CNNC_torsion": -8.252, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 10.069, "planarity": 0.125, "simple_Shear": 0.214, "simple_Stretch": -0.151, "simple_Buckle": 4.873, "simple_Propeller": -8.811, "bp_simpleParams": [ 0.214, -0.151, 0.098, 4.873, -8.811, -0.403 ], "bp_params": [ 0.211, -0.154, 0.098, 4.737, -8.886, -0.404 ], "frame": { "rmsd": null, "origin": [ 172.353, 126.951, 170.455 ], "x_axis": [ 0.352, -0.930, 0.102 ], "y_axis": [ -0.934, -0.356, -0.021 ], "z_axis": [ 0.056, -0.088, -0.995 ], "quaternion": [ 0.020, 0.822, -0.567, 0.048 ] } }, { "index": 43, "nt1": "///I/43", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -83.340, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.445, "chi2": -88.049, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.742, "C1C1_dist": 10.644, "N1N9_dist": 8.921, "C6C8_dist": 9.871, "CNNC_torsion": -13.838, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 11.370, "planarity": 0.171, "simple_Shear": 0.197, "simple_Stretch": -0.166, "simple_Buckle": 0.192, "simple_Propeller": -11.368, "bp_simpleParams": [ 0.197, -0.166, 0.488, 0.192, -11.368, 0.330 ], "bp_params": [ 0.195, -0.169, 0.488, 0.019, -11.370, 0.331 ], "frame": { "rmsd": null, "origin": [ 170.560, 126.255, 166.857 ], "x_axis": [ -0.358, -0.934, 0.011 ], "y_axis": [ -0.931, 0.356, -0.083 ], "z_axis": [ 0.074, -0.040, -0.996 ], "quaternion": [ 0.019, -0.566, 0.823, -0.038 ] } }, { "index": 44, "nt1": "///I/44", "nt2": "///J/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.589, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.928, "chi2": -58.737, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 56.388, "C1C1_dist": 10.504, "N1N9_dist": 8.863, "C6C8_dist": 9.879, "CNNC_torsion": -6.952, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 13.269, "planarity": 0.150, "simple_Shear": -0.270, "simple_Stretch": -0.122, "simple_Buckle": -7.492, "simple_Propeller": -10.952, "bp_simpleParams": [ -0.270, -0.122, -0.277, -7.492, -10.952, 4.074 ], "bp_params": [ -0.268, -0.127, -0.277, -7.270, -11.101, 4.085 ], "frame": { "rmsd": null, "origin": [ 169.336, 127.503, 163.208 ], "x_axis": [ -0.865, -0.499, -0.059 ], "y_axis": [ -0.493, 0.866, -0.084 ], "z_axis": [ 0.093, -0.044, -0.995 ], "quaternion": [ 0.039, -0.257, 0.965, -0.033 ] } }, { "index": 45, "nt1": "///I/45", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -82.237, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.587, "chi2": -110.066, "conf2": "anti", "pucker2": "----", "lambda2": 54.013, "C1C1_dist": 10.347, "N1N9_dist": 8.670, "C6C8_dist": 9.658, "CNNC_torsion": 1.593, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.82]", "interBase_angle": 13.798, "planarity": 0.259, "simple_Shear": 0.136, "simple_Stretch": -0.322, "simple_Buckle": -10.479, "simple_Propeller": -8.976, "bp_simpleParams": [ 0.136, -0.322, -1.216, -10.479, -8.976, 3.173 ], "bp_params": [ 0.129, -0.325, -1.216, -10.675, -8.742, 3.169 ], "frame": { "rmsd": null, "origin": [ 170.303, 129.570, 159.704 ], "x_axis": [ -0.972, 0.228, -0.056 ], "y_axis": [ 0.226, 0.973, 0.036 ], "z_axis": [ 0.063, 0.022, -0.998 ], "quaternion": [ 0.030, 0.114, 0.993, 0.015 ] } }, { "index": 46, "nt1": "///I/46", "nt2": "///J/152", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.418, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.142, "chi2": -90.106, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.189, "C1C1_dist": 10.522, "N1N9_dist": 8.785, "C6C8_dist": 9.689, "CNNC_torsion": 11.335, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 10.099, "planarity": 0.261, "simple_Shear": -0.144, "simple_Stretch": -0.395, "simple_Buckle": -10.030, "simple_Propeller": -1.177, "bp_simpleParams": [ -0.144, -0.395, -1.391, -10.030, -1.177, -0.340 ], "bp_params": [ -0.141, -0.396, -1.391, -10.019, -1.268, -0.339 ], "frame": { "rmsd": null, "origin": [ 170.990, 130.527, 156.367 ], "x_axis": [ -0.710, 0.703, 0.042 ], "y_axis": [ 0.703, 0.703, 0.106 ], "z_axis": [ 0.045, 0.104, -0.994 ], "quaternion": [ 0.001, 0.381, 0.923, 0.057 ] } }, { "index": 47, "nt1": "///I/47", "nt2": "///J/151", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.690, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.540, "chi2": -93.646, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.909, "C1C1_dist": 10.636, "N1N9_dist": 8.861, "C6C8_dist": 9.755, "CNNC_torsion": 11.898, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 5.016, "planarity": 0.215, "simple_Shear": -0.136, "simple_Stretch": -0.320, "simple_Buckle": -4.414, "simple_Propeller": 2.383, "bp_simpleParams": [ -0.136, -0.320, -1.079, -4.414, 2.383, -1.437 ], "bp_params": [ -0.133, -0.321, -1.079, -4.436, 2.342, -1.436 ], "frame": { "rmsd": null, "origin": [ 171.174, 131.003, 153.198 ], "x_axis": [ -0.258, 0.950, 0.178 ], "y_axis": [ 0.965, 0.243, 0.100 ], "z_axis": [ 0.052, 0.197, -0.979 ], "quaternion": [ -0.040, 0.608, 0.787, 0.094 ] } }, { "index": 48, "nt1": "///I/48", "nt2": "///J/150", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.195, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.051, "chi2": -112.818, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.843, "C1C1_dist": 10.696, "N1N9_dist": 8.925, "C6C8_dist": 9.844, "CNNC_torsion": 4.661, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 2.590, "planarity": 0.082, "simple_Shear": 0.178, "simple_Stretch": -0.180, "simple_Buckle": 0.832, "simple_Propeller": 2.453, "bp_simpleParams": [ 0.178, -0.180, -0.384, 0.832, 2.453, -0.216 ], "bp_params": [ 0.175, -0.182, -0.384, 0.864, 2.442, -0.216 ], "frame": { "rmsd": null, "origin": [ 171.177, 132.015, 150.085 ], "x_axis": [ 0.380, 0.874, 0.302 ], "y_axis": [ 0.918, -0.396, -0.009 ], "z_axis": [ 0.112, 0.281, -0.953 ], "quaternion": [ -0.088, 0.826, 0.543, 0.125 ] } }, { "index": 49, "nt1": "///I/49", "nt2": "///J/149", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.998, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.974, "chi2": -115.747, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.378, "C1C1_dist": 10.742, "N1N9_dist": 8.972, "C6C8_dist": 9.902, "CNNC_torsion": 2.192, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 3.238, "planarity": 0.044, "simple_Shear": 0.224, "simple_Stretch": -0.116, "simple_Buckle": 1.260, "simple_Propeller": 2.983, "bp_simpleParams": [ 0.224, -0.116, -0.046, 1.260, 2.983, 0.493 ], "bp_params": [ 0.222, -0.120, -0.046, 1.312, 2.960, 0.493 ], "frame": { "rmsd": null, "origin": [ 171.433, 133.367, 147.105 ], "x_axis": [ 0.823, 0.479, 0.306 ], "y_axis": [ 0.551, -0.804, -0.222 ], "z_axis": [ 0.140, 0.352, -0.926 ], "quaternion": [ -0.152, 0.942, 0.273, 0.118 ] } }, { "index": 50, "nt1": "///I/50", "nt2": "///J/148", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.141, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.106, "chi2": -129.592, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.812, "C1C1_dist": 10.725, "N1N9_dist": 8.933, "C6C8_dist": 9.828, "CNNC_torsion": -7.144, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 4.109, "planarity": 0.133, "simple_Shear": -0.169, "simple_Stretch": -0.208, "simple_Buckle": 4.088, "simple_Propeller": -0.415, "bp_simpleParams": [ -0.169, -0.208, 0.699, 4.088, -0.415, -0.932 ], "bp_params": [ -0.167, -0.210, 0.699, 4.092, -0.366, -0.932 ], "frame": { "rmsd": null, "origin": [ 172.527, 134.687, 144.414 ], "x_axis": [ 0.977, -0.133, 0.167 ], "y_axis": [ -0.057, -0.916, -0.397 ], "z_axis": [ 0.205, 0.378, -0.903 ], "quaternion": [ -0.199, 0.974, -0.049, 0.096 ] } }, { "index": 51, "nt1": "///I/51", "nt2": "///J/147", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.380, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.335, "chi2": -110.484, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.751, "C1C1_dist": 10.567, "N1N9_dist": 8.862, "C6C8_dist": 9.823, "CNNC_torsion": -6.551, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 7.308, "planarity": 0.208, "simple_Shear": 0.235, "simple_Stretch": -0.195, "simple_Buckle": 7.241, "simple_Propeller": -0.985, "bp_simpleParams": [ 0.235, -0.195, 0.602, 7.241, -0.985, 1.565 ], "bp_params": [ 0.232, -0.200, 0.602, 7.222, -1.117, 1.562 ], "frame": { "rmsd": null, "origin": [ 173.944, 135.773, 141.566 ], "x_axis": [ 0.768, -0.635, -0.084 ], "y_axis": [ -0.585, -0.641, -0.496 ], "z_axis": [ 0.261, 0.431, -0.864 ], "quaternion": [ -0.256, 0.905, -0.337, 0.049 ] } }, { "index": 52, "nt1": "///I/52", "nt2": "///J/146", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.662, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.307, "chi2": -109.492, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.414, "C1C1_dist": 10.741, "N1N9_dist": 8.867, "C6C8_dist": 9.666, "CNNC_torsion": -18.037, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 15.767, "planarity": 0.303, "simple_Shear": -0.093, "simple_Stretch": -0.262, "simple_Buckle": 9.928, "simple_Propeller": -12.249, "bp_simpleParams": [ -0.093, -0.262, 0.731, 9.928, -12.249, -7.520 ], "bp_params": [ -0.088, -0.263, 0.731, 10.133, -12.080, -7.532 ], "frame": { "rmsd": null, "origin": [ 174.131, 137.551, 138.656 ], "x_axis": [ 0.303, -0.876, -0.375 ], "y_axis": [ -0.908, -0.146, -0.392 ], "z_axis": [ 0.289, 0.459, -0.840 ], "quaternion": [ -0.281, 0.757, -0.590, -0.028 ] } }, { "index": 53, "nt1": "///I/53", "nt2": "///J/145", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.113, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.199, "chi2": -92.523, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.108, "C1C1_dist": 10.646, "N1N9_dist": 8.926, "C6C8_dist": 9.882, "CNNC_torsion": -13.576, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 14.256, "planarity": 0.184, "simple_Shear": 0.188, "simple_Stretch": -0.144, "simple_Buckle": -1.041, "simple_Propeller": -14.218, "bp_simpleParams": [ 0.188, -0.144, 0.279, -1.041, -14.218, 0.675 ], "bp_params": [ 0.186, -0.147, 0.279, -1.252, -14.201, 0.680 ], "frame": { "rmsd": null, "origin": [ 173.675, 139.058, 134.907 ], "x_axis": [ -0.389, -0.665, -0.637 ], "y_axis": [ -0.845, 0.533, -0.041 ], "z_axis": [ 0.367, 0.523, -0.769 ], "quaternion": [ 0.306, -0.460, 0.820, 0.147 ] } }, { "index": 54, "nt1": "///I/54", "nt2": "///J/144", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.741, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.166, "chi2": -79.685, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.318, "C1C1_dist": 10.357, "N1N9_dist": 8.720, "C6C8_dist": 9.736, "CNNC_torsion": -2.386, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.81]", "interBase_angle": 18.027, "planarity": 0.255, "simple_Shear": 0.075, "simple_Stretch": -0.191, "simple_Buckle": -12.091, "simple_Propeller": -13.371, "bp_simpleParams": [ 0.075, -0.191, -0.862, -12.091, -13.371, 4.720 ], "bp_params": [ 0.072, -0.192, -0.862, -12.332, -13.149, 4.724 ], "frame": { "rmsd": null, "origin": [ 173.842, 142.609, 132.589 ], "x_axis": [ -0.814, -0.170, -0.556 ], "y_axis": [ -0.416, 0.839, 0.352 ], "z_axis": [ 0.406, 0.517, -0.753 ], "quaternion": [ 0.261, -0.159, 0.923, 0.236 ] } }, { "index": 55, "nt1": "///I/55", "nt2": "///J/143", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.965, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.175, "chi2": -80.534, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.920, "C1C1_dist": 10.051, "N1N9_dist": 8.490, "C6C8_dist": 9.532, "CNNC_torsion": 6.249, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.11],N1-N3(imino)[2.88]", "interBase_angle": 19.712, "planarity": 0.381, "simple_Shear": -0.024, "simple_Stretch": -0.476, "simple_Buckle": -17.137, "simple_Propeller": -9.739, "bp_simpleParams": [ -0.024, -0.476, -1.849, -17.137, -9.739, 7.949 ], "bp_params": [ -0.028, -0.476, -1.849, -17.251, -9.537, 7.887 ], "frame": { "rmsd": null, "origin": [ 175.777, 145.791, 131.253 ], "x_axis": [ -0.927, 0.337, -0.167 ], "y_axis": [ 0.141, 0.723, 0.676 ], "z_axis": [ 0.348, 0.603, -0.718 ], "quaternion": [ 0.140, 0.130, 0.918, 0.348 ] } }, { "index": 56, "nt1": "///I/56", "nt2": "///J/142", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.928, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.948, "chi2": -85.287, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.754, "C1C1_dist": 10.294, "N1N9_dist": 8.549, "C6C8_dist": 9.474, "CNNC_torsion": 10.170, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 9.585, "planarity": 0.372, "simple_Shear": -0.221, "simple_Stretch": -0.550, "simple_Buckle": -9.451, "simple_Propeller": -1.596, "bp_simpleParams": [ -0.221, -0.550, -1.404, -9.451, -1.596, -0.824 ], "bp_params": [ -0.207, -0.555, -1.404, -9.408, -1.836, -0.822 ], "frame": { "rmsd": null, "origin": [ 177.563, 147.490, 129.262 ], "x_axis": [ -0.739, 0.621, 0.259 ], "y_axis": [ 0.565, 0.363, 0.741 ], "z_axis": [ 0.366, 0.694, -0.619 ], "quaternion": [ 0.032, 0.360, 0.825, 0.435 ] } }, { "index": 57, "nt1": "///I/56", "nt2": "///J/143", "bp": "T-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.928, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 67.375, "chi2": -80.534, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 77.737, "C1C1_dist": 8.383, "N1N9_dist": 7.493, "C6C8_dist": 9.269, "CNNC_torsion": -11.455, "hbonds_num": 1, "hbonds_desc": "N3(imino)-O2(carbonyl)[3.99]", "interBase_angle": 21.533, "planarity": 0.315, "simple_Shear": -0.853, "simple_Stretch": -0.260, "simple_Buckle": -21.490, "simple_Propeller": -1.354, "bp_simpleParams": [ -0.853, -0.260, 1.474, -21.490, -1.354, 35.780 ], "bp_params": [ -0.827, -0.334, 1.474, -21.293, -3.208, 35.216 ], "frame": { "rmsd": null, "origin": [ 176.672, 146.681, 130.106 ], "x_axis": [ -0.872, 0.489, 0.011 ], "y_axis": [ 0.351, 0.610, 0.710 ], "z_axis": [ 0.340, 0.624, -0.704 ], "quaternion": [ 0.092, 0.235, 0.893, 0.374 ] } }, { "index": 58, "nt1": "///I/57", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.577, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.329, "chi2": -101.178, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.741, "C1C1_dist": 10.529, "N1N9_dist": 8.726, "C6C8_dist": 9.612, "CNNC_torsion": 16.413, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.75],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 10.348, "planarity": 0.251, "simple_Shear": -0.266, "simple_Stretch": -0.367, "simple_Buckle": -2.474, "simple_Propeller": 10.048, "bp_simpleParams": [ -0.266, -0.367, -0.892, -2.474, 10.048, -3.946 ], "bp_params": [ -0.254, -0.375, -0.892, -2.782, 9.967, -3.959 ], "frame": { "rmsd": null, "origin": [ 178.951, 150.063, 127.195 ], "x_axis": [ -0.385, 0.615, 0.688 ], "y_axis": [ 0.847, -0.060, 0.528 ], "z_axis": [ 0.366, 0.786, -0.498 ], "quaternion": [ -0.119, 0.542, 0.675, 0.487 ] } }, { "index": 59, "nt1": "///I/58", "nt2": "///J/140", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.890, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.672, "chi2": -103.215, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.672, "C1C1_dist": 10.638, "N1N9_dist": 8.878, "C6C8_dist": 9.811, "CNNC_torsion": 11.988, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 12.465, "planarity": 0.163, "simple_Shear": -0.230, "simple_Stretch": -0.205, "simple_Buckle": 2.560, "simple_Propeller": 12.199, "bp_simpleParams": [ -0.230, -0.205, -0.245, 2.560, 12.199, 0.245 ], "bp_params": [ -0.226, -0.209, -0.245, 2.343, 12.243, 0.246 ], "frame": { "rmsd": null, "origin": [ 180.544, 152.808, 126.555 ], "x_axis": [ 0.109, 0.354, 0.929 ], "y_axis": [ 0.916, -0.400, 0.045 ], "z_axis": [ 0.387, 0.846, -0.368 ], "quaternion": [ -0.292, 0.685, 0.463, 0.480 ] } }, { "index": 60, "nt1": "///I/59", "nt2": "///J/139", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.157, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.158, "chi2": -106.599, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.668, "C1C1_dist": 10.660, "N1N9_dist": 8.913, "C6C8_dist": 9.843, "CNNC_torsion": 6.769, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 5.804, "planarity": 0.085, "simple_Shear": -0.215, "simple_Stretch": -0.174, "simple_Buckle": 1.458, "simple_Propeller": 5.618, "bp_simpleParams": [ -0.215, -0.174, -0.185, 1.458, 5.618, -0.097 ], "bp_params": [ -0.212, -0.178, -0.185, 1.364, 5.642, -0.098 ], "frame": { "rmsd": null, "origin": [ 181.497, 156.066, 126.291 ], "x_axis": [ 0.498, -0.042, 0.866 ], "y_axis": [ 0.758, -0.464, -0.458 ], "z_axis": [ 0.421, 0.885, -0.199 ], "quaternion": [ -0.457, 0.735, 0.244, 0.438 ] } }, { "index": 61, "nt1": "///I/60", "nt2": "///J/138", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.473, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.015, "chi2": -125.564, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.902, "C1C1_dist": 10.549, "N1N9_dist": 8.798, "C6C8_dist": 9.752, "CNNC_torsion": -0.706, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 7.518, "planarity": 0.133, "simple_Shear": -0.059, "simple_Stretch": -0.177, "simple_Buckle": 7.058, "simple_Propeller": 2.590, "bp_simpleParams": [ -0.059, -0.177, 0.292, 7.058, 2.590, 0.481 ], "bp_params": [ -0.057, -0.178, 0.292, 7.034, 2.655, 0.481 ], "frame": { "rmsd": null, "origin": [ 182.523, 159.256, 126.345 ], "x_axis": [ 0.810, -0.334, 0.482 ], "y_axis": [ 0.374, -0.339, -0.863 ], "z_axis": [ 0.451, 0.880, -0.150 ], "quaternion": [ 0.575, -0.758, -0.013, -0.308 ] } }, { "index": 62, "nt1": "///I/61", "nt2": "///J/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.690, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.870, "chi2": -127.274, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.562, "C1C1_dist": 10.679, "N1N9_dist": 8.920, "C6C8_dist": 9.843, "CNNC_torsion": -3.520, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 4.834, "planarity": 0.105, "simple_Shear": 0.215, "simple_Stretch": -0.172, "simple_Buckle": 4.104, "simple_Propeller": -2.554, "bp_simpleParams": [ 0.215, -0.172, 0.282, 4.104, -2.554, -0.084 ], "bp_params": [ 0.212, -0.176, 0.282, 4.062, -2.621, -0.084 ], "frame": { "rmsd": null, "origin": [ 184.689, 161.875, 126.477 ], "x_axis": [ 0.863, -0.487, -0.135 ], "y_axis": [ -0.130, 0.045, -0.991 ], "z_axis": [ 0.488, 0.872, -0.024 ], "quaternion": [ 0.686, -0.679, 0.227, -0.130 ] } }, { "index": 63, "nt1": "///I/62", "nt2": "///J/136", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.289, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.617, "chi2": -102.530, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.767, "C1C1_dist": 10.612, "N1N9_dist": 8.867, "C6C8_dist": 9.782, "CNNC_torsion": -15.321, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 7.246, "planarity": 0.220, "simple_Shear": -0.148, "simple_Stretch": -0.290, "simple_Buckle": 1.962, "simple_Propeller": -6.976, "bp_simpleParams": [ -0.148, -0.290, 0.987, 1.962, -6.976, -1.154 ], "bp_params": [ -0.145, -0.292, 0.987, 2.036, -6.955, -1.156 ], "frame": { "rmsd": null, "origin": [ 186.183, 164.930, 125.478 ], "x_axis": [ 0.628, -0.347, -0.697 ], "y_axis": [ -0.621, 0.317, -0.717 ], "z_axis": [ 0.469, 0.883, -0.017 ], "quaternion": [ 0.694, -0.576, 0.420, 0.099 ] } }, { "index": 64, "nt1": "///I/63", "nt2": "///J/135", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.374, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.054, "chi2": -106.263, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.115, "C1C1_dist": 10.610, "N1N9_dist": 8.841, "C6C8_dist": 9.755, "CNNC_torsion": -16.880, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 9.249, "planarity": 0.222, "simple_Shear": -0.189, "simple_Stretch": -0.239, "simple_Buckle": -1.115, "simple_Propeller": -9.181, "bp_simpleParams": [ -0.189, -0.239, 0.893, -1.115, -9.181, -2.664 ], "bp_params": [ -0.184, -0.243, 0.893, -0.904, -9.204, -2.672 ], "frame": { "rmsd": null, "origin": [ 187.527, 168.498, 125.495 ], "x_axis": [ 0.169, -0.065, -0.983 ], "y_axis": [ -0.867, 0.465, -0.180 ], "z_axis": [ 0.469, 0.883, 0.022 ], "quaternion": [ 0.644, -0.413, 0.564, 0.311 ] } }, { "index": 65, "nt1": "///I/64", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.020, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 53.669, "chi2": -99.196, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.041, "C1C1_dist": 10.674, "N1N9_dist": 8.897, "C6C8_dist": 9.799, "CNNC_torsion": -11.266, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.86]", "interBase_angle": 21.784, "planarity": 0.281, "simple_Shear": 0.062, "simple_Stretch": -0.107, "simple_Buckle": -11.636, "simple_Propeller": -18.416, "bp_simpleParams": [ 0.062, -0.107, -0.468, -11.636, -18.416, -0.299 ], "bp_params": [ 0.059, -0.108, -0.468, -11.940, -18.220, -0.301 ], "frame": { "rmsd": null, "origin": [ 187.690, 172.428, 127.028 ], "x_axis": [ -0.456, 0.417, -0.786 ], "y_axis": [ -0.723, 0.341, 0.600 ], "z_axis": [ 0.518, 0.843, 0.146 ], "quaternion": [ 0.508, -0.119, 0.642, 0.562 ] } }, { "index": 66, "nt1": "///I/65", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.642, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.498, "chi2": -79.856, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.556, "C1C1_dist": 10.533, "N1N9_dist": 8.849, "C6C8_dist": 9.800, "CNNC_torsion": 1.091, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 17.497, "planarity": 0.205, "simple_Shear": -0.238, "simple_Stretch": -0.172, "simple_Buckle": -15.180, "simple_Propeller": -8.700, "bp_simpleParams": [ -0.238, -0.172, -0.891, -15.180, -8.700, 2.639 ], "bp_params": [ -0.235, -0.176, -0.891, -15.072, -8.887, 2.625 ], "frame": { "rmsd": null, "origin": [ 188.517, 175.556, 128.200 ], "x_axis": [ -0.775, 0.508, -0.375 ], "y_axis": [ -0.403, 0.060, 0.913 ], "z_axis": [ 0.486, 0.859, 0.158 ], "quaternion": [ 0.333, 0.040, 0.647, 0.685 ] } }, { "index": 67, "nt1": "///I/66", "nt2": "///J/132", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.418, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.672, "chi2": -85.049, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.285, "C1C1_dist": 10.441, "N1N9_dist": 8.734, "C6C8_dist": 9.693, "CNNC_torsion": 6.530, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 13.938, "planarity": 0.224, "simple_Shear": 0.101, "simple_Stretch": -0.248, "simple_Buckle": -13.823, "simple_Propeller": -1.787, "bp_simpleParams": [ 0.101, -0.248, -1.130, -13.823, -1.787, 1.026 ], "bp_params": [ 0.098, -0.249, -1.130, -13.850, -1.564, 1.019 ], "frame": { "rmsd": null, "origin": [ 190.892, 177.582, 129.984 ], "x_axis": [ -0.903, 0.360, 0.235 ], "y_axis": [ 0.091, -0.373, 0.923 ], "z_axis": [ 0.420, 0.855, 0.304 ], "quaternion": [ 0.084, 0.204, 0.553, 0.803 ] } }, { "index": 68, "nt1": "///I/67", "nt2": "///J/131", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.491, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.219, "chi2": -98.967, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.355, "C1C1_dist": 10.496, "N1N9_dist": 8.817, "C6C8_dist": 9.805, "CNNC_torsion": 5.755, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 8.678, "planarity": 0.200, "simple_Shear": 0.198, "simple_Stretch": -0.203, "simple_Buckle": -8.023, "simple_Propeller": 3.306, "bp_simpleParams": [ 0.198, -0.203, -0.526, -8.023, 3.306, 2.348 ], "bp_params": [ 0.195, -0.206, -0.526, -7.977, 3.415, 2.343 ], "frame": { "rmsd": null, "origin": [ 191.690, 180.406, 131.165 ], "x_axis": [ -0.767, -0.047, 0.640 ], "y_axis": [ 0.545, -0.574, 0.611 ], "z_axis": [ 0.339, 0.817, 0.466 ], "quaternion": [ -0.177, 0.292, 0.426, 0.838 ] } }, { "index": 69, "nt1": "///I/68", "nt2": "///J/130", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.979, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.561, "chi2": -103.958, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.948, "C1C1_dist": 10.562, "N1N9_dist": 8.838, "C6C8_dist": 9.811, "CNNC_torsion": 4.875, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.83]", "interBase_angle": 8.052, "planarity": 0.094, "simple_Shear": 0.071, "simple_Stretch": -0.125, "simple_Buckle": -7.107, "simple_Propeller": 3.786, "bp_simpleParams": [ 0.071, -0.125, -0.322, -7.107, 3.786, 0.739 ], "bp_params": [ 0.070, -0.126, -0.322, -7.067, 3.859, 0.738 ], "frame": { "rmsd": null, "origin": [ 192.888, 183.007, 132.470 ], "x_axis": [ -0.352, -0.520, 0.779 ], "y_axis": [ 0.897, -0.425, 0.122 ], "z_axis": [ 0.268, 0.741, 0.616 ], "quaternion": [ -0.458, 0.338, 0.279, 0.773 ] } }, { "index": 70, "nt1": "///I/69", "nt2": "///J/129", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.604, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.529, "chi2": -125.079, "conf2": "anti", "pucker2": "----", "lambda2": 53.201, "C1C1_dist": 10.739, "N1N9_dist": 8.957, "C6C8_dist": 9.870, "CNNC_torsion": 4.440, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 2.153, "planarity": 0.119, "simple_Shear": -0.197, "simple_Stretch": -0.169, "simple_Buckle": -1.930, "simple_Propeller": 0.955, "bp_simpleParams": [ -0.197, -0.169, -0.598, -1.930, 0.955, -0.345 ], "bp_params": [ -0.195, -0.172, -0.598, -1.944, 0.926, -0.345 ], "frame": { "rmsd": null, "origin": [ 193.443, 185.397, 134.688 ], "x_axis": [ 0.123, -0.705, 0.699 ], "y_axis": [ 0.953, -0.113, -0.281 ], "z_axis": [ 0.277, 0.701, 0.658 ], "quaternion": [ 0.646, -0.380, -0.164, -0.642 ] } }, { "index": 71, "nt1": "///I/70", "nt2": "///J/128", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.603, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.068, "chi2": -104.905, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.112, "C1C1_dist": 10.657, "N1N9_dist": 8.911, "C6C8_dist": 9.843, "CNNC_torsion": 3.520, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 5.054, "planarity": 0.098, "simple_Shear": 0.202, "simple_Stretch": -0.181, "simple_Buckle": 4.987, "simple_Propeller": -0.818, "bp_simpleParams": [ 0.202, -0.181, -0.535, 4.987, -0.818, 0.454 ], "bp_params": [ 0.199, -0.184, -0.535, 4.974, -0.893, 0.453 ], "frame": { "rmsd": null, "origin": [ 193.931, 187.608, 136.773 ], "x_axis": [ 0.618, -0.679, 0.396 ], "y_axis": [ 0.727, 0.302, -0.617 ], "z_axis": [ 0.299, 0.669, 0.680 ], "quaternion": [ 0.806, -0.399, -0.030, -0.436 ] } }, { "index": 72, "nt1": "///I/71", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.797, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.320, "chi2": -108.439, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.535, "C1C1_dist": 10.458, "N1N9_dist": 8.747, "C6C8_dist": 9.716, "CNNC_torsion": -1.958, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 11.320, "planarity": 0.153, "simple_Shear": -0.042, "simple_Stretch": -0.212, "simple_Buckle": 8.877, "simple_Propeller": -7.024, "bp_simpleParams": [ -0.042, -0.212, -0.509, 8.877, -7.024, 1.351 ], "bp_params": [ -0.039, -0.213, -0.509, 8.957, -6.922, 1.349 ], "frame": { "rmsd": null, "origin": [ 194.758, 189.621, 139.124 ], "x_axis": [ 0.890, -0.457, -0.016 ], "y_axis": [ 0.310, 0.629, -0.713 ], "z_axis": [ 0.336, 0.630, 0.700 ], "quaternion": [ 0.897, -0.374, 0.098, -0.214 ] } }, { "index": 73, "nt1": "///I/72", "nt2": "///J/126", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.067, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.116, "chi2": -102.056, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.664, "C1C1_dist": 10.520, "N1N9_dist": 8.888, "C6C8_dist": 9.903, "CNNC_torsion": -0.689, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 9.238, "planarity": 0.114, "simple_Shear": 0.276, "simple_Stretch": -0.110, "simple_Buckle": 5.942, "simple_Propeller": -7.073, "bp_simpleParams": [ 0.276, -0.110, -0.393, 5.942, -7.073, 4.003 ], "bp_params": [ 0.273, -0.116, -0.393, 5.789, -7.199, 4.006 ], "frame": { "rmsd": null, "origin": [ 196.890, 192.508, 140.553 ], "x_axis": [ 0.879, 0.113, -0.464 ], "y_axis": [ -0.336, 0.836, -0.434 ], "z_axis": [ 0.338, 0.538, 0.772 ], "quaternion": [ 0.934, -0.260, 0.215, 0.120 ] } }, { "index": 74, "nt1": "///I/73", "nt2": "///J/125", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -82.990, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.630, "chi2": -100.411, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.639, "C1C1_dist": 10.525, "N1N9_dist": 8.806, "C6C8_dist": 9.780, "CNNC_torsion": -11.708, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 16.925, "planarity": 0.224, "simple_Shear": -0.063, "simple_Stretch": -0.169, "simple_Buckle": 3.056, "simple_Propeller": -16.647, "bp_simpleParams": [ -0.063, -0.169, -0.336, 3.056, -16.647, 1.788 ], "bp_params": [ -0.061, -0.170, -0.336, 3.253, -16.610, 1.806 ], "frame": { "rmsd": null, "origin": [ 196.995, 194.569, 143.529 ], "x_axis": [ 0.544, 0.538, -0.644 ], "y_axis": [ -0.765, 0.633, -0.118 ], "z_axis": [ 0.345, 0.557, 0.756 ], "quaternion": [ 0.856, -0.197, 0.289, 0.380 ] } }, { "index": 75, "nt1": "///I/74", "nt2": "///J/124", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.212, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.063, "chi2": -100.865, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.888, "C1C1_dist": 10.533, "N1N9_dist": 8.838, "C6C8_dist": 9.834, "CNNC_torsion": -1.657, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.83]", "interBase_angle": 8.674, "planarity": 0.111, "simple_Shear": 0.111, "simple_Stretch": -0.106, "simple_Buckle": -5.655, "simple_Propeller": -6.577, "bp_simpleParams": [ 0.111, -0.106, -0.227, -5.655, -6.577, 1.999 ], "bp_params": [ 0.109, -0.108, -0.227, -5.765, -6.481, 1.999 ], "frame": { "rmsd": null, "origin": [ 196.651, 197.682, 146.224 ], "x_axis": [ -0.080, 0.886, -0.456 ], "y_axis": [ -0.947, 0.075, 0.313 ], "z_axis": [ 0.311, 0.457, 0.833 ], "quaternion": [ 0.676, -0.053, 0.284, 0.678 ] } }, { "index": 76, "nt1": "///I/75", "nt2": "///J/123", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.628, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.168, "chi2": -94.863, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.551, "C1C1_dist": 10.630, "N1N9_dist": 8.901, "C6C8_dist": 9.835, "CNNC_torsion": 0.375, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 12.268, "planarity": 0.135, "simple_Shear": -0.211, "simple_Stretch": -0.145, "simple_Buckle": -11.577, "simple_Propeller": -4.061, "bp_simpleParams": [ -0.211, -0.145, -0.500, -11.577, -4.061, 0.940 ], "bp_params": [ -0.209, -0.148, -0.500, -11.522, -4.215, 0.936 ], "frame": { "rmsd": null, "origin": [ 197.200, 198.600, 149.742 ], "x_axis": [ -0.611, 0.760, -0.223 ], "y_axis": [ -0.750, -0.465, 0.470 ], "z_axis": [ 0.253, 0.454, 0.854 ], "quaternion": [ 0.441, 0.009, 0.270, 0.856 ] } }, { "index": 77, "nt1": "///I/76", "nt2": "///J/122", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.140, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.231, "chi2": -111.802, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.651, "C1C1_dist": 10.679, "N1N9_dist": 8.947, "C6C8_dist": 9.895, "CNNC_torsion": -2.533, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 5.429, "planarity": 0.066, "simple_Shear": 0.198, "simple_Stretch": -0.115, "simple_Buckle": -5.428, "simple_Propeller": 0.117, "bp_simpleParams": [ 0.198, -0.115, 0.096, -5.428, 0.117, 1.024 ], "bp_params": [ 0.196, -0.118, 0.096, -5.426, 0.199, 1.023 ], "frame": { "rmsd": null, "origin": [ 198.100, 200.240, 152.410 ], "x_axis": [ -0.930, 0.367, -0.010 ], "y_axis": [ -0.336, -0.839, 0.427 ], "z_axis": [ 0.148, 0.401, 0.904 ], "quaternion": [ 0.183, 0.036, 0.216, 0.958 ] } }, { "index": 78, "nt1": "///I/77", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.785, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.230, "chi2": -104.146, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.452, "C1C1_dist": 10.609, "N1N9_dist": 8.873, "C6C8_dist": 9.838, "CNNC_torsion": -4.644, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.87]", "interBase_angle": 2.785, "planarity": 0.107, "simple_Shear": 0.039, "simple_Stretch": -0.118, "simple_Buckle": -2.734, "simple_Propeller": 0.532, "bp_simpleParams": [ 0.039, -0.118, 0.413, -2.734, 0.532, 0.659 ], "bp_params": [ 0.038, -0.118, 0.413, -2.730, 0.554, 0.659 ], "frame": { "rmsd": null, "origin": [ 198.890, 202.088, 154.781 ], "x_axis": [ -0.981, -0.154, 0.114 ], "y_axis": [ 0.185, -0.919, 0.349 ], "z_axis": [ 0.051, 0.364, 0.930 ], "quaternion": [ -0.087, 0.042, 0.182, 0.979 ] } }, { "index": 79, "nt1": "///I/78", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.089, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.657, "chi2": -134.463, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.707, "C1C1_dist": 10.731, "N1N9_dist": 8.961, "C6C8_dist": 9.878, "CNNC_torsion": -3.738, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 2.645, "planarity": 0.093, "simple_Shear": 0.206, "simple_Stretch": -0.152, "simple_Buckle": -2.181, "simple_Propeller": 1.497, "bp_simpleParams": [ 0.206, -0.152, 0.456, -2.181, 1.497, 0.121 ], "bp_params": [ 0.203, -0.155, 0.456, -2.158, 1.530, 0.121 ], "frame": { "rmsd": null, "origin": [ 198.248, 204.245, 157.644 ], "x_axis": [ -0.739, -0.642, 0.204 ], "y_axis": [ 0.674, -0.707, 0.217 ], "z_axis": [ 0.005, 0.298, 0.955 ], "quaternion": [ -0.357, 0.057, 0.139, 0.922 ] } }, { "index": 80, "nt1": "///I/79", "nt2": "///J/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.385, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.467, "chi2": -147.436, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 53.688, "C1C1_dist": 10.633, "N1N9_dist": 8.886, "C6C8_dist": 9.818, "CNNC_torsion": -3.369, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 3.298, "planarity": 0.168, "simple_Shear": 0.176, "simple_Stretch": -0.225, "simple_Buckle": 0.493, "simple_Propeller": 3.261, "bp_simpleParams": [ 0.176, -0.225, 0.682, 0.493, 3.261, 0.506 ], "bp_params": [ 0.173, -0.227, 0.682, 0.535, 3.254, 0.506 ], "frame": { "rmsd": null, "origin": [ 197.534, 205.786, 160.463 ], "x_axis": [ -0.293, -0.939, 0.181 ], "y_axis": [ 0.956, -0.283, 0.078 ], "z_axis": [ -0.022, 0.196, 0.980 ], "quaternion": [ 0.592, -0.050, -0.086, -0.800 ] } }, { "index": 81, "nt1": "///I/80", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.925, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.070, "chi2": -124.894, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.934, "C1C1_dist": 10.691, "N1N9_dist": 8.904, "C6C8_dist": 9.809, "CNNC_torsion": -2.375, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 5.511, "planarity": 0.114, "simple_Shear": -0.198, "simple_Stretch": -0.213, "simple_Buckle": 4.426, "simple_Propeller": 3.284, "bp_simpleParams": [ -0.198, -0.213, 0.566, 4.426, 3.284, -0.211 ], "bp_params": [ -0.195, -0.216, 0.566, 4.379, 3.346, -0.211 ], "frame": { "rmsd": null, "origin": [ 196.922, 206.455, 163.384 ], "x_axis": [ 0.255, -0.960, 0.119 ], "y_axis": [ 0.966, 0.257, -0.002 ], "z_axis": [ -0.029, 0.115, 0.993 ], "quaternion": [ 0.791, -0.037, -0.047, -0.608 ] } }, { "index": 82, "nt1": "///I/81", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.461, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.718, "chi2": -121.645, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.119, "C1C1_dist": 10.587, "N1N9_dist": 8.816, "C6C8_dist": 9.716, "CNNC_torsion": -12.651, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 7.667, "planarity": 0.270, "simple_Shear": 0.158, "simple_Stretch": -0.326, "simple_Buckle": 7.005, "simple_Propeller": -3.115, "bp_simpleParams": [ 0.158, -0.326, 0.901, 7.005, -3.115, -0.957 ], "bp_params": [ 0.154, -0.327, 0.901, 6.974, -3.184, -0.956 ], "frame": { "rmsd": null, "origin": [ 196.157, 206.451, 166.793 ], "x_axis": [ 0.741, -0.669, 0.056 ], "y_axis": [ 0.671, 0.742, -0.008 ], "z_axis": [ -0.036, 0.043, 0.998 ], "quaternion": [ 0.933, -0.014, -0.024, -0.359 ] } }, { "index": 83, "nt1": "///I/82", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.069, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.087, "chi2": -119.316, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.020, "C1C1_dist": 10.836, "N1N9_dist": 8.986, "C6C8_dist": 9.833, "CNNC_torsion": -8.236, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 12.008, "planarity": 0.155, "simple_Shear": -0.119, "simple_Stretch": -0.087, "simple_Buckle": 7.456, "simple_Propeller": -9.413, "bp_simpleParams": [ -0.119, -0.087, -0.119, 7.456, -9.413, -4.330 ], "bp_params": [ -0.117, -0.089, -0.119, 7.621, -9.279, -4.335 ], "frame": { "rmsd": null, "origin": [ 195.732, 206.416, 170.092 ], "x_axis": [ 0.986, -0.154, 0.064 ], "y_axis": [ 0.150, 0.986, 0.067 ], "z_axis": [ -0.074, -0.057, 0.996 ], "quaternion": [ 0.996, 0.031, -0.035, -0.076 ] } }, { "index": 84, "nt1": "///I/83", "nt2": "///J/115", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.990, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.797, "chi2": -88.513, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.673, "C1C1_dist": 10.530, "N1N9_dist": 8.868, "C6C8_dist": 9.894, "CNNC_torsion": -3.393, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.11]", "interBase_angle": 10.723, "planarity": 0.140, "simple_Shear": -0.110, "simple_Stretch": -0.055, "simple_Buckle": 3.668, "simple_Propeller": -10.076, "bp_simpleParams": [ -0.110, -0.055, -0.258, 3.668, -10.076, 3.343 ], "bp_params": [ -0.109, -0.057, -0.258, 3.833, -10.015, 3.354 ], "frame": { "rmsd": null, "origin": [ 196.623, 207.103, 173.612 ], "x_axis": [ 0.869, 0.479, 0.119 ], "y_axis": [ -0.493, 0.857, 0.150 ], "z_axis": [ -0.030, -0.189, 0.982 ], "quaternion": [ 0.963, 0.088, -0.039, 0.253 ] } }, { "index": 85, "nt1": "///I/84", "nt2": "///J/114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.586, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.660, "chi2": -90.903, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.653, "C1C1_dist": 10.425, "N1N9_dist": 8.746, "C6C8_dist": 9.750, "CNNC_torsion": -4.477, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.82]", "interBase_angle": 13.187, "planarity": 0.214, "simple_Shear": 0.048, "simple_Stretch": -0.217, "simple_Buckle": -2.487, "simple_Propeller": -12.951, "bp_simpleParams": [ 0.048, -0.217, -0.700, -2.487, -12.951, 3.601 ], "bp_params": [ 0.046, -0.217, -0.700, -2.616, -12.925, 3.623 ], "frame": { "rmsd": null, "origin": [ 194.557, 206.989, 177.098 ], "x_axis": [ 0.354, 0.904, 0.238 ], "y_axis": [ -0.931, 0.364, 0.002 ], "z_axis": [ -0.085, -0.223, 0.971 ], "quaternion": [ 0.820, 0.069, -0.099, 0.560 ] } }, { "index": 86, "nt1": "///I/85", "nt2": "///J/113", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.216, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.394, "chi2": -88.401, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.512, "C1C1_dist": 10.546, "N1N9_dist": 8.815, "C6C8_dist": 9.766, "CNNC_torsion": -6.298, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.88]", "interBase_angle": 17.546, "planarity": 0.269, "simple_Shear": 0.037, "simple_Stretch": -0.207, "simple_Buckle": -8.204, "simple_Propeller": -15.510, "bp_simpleParams": [ 0.037, -0.207, -0.970, -8.204, -15.510, 2.175 ], "bp_params": [ 0.034, -0.207, -0.970, -8.378, -15.417, 2.189 ], "frame": { "rmsd": null, "origin": [ 193.428, 205.724, 180.163 ], "x_axis": [ -0.267, 0.950, 0.164 ], "y_axis": [ -0.953, -0.234, -0.192 ], "z_axis": [ -0.144, -0.208, 0.968 ], "quaternion": [ 0.606, 0.007, -0.127, 0.786 ] } }, { "index": 87, "nt1": "///I/86", "nt2": "///J/112", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.263, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.443, "chi2": -98.966, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.994, "C1C1_dist": 10.341, "N1N9_dist": 8.666, "C6C8_dist": 9.656, "CNNC_torsion": 2.185, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.85]", "interBase_angle": 14.076, "planarity": 0.287, "simple_Shear": 0.150, "simple_Stretch": -0.349, "simple_Buckle": -9.174, "simple_Propeller": -10.676, "bp_simpleParams": [ 0.150, -0.349, -1.332, -9.174, -10.676, 3.794 ], "bp_params": [ 0.142, -0.352, -1.332, -9.418, -10.461, 3.797 ], "frame": { "rmsd": null, "origin": [ 192.715, 204.504, 183.324 ], "x_axis": [ -0.801, 0.598, -0.021 ], "y_axis": [ -0.563, -0.765, -0.313 ], "z_axis": [ -0.203, -0.239, 0.950 ], "quaternion": [ 0.310, -0.060, -0.147, 0.938 ] } }, { "index": 88, "nt1": "///I/87", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.388, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.484, "chi2": -106.514, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.654, "C1C1_dist": 10.362, "N1N9_dist": 8.722, "C6C8_dist": 9.745, "CNNC_torsion": 1.718, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 8.301, "planarity": 0.264, "simple_Shear": 0.232, "simple_Stretch": -0.281, "simple_Buckle": -6.282, "simple_Propeller": -5.426, "bp_simpleParams": [ 0.232, -0.281, -0.794, -6.282, -5.426, 4.786 ], "bp_params": [ 0.226, -0.285, -0.794, -6.388, -5.301, 4.784 ], "frame": { "rmsd": null, "origin": [ 191.952, 203.745, 186.502 ], "x_axis": [ -0.976, 0.025, -0.217 ], "y_axis": [ 0.049, -0.942, -0.331 ], "z_axis": [ -0.213, -0.334, 0.918 ], "quaternion": [ -0.006, -0.110, -0.170, 0.979 ] } }, { "index": 89, "nt1": "///I/88", "nt2": "///J/110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.153, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.232, "chi2": -107.927, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.561, "C1C1_dist": 10.633, "N1N9_dist": 8.918, "C6C8_dist": 9.879, "CNNC_torsion": -2.315, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 7.546, "planarity": 0.128, "simple_Shear": -0.200, "simple_Stretch": -0.121, "simple_Buckle": -7.523, "simple_Propeller": 0.589, "bp_simpleParams": [ -0.200, -0.121, 0.140, -7.523, 0.589, 1.433 ], "bp_params": [ -0.198, -0.124, 0.140, -7.531, 0.473, 1.430 ], "frame": { "rmsd": null, "origin": [ 191.173, 202.219, 189.434 ], "x_axis": [ -0.771, -0.469, -0.431 ], "y_axis": [ 0.590, -0.782, -0.203 ], "z_axis": [ -0.242, -0.411, 0.879 ], "quaternion": [ -0.286, -0.182, -0.166, 0.926 ] } }, { "index": 90, "nt1": "///I/89", "nt2": "///J/109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.258, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.793, "chi2": -120.408, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.973, "C1C1_dist": 10.651, "N1N9_dist": 8.915, "C6C8_dist": 9.856, "CNNC_torsion": -2.071, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 9.403, "planarity": 0.134, "simple_Shear": 0.260, "simple_Stretch": -0.160, "simple_Buckle": -7.642, "simple_Propeller": 5.479, "bp_simpleParams": [ 0.260, -0.160, 0.633, -7.642, 5.479, 1.499 ], "bp_params": [ 0.257, -0.165, 0.633, -7.537, 5.623, 1.498 ], "frame": { "rmsd": null, "origin": [ 189.500, 200.559, 191.881 ], "x_axis": [ -0.259, -0.786, -0.561 ], "y_axis": [ 0.927, -0.365, 0.084 ], "z_axis": [ -0.270, -0.498, 0.824 ], "quaternion": [ 0.548, 0.266, 0.133, -0.782 ] } }, { "index": 91, "nt1": "///I/90", "nt2": "///J/107", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.223, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 37.215, "chi2": -131.740, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.549, "C1C1_dist": 12.547, "N1N9_dist": 10.268, "C6C8_dist": 10.294, "CNNC_torsion": 29.638, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.67],N1-N1(imino)[3.05]", "interBase_angle": 2.027, "planarity": 0.506, "simple_Shear": -0.265, "simple_Stretch": 0.625, "simple_Buckle": 1.977, "simple_Propeller": -0.448, "bp_simpleParams": [ -0.265, 0.625, -2.163, 1.977, -0.448, -32.248 ], "bp_params": [ -0.283, 0.616, -2.163, 1.990, -0.387, -32.244 ], "frame": { "rmsd": null, "origin": [ 187.551, 198.100, 194.977 ], "x_axis": [ 0.575, -0.707, -0.412 ], "y_axis": [ 0.787, 0.342, 0.513 ], "z_axis": [ -0.222, -0.619, 0.754 ], "quaternion": [ 0.817, 0.346, 0.058, -0.457 ] } }, { "index": 92, "nt1": "///I/90", "nt2": "///J/108", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.223, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.608, "chi2": -120.454, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.473, "C1C1_dist": 10.588, "N1N9_dist": 8.801, "C6C8_dist": 9.702, "CNNC_torsion": -7.708, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.84]", "interBase_angle": 3.585, "planarity": 0.196, "simple_Shear": 0.158, "simple_Stretch": -0.275, "simple_Buckle": -2.998, "simple_Propeller": 1.966, "bp_simpleParams": [ 0.158, -0.275, 0.829, -2.998, 1.966, -1.831 ], "bp_params": [ 0.152, -0.278, 0.829, -2.959, 2.024, -1.830 ], "frame": { "rmsd": null, "origin": [ 188.161, 199.305, 194.167 ], "x_axis": [ 0.344, -0.782, -0.519 ], "y_axis": [ 0.900, 0.118, 0.419 ], "z_axis": [ -0.267, -0.612, 0.745 ], "quaternion": [ 0.743, 0.347, 0.085, -0.566 ] } }, { "index": 93, "nt1": "///I/91", "nt2": "///J/107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.344, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.242, "chi2": -131.740, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.548, "C1C1_dist": 10.622, "N1N9_dist": 8.886, "C6C8_dist": 9.825, "CNNC_torsion": -5.567, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 8.245, "planarity": 0.247, "simple_Shear": 0.197, "simple_Stretch": -0.196, "simple_Buckle": 8.158, "simple_Propeller": 1.193, "bp_simpleParams": [ 0.197, -0.196, 0.704, 8.158, 1.193, 1.339 ], "bp_params": [ 0.194, -0.199, 0.704, 8.175, 1.069, 1.335 ], "frame": { "rmsd": null, "origin": [ 187.085, 196.890, 195.738 ], "x_axis": [ 0.782, -0.567, -0.259 ], "y_axis": [ 0.575, 0.496, 0.650 ], "z_axis": [ -0.240, -0.658, 0.714 ], "quaternion": [ 0.865, 0.378, 0.005, -0.330 ] } }, { "index": 94, "nt1": "///I/92", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.954, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.731, "chi2": -110.071, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.708, "C1C1_dist": 10.592, "N1N9_dist": 8.910, "C6C8_dist": 9.882, "CNNC_torsion": -9.915, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 10.722, "planarity": 0.150, "simple_Shear": -0.164, "simple_Stretch": -0.132, "simple_Buckle": 8.260, "simple_Propeller": -6.836, "bp_simpleParams": [ -0.164, -0.132, 0.599, 8.260, -6.836, 1.459 ], "bp_params": [ -0.162, -0.134, 0.599, 8.357, -6.717, 1.458 ], "frame": { "rmsd": null, "origin": [ 186.882, 194.818, 198.208 ], "x_axis": [ 0.967, -0.190, 0.170 ], "y_axis": [ 0.013, 0.702, 0.712 ], "z_axis": [ -0.255, -0.686, 0.681 ], "quaternion": [ 0.915, 0.382, -0.116, -0.056 ] } }, { "index": 95, "nt1": "///I/93", "nt2": "///J/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -83.803, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.575, "chi2": -108.366, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.249, "C1C1_dist": 10.535, "N1N9_dist": 8.799, "C6C8_dist": 9.764, "CNNC_torsion": -18.340, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 18.831, "planarity": 0.275, "simple_Shear": -0.023, "simple_Stretch": -0.173, "simple_Buckle": 7.660, "simple_Propeller": -17.203, "bp_simpleParams": [ -0.023, -0.173, 0.354, 7.660, -17.203, 0.087 ], "bp_params": [ -0.021, -0.173, 0.354, 7.822, -17.129, 0.087 ], "frame": { "rmsd": null, "origin": [ 184.799, 192.537, 200.867 ], "x_axis": [ 0.789, 0.236, 0.568 ], "y_axis": [ -0.550, 0.684, 0.480 ], "z_axis": [ -0.275, -0.690, 0.669 ], "quaternion": [ 0.886, 0.330, -0.238, 0.222 ] } }, { "index": 96, "nt1": "///I/94", "nt2": "///J/104", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -81.264, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.504, "chi2": -84.989, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.472, "C1C1_dist": 10.618, "N1N9_dist": 8.867, "C6C8_dist": 9.798, "CNNC_torsion": -9.085, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.89]", "interBase_angle": 21.712, "planarity": 0.296, "simple_Shear": -0.026, "simple_Stretch": -0.164, "simple_Buckle": -5.849, "simple_Propeller": -20.910, "bp_simpleParams": [ -0.026, -0.164, -0.692, -5.849, -20.910, 1.466 ], "bp_params": [ -0.027, -0.164, -0.692, -5.936, -20.885, 1.488 ], "frame": { "rmsd": null, "origin": [ 182.196, 190.900, 203.512 ], "x_axis": [ 0.158, 0.589, 0.792 ], "y_axis": [ -0.956, 0.293, -0.027 ], "z_axis": [ -0.249, -0.753, 0.609 ], "quaternion": [ 0.718, 0.253, -0.363, 0.538 ] } }, { "index": 97, "nt1": "///I/95", "nt2": "///J/103", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.724, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.712, "chi2": -86.400, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.792, "C1C1_dist": 10.536, "N1N9_dist": 8.820, "C6C8_dist": 9.771, "CNNC_torsion": -0.482, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 11.345, "planarity": 0.280, "simple_Shear": 0.226, "simple_Stretch": -0.244, "simple_Buckle": -8.287, "simple_Propeller": -7.748, "bp_simpleParams": [ 0.226, -0.244, -0.708, -8.287, -7.748, 2.263 ], "bp_params": [ 0.221, -0.249, -0.708, -8.444, -7.577, 2.262 ], "frame": { "rmsd": null, "origin": [ 179.780, 188.030, 204.365 ], "x_axis": [ -0.562, 0.514, 0.648 ], "y_axis": [ -0.774, -0.052, -0.631 ], "z_axis": [ -0.290, -0.856, 0.427 ], "quaternion": [ 0.451, 0.125, -0.520, 0.714 ] } }, { "index": 98, "nt1": "///I/96", "nt2": "///J/102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.370, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.971, "chi2": -95.033, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.466, "C1C1_dist": 10.607, "N1N9_dist": 8.907, "C6C8_dist": 9.865, "CNNC_torsion": 4.565, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 9.687, "planarity": 0.128, "simple_Shear": -0.203, "simple_Stretch": -0.138, "simple_Buckle": -9.639, "simple_Propeller": 0.961, "bp_simpleParams": [ -0.203, -0.138, -0.625, -9.639, 0.961, 1.536 ], "bp_params": [ -0.201, -0.141, -0.625, -9.653, 0.806, 1.530 ], "frame": { "rmsd": null, "origin": [ 177.921, 184.744, 204.554 ], "x_axis": [ -0.889, 0.434, 0.148 ], "y_axis": [ -0.299, -0.303, -0.905 ], "z_axis": [ -0.348, -0.849, 0.398 ], "quaternion": [ 0.228, -0.062, -0.545, 0.805 ] } }, { "index": 99, "nt1": "///I/97", "nt2": "///J/101", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.409, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.515, "chi2": -101.056, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.755, "C1C1_dist": 10.555, "N1N9_dist": 8.871, "C6C8_dist": 9.859, "CNNC_torsion": 4.790, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 1.950, "planarity": 0.127, "simple_Shear": 0.220, "simple_Stretch": -0.170, "simple_Buckle": -1.883, "simple_Propeller": 0.510, "bp_simpleParams": [ 0.220, -0.170, -0.495, -1.883, 0.510, 2.500 ], "bp_params": [ 0.217, -0.174, -0.495, -1.874, 0.542, 2.500 ], "frame": { "rmsd": null, "origin": [ 176.583, 182.318, 205.679 ], "x_axis": [ -0.885, 0.277, -0.374 ], "y_axis": [ 0.209, -0.483, -0.850 ], "z_axis": [ -0.416, -0.831, 0.370 ], "quaternion": [ 0.020, -0.239, -0.508, 0.827 ] } }, { "index": 100, "nt1": "///I/98", "nt2": "///J/100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.403, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.968, "chi2": -118.079, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.203, "C1C1_dist": 10.703, "N1N9_dist": 8.953, "C6C8_dist": 9.892, "CNNC_torsion": -4.499, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 3.878, "planarity": 0.145, "simple_Shear": -0.215, "simple_Stretch": -0.134, "simple_Buckle": -3.590, "simple_Propeller": 1.467, "bp_simpleParams": [ -0.215, -0.134, 0.468, -3.590, 1.467, 0.949 ], "bp_params": [ -0.213, -0.138, 0.468, -3.613, 1.407, 0.948 ], "frame": { "rmsd": null, "origin": [ 174.897, 179.822, 206.468 ], "x_axis": [ -0.524, 0.017, -0.852 ], "y_axis": [ 0.719, -0.527, -0.453 ], "z_axis": [ -0.456, -0.850, 0.264 ], "quaternion": [ -0.231, -0.430, -0.428, 0.761 ] } }, { "index": 101, "nt1": "///I/99", "nt2": "///J/99", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.507, "conf1": "anti", "pucker1": "----", "lambda1": 54.684, "chi2": -128.052, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.634, "C1C1_dist": 10.547, "N1N9_dist": 8.825, "C6C8_dist": 9.774, "CNNC_torsion": -6.778, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 2.967, "planarity": 0.202, "simple_Shear": 0.228, "simple_Stretch": -0.280, "simple_Buckle": -0.366, "simple_Propeller": 2.945, "bp_simpleParams": [ 0.228, -0.280, 0.864, -0.366, 2.945, 1.653 ], "bp_params": [ 0.223, -0.284, 0.864, -0.313, 2.951, 1.654 ], "frame": { "rmsd": null, "origin": [ 172.808, 177.525, 207.177 ], "x_axis": [ -0.001, -0.209, -0.978 ], "y_axis": [ 0.898, -0.431, 0.091 ], "z_axis": [ -0.440, -0.878, 0.188 ], "quaternion": [ -0.435, -0.557, -0.309, 0.636 ] } }, { "index": 102, "nt1": "///I/100", "nt2": "///J/98", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.923, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.641, "chi2": -117.276, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.652, "C1C1_dist": 10.637, "N1N9_dist": 8.846, "C6C8_dist": 9.751, "CNNC_torsion": -9.400, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 3.070, "planarity": 0.197, "simple_Shear": -0.118, "simple_Stretch": -0.231, "simple_Buckle": 2.885, "simple_Propeller": -1.050, "bp_simpleParams": [ -0.118, -0.231, 0.830, 2.885, -1.050, -2.061 ], "bp_params": [ -0.115, -0.233, 0.830, 2.901, -1.003, -2.061 ], "frame": { "rmsd": null, "origin": [ 170.562, 175.251, 207.509 ], "x_axis": [ 0.473, -0.353, -0.807 ], "y_axis": [ 0.755, -0.311, 0.578 ], "z_axis": [ -0.455, -0.883, 0.119 ], "quaternion": [ 0.566, 0.645, 0.156, -0.489 ] } }, { "index": 103, "nt1": "///I/101", "nt2": "///J/97", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.744, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.955, "chi2": -107.834, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.061, "C1C1_dist": 10.589, "N1N9_dist": 8.899, "C6C8_dist": 9.875, "CNNC_torsion": -1.743, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 4.444, "planarity": 0.121, "simple_Shear": -0.248, "simple_Stretch": -0.156, "simple_Buckle": 3.089, "simple_Propeller": 3.195, "bp_simpleParams": [ -0.248, -0.156, 0.579, 3.089, 3.195, 2.531 ], "bp_params": [ -0.245, -0.161, 0.579, 3.027, 3.255, 2.531 ], "frame": { "rmsd": null, "origin": [ 169.282, 172.431, 207.337 ], "x_axis": [ 0.832, -0.467, -0.299 ], "y_axis": [ 0.300, -0.074, 0.951 ], "z_axis": [ -0.467, -0.881, 0.079 ], "quaternion": [ 0.678, 0.676, -0.062, -0.283 ] } }, { "index": 104, "nt1": "///I/102", "nt2": "///J/96", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.724, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.547, "chi2": -115.944, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.142, "C1C1_dist": 10.640, "N1N9_dist": 8.856, "C6C8_dist": 9.763, "CNNC_torsion": -2.015, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 9.027, "planarity": 0.118, "simple_Shear": -0.065, "simple_Stretch": -0.157, "simple_Buckle": 8.755, "simple_Propeller": -2.201, "bp_simpleParams": [ -0.065, -0.157, -0.042, 8.755, -2.201, -1.869 ], "bp_params": [ -0.063, -0.157, -0.042, 8.780, -2.097, -1.864 ], "frame": { "rmsd": null, "origin": [ 167.065, 169.958, 206.927 ], "x_axis": [ 0.884, -0.414, 0.216 ], "y_axis": [ -0.183, 0.119, 0.976 ], "z_axis": [ -0.430, -0.902, 0.029 ], "quaternion": [ 0.713, 0.659, -0.227, -0.081 ] } }, { "index": 105, "nt1": "///I/103", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.766, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.569, "chi2": -107.005, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.422, "C1C1_dist": 10.603, "N1N9_dist": 8.873, "C6C8_dist": 9.804, "CNNC_torsion": -3.656, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 13.042, "planarity": 0.148, "simple_Shear": 0.237, "simple_Stretch": -0.166, "simple_Buckle": 11.157, "simple_Propeller": -6.754, "bp_simpleParams": [ 0.237, -0.166, -0.119, 11.157, -6.754, 0.569 ], "bp_params": [ 0.235, -0.169, -0.119, 11.053, -6.923, 0.567 ], "frame": { "rmsd": null, "origin": [ 165.929, 166.801, 207.747 ], "x_axis": [ 0.591, -0.232, 0.773 ], "y_axis": [ -0.724, 0.271, 0.635 ], "z_axis": [ -0.356, -0.934, -0.007 ], "quaternion": [ 0.681, 0.576, -0.414, 0.181 ] } }, { "index": 106, "nt1": "///I/104", "nt2": "///J/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -73.112, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.984, "chi2": -81.648, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.763, "C1C1_dist": 10.526, "N1N9_dist": 8.855, "C6C8_dist": 9.850, "CNNC_torsion": -5.375, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 12.388, "planarity": 0.183, "simple_Shear": 0.269, "simple_Stretch": -0.174, "simple_Buckle": 1.637, "simple_Propeller": -12.280, "bp_simpleParams": [ 0.269, -0.174, -0.404, 1.637, -12.280, 3.706 ], "bp_params": [ 0.265, -0.179, -0.404, 1.369, -12.312, 3.728 ], "frame": { "rmsd": null, "origin": [ 163.287, 163.771, 208.076 ], "x_axis": [ -0.085, -0.095, 0.992 ], "y_axis": [ -0.943, 0.329, -0.049 ], "z_axis": [ -0.322, -0.939, -0.117 ], "quaternion": [ 0.531, 0.419, -0.619, 0.399 ] } }, { "index": 107, "nt1": "///I/105", "nt2": "///J/93", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -66.535, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 56.305, "chi2": -76.748, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.902, "C1C1_dist": 10.423, "N1N9_dist": 8.768, "C6C8_dist": 9.777, "CNNC_torsion": -5.104, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 13.893, "planarity": 0.270, "simple_Shear": 0.247, "simple_Stretch": -0.238, "simple_Buckle": -5.747, "simple_Propeller": -12.648, "bp_simpleParams": [ 0.247, -0.238, -0.570, -5.747, -12.648, 4.758 ], "bp_params": [ 0.241, -0.243, -0.570, -6.016, -12.523, 4.780 ], "frame": { "rmsd": null, "origin": [ 160.486, 161.091, 206.717 ], "x_axis": [ -0.654, 0.053, 0.755 ], "y_axis": [ -0.698, 0.343, -0.629 ], "z_axis": [ -0.292, -0.938, -0.187 ], "quaternion": [ -0.354, -0.218, 0.739, -0.530 ] } }, { "index": 108, "nt1": "///I/106", "nt2": "///J/92", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.257, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.672, "chi2": -99.702, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.121, "C1C1_dist": 10.562, "N1N9_dist": 8.865, "C6C8_dist": 9.834, "CNNC_torsion": 0.295, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 11.882, "planarity": 0.250, "simple_Shear": 0.165, "simple_Stretch": -0.152, "simple_Buckle": -10.959, "simple_Propeller": -4.590, "bp_simpleParams": [ 0.165, -0.152, -0.465, -10.959, -4.590, 2.327 ], "bp_params": [ 0.163, -0.154, -0.465, -11.024, -4.432, 2.318 ], "frame": { "rmsd": null, "origin": [ 158.600, 158.407, 204.287 ], "x_axis": [ -0.961, 0.232, 0.149 ], "y_axis": [ -0.074, 0.304, -0.950 ], "z_axis": [ -0.266, -0.924, -0.275 ], "quaternion": [ -0.130, 0.050, 0.797, -0.588 ] } }, { "index": 109, "nt1": "///I/107", "nt2": "///J/91", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.114, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.195, "chi2": -111.126, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.565, "C1C1_dist": 10.711, "N1N9_dist": 8.955, "C6C8_dist": 9.881, "CNNC_torsion": 0.057, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 8.079, "planarity": 0.104, "simple_Shear": 0.163, "simple_Stretch": -0.116, "simple_Buckle": -7.827, "simple_Propeller": 2.002, "bp_simpleParams": [ 0.163, -0.116, 0.023, -7.827, 2.002, 0.193 ], "bp_params": [ 0.162, -0.117, 0.023, -7.806, 2.086, 0.193 ], "frame": { "rmsd": null, "origin": [ 158.222, 155.201, 203.071 ], "x_axis": [ -0.800, 0.446, -0.401 ], "y_axis": [ 0.519, 0.180, -0.836 ], "z_axis": [ -0.300, -0.877, -0.375 ], "quaternion": [ 0.033, 0.314, 0.767, -0.558 ] } }, { "index": 110, "nt1": "///I/108", "nt2": "///J/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.234, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.608, "chi2": -107.044, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.272, "C1C1_dist": 10.585, "N1N9_dist": 8.875, "C6C8_dist": 9.850, "CNNC_torsion": 0.447, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 8.091, "planarity": 0.187, "simple_Shear": -0.237, "simple_Stretch": -0.171, "simple_Buckle": -3.913, "simple_Propeller": 7.082, "bp_simpleParams": [ -0.237, -0.171, 0.482, -3.913, 7.082, 2.871 ], "bp_params": [ -0.234, -0.176, 0.482, -4.048, 7.006, 2.875 ], "frame": { "rmsd": null, "origin": [ 157.075, 152.865, 201.440 ], "x_axis": [ -0.333, 0.561, -0.758 ], "y_axis": [ 0.881, -0.101, -0.461 ], "z_axis": [ -0.335, -0.821, -0.461 ], "quaternion": [ 0.162, 0.554, 0.651, -0.493 ] } }, { "index": 111, "nt1": "///I/109", "nt2": "///J/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.059, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.346, "chi2": -119.630, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.002, "C1C1_dist": 10.444, "N1N9_dist": 8.781, "C6C8_dist": 9.782, "CNNC_torsion": -3.666, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 5.649, "planarity": 0.226, "simple_Shear": 0.248, "simple_Stretch": -0.271, "simple_Buckle": 0.364, "simple_Propeller": 5.638, "bp_simpleParams": [ 0.248, -0.271, 0.878, 0.364, 5.638, 4.147 ], "bp_params": [ 0.243, -0.276, 0.878, 0.475, 5.629, 4.152 ], "frame": { "rmsd": null, "origin": [ 155.431, 150.761, 199.501 ], "x_axis": [ 0.206, 0.525, -0.826 ], "y_axis": [ 0.931, -0.365, 0.000 ], "z_axis": [ -0.301, -0.769, -0.564 ], "quaternion": [ 0.263, 0.731, 0.498, -0.386 ] } }, { "index": 112, "nt1": "///I/110", "nt2": "///J/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.261, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.949, "chi2": -114.583, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.748, "C1C1_dist": 10.553, "N1N9_dist": 8.856, "C6C8_dist": 9.825, "CNNC_torsion": -7.942, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 3.261, "planarity": 0.179, "simple_Shear": -0.215, "simple_Stretch": -0.229, "simple_Buckle": 3.133, "simple_Propeller": 0.904, "bp_simpleParams": [ -0.215, -0.229, 0.885, 3.133, 0.904, 2.095 ], "bp_params": [ -0.211, -0.232, 0.885, 3.118, 0.955, 2.094 ], "frame": { "rmsd": null, "origin": [ 154.077, 148.344, 198.184 ], "x_axis": [ 0.727, 0.260, -0.636 ], "y_axis": [ 0.637, -0.602, 0.482 ], "z_axis": [ -0.257, -0.755, -0.603 ], "quaternion": [ 0.361, 0.856, 0.262, -0.261 ] } }, { "index": 113, "nt1": "///I/111", "nt2": "///J/87", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.099, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.164, "chi2": -123.299, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.283, "C1C1_dist": 10.541, "N1N9_dist": 8.782, "C6C8_dist": 9.719, "CNNC_torsion": -9.627, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 8.640, "planarity": 0.160, "simple_Shear": -0.123, "simple_Stretch": -0.223, "simple_Buckle": 5.327, "simple_Propeller": -6.803, "bp_simpleParams": [ -0.123, -0.223, 0.377, 5.327, -6.803, -1.083 ], "bp_params": [ -0.119, -0.225, 0.377, 5.446, -6.708, -1.084 ], "frame": { "rmsd": null, "origin": [ 152.430, 146.659, 195.718 ], "x_axis": [ 0.958, -0.101, -0.269 ], "y_axis": [ 0.126, -0.694, 0.709 ], "z_axis": [ -0.258, -0.713, -0.652 ], "quaternion": [ 0.391, 0.909, 0.007, -0.145 ] } }, { "index": 114, "nt1": "///I/112", "nt2": "///J/86", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.712, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.664, "chi2": -120.599, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.470, "C1C1_dist": 10.553, "N1N9_dist": 8.806, "C6C8_dist": 9.762, "CNNC_torsion": -6.401, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 13.989, "planarity": 0.181, "simple_Shear": -0.079, "simple_Stretch": -0.173, "simple_Buckle": 6.636, "simple_Propeller": -12.315, "bp_simpleParams": [ -0.079, -0.173, -0.318, 6.636, -12.315, 0.790 ], "bp_params": [ -0.077, -0.174, -0.318, 6.812, -12.218, 0.793 ], "frame": { "rmsd": null, "origin": [ 151.709, 144.846, 193.278 ], "x_axis": [ 0.826, -0.533, 0.185 ], "y_axis": [ -0.504, -0.550, 0.666 ], "z_axis": [ -0.253, -0.643, -0.722 ], "quaternion": [ 0.372, 0.880, -0.295, -0.019 ] } }, { "index": 115, "nt1": "///I/113", "nt2": "///J/85", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.463, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.977, "chi2": -122.166, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.965, "C1C1_dist": 10.441, "N1N9_dist": 8.734, "C6C8_dist": 9.717, "CNNC_torsion": -6.026, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 15.064, "planarity": 0.246, "simple_Shear": -0.043, "simple_Stretch": -0.261, "simple_Buckle": 1.228, "simple_Propeller": -15.014, "bp_simpleParams": [ -0.043, -0.261, -0.773, 1.228, -15.014, 3.008 ], "bp_params": [ -0.040, -0.261, -0.773, 1.363, -15.002, 3.034 ], "frame": { "rmsd": null, "origin": [ 151.025, 142.526, 190.815 ], "x_axis": [ 0.328, -0.768, 0.550 ], "y_axis": [ -0.922, -0.135, 0.362 ], "z_axis": [ -0.204, -0.626, -0.753 ], "quaternion": [ 0.332, 0.744, -0.568, 0.116 ] } }, { "index": 116, "nt1": "///I/114", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.109, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.161, "chi2": -88.609, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 53.882, "C1C1_dist": 10.532, "N1N9_dist": 8.807, "C6C8_dist": 9.765, "CNNC_torsion": -5.213, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 15.192, "planarity": 0.261, "simple_Shear": -0.007, "simple_Stretch": -0.209, "simple_Buckle": -4.076, "simple_Propeller": -14.635, "bp_simpleParams": [ -0.007, -0.209, -0.772, -4.076, -14.635, 1.928 ], "bp_params": [ -0.006, -0.209, -0.772, -4.014, -14.652, 1.943 ], "frame": { "rmsd": null, "origin": [ 149.911, 140.682, 188.184 ], "x_axis": [ -0.215, -0.699, 0.683 ], "y_axis": [ -0.960, 0.281, -0.015 ], "z_axis": [ -0.181, -0.658, -0.731 ], "quaternion": [ -0.290, -0.556, 0.746, -0.225 ] } }, { "index": 117, "nt1": "///I/115", "nt2": "///J/83", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -81.774, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.269, "chi2": -130.282, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.216, "C1C1_dist": 10.628, "N1N9_dist": 8.862, "C6C8_dist": 9.764, "CNNC_torsion": 4.833, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.95]", "interBase_angle": 12.213, "planarity": 0.261, "simple_Shear": 0.240, "simple_Stretch": -0.238, "simple_Buckle": -8.807, "simple_Propeller": -8.461, "bp_simpleParams": [ 0.240, -0.238, -1.295, -8.807, -8.461, -0.551 ], "bp_params": [ 0.232, -0.246, -1.295, -9.065, -8.185, -0.551 ], "frame": { "rmsd": null, "origin": [ 147.410, 139.309, 184.918 ], "x_axis": [ -0.826, -0.309, 0.471 ], "y_axis": [ -0.524, 0.728, -0.443 ], "z_axis": [ -0.206, -0.613, -0.763 ], "quaternion": [ -0.186, -0.229, 0.911, -0.290 ] } }, { "index": 118, "nt1": "///I/116", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.661, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.868, "chi2": -71.700, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 53.456, "C1C1_dist": 10.372, "N1N9_dist": 8.668, "C6C8_dist": 9.610, "CNNC_torsion": 1.150, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.80]", "interBase_angle": 19.046, "planarity": 0.289, "simple_Shear": 0.207, "simple_Stretch": -0.314, "simple_Buckle": -15.651, "simple_Propeller": -10.854, "bp_simpleParams": [ 0.207, -0.314, -1.251, -15.651, -10.854, 2.134 ], "bp_params": [ 0.197, -0.321, -1.251, -16.003, -10.327, 2.122 ], "frame": { "rmsd": null, "origin": [ 147.940, 139.130, 180.945 ], "x_axis": [ -0.979, 0.190, 0.073 ], "y_axis": [ 0.125, 0.844, -0.521 ], "z_axis": [ -0.161, -0.501, -0.850 ], "quaternion": [ -0.061, 0.082, 0.958, -0.267 ] } }, { "index": 119, "nt1": "///I/117", "nt2": "///J/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.787, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.515, "chi2": -115.146, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.629, "C1C1_dist": 10.516, "N1N9_dist": 8.790, "C6C8_dist": 9.737, "CNNC_torsion": 4.560, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 9.352, "planarity": 0.274, "simple_Shear": 0.149, "simple_Stretch": -0.281, "simple_Buckle": -9.330, "simple_Propeller": -0.648, "bp_simpleParams": [ 0.149, -0.281, -0.784, -9.330, -0.648, 1.080 ], "bp_params": [ 0.146, -0.283, -0.784, -9.336, -0.549, 1.077 ], "frame": { "rmsd": null, "origin": [ 147.459, 137.964, 177.992 ], "x_axis": [ -0.726, 0.670, -0.153 ], "y_axis": [ 0.666, 0.630, -0.399 ], "z_axis": [ -0.171, -0.392, -0.904 ], "quaternion": [ -0.005, 0.370, 0.903, -0.219 ] } }, { "index": 120, "nt1": "///I/118", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.870, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.166, "chi2": -105.123, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.432, "C1C1_dist": 10.711, "N1N9_dist": 8.935, "C6C8_dist": 9.851, "CNNC_torsion": 3.588, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 7.119, "planarity": 0.095, "simple_Shear": 0.199, "simple_Stretch": -0.157, "simple_Buckle": -5.635, "simple_Propeller": 4.350, "bp_simpleParams": [ 0.199, -0.157, -0.084, -5.635, 4.350, -0.302 ], "bp_params": [ 0.197, -0.160, -0.084, -5.574, 4.429, -0.302 ], "frame": { "rmsd": null, "origin": [ 146.714, 137.035, 174.841 ], "x_axis": [ -0.274, 0.937, -0.218 ], "y_axis": [ 0.948, 0.225, -0.223 ], "z_axis": [ -0.160, -0.267, -0.950 ], "quaternion": [ 0.018, 0.602, 0.782, -0.157 ] } }, { "index": 121, "nt1": "///I/119", "nt2": "///J/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.511, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.571, "chi2": -102.642, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.119, "C1C1_dist": 10.678, "N1N9_dist": 8.927, "C6C8_dist": 9.864, "CNNC_torsion": -0.007, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 5.914, "planarity": 0.139, "simple_Shear": -0.229, "simple_Stretch": -0.164, "simple_Buckle": -1.497, "simple_Propeller": 5.722, "bp_simpleParams": [ -0.229, -0.164, 0.418, -1.497, 5.722, 1.033 ], "bp_params": [ -0.226, -0.168, 0.418, -1.599, 5.694, 1.034 ], "frame": { "rmsd": null, "origin": [ 146.117, 136.675, 171.908 ], "x_axis": [ 0.260, 0.949, -0.180 ], "y_axis": [ 0.958, -0.277, -0.075 ], "z_axis": [ -0.121, -0.153, -0.981 ], "quaternion": [ 0.024, 0.793, 0.601, -0.095 ] } }, { "index": 122, "nt1": "///I/120", "nt2": "///J/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.872, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.894, "chi2": -130.917, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.759, "C1C1_dist": 10.667, "N1N9_dist": 8.908, "C6C8_dist": 9.838, "CNNC_torsion": -2.712, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 4.276, "planarity": 0.152, "simple_Shear": 0.218, "simple_Stretch": -0.194, "simple_Buckle": 1.672, "simple_Propeller": 3.935, "bp_simpleParams": [ 0.218, -0.194, 0.531, 1.672, 3.935, 0.745 ], "bp_params": [ 0.215, -0.198, 0.531, 1.739, 3.906, 0.745 ], "frame": { "rmsd": null, "origin": [ 145.291, 137.405, 168.726 ], "x_axis": [ 0.748, 0.659, -0.083 ], "y_axis": [ 0.661, -0.751, -0.003 ], "z_axis": [ -0.064, -0.052, -0.997 ], "quaternion": [ 0.013, 0.935, 0.353, -0.039 ] } }, { "index": 123, "nt1": "///I/121", "nt2": "///J/77", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.127, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.658, "chi2": -137.933, "conf2": "anti", "pucker2": "----", "lambda2": 53.228, "C1C1_dist": 10.638, "N1N9_dist": 8.885, "C6C8_dist": 9.810, "CNNC_torsion": -7.623, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 2.002, "planarity": 0.215, "simple_Shear": 0.182, "simple_Stretch": -0.252, "simple_Buckle": 1.237, "simple_Propeller": 1.574, "bp_simpleParams": [ 0.182, -0.252, 0.892, 1.237, 1.574, 0.352 ], "bp_params": [ 0.179, -0.255, 0.892, 1.258, 1.558, 0.352 ], "frame": { "rmsd": null, "origin": [ 144.847, 138.782, 165.522 ], "x_axis": [ 0.978, 0.207, 0.025 ], "y_axis": [ 0.208, -0.978, -0.026 ], "z_axis": [ 0.019, 0.030, -0.999 ], "quaternion": [ -0.014, 0.994, 0.104, 0.011 ] } }, { "index": 124, "nt1": "///I/122", "nt2": "///J/76", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.910, "conf1": "anti", "pucker1": "----", "lambda1": 53.372, "chi2": -126.278, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.846, "C1C1_dist": 10.690, "N1N9_dist": 8.883, "C6C8_dist": 9.772, "CNNC_torsion": -10.953, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.86]", "interBase_angle": 3.799, "planarity": 0.164, "simple_Shear": 0.192, "simple_Stretch": -0.204, "simple_Buckle": 2.378, "simple_Propeller": -2.962, "bp_simpleParams": [ 0.192, -0.204, 0.805, 2.378, -2.962, -2.901 ], "bp_params": [ 0.187, -0.209, 0.805, 2.309, -3.016, -2.902 ], "frame": { "rmsd": null, "origin": [ 144.947, 139.823, 162.716 ], "x_axis": [ 0.933, -0.347, 0.098 ], "y_axis": [ -0.340, -0.937, -0.086 ], "z_axis": [ 0.122, 0.047, -0.991 ], "quaternion": [ -0.034, 0.982, -0.175, 0.056 ] } }, { "index": 125, "nt1": "///I/123", "nt2": "///J/75", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.466, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.367, "chi2": -125.165, "conf2": "anti", "pucker2": "----", "lambda2": 51.506, "C1C1_dist": 10.695, "N1N9_dist": 8.899, "C6C8_dist": 9.805, "CNNC_torsion": -12.833, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.85]", "interBase_angle": 9.257, "planarity": 0.142, "simple_Shear": 0.170, "simple_Stretch": -0.148, "simple_Buckle": 4.699, "simple_Propeller": -7.976, "bp_simpleParams": [ 0.170, -0.148, 0.516, 4.699, -7.976, -2.375 ], "bp_params": [ 0.167, -0.151, 0.516, 4.536, -8.070, -2.379 ], "frame": { "rmsd": null, "origin": [ 145.301, 140.635, 159.543 ], "x_axis": [ 0.558, -0.828, 0.045 ], "y_axis": [ -0.814, -0.557, -0.165 ], "z_axis": [ 0.161, 0.056, -0.985 ], "quaternion": [ -0.063, 0.880, -0.466, 0.058 ] } }, { "index": 126, "nt1": "///I/124", "nt2": "///J/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.479, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.833, "chi2": -84.378, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.005, "C1C1_dist": 10.611, "N1N9_dist": 8.917, "C6C8_dist": 9.893, "CNNC_torsion": -8.465, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 9.961, "planarity": 0.135, "simple_Shear": -0.172, "simple_Stretch": -0.133, "simple_Buckle": 3.061, "simple_Propeller": -9.479, "bp_simpleParams": [ -0.172, -0.133, 0.331, 3.061, -9.479, 1.578 ], "bp_params": [ -0.171, -0.135, 0.331, 3.185, -9.438, 1.582 ], "frame": { "rmsd": null, "origin": [ 145.968, 140.137, 156.040 ], "x_axis": [ 0.067, -0.993, -0.097 ], "y_axis": [ -0.976, -0.045, -0.213 ], "z_axis": [ 0.207, 0.109, -0.972 ], "quaternion": [ -0.111, 0.722, -0.682, 0.038 ] } }, { "index": 127, "nt1": "///I/125", "nt2": "///J/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.373, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.206, "chi2": -86.961, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.021, "C1C1_dist": 10.544, "N1N9_dist": 8.865, "C6C8_dist": 9.848, "CNNC_torsion": -9.183, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 17.055, "planarity": 0.201, "simple_Shear": -0.299, "simple_Stretch": -0.150, "simple_Buckle": -8.501, "simple_Propeller": -14.786, "bp_simpleParams": [ -0.299, -0.150, -0.452, -8.501, -14.786, 3.936 ], "bp_params": [ -0.296, -0.156, -0.452, -8.177, -14.967, 3.960 ], "frame": { "rmsd": null, "origin": [ 145.492, 142.088, 152.477 ], "x_axis": [ -0.596, -0.763, -0.249 ], "y_axis": [ -0.777, 0.626, -0.058 ], "z_axis": [ 0.200, 0.158, -0.967 ], "quaternion": [ 0.126, -0.431, 0.893, 0.028 ] } }, { "index": 128, "nt1": "///I/126", "nt2": "///J/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.831, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.424, "chi2": -78.241, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.228, "C1C1_dist": 10.414, "N1N9_dist": 8.779, "C6C8_dist": 9.770, "CNNC_torsion": 2.020, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 16.558, "planarity": 0.245, "simple_Shear": -0.281, "simple_Stretch": -0.250, "simple_Buckle": -13.177, "simple_Propeller": -10.026, "bp_simpleParams": [ -0.281, -0.250, -1.164, -13.177, -10.026, 5.019 ], "bp_params": [ -0.276, -0.255, -1.164, -13.003, -10.250, 5.007 ], "frame": { "rmsd": null, "origin": [ 145.203, 143.529, 149.038 ], "x_axis": [ -0.936, -0.264, -0.233 ], "y_axis": [ -0.286, 0.956, 0.066 ], "z_axis": [ 0.205, 0.128, -0.970 ], "quaternion": [ 0.111, -0.140, 0.983, 0.049 ] } }, { "index": 129, "nt1": "///I/127", "nt2": "///J/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.996, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.811, "chi2": -78.071, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 56.429, "C1C1_dist": 10.384, "N1N9_dist": 8.720, "C6C8_dist": 9.673, "CNNC_torsion": 7.443, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 16.427, "planarity": 0.301, "simple_Shear": -0.196, "simple_Stretch": -0.390, "simple_Buckle": -15.389, "simple_Propeller": -5.748, "bp_simpleParams": [ -0.196, -0.390, -1.599, -15.389, -5.748, 3.238 ], "bp_params": [ -0.191, -0.393, -1.599, -15.333, -5.896, 3.214 ], "frame": { "rmsd": null, "origin": [ 147.377, 145.730, 146.444 ], "x_axis": [ -0.925, 0.365, -0.100 ], "y_axis": [ 0.324, 0.900, 0.290 ], "z_axis": [ 0.196, 0.236, -0.952 ], "quaternion": [ 0.076, 0.177, 0.972, 0.135 ] } }, { "index": 130, "nt1": "///I/127", "nt2": "///J/72", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.996, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 68.331, "chi2": -78.241, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 83.538, "C1C1_dist": 9.865, "N1N9_dist": 9.165, "C6C8_dist": 10.883, "CNNC_torsion": -13.678, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.10]", "interBase_angle": 21.678, "planarity": 0.570, "simple_Shear": -1.447, "simple_Stretch": 1.645, "simple_Buckle": -21.188, "simple_Propeller": -4.582, "bp_simpleParams": [ -1.447, 1.645, 1.980, -21.188, -4.582, 42.562 ], "bp_params": [ -1.667, 1.422, 1.980, -20.337, -7.504, 42.036 ], "frame": { "rmsd": null, "origin": [ 146.201, 144.509, 147.804 ], "x_axis": [ -0.975, 0.056, -0.216 ], "y_axis": [ 0.017, 0.984, 0.176 ], "z_axis": [ 0.222, 0.168, -0.960 ], "quaternion": [ 0.111, 0.018, 0.990, 0.087 ] } }, { "index": 131, "nt1": "///I/128", "nt2": "///J/70", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.693, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.313, "chi2": -88.983, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.391, "C1C1_dist": 10.459, "N1N9_dist": 8.700, "C6C8_dist": 9.611, "CNNC_torsion": 13.308, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.83]", "interBase_angle": 9.091, "planarity": 0.273, "simple_Shear": 0.236, "simple_Stretch": -0.416, "simple_Buckle": -9.030, "simple_Propeller": 1.052, "bp_simpleParams": [ 0.236, -0.416, -1.441, -9.030, 1.052, -1.641 ], "bp_params": [ 0.224, -0.422, -1.441, -8.998, 1.297, -1.636 ], "frame": { "rmsd": null, "origin": [ 148.310, 147.198, 143.651 ], "x_axis": [ -0.590, 0.782, 0.202 ], "y_axis": [ 0.789, 0.506, 0.350 ], "z_axis": [ 0.171, 0.366, -0.915 ], "quaternion": [ -0.009, 0.453, 0.868, 0.206 ] } }, { "index": 132, "nt1": "///I/129", "nt2": "///J/69", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.987, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.709, "chi2": -100.202, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.514, "C1C1_dist": 10.558, "N1N9_dist": 8.809, "C6C8_dist": 9.759, "CNNC_torsion": 9.102, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 4.794, "planarity": 0.167, "simple_Shear": -0.238, "simple_Stretch": -0.211, "simple_Buckle": -2.457, "simple_Propeller": 4.116, "bp_simpleParams": [ -0.238, -0.211, -0.665, -2.457, 4.116, -0.693 ], "bp_params": [ -0.232, -0.217, -0.665, -2.572, 4.045, -0.694 ], "frame": { "rmsd": null, "origin": [ 148.588, 148.614, 140.774 ], "x_axis": [ -0.129, 0.912, 0.389 ], "y_axis": [ 0.961, 0.019, 0.275 ], "z_axis": [ 0.243, 0.409, -0.879 ], "quaternion": [ -0.051, 0.658, 0.712, 0.240 ] } }, { "index": 133, "nt1": "///I/130", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.413, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.820, "chi2": -109.001, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.245, "C1C1_dist": 10.689, "N1N9_dist": 8.940, "C6C8_dist": 9.892, "CNNC_torsion": 4.797, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 6.974, "planarity": 0.089, "simple_Shear": -0.087, "simple_Stretch": -0.063, "simple_Buckle": -1.347, "simple_Propeller": 6.842, "bp_simpleParams": [ -0.087, -0.063, 0.010, -1.347, 6.842, -0.220 ], "bp_params": [ -0.087, -0.065, 0.010, -1.437, 6.824, -0.221 ], "frame": { "rmsd": null, "origin": [ 148.879, 150.569, 137.882 ], "x_axis": [ 0.390, 0.731, 0.560 ], "y_axis": [ 0.880, -0.475, 0.006 ], "z_axis": [ 0.270, 0.490, -0.829 ], "quaternion": [ -0.148, 0.821, 0.491, 0.253 ] } }, { "index": 134, "nt1": "///I/131", "nt2": "///J/67", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.905, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.919, "chi2": -113.299, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.084, "C1C1_dist": 10.620, "N1N9_dist": 8.867, "C6C8_dist": 9.816, "CNNC_torsion": 0.584, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.84]", "interBase_angle": 4.288, "planarity": 0.081, "simple_Shear": 0.111, "simple_Stretch": -0.137, "simple_Buckle": 0.282, "simple_Propeller": 4.279, "bp_simpleParams": [ 0.111, -0.137, 0.301, 0.282, 4.279, 0.071 ], "bp_params": [ 0.109, -0.138, 0.301, 0.350, 4.274, 0.071 ], "frame": { "rmsd": null, "origin": [ 150.061, 152.434, 135.790 ], "x_axis": [ 0.827, 0.202, 0.525 ], "y_axis": [ 0.445, -0.805, -0.392 ], "z_axis": [ 0.343, 0.558, -0.755 ], "quaternion": [ -0.258, 0.920, 0.176, 0.236 ] } }, { "index": 135, "nt1": "///I/132", "nt2": "///J/66", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.700, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.201, "chi2": -135.826, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.571, "C1C1_dist": 10.679, "N1N9_dist": 8.922, "C6C8_dist": 9.852, "CNNC_torsion": -0.875, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 10.513, "planarity": 0.209, "simple_Shear": 0.228, "simple_Stretch": -0.136, "simple_Buckle": 9.846, "simple_Propeller": 3.684, "bp_simpleParams": [ 0.228, -0.136, 0.345, 9.846, 3.684, 1.003 ], "bp_params": [ 0.225, -0.140, 0.345, 9.917, 3.490, 0.999 ], "frame": { "rmsd": null, "origin": [ 151.206, 155.002, 134.148 ], "x_axis": [ 0.935, -0.233, 0.267 ], "y_axis": [ -0.012, -0.773, -0.634 ], "z_axis": [ 0.354, 0.590, -0.726 ], "quaternion": [ -0.330, 0.927, -0.066, 0.168 ] } }, { "index": 136, "nt1": "///I/133", "nt2": "///J/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.004, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.999, "chi2": -124.202, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.777, "C1C1_dist": 10.507, "N1N9_dist": 8.796, "C6C8_dist": 9.776, "CNNC_torsion": 0.627, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 8.894, "planarity": 0.133, "simple_Shear": -0.065, "simple_Stretch": -0.145, "simple_Buckle": 8.877, "simple_Propeller": -0.549, "bp_simpleParams": [ -0.065, -0.145, 0.152, 8.877, -0.549, 1.131 ], "bp_params": [ -0.063, -0.145, 0.152, 8.882, -0.450, 1.128 ], "frame": { "rmsd": null, "origin": [ 153.294, 156.969, 132.157 ], "x_axis": [ 0.786, -0.603, -0.136 ], "y_axis": [ -0.471, -0.442, -0.764 ], "z_axis": [ 0.401, 0.664, -0.631 ], "quaternion": [ -0.422, 0.845, -0.318, 0.078 ] } }, { "index": 137, "nt1": "///I/134", "nt2": "///J/64", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.911, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.984, "chi2": -116.172, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.695, "C1C1_dist": 10.761, "N1N9_dist": 8.939, "C6C8_dist": 9.808, "CNNC_torsion": -11.792, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 13.118, "planarity": 0.241, "simple_Shear": 0.193, "simple_Stretch": -0.200, "simple_Buckle": 9.334, "simple_Propeller": -9.217, "bp_simpleParams": [ 0.193, -0.200, 0.599, 9.334, -9.217, -2.519 ], "bp_params": [ 0.191, -0.202, 0.599, 9.229, -9.322, -2.519 ], "frame": { "rmsd": null, "origin": [ 154.279, 159.118, 129.686 ], "x_axis": [ 0.336, -0.734, -0.590 ], "y_axis": [ -0.847, 0.038, -0.530 ], "z_axis": [ 0.412, 0.678, -0.609 ], "quaternion": [ -0.438, 0.690, -0.572, -0.065 ] } }, { "index": 138, "nt1": "///I/135", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -82.763, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.507, "chi2": -95.809, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.414, "C1C1_dist": 10.631, "N1N9_dist": 8.904, "C6C8_dist": 9.852, "CNNC_torsion": -13.732, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 15.636, "planarity": 0.200, "simple_Shear": 0.210, "simple_Stretch": -0.173, "simple_Buckle": -0.860, "simple_Propeller": -15.612, "bp_simpleParams": [ 0.210, -0.173, 0.248, -0.860, -15.612, 0.621 ], "bp_params": [ 0.207, -0.177, 0.248, -1.121, -15.595, 0.627 ], "frame": { "rmsd": null, "origin": [ 154.498, 161.892, 126.853 ], "x_axis": [ -0.262, -0.434, -0.862 ], "y_axis": [ -0.836, 0.548, -0.022 ], "z_axis": [ 0.482, 0.715, -0.506 ], "quaternion": [ 0.442, -0.417, 0.761, 0.228 ] } }, { "index": 139, "nt1": "///I/136", "nt2": "///J/62", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -74.029, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.917, "chi2": -85.340, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.480, "C1C1_dist": 10.522, "N1N9_dist": 8.842, "C6C8_dist": 9.823, "CNNC_torsion": -6.046, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 15.043, "planarity": 0.253, "simple_Shear": 0.237, "simple_Stretch": -0.157, "simple_Buckle": -10.099, "simple_Propeller": -11.150, "bp_simpleParams": [ 0.237, -0.157, -0.238, -10.099, -11.150, 3.035 ], "bp_params": [ 0.234, -0.163, -0.238, -10.350, -10.917, 3.037 ], "frame": { "rmsd": null, "origin": [ 155.375, 165.711, 126.045 ], "x_axis": [ -0.713, 0.082, -0.696 ], "y_axis": [ -0.477, 0.672, 0.567 ], "z_axis": [ 0.514, 0.736, -0.440 ], "quaternion": [ 0.360, -0.117, 0.840, 0.388 ] } }, { "index": 140, "nt1": "///I/137", "nt2": "///J/61", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.139, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.612, "chi2": -86.592, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.994, "C1C1_dist": 10.492, "N1N9_dist": 8.783, "C6C8_dist": 9.774, "CNNC_torsion": -2.854, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 10.696, "planarity": 0.180, "simple_Shear": -0.155, "simple_Stretch": -0.157, "simple_Buckle": -8.638, "simple_Propeller": -6.307, "bp_simpleParams": [ -0.155, -0.157, -0.403, -8.638, -6.307, 1.926 ], "bp_params": [ -0.153, -0.159, -0.403, -8.526, -6.457, 1.924 ], "frame": { "rmsd": null, "origin": [ 157.455, 168.779, 125.682 ], "x_axis": [ -0.869, 0.372, -0.327 ], "y_axis": [ -0.125, 0.474, 0.872 ], "z_axis": [ 0.479, 0.798, -0.365 ], "quaternion": [ 0.245, 0.075, 0.823, 0.507 ] } }, { "index": 141, "nt1": "///I/138", "nt2": "///J/60", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.122, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.650, "chi2": -106.541, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.049, "C1C1_dist": 10.475, "N1N9_dist": 8.739, "C6C8_dist": 9.662, "CNNC_torsion": 11.304, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.83]", "interBase_angle": 13.505, "planarity": 0.244, "simple_Shear": 0.235, "simple_Stretch": -0.296, "simple_Buckle": -13.493, "simple_Propeller": 0.579, "bp_simpleParams": [ 0.235, -0.296, -1.274, -13.493, 0.579, -0.787 ], "bp_params": [ 0.227, -0.302, -1.274, -13.472, 0.945, -0.782 ], "frame": { "rmsd": null, "origin": [ 159.711, 171.754, 125.157 ], "x_axis": [ -0.786, 0.474, 0.398 ], "y_axis": [ 0.485, 0.071, 0.872 ], "z_axis": [ 0.385, 0.878, -0.286 ], "quaternion": [ -0.005, 0.327, 0.732, 0.598 ] } }, { "index": 142, "nt1": "///I/139", "nt2": "///J/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.502, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.219, "chi2": -98.160, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.005, "C1C1_dist": 10.692, "N1N9_dist": 8.905, "C6C8_dist": 9.779, "CNNC_torsion": 13.696, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 9.603, "planarity": 0.207, "simple_Shear": -0.126, "simple_Stretch": -0.271, "simple_Buckle": -8.437, "simple_Propeller": 4.587, "bp_simpleParams": [ -0.126, -0.271, -1.058, -8.437, 4.587, -2.475 ], "bp_params": [ -0.124, -0.272, -1.058, -8.483, 4.501, -2.471 ], "frame": { "rmsd": null, "origin": [ 160.607, 174.605, 124.121 ], "x_axis": [ -0.461, 0.379, 0.802 ], "y_axis": [ 0.799, -0.217, 0.561 ], "z_axis": [ 0.387, 0.900, -0.203 ], "quaternion": [ -0.173, 0.490, 0.601, 0.607 ] } }, { "index": 143, "nt1": "///I/140", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.055, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.898, "chi2": -101.471, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.314, "C1C1_dist": 10.522, "N1N9_dist": 8.776, "C6C8_dist": 9.744, "CNNC_torsion": 9.834, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 11.197, "planarity": 0.139, "simple_Shear": -0.093, "simple_Stretch": -0.202, "simple_Buckle": 2.962, "simple_Propeller": 10.798, "bp_simpleParams": [ -0.093, -0.202, -0.136, 2.962, 10.798, 0.538 ], "bp_params": [ -0.090, -0.203, -0.136, 2.820, 10.836, 0.541 ], "frame": { "rmsd": null, "origin": [ 161.340, 177.625, 123.441 ], "x_axis": [ -0.054, 0.125, 0.991 ], "y_axis": [ 0.900, -0.423, 0.103 ], "z_axis": [ 0.432, 0.897, -0.090 ], "quaternion": [ -0.329, 0.604, 0.425, 0.589 ] } }, { "index": 144, "nt1": "///I/141", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.184, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.563, "chi2": -111.625, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.321, "C1C1_dist": 10.647, "N1N9_dist": 8.893, "C6C8_dist": 9.821, "CNNC_torsion": 2.650, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 9.008, "planarity": 0.158, "simple_Shear": 0.196, "simple_Stretch": -0.188, "simple_Buckle": 4.301, "simple_Propeller": 7.915, "bp_simpleParams": [ 0.196, -0.188, 0.228, 4.301, 7.915, 0.592 ], "bp_params": [ 0.193, -0.191, 0.228, 4.425, 7.846, 0.593 ], "frame": { "rmsd": null, "origin": [ 162.572, 180.707, 123.760 ], "x_axis": [ 0.391, -0.268, 0.880 ], "y_axis": [ 0.802, -0.371, -0.469 ], "z_axis": [ 0.452, 0.889, 0.070 ], "quaternion": [ 0.522, -0.650, -0.205, -0.512 ] } }, { "index": 145, "nt1": "///I/142", "nt2": "///J/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.992, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.151, "chi2": -129.123, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.082, "C1C1_dist": 10.371, "N1N9_dist": 8.687, "C6C8_dist": 9.691, "CNNC_torsion": -1.594, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 7.780, "planarity": 0.114, "simple_Shear": -0.007, "simple_Stretch": -0.232, "simple_Buckle": 7.762, "simple_Propeller": 0.530, "bp_simpleParams": [ -0.007, -0.232, 0.125, 7.762, 0.530, 2.108 ], "bp_params": [ -0.005, -0.232, 0.125, 7.759, 0.569, 2.103 ], "frame": { "rmsd": null, "origin": [ 164.004, 183.430, 124.847 ], "x_axis": [ 0.750, -0.473, 0.463 ], "y_axis": [ 0.481, -0.090, -0.872 ], "z_axis": [ 0.454, 0.877, 0.160 ], "quaternion": [ 0.675, -0.648, -0.003, -0.354 ] } }, { "index": 146, "nt1": "///I/143", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.138, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.869, "chi2": -117.435, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.210, "C1C1_dist": 10.531, "N1N9_dist": 8.846, "C6C8_dist": 9.813, "CNNC_torsion": 1.601, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 12.882, "planarity": 0.165, "simple_Shear": 0.230, "simple_Stretch": -0.139, "simple_Buckle": 12.832, "simple_Propeller": -1.131, "bp_simpleParams": [ 0.230, -0.139, -0.110, 12.832, -1.131, 1.853 ], "bp_params": [ 0.227, -0.144, -0.110, 12.810, -1.355, 1.841 ], "frame": { "rmsd": null, "origin": [ 166.091, 185.734, 125.697 ], "x_axis": [ 0.880, -0.457, -0.132 ], "y_axis": [ 0.030, 0.332, -0.943 ], "z_axis": [ 0.475, 0.825, 0.306 ], "quaternion": [ 0.793, -0.557, 0.191, -0.154 ] } }, { "index": 147, "nt1": "///I/144", "nt2": "///J/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.610, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.806, "chi2": -99.409, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.620, "C1C1_dist": 10.598, "N1N9_dist": 8.898, "C6C8_dist": 9.862, "CNNC_torsion": -10.225, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 13.810, "planarity": 0.179, "simple_Shear": 0.241, "simple_Stretch": -0.137, "simple_Buckle": 8.325, "simple_Propeller": -11.019, "bp_simpleParams": [ 0.241, -0.137, 0.204, 8.325, -11.019, 1.272 ], "bp_params": [ 0.239, -0.141, 0.204, 8.137, -11.159, 1.274 ], "frame": { "rmsd": null, "origin": [ 167.641, 189.046, 125.814 ], "x_axis": [ 0.720, -0.077, -0.689 ], "y_axis": [ -0.528, 0.584, -0.617 ], "z_axis": [ 0.450, 0.808, 0.380 ], "quaternion": [ 0.819, -0.435, 0.348, 0.138 ] } }, { "index": 148, "nt1": "///I/145", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -83.446, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.008, "chi2": -94.663, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.168, "C1C1_dist": 10.493, "N1N9_dist": 8.807, "C6C8_dist": 9.819, "CNNC_torsion": -10.176, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.80]", "interBase_angle": 15.098, "planarity": 0.194, "simple_Shear": 0.067, "simple_Stretch": -0.129, "simple_Buckle": -2.954, "simple_Propeller": -14.807, "bp_simpleParams": [ 0.067, -0.129, -0.016, -2.954, -14.807, 2.470 ], "bp_params": [ 0.065, -0.130, -0.016, -3.128, -14.771, 2.490 ], "frame": { "rmsd": null, "origin": [ 168.030, 193.241, 126.792 ], "x_axis": [ 0.245, 0.370, -0.896 ], "y_axis": [ -0.857, 0.515, -0.022 ], "z_axis": [ 0.453, 0.773, 0.444 ], "quaternion": [ 0.742, -0.268, 0.454, 0.413 ] } }, { "index": 149, "nt1": "///I/146", "nt2": "///J/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.460, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.065, "chi2": -65.963, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 55.419, "C1C1_dist": 10.548, "N1N9_dist": 8.851, "C6C8_dist": 9.807, "CNNC_torsion": -6.496, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 19.977, "planarity": 0.215, "simple_Shear": -0.308, "simple_Stretch": -0.141, "simple_Buckle": -15.180, "simple_Propeller": -12.987, "bp_simpleParams": [ -0.308, -0.141, -0.571, -15.180, -12.987, 3.041 ], "bp_params": [ -0.306, -0.147, -0.571, -14.950, -13.250, 3.036 ], "frame": { "rmsd": null, "origin": [ 167.754, 196.226, 129.535 ], "x_axis": [ -0.350, 0.651, -0.673 ], "y_axis": [ -0.821, 0.132, 0.555 ], "z_axis": [ 0.451, 0.747, 0.488 ], "quaternion": [ 0.564, -0.085, 0.499, 0.653 ] } }, { "index": 150, "nt1": "///I/147", "nt2": "///J/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.148, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.565, "chi2": -70.926, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.512, "C1C1_dist": 10.477, "N1N9_dist": 8.817, "C6C8_dist": 9.776, "CNNC_torsion": 1.287, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 18.774, "planarity": 0.214, "simple_Shear": -0.265, "simple_Stretch": -0.169, "simple_Buckle": -17.558, "simple_Propeller": -6.645, "bp_simpleParams": [ -0.265, -0.169, -0.926, -17.558, -6.645, 2.785 ], "bp_params": [ -0.262, -0.174, -0.926, -17.456, -6.910, 2.758 ], "frame": { "rmsd": null, "origin": [ 167.995, 198.590, 132.431 ], "x_axis": [ -0.788, 0.563, -0.249 ], "y_axis": [ -0.472, -0.293, 0.832 ], "z_axis": [ 0.396, 0.773, 0.497 ], "quaternion": [ 0.323, 0.046, 0.500, 0.803 ] } }, { "index": 151, "nt1": "///I/148", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.238, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.532, "chi2": -94.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.564, "C1C1_dist": 10.685, "N1N9_dist": 8.928, "C6C8_dist": 9.857, "CNNC_torsion": 5.758, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 9.305, "planarity": 0.178, "simple_Shear": 0.179, "simple_Stretch": -0.145, "simple_Buckle": -8.599, "simple_Propeller": 3.557, "bp_simpleParams": [ 0.179, -0.145, -0.377, -8.599, 3.557, 0.260 ], "bp_params": [ 0.178, -0.147, -0.377, -8.558, 3.654, 0.260 ], "frame": { "rmsd": null, "origin": [ 169.879, 200.377, 134.839 ], "x_axis": [ -0.961, 0.219, 0.171 ], "y_axis": [ -0.029, -0.692, 0.722 ], "z_axis": [ 0.276, 0.688, 0.671 ], "quaternion": [ 0.068, 0.123, 0.387, 0.911 ] } }, { "index": 152, "nt1": "///I/149", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.659, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.294, "chi2": -98.442, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.554, "C1C1_dist": 10.563, "N1N9_dist": 8.829, "C6C8_dist": 9.798, "CNNC_torsion": 2.178, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.81]", "interBase_angle": 5.506, "planarity": 0.062, "simple_Shear": 0.089, "simple_Stretch": -0.144, "simple_Buckle": -4.096, "simple_Propeller": 3.679, "bp_simpleParams": [ 0.089, -0.144, -0.103, -4.096, 3.679, 0.701 ], "bp_params": [ 0.087, -0.145, -0.103, -4.049, 3.731, 0.701 ], "frame": { "rmsd": null, "origin": [ 171.079, 202.121, 137.052 ], "x_axis": [ -0.791, -0.355, 0.498 ], "y_axis": [ 0.576, -0.705, 0.413 ], "z_axis": [ 0.205, 0.614, 0.762 ], "quaternion": [ -0.258, 0.195, 0.285, 0.903 ] } }, { "index": 153, "nt1": "///I/150", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.881, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.538, "chi2": -119.195, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.137, "C1C1_dist": 10.700, "N1N9_dist": 8.942, "C6C8_dist": 9.874, "CNNC_torsion": 0.791, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 1.091, "planarity": 0.021, "simple_Shear": 0.199, "simple_Stretch": -0.146, "simple_Buckle": 0.932, "simple_Propeller": 0.566, "bp_simpleParams": [ 0.199, -0.146, -0.109, 0.932, 0.566, 0.243 ], "bp_params": [ 0.197, -0.149, -0.109, 0.941, 0.552, 0.243 ], "frame": { "rmsd": null, "origin": [ 171.099, 204.348, 139.494 ], "x_axis": [ -0.340, -0.728, 0.595 ], "y_axis": [ 0.921, -0.385, 0.056 ], "z_axis": [ 0.188, 0.567, 0.802 ], "quaternion": [ 0.519, -0.246, -0.196, -0.795 ] } }, { "index": 154, "nt1": "///I/151", "nt2": "///J/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.837, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.892, "chi2": -126.613, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.560, "C1C1_dist": 10.682, "N1N9_dist": 8.921, "C6C8_dist": 9.848, "CNNC_torsion": 2.720, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 1.566, "planarity": 0.061, "simple_Shear": -0.195, "simple_Stretch": -0.173, "simple_Buckle": 1.313, "simple_Propeller": 0.853, "bp_simpleParams": [ -0.195, -0.173, -0.220, 1.313, 0.853, 0.109 ], "bp_params": [ -0.193, -0.176, -0.220, 1.300, 0.872, 0.109 ], "frame": { "rmsd": null, "origin": [ 171.290, 206.146, 142.226 ], "x_axis": [ 0.238, -0.841, 0.486 ], "y_axis": [ 0.954, 0.109, -0.279 ], "z_axis": [ 0.181, 0.530, 0.828 ], "quaternion": [ 0.738, -0.274, -0.103, -0.608 ] } }, { "index": 155, "nt1": "///I/152", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.733, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.644, "chi2": -109.491, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.836, "C1C1_dist": 10.603, "N1N9_dist": 8.844, "C6C8_dist": 9.786, "CNNC_torsion": 1.905, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 5.036, "planarity": 0.069, "simple_Shear": -0.080, "simple_Stretch": -0.155, "simple_Buckle": 4.889, "simple_Propeller": -1.208, "bp_simpleParams": [ -0.080, -0.155, -0.301, 4.889, -1.208, -0.270 ], "bp_params": [ -0.078, -0.156, -0.301, 4.904, -1.146, -0.270 ], "frame": { "rmsd": null, "origin": [ 171.423, 207.695, 145.170 ], "x_axis": [ 0.696, -0.678, 0.237 ], "y_axis": [ 0.695, 0.553, -0.460 ], "z_axis": [ 0.180, 0.485, 0.856 ], "quaternion": [ 0.881, -0.268, -0.016, -0.389 ] } }, { "index": 156, "nt1": "///I/153", "nt2": "///J/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.239, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.572, "chi2": -109.887, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.245, "C1C1_dist": 10.654, "N1N9_dist": 8.922, "C6C8_dist": 9.873, "CNNC_torsion": -3.641, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.484, "planarity": 0.119, "simple_Shear": -0.203, "simple_Stretch": -0.144, "simple_Buckle": 3.304, "simple_Propeller": -5.578, "bp_simpleParams": [ -0.203, -0.144, -0.203, 3.304, -5.578, 1.381 ], "bp_params": [ -0.200, -0.147, -0.203, 3.393, -5.525, 1.382 ], "frame": { "rmsd": null, "origin": [ 172.623, 209.733, 147.872 ], "x_axis": [ 0.969, -0.221, -0.107 ], "y_axis": [ 0.145, 0.867, -0.477 ], "z_axis": [ 0.198, 0.447, 0.873 ], "quaternion": [ 0.963, -0.240, 0.079, -0.095 ] } }, { "index": 157, "nt1": "///I/154", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.662, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.892, "chi2": -92.264, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.294, "C1C1_dist": 10.535, "N1N9_dist": 8.808, "C6C8_dist": 9.774, "CNNC_torsion": -10.434, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 12.549, "planarity": 0.178, "simple_Shear": -0.020, "simple_Stretch": -0.161, "simple_Buckle": 6.659, "simple_Propeller": -10.636, "bp_simpleParams": [ -0.020, -0.161, 0.131, 6.659, -10.636, 0.510 ], "bp_params": [ -0.019, -0.161, 0.131, 6.751, -10.578, 0.512 ], "frame": { "rmsd": null, "origin": [ 173.063, 211.948, 150.557 ], "x_axis": [ 0.866, 0.351, -0.356 ], "y_axis": [ -0.461, 0.836, -0.297 ], "z_axis": [ 0.194, 0.421, 0.886 ], "quaternion": [ 0.947, -0.189, 0.145, 0.214 ] } }, { "index": 158, "nt1": "///I/155", "nt2": "///J/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -79.800, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.538, "chi2": -92.888, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.406, "C1C1_dist": 10.542, "N1N9_dist": 8.879, "C6C8_dist": 9.879, "CNNC_torsion": -7.829, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 10.130, "planarity": 0.124, "simple_Shear": 0.216, "simple_Stretch": -0.140, "simple_Buckle": 1.344, "simple_Propeller": -10.041, "bp_simpleParams": [ 0.216, -0.140, 0.043, 1.344, -10.041, 2.866 ], "bp_params": [ 0.213, -0.143, 0.043, 1.174, -10.062, 2.877 ], "frame": { "rmsd": null, "origin": [ 172.570, 214.821, 153.287 ], "x_axis": [ 0.281, 0.871, -0.403 ], "y_axis": [ -0.940, 0.334, 0.066 ], "z_axis": [ 0.192, 0.360, 0.913 ], "quaternion": [ 0.795, -0.093, 0.187, 0.569 ] } }, { "index": 159, "nt1": "///I/156", "nt2": "///J/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -82.076, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 55.288, "chi2": -83.166, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.508, "C1C1_dist": 10.544, "N1N9_dist": 8.830, "C6C8_dist": 9.799, "CNNC_torsion": -4.931, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 14.310, "planarity": 0.191, "simple_Shear": 0.083, "simple_Stretch": -0.135, "simple_Buckle": -8.833, "simple_Propeller": -11.258, "bp_simpleParams": [ 0.083, -0.135, -0.493, -8.833, -11.258, 1.484 ], "bp_params": [ 0.081, -0.136, -0.493, -9.013, -11.115, 1.486 ], "frame": { "rmsd": null, "origin": [ 170.892, 215.300, 157.326 ], "x_axis": [ -0.412, 0.878, -0.242 ], "y_axis": [ -0.895, -0.341, 0.287 ], "z_axis": [ 0.170, 0.335, 0.927 ], "quaternion": [ 0.542, -0.022, 0.190, 0.819 ] } }, { "index": 160, "nt1": "///I/157", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.401, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.321, "chi2": -84.060, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.935, "C1C1_dist": 10.465, "N1N9_dist": 8.805, "C6C8_dist": 9.781, "CNNC_torsion": 5.801, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 11.855, "planarity": 0.194, "simple_Shear": -0.203, "simple_Stretch": -0.245, "simple_Buckle": -11.005, "simple_Propeller": -4.406, "bp_simpleParams": [ -0.203, -0.245, -1.014, -11.005, -4.406, 2.970 ], "bp_params": [ -0.200, -0.248, -1.014, -10.948, -4.547, 2.959 ], "frame": { "rmsd": null, "origin": [ 170.227, 216.124, 160.889 ], "x_axis": [ -0.812, 0.579, -0.076 ], "y_axis": [ -0.562, -0.739, 0.373 ], "z_axis": [ 0.160, 0.346, 0.925 ], "quaternion": [ 0.306, 0.022, 0.193, 0.932 ] } }, { "index": 161, "nt1": "///I/158", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.004, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.127, "chi2": -95.475, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.188, "C1C1_dist": 10.426, "N1N9_dist": 8.739, "C6C8_dist": 9.727, "CNNC_torsion": 3.777, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.82]", "interBase_angle": 11.872, "planarity": 0.204, "simple_Shear": 0.173, "simple_Stretch": -0.230, "simple_Buckle": -11.153, "simple_Propeller": -4.067, "bp_simpleParams": [ 0.173, -0.230, -1.015, -11.153, -4.067, 2.174 ], "bp_params": [ 0.167, -0.234, -1.015, -11.250, -3.793, 2.164 ], "frame": { "rmsd": null, "origin": [ 171.209, 216.209, 164.180 ], "x_axis": [ -0.998, -0.038, 0.059 ], "y_axis": [ 0.052, -0.962, 0.267 ], "z_axis": [ 0.047, 0.270, 0.962 ], "quaternion": [ -0.023, 0.027, 0.136, 0.990 ] } }, { "index": 162, "nt1": "///I/159", "nt2": "///J/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.920, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.310, "chi2": -114.568, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.382, "C1C1_dist": 10.318, "N1N9_dist": 8.705, "C6C8_dist": 9.787, "CNNC_torsion": 1.116, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 4.780, "planarity": 0.064, "simple_Shear": -0.041, "simple_Stretch": -0.148, "simple_Buckle": -3.805, "simple_Propeller": 2.893, "bp_simpleParams": [ -0.041, -0.148, -0.002, -3.805, 2.893, 5.377 ], "bp_params": [ -0.040, -0.149, -0.002, -3.833, 2.857, 5.376 ], "frame": { "rmsd": null, "origin": [ 170.621, 217.331, 167.216 ], "x_axis": [ -0.806, -0.577, 0.133 ], "y_axis": [ 0.589, -0.802, 0.093 ], "z_axis": [ 0.053, 0.154, 0.987 ], "quaternion": [ -0.307, 0.049, 0.065, 0.948 ] } }, { "index": 163, "nt1": "///I/160", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.887, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.884, "chi2": -115.210, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.189, "C1C1_dist": 10.494, "N1N9_dist": 8.786, "C6C8_dist": 9.779, "CNNC_torsion": 2.734, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.78]", "interBase_angle": 4.724, "planarity": 0.056, "simple_Shear": 0.041, "simple_Stretch": -0.166, "simple_Buckle": -3.820, "simple_Propeller": 2.779, "bp_simpleParams": [ 0.041, -0.166, -0.067, -3.820, 2.779, 1.632 ], "bp_params": [ 0.040, -0.167, -0.067, -3.797, 2.811, 1.632 ], "frame": { "rmsd": null, "origin": [ 170.278, 217.713, 170.194 ], "x_axis": [ -0.302, -0.953, 0.041 ], "y_axis": [ 0.952, -0.299, 0.060 ], "z_axis": [ -0.045, 0.057, 0.997 ], "quaternion": [ 0.591, 0.001, -0.036, -0.806 ] } }, { "index": 164, "nt1": "///I/161", "nt2": "///J/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.505, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.236, "chi2": -125.364, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.246, "C1C1_dist": 10.646, "N1N9_dist": 8.882, "C6C8_dist": 9.823, "CNNC_torsion": -0.696, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 4.871, "planarity": 0.096, "simple_Shear": -0.108, "simple_Stretch": -0.134, "simple_Buckle": -0.404, "simple_Propeller": 4.854, "bp_simpleParams": [ -0.108, -0.134, 0.376, -0.404, 4.854, -0.234 ], "bp_params": [ -0.106, -0.136, 0.376, -0.478, 4.848, -0.235 ], "frame": { "rmsd": null, "origin": [ 168.922, 217.601, 173.517 ], "x_axis": [ 0.220, -0.975, 0.010 ], "y_axis": [ 0.974, 0.220, 0.048 ], "z_axis": [ -0.049, -0.001, 0.999 ], "quaternion": [ 0.781, 0.016, -0.019, -0.624 ] } }, { "index": 165, "nt1": "///I/162", "nt2": "///J/36", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.375, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.803, "chi2": -115.455, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.891, "C1C1_dist": 10.525, "N1N9_dist": 8.808, "C6C8_dist": 9.799, "CNNC_torsion": -6.523, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.80]", "interBase_angle": 8.714, "planarity": 0.117, "simple_Shear": 0.036, "simple_Stretch": -0.145, "simple_Buckle": -3.985, "simple_Propeller": -7.750, "bp_simpleParams": [ 0.036, -0.145, -0.006, -3.985, -7.750, 1.692 ], "bp_params": [ 0.034, -0.146, -0.006, -4.054, -7.714, 1.695 ], "frame": { "rmsd": null, "origin": [ 168.588, 216.844, 176.554 ], "x_axis": [ 0.725, -0.674, -0.144 ], "y_axis": [ 0.689, 0.709, 0.152 ], "z_axis": [ -0.000, -0.209, 0.978 ], "quaternion": [ 0.923, 0.098, 0.039, -0.369 ] } }, { "index": 166, "nt1": "///I/163", "nt2": "///J/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.503, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.710, "chi2": -108.929, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.393, "C1C1_dist": 10.504, "N1N9_dist": 8.818, "C6C8_dist": 9.834, "CNNC_torsion": -7.116, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 6.912, "planarity": 0.088, "simple_Shear": -0.047, "simple_Stretch": -0.118, "simple_Buckle": -1.567, "simple_Propeller": -6.732, "bp_simpleParams": [ -0.047, -0.118, 0.040, -1.567, -6.732, 2.579 ], "bp_params": [ -0.046, -0.118, 0.040, -1.506, -6.746, 2.583 ], "frame": { "rmsd": null, "origin": [ 167.950, 215.459, 179.738 ], "x_axis": [ 0.973, -0.226, -0.033 ], "y_axis": [ 0.229, 0.958, 0.175 ], "z_axis": [ -0.008, -0.178, 0.984 ], "quaternion": [ 0.989, 0.089, 0.006, -0.115 ] } }, { "index": 167, "nt1": "///I/164", "nt2": "///J/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.525, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.529, "chi2": -120.190, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.744, "C1C1_dist": 10.560, "N1N9_dist": 8.854, "C6C8_dist": 9.849, "CNNC_torsion": -10.408, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.84]", "interBase_angle": 8.999, "planarity": 0.131, "simple_Shear": 0.095, "simple_Stretch": -0.104, "simple_Buckle": -2.189, "simple_Propeller": -8.729, "bp_simpleParams": [ 0.095, -0.104, 0.169, -2.189, -8.729, 1.536 ], "bp_params": [ 0.094, -0.105, 0.169, -2.314, -8.696, 1.540 ], "frame": { "rmsd": null, "origin": [ 167.973, 215.268, 182.982 ], "x_axis": [ 0.879, 0.470, 0.077 ], "y_axis": [ -0.476, 0.870, 0.128 ], "z_axis": [ -0.007, -0.149, 0.989 ], "quaternion": [ 0.967, 0.072, -0.022, 0.245 ] } }, { "index": 168, "nt1": "///I/165", "nt2": "///J/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.986, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.278, "chi2": -109.048, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.529, "C1C1_dist": 10.697, "N1N9_dist": 8.956, "C6C8_dist": 9.912, "CNNC_torsion": -6.259, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 8.044, "planarity": 0.121, "simple_Shear": 0.196, "simple_Stretch": -0.108, "simple_Buckle": -2.541, "simple_Propeller": -7.632, "bp_simpleParams": [ 0.196, -0.108, -0.086, -2.541, -7.632, 1.517 ], "bp_params": [ 0.195, -0.111, -0.086, -2.655, -7.593, 1.520 ], "frame": { "rmsd": null, "origin": [ 168.140, 214.344, 186.165 ], "x_axis": [ 0.463, 0.869, 0.176 ], "y_axis": [ -0.886, 0.461, 0.053 ], "z_axis": [ -0.035, -0.180, 0.983 ], "quaternion": [ 0.852, 0.068, -0.062, 0.515 ] } }, { "index": 169, "nt1": "///I/166", "nt2": "///J/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.969, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.080, "chi2": -116.027, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.671, "C1C1_dist": 10.606, "N1N9_dist": 8.866, "C6C8_dist": 9.827, "CNNC_torsion": -1.877, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.85]", "interBase_angle": 9.513, "planarity": 0.133, "simple_Shear": 0.123, "simple_Stretch": -0.116, "simple_Buckle": -7.208, "simple_Propeller": -6.208, "bp_simpleParams": [ 0.123, -0.116, -0.485, -7.208, -6.208, 0.827 ], "bp_params": [ 0.121, -0.118, -0.485, -7.322, -6.072, 0.827 ], "frame": { "rmsd": null, "origin": [ 168.289, 213.215, 189.781 ], "x_axis": [ -0.163, 0.966, 0.202 ], "y_axis": [ -0.986, -0.157, -0.046 ], "z_axis": [ -0.013, -0.207, 0.978 ], "quaternion": [ 0.644, 0.062, -0.083, 0.758 ] } }, { "index": 170, "nt1": "///I/167", "nt2": "///J/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.864, "chi2": -111.181, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.334, "C1C1_dist": 10.671, "N1N9_dist": 8.875, "C6C8_dist": 9.789, "CNNC_torsion": -3.193, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 6.262, "planarity": 0.122, "simple_Shear": -0.123, "simple_Stretch": -0.171, "simple_Buckle": -1.605, "simple_Propeller": -6.053, "bp_simpleParams": [ -0.123, -0.171, -0.422, -1.605, -6.053, -1.303 ], "bp_params": [ -0.120, -0.173, -0.422, -1.504, -6.079, -1.304 ], "frame": { "rmsd": null, "origin": [ 168.376, 212.280, 192.791 ], "x_axis": [ -0.649, 0.746, 0.151 ], "y_axis": [ -0.760, -0.626, -0.173 ], "z_axis": [ -0.034, -0.227, 0.973 ], "quaternion": [ 0.418, 0.032, -0.111, 0.901 ] } }, { "index": 171, "nt1": "///I/168", "nt2": "///J/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.657, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.983, "chi2": -118.865, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.199, "C1C1_dist": 10.707, "N1N9_dist": 8.953, "C6C8_dist": 9.897, "CNNC_torsion": -3.631, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 6.048, "planarity": 0.127, "simple_Shear": 0.199, "simple_Stretch": -0.131, "simple_Buckle": -1.535, "simple_Propeller": -5.850, "bp_simpleParams": [ 0.199, -0.131, -0.344, -1.535, -5.850, 1.334 ], "bp_params": [ 0.197, -0.134, -0.344, -1.623, -5.826, 1.335 ], "frame": { "rmsd": null, "origin": [ 168.316, 211.973, 196.062 ], "x_axis": [ -0.969, 0.242, -0.045 ], "y_axis": [ -0.224, -0.944, -0.241 ], "z_axis": [ -0.101, -0.223, 0.970 ], "quaternion": [ 0.118, -0.037, -0.118, 0.985 ] } }, { "index": 172, "nt1": "///I/169", "nt2": "///J/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.416, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.934, "chi2": -110.150, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.281, "C1C1_dist": 10.590, "N1N9_dist": 8.925, "C6C8_dist": 9.921, "CNNC_torsion": -0.212, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 3.694, "planarity": 0.084, "simple_Shear": 0.228, "simple_Stretch": -0.099, "simple_Buckle": -2.411, "simple_Propeller": -2.798, "bp_simpleParams": [ 0.228, -0.099, -0.197, -2.411, -2.798, 2.824 ], "bp_params": [ 0.226, -0.103, -0.197, -2.462, -2.753, 2.824 ], "frame": { "rmsd": null, "origin": [ 167.107, 210.933, 199.037 ], "x_axis": [ -0.905, -0.375, -0.201 ], "y_axis": [ 0.400, -0.911, -0.100 ], "z_axis": [ -0.146, -0.171, 0.974 ], "quaternion": [ -0.199, -0.089, -0.070, 0.973 ] } }, { "index": 173, "nt1": "///I/170", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.903, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.655, "chi2": -108.373, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.628, "C1C1_dist": 10.547, "N1N9_dist": 8.862, "C6C8_dist": 9.876, "CNNC_torsion": -4.083, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 2.750, "planarity": 0.064, "simple_Shear": 0.040, "simple_Stretch": -0.078, "simple_Buckle": -1.134, "simple_Propeller": -2.505, "bp_simpleParams": [ 0.040, -0.078, 0.297, -1.134, -2.505, 2.747 ], "bp_params": [ 0.040, -0.078, 0.297, -1.131, -2.506, 2.747 ], "frame": { "rmsd": null, "origin": [ 166.646, 210.288, 202.408 ], "x_axis": [ -0.605, -0.751, -0.263 ], "y_axis": [ 0.779, -0.627, -0.002 ], "z_axis": [ -0.164, -0.206, 0.965 ], "quaternion": [ -0.428, -0.119, -0.058, 0.894 ] } }, { "index": 174, "nt1": "///I/171", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.507, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.640, "chi2": -113.991, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.671, "C1C1_dist": 10.686, "N1N9_dist": 8.919, "C6C8_dist": 9.838, "CNNC_torsion": -6.499, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 3.614, "planarity": 0.177, "simple_Shear": -0.188, "simple_Stretch": -0.200, "simple_Buckle": -3.609, "simple_Propeller": 0.183, "bp_simpleParams": [ -0.188, -0.200, 0.632, -3.609, 0.183, -0.004 ], "bp_params": [ -0.185, -0.203, 0.632, -3.611, 0.133, -0.004 ], "frame": { "rmsd": null, "origin": [ 166.613, 209.167, 205.541 ], "x_axis": [ 0.052, -0.974, -0.223 ], "y_axis": [ 0.987, 0.016, 0.159 ], "z_axis": [ -0.151, -0.228, 0.962 ], "quaternion": [ 0.712, 0.136, 0.025, -0.688 ] } }, { "index": 175, "nt1": "///I/172", "nt2": "///J/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.977, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.006, "chi2": -117.164, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.912, "C1C1_dist": 10.649, "N1N9_dist": 8.855, "C6C8_dist": 9.766, "CNNC_torsion": -3.968, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 3.706, "planarity": 0.140, "simple_Shear": -0.069, "simple_Stretch": -0.204, "simple_Buckle": -0.794, "simple_Propeller": 3.620, "bp_simpleParams": [ -0.069, -0.204, 0.659, -0.794, 3.620, -1.298 ], "bp_params": [ -0.067, -0.205, 0.659, -0.835, 3.610, -1.298 ], "frame": { "rmsd": null, "origin": [ 165.243, 208.208, 208.523 ], "x_axis": [ 0.532, -0.833, -0.153 ], "y_axis": [ 0.835, 0.485, 0.260 ], "z_axis": [ -0.143, -0.266, 0.953 ], "quaternion": [ 0.862, 0.153, 0.003, -0.484 ] } }, { "index": 176, "nt1": "///I/173", "nt2": "///J/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.336, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.251, "chi2": -120.370, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.388, "C1C1_dist": 10.702, "N1N9_dist": 8.946, "C6C8_dist": 9.877, "CNNC_torsion": -7.606, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 4.733, "planarity": 0.109, "simple_Shear": -0.185, "simple_Stretch": -0.155, "simple_Buckle": -0.922, "simple_Propeller": -4.642, "bp_simpleParams": [ -0.185, -0.155, 0.411, -0.922, -4.642, -0.091 ], "bp_params": [ -0.182, -0.158, 0.411, -0.858, -4.654, -0.091 ], "frame": { "rmsd": null, "origin": [ 165.029, 206.687, 211.162 ], "x_axis": [ 0.917, -0.369, -0.148 ], "y_axis": [ 0.397, 0.834, 0.382 ], "z_axis": [ -0.018, -0.409, 0.912 ], "quaternion": [ 0.957, 0.207, 0.034, -0.200 ] } }, { "index": 177, "nt1": "///I/174", "nt2": "///J/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.397, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.271, "chi2": -112.195, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.213, "C1C1_dist": 10.689, "N1N9_dist": 8.948, "C6C8_dist": 9.894, "CNNC_torsion": -5.461, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 5.160, "planarity": 0.068, "simple_Shear": 0.225, "simple_Stretch": -0.128, "simple_Buckle": -0.430, "simple_Propeller": -5.142, "bp_simpleParams": [ 0.225, -0.128, 0.046, -0.430, -5.142, 0.717 ], "bp_params": [ 0.223, -0.132, 0.046, -0.521, -5.134, 0.718 ], "frame": { "rmsd": null, "origin": [ 164.638, 204.613, 213.891 ], "x_axis": [ 0.984, 0.163, 0.071 ], "y_axis": [ -0.178, 0.893, 0.413 ], "z_axis": [ 0.004, -0.419, 0.908 ], "quaternion": [ 0.973, 0.214, -0.017, 0.088 ] } }, { "index": 178, "nt1": "///I/175", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.137, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.450, "chi2": -131.619, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.124, "C1C1_dist": 10.601, "N1N9_dist": 8.857, "C6C8_dist": 9.816, "CNNC_torsion": -9.498, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[2.85]", "interBase_angle": 3.916, "planarity": 0.140, "simple_Shear": 0.085, "simple_Stretch": -0.156, "simple_Buckle": -0.629, "simple_Propeller": -3.865, "bp_simpleParams": [ 0.085, -0.156, 0.593, -0.629, -3.865, 0.002 ], "bp_params": [ 0.083, -0.158, 0.593, -0.679, -3.857, 0.002 ], "frame": { "rmsd": null, "origin": [ 164.980, 203.111, 216.738 ], "x_axis": [ 0.637, 0.715, 0.288 ], "y_axis": [ -0.771, 0.586, 0.249 ], "z_axis": [ 0.009, -0.380, 0.925 ], "quaternion": [ 0.887, 0.177, -0.078, 0.419 ] } }, { "index": 179, "nt1": "///I/176", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.953, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.115, "chi2": -125.454, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.805, "C1C1_dist": 10.573, "N1N9_dist": 8.837, "C6C8_dist": 9.804, "CNNC_torsion": -1.526, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 4.334, "planarity": 0.072, "simple_Shear": -0.089, "simple_Stretch": -0.148, "simple_Buckle": -1.706, "simple_Propeller": -3.984, "bp_simpleParams": [ -0.089, -0.148, -0.189, -1.706, -3.984, 0.566 ], "bp_params": [ -0.088, -0.149, -0.189, -1.654, -4.006, 0.566 ], "frame": { "rmsd": null, "origin": [ 165.738, 201.104, 219.923 ], "x_axis": [ 0.098, 0.919, 0.381 ], "y_axis": [ -0.995, 0.079, 0.067 ], "z_axis": [ 0.031, -0.385, 0.922 ], "quaternion": [ 0.724, 0.156, -0.121, 0.661 ] } }, { "index": 180, "nt1": "///I/177", "nt2": "///J/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.772, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.965, "chi2": -113.676, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.427, "C1C1_dist": 10.540, "N1N9_dist": 8.860, "C6C8_dist": 9.848, "CNNC_torsion": -2.396, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 2.214, "planarity": 0.103, "simple_Shear": -0.214, "simple_Stretch": -0.180, "simple_Buckle": -1.368, "simple_Propeller": 1.741, "bp_simpleParams": [ -0.214, -0.180, 0.376, -1.368, 1.741, 2.325 ], "bp_params": [ -0.211, -0.184, 0.376, -1.397, 1.718, 2.326 ], "frame": { "rmsd": null, "origin": [ 166.872, 200.770, 223.034 ], "x_axis": [ -0.396, 0.887, 0.237 ], "y_axis": [ -0.918, -0.375, -0.132 ], "z_axis": [ -0.028, -0.269, 0.963 ], "quaternion": [ 0.546, 0.063, -0.121, 0.827 ] } }, { "index": 181, "nt1": "///I/178", "nt2": "///J/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.499, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.486, "chi2": -129.331, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.464, "C1C1_dist": 10.377, "N1N9_dist": 8.749, "C6C8_dist": 9.825, "CNNC_torsion": -6.719, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.16]", "interBase_angle": 1.756, "planarity": 0.126, "simple_Shear": -0.105, "simple_Stretch": -0.136, "simple_Buckle": 0.437, "simple_Propeller": -1.700, "bp_simpleParams": [ -0.105, -0.136, 0.579, 0.437, -1.700, 5.188 ], "bp_params": [ -0.103, -0.138, 0.579, 0.463, -1.693, 5.188 ], "frame": { "rmsd": null, "origin": [ 167.866, 201.052, 226.463 ], "x_axis": [ -0.825, 0.557, 0.093 ], "y_axis": [ -0.563, -0.794, -0.229 ], "z_axis": [ -0.054, -0.241, 0.969 ], "quaternion": [ 0.296, 0.010, -0.124, 0.947 ] } }, { "index": 182, "nt1": "///I/179", "nt2": "///J/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.689, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.667, "chi2": -125.353, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.534, "C1C1_dist": 10.677, "N1N9_dist": 8.889, "C6C8_dist": 9.805, "CNNC_torsion": -4.723, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.84]", "interBase_angle": 8.796, "planarity": 0.103, "simple_Shear": 0.136, "simple_Stretch": -0.125, "simple_Buckle": 7.531, "simple_Propeller": -4.544, "bp_simpleParams": [ 0.136, -0.125, 0.133, 7.531, -4.544, -1.612 ], "bp_params": [ 0.133, -0.127, 0.133, 7.457, -4.665, -1.610 ], "frame": { "rmsd": null, "origin": [ 168.517, 201.248, 229.412 ], "x_axis": [ -0.985, 0.079, -0.155 ], "y_axis": [ -0.063, -0.993, -0.104 ], "z_axis": [ -0.162, -0.093, 0.982 ], "quaternion": [ 0.036, -0.080, -0.049, 0.995 ] } }, { "index": 183, "nt1": "///I/180", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.883, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.842, "chi2": -125.675, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.854, "C1C1_dist": 10.757, "N1N9_dist": 8.949, "C6C8_dist": 9.841, "CNNC_torsion": -5.937, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 8.566, "planarity": 0.119, "simple_Shear": -0.083, "simple_Stretch": -0.113, "simple_Buckle": -1.296, "simple_Propeller": -8.467, "bp_simpleParams": [ -0.083, -0.113, -0.208, -1.296, -8.467, -2.506 ], "bp_params": [ -0.082, -0.114, -0.208, -1.191, -8.483, -2.513 ], "frame": { "rmsd": null, "origin": [ 168.056, 202.481, 232.857 ], "x_axis": [ -0.848, -0.512, -0.138 ], "y_axis": [ 0.514, -0.857, 0.023 ], "z_axis": [ -0.130, -0.051, 0.990 ], "quaternion": [ -0.267, -0.070, -0.007, 0.961 ] } }, { "index": 184, "nt1": "///I/181", "nt2": "///J/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.590, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.682, "chi2": -129.378, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.743, "C1C1_dist": 10.336, "N1N9_dist": 8.714, "C6C8_dist": 9.790, "CNNC_torsion": -2.247, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 6.817, "planarity": 0.113, "simple_Shear": -0.017, "simple_Stretch": -0.165, "simple_Buckle": 1.527, "simple_Propeller": -6.644, "bp_simpleParams": [ -0.017, -0.165, -0.372, 1.527, -6.644, 5.515 ], "bp_params": [ -0.016, -0.165, -0.372, 1.573, -6.633, 5.523 ], "frame": { "rmsd": null, "origin": [ 167.502, 202.010, 236.232 ], "x_axis": [ -0.445, -0.879, -0.169 ], "y_axis": [ 0.878, -0.466, 0.109 ], "z_axis": [ -0.175, -0.100, 0.980 ], "quaternion": [ 0.517, 0.101, -0.003, -0.850 ] } }, { "index": 185, "nt1": "///I/182", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.456, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.658, "chi2": -96.103, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.120, "C1C1_dist": 10.731, "N1N9_dist": 8.965, "C6C8_dist": 9.892, "CNNC_torsion": -0.688, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 8.406, "planarity": 0.158, "simple_Shear": -0.229, "simple_Stretch": -0.150, "simple_Buckle": -3.992, "simple_Propeller": -7.398, "bp_simpleParams": [ -0.229, -0.150, -0.670, -3.992, -7.398, 1.254 ], "bp_params": [ -0.226, -0.154, -0.670, -3.866, -7.464, 1.256 ], "frame": { "rmsd": null, "origin": [ 168.618, 202.452, 239.892 ], "x_axis": [ 0.284, -0.957, -0.051 ], "y_axis": [ 0.947, 0.272, 0.172 ], "z_axis": [ -0.150, -0.097, 0.984 ], "quaternion": [ 0.797, 0.084, -0.031, -0.597 ] } }, { "index": 186, "nt1": "///I/183", "nt2": "///J/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.327, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.935, "chi2": -92.431, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.736, "C1C1_dist": 10.326, "N1N9_dist": 8.648, "C6C8_dist": 9.614, "CNNC_torsion": 12.740, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.87]", "interBase_angle": 5.593, "planarity": 0.306, "simple_Shear": 0.160, "simple_Stretch": -0.456, "simple_Buckle": -4.730, "simple_Propeller": -2.985, "bp_simpleParams": [ 0.160, -0.456, -1.534, -4.730, -2.985, 1.574 ], "bp_params": [ 0.150, -0.459, -1.534, -4.792, -2.884, 1.573 ], "frame": { "rmsd": null, "origin": [ 168.874, 202.506, 243.595 ], "x_axis": [ 0.792, -0.601, 0.109 ], "y_axis": [ 0.579, 0.795, 0.180 ], "z_axis": [ -0.195, -0.079, 0.978 ], "quaternion": [ 0.944, 0.069, -0.080, -0.313 ] } }, { "index": 187, "nt1": "///I/184", "nt2": "///J/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.049, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.670, "chi2": -98.037, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.539, "C1C1_dist": 10.387, "N1N9_dist": 8.601, "C6C8_dist": 9.474, "CNNC_torsion": 12.906, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.78]", "interBase_angle": 7.751, "planarity": 0.297, "simple_Shear": 0.252, "simple_Stretch": -0.568, "simple_Buckle": -7.713, "simple_Propeller": -0.759, "bp_simpleParams": [ 0.252, -0.568, -1.528, -7.713, -0.759, -2.927 ], "bp_params": [ 0.235, -0.575, -1.528, -7.732, -0.530, -2.921 ], "frame": { "rmsd": null, "origin": [ 167.051, 204.208, 246.940 ], "x_axis": [ 0.992, 0.013, 0.127 ], "y_axis": [ -0.002, 0.996, -0.087 ], "z_axis": [ -0.128, 0.086, 0.988 ], "quaternion": [ 0.997, -0.043, -0.064, 0.004 ] } }, { "index": 188, "nt1": "///I/185", "nt2": "///J/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.395, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.121, "chi2": -110.535, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.859, "C1C1_dist": 10.527, "N1N9_dist": 8.774, "C6C8_dist": 9.697, "CNNC_torsion": 11.012, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 6.164, "planarity": 0.273, "simple_Shear": 0.132, "simple_Stretch": -0.365, "simple_Buckle": -5.588, "simple_Propeller": 2.600, "bp_simpleParams": [ 0.132, -0.365, -0.988, -5.588, 2.600, -0.324 ], "bp_params": [ 0.129, -0.366, -0.988, -5.568, 2.644, -0.324 ], "frame": { "rmsd": null, "origin": [ 167.276, 204.307, 250.251 ], "x_axis": [ 0.854, 0.520, -0.029 ], "y_axis": [ -0.515, 0.835, -0.193 ], "z_axis": [ -0.076, 0.179, 0.981 ], "quaternion": [ 0.958, -0.097, -0.012, 0.270 ] } }, { "index": 189, "nt1": "///I/186", "nt2": "///J/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.717, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.706, "chi2": -113.829, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.378, "C1C1_dist": 10.395, "N1N9_dist": 8.746, "C6C8_dist": 9.785, "CNNC_torsion": 2.455, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.79]", "interBase_angle": 8.562, "planarity": 0.123, "simple_Shear": 0.070, "simple_Stretch": -0.153, "simple_Buckle": -8.052, "simple_Propeller": -2.911, "bp_simpleParams": [ 0.070, -0.153, -0.530, -8.052, -2.911, 3.878 ], "bp_params": [ 0.068, -0.154, -0.530, -8.089, -2.806, 3.869 ], "frame": { "rmsd": null, "origin": [ 167.093, 206.051, 253.439 ], "x_axis": [ 0.313, 0.915, -0.255 ], "y_axis": [ -0.949, 0.298, -0.100 ], "z_axis": [ -0.015, 0.273, 0.962 ], "quaternion": [ 0.802, -0.116, 0.075, 0.581 ] } }, { "index": 190, "nt1": "///I/187", "nt2": "///J/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.222, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.416, "chi2": -105.798, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.064, "C1C1_dist": 10.743, "N1N9_dist": 8.955, "C6C8_dist": 9.861, "CNNC_torsion": 4.531, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 5.300, "planarity": 0.145, "simple_Shear": -0.179, "simple_Stretch": -0.184, "simple_Buckle": -4.909, "simple_Propeller": -2.000, "bp_simpleParams": [ -0.179, -0.184, -0.760, -4.909, -2.000, -0.233 ], "bp_params": [ -0.176, -0.186, -0.760, -4.883, -2.060, -0.233 ], "frame": { "rmsd": null, "origin": [ 167.227, 205.755, 257.016 ], "x_axis": [ -0.267, 0.925, -0.270 ], "y_axis": [ -0.963, -0.264, 0.046 ], "z_axis": [ -0.028, 0.272, 0.962 ], "quaternion": [ 0.598, -0.094, 0.101, 0.789 ] } }, { "index": 191, "nt1": "///I/188", "nt2": "///J/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.528, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.333, "chi2": -110.125, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.089, "C1C1_dist": 10.696, "N1N9_dist": 8.948, "C6C8_dist": 9.893, "CNNC_torsion": 0.182, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 1.885, "planarity": 0.068, "simple_Shear": 0.221, "simple_Stretch": -0.133, "simple_Buckle": 0.208, "simple_Propeller": -1.874, "bp_simpleParams": [ 0.221, -0.133, -0.281, 0.208, -1.874, 1.070 ], "bp_params": [ 0.219, -0.136, -0.281, 0.176, -1.877, 1.068 ], "frame": { "rmsd": null, "origin": [ 166.805, 206.910, 259.959 ], "x_axis": [ -0.784, 0.575, -0.233 ], "y_axis": [ -0.615, -0.772, 0.163 ], "z_axis": [ -0.086, 0.271, 0.959 ], "quaternion": [ 0.317, -0.085, 0.116, 0.937 ] } }, { "index": 192, "nt1": "///I/189", "nt2": "///J/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.519, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.120, "chi2": -115.761, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.679, "C1C1_dist": 10.808, "N1N9_dist": 9.007, "C6C8_dist": 9.907, "CNNC_torsion": -2.080, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 2.229, "planarity": 0.027, "simple_Shear": -0.186, "simple_Stretch": -0.116, "simple_Buckle": -1.964, "simple_Propeller": -1.056, "bp_simpleParams": [ -0.186, -0.116, -0.023, -1.964, -1.056, -0.771 ], "bp_params": [ -0.185, -0.118, -0.023, -1.949, -1.082, -0.771 ], "frame": { "rmsd": null, "origin": [ 166.801, 207.388, 263.067 ], "x_axis": [ -0.986, -0.075, -0.150 ], "y_axis": [ 0.036, -0.968, 0.249 ], "z_axis": [ -0.163, 0.240, 0.957 ], "quaternion": [ -0.028, -0.079, 0.124, 0.989 ] } }, { "index": 193, "nt1": "///I/190", "nt2": "///J/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.300, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.066, "chi2": -108.627, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.507, "C1C1_dist": 10.508, "N1N9_dist": 8.823, "C6C8_dist": 9.840, "CNNC_torsion": -3.454, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.81]", "interBase_angle": 3.782, "planarity": 0.055, "simple_Shear": 0.076, "simple_Stretch": -0.112, "simple_Buckle": -1.905, "simple_Propeller": -3.268, "bp_simpleParams": [ 0.076, -0.112, 0.053, -1.905, -3.268, 2.600 ], "bp_params": [ 0.075, -0.113, 0.053, -1.945, -3.244, 2.600 ], "frame": { "rmsd": null, "origin": [ 165.625, 208.000, 265.985 ], "x_axis": [ -0.745, -0.667, 0.005 ], "y_axis": [ 0.636, -0.707, 0.311 ], "z_axis": [ -0.204, 0.234, 0.951 ], "quaternion": [ -0.353, -0.054, 0.148, 0.922 ] } }, { "index": 194, "nt1": "///I/191", "nt2": "///J/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.095, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.495, "chi2": -111.237, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.084, "C1C1_dist": 10.815, "N1N9_dist": 9.009, "C6C8_dist": 9.910, "CNNC_torsion": -4.431, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.175, "planarity": 0.052, "simple_Shear": 0.181, "simple_Stretch": -0.114, "simple_Buckle": 0.801, "simple_Propeller": -4.097, "bp_simpleParams": [ 0.181, -0.114, 0.018, 0.801, -4.097, -0.697 ], "bp_params": [ 0.180, -0.116, 0.018, 0.747, -4.107, -0.697 ], "frame": { "rmsd": null, "origin": [ 165.650, 209.634, 268.880 ], "x_axis": [ -0.199, -0.964, 0.178 ], "y_axis": [ 0.963, -0.160, 0.216 ], "z_axis": [ -0.180, 0.214, 0.960 ], "quaternion": [ 0.633, 0.001, -0.141, -0.761 ] } }, { "index": 195, "nt1": "///I/192", "nt2": "///J/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.365, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.504, "chi2": -118.099, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.732, "C1C1_dist": 10.748, "N1N9_dist": 8.975, "C6C8_dist": 9.900, "CNNC_torsion": -4.016, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 4.127, "planarity": 0.054, "simple_Shear": 0.190, "simple_Stretch": -0.124, "simple_Buckle": -0.631, "simple_Propeller": -4.079, "bp_simpleParams": [ 0.190, -0.124, 0.064, -0.631, -4.079, 0.165 ], "bp_params": [ 0.189, -0.127, 0.064, -0.689, -4.069, 0.165 ], "frame": { "rmsd": null, "origin": [ 164.899, 209.960, 271.976 ], "x_axis": [ 0.445, -0.851, 0.279 ], "y_axis": [ 0.875, 0.480, 0.067 ], "z_axis": [ -0.191, 0.214, 0.958 ], "quaternion": [ 0.849, -0.043, -0.138, -0.508 ] } }, { "index": 196, "nt1": "///I/193", "nt2": "///J/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.422, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.211, "chi2": -101.355, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.461, "C1C1_dist": 10.646, "N1N9_dist": 8.881, "C6C8_dist": 9.826, "CNNC_torsion": 1.429, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.85]", "interBase_angle": 4.234, "planarity": 0.099, "simple_Shear": 0.112, "simple_Stretch": -0.136, "simple_Buckle": -2.703, "simple_Propeller": -3.258, "bp_simpleParams": [ 0.112, -0.136, -0.483, -2.703, -3.258, -0.041 ], "bp_params": [ 0.110, -0.138, -0.483, -2.756, -3.214, -0.041 ], "frame": { "rmsd": null, "origin": [ 164.652, 212.211, 275.165 ], "x_axis": [ 0.919, -0.290, 0.266 ], "y_axis": [ 0.333, 0.933, -0.136 ], "z_axis": [ -0.209, 0.214, 0.954 ], "quaternion": [ 0.975, -0.090, -0.122, -0.160 ] } }, { "index": 197, "nt1": "///I/194", "nt2": "///J/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.359, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.118, "chi2": -106.435, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.873, "C1C1_dist": 10.384, "N1N9_dist": 8.736, "C6C8_dist": 9.740, "CNNC_torsion": 8.896, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 1.740, "planarity": 0.266, "simple_Shear": 0.194, "simple_Stretch": -0.346, "simple_Buckle": -1.325, "simple_Propeller": -1.128, "bp_simpleParams": [ 0.194, -0.346, -1.111, -1.325, -1.128, 3.262 ], "bp_params": [ 0.189, -0.349, -1.111, -1.342, -1.108, 3.262 ], "frame": { "rmsd": null, "origin": [ 164.796, 213.157, 278.953 ], "x_axis": [ 0.955, 0.263, 0.138 ], "y_axis": [ -0.221, 0.939, -0.264 ], "z_axis": [ -0.199, 0.222, 0.955 ], "quaternion": [ 0.981, -0.124, -0.086, 0.123 ] } }, { "index": 198, "nt1": "///I/195", "nt2": "///J/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.084, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.790, "chi2": -110.007, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.447, "C1C1_dist": 10.675, "N1N9_dist": 8.885, "C6C8_dist": 9.785, "CNNC_torsion": 8.918, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 1.743, "planarity": 0.227, "simple_Shear": 0.157, "simple_Stretch": -0.289, "simple_Buckle": -0.995, "simple_Propeller": 1.432, "bp_simpleParams": [ 0.157, -0.289, -0.980, -0.995, 1.432, -0.934 ], "bp_params": [ 0.154, -0.291, -0.980, -0.979, 1.442, -0.934 ], "frame": { "rmsd": null, "origin": [ 163.010, 213.495, 282.197 ], "x_axis": [ 0.660, 0.744, -0.106 ], "y_axis": [ -0.732, 0.606, -0.311 ], "z_axis": [ -0.167, 0.282, 0.945 ], "quaternion": [ 0.896, -0.166, -0.017, 0.412 ] } }, { "index": 199, "nt1": "///I/196", "nt2": "///J/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.308, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.017, "chi2": -123.838, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.605, "C1C1_dist": 10.694, "N1N9_dist": 8.913, "C6C8_dist": 9.814, "CNNC_torsion": 8.871, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 3.088, "planarity": 0.166, "simple_Shear": 0.162, "simple_Stretch": -0.240, "simple_Buckle": 2.847, "simple_Propeller": 1.196, "bp_simpleParams": [ 0.162, -0.240, -0.825, 2.847, 1.196, -0.869 ], "bp_params": [ 0.159, -0.242, -0.825, 2.860, 1.163, -0.869 ], "frame": { "rmsd": null, "origin": [ 162.492, 214.990, 285.121 ], "x_axis": [ 0.030, 0.958, -0.284 ], "y_axis": [ -0.992, -0.008, -0.129 ], "z_axis": [ -0.126, 0.286, 0.950 ], "quaternion": [ 0.702, -0.148, 0.056, 0.694 ] } }, { "index": 200, "nt1": "///I/197", "nt2": "///J/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.754, "conf1": "anti", "pucker1": "----", "lambda1": 54.904, "chi2": -103.432, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.709, "C1C1_dist": 10.592, "N1N9_dist": 8.890, "C6C8_dist": 9.859, "CNNC_torsion": 6.103, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 3.594, "planarity": 0.102, "simple_Shear": 0.189, "simple_Stretch": -0.176, "simple_Buckle": 3.560, "simple_Propeller": 0.492, "bp_simpleParams": [ 0.189, -0.176, -0.540, 3.560, 0.492, 1.574 ], "bp_params": [ 0.186, -0.178, -0.540, 3.567, 0.441, 1.573 ], "frame": { "rmsd": null, "origin": [ 161.149, 216.824, 288.125 ], "x_axis": [ -0.553, 0.778, -0.297 ], "y_axis": [ -0.829, -0.550, 0.104 ], "z_axis": [ -0.083, 0.304, 0.949 ], "quaternion": [ 0.460, -0.109, 0.117, 0.874 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGGCTGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCACCCC", "strand2": "CCCGACCTGGGATATGCGCCGGCGGGACCTCTTAGGGCCACGGCTCCGGCGAGTTAACCAGCATCTGTCGAGATCGTGGCGAATTTGCGTGCATGCGCGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACGTACATAACTTGTCGCTGGTGGGG", "bp_type": "|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||", "helix_form": "B.BBBBBBBBB....BBBB.BBBBBBBBBBBBBBBBBBBBB.B....BBBB.B.....BBBB.BB.B..BBB.BBBBBBBBB.B..BBBBBBBBBBBBBBBBBBBBBBBBBBB..BBBBBBBB.B....BBBBBBB...BBBBBBBBBBBBBBB.BB.B.BBBBBBBBBBBBBBB....B.B....BBBBB.....", "helical_rise": 0.205, "helical_rise_std": 2.360, "helical_axis": [ -0.925, 0.379, -0.028 ], "point1": [ null, null, null ], "point2": [ null, null, null ], "num_pairs": 197, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/197", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.179, -0.446, 8.258, -0.754, 1.383 ], "step_params": [ -0.209, 0.375, 4.487, 1.557, -1.850, 36.120 ], "heli_params": [ 0.960, 0.636, 4.451, -2.979, -2.507, 36.198 ], "bp2_params": [ -0.177, -0.128, 0.163, 5.489, -8.049, 1.112 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.487, "simple_Twist": 36.142, "simple_hRise": 4.451, "simple_hTwist": 36.220 }, { "index": 2, "nt1": "///I/2", "nt2": "///J/196", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.128, 0.163, 5.489, -8.049, 1.112 ], "step_params": [ -0.173, 1.600, 4.298, 1.085, -4.561, 43.333 ], "heli_params": [ 2.721, 0.367, 4.112, -6.155, -1.464, 43.574 ], "bp2_params": [ -0.246, -0.201, -0.690, -4.523, -10.865, 3.502 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.298, "simple_Twist": 43.464, "simple_hRise": 4.113, "simple_hTwist": 43.704 }, { "index": 3, "nt1": "///I/3", "nt2": "///J/195", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.201, -0.690, -4.523, -10.865, 3.502 ], "step_params": [ -0.827, 0.241, 3.547, -3.754, -4.509, 41.994 ], "heli_params": [ 0.836, 0.727, 3.562, -6.255, 5.207, 42.384 ], "bp2_params": [ 0.180, -0.298, -0.919, -7.745, -5.482, 1.756 ], "groove_widths": [ 10.785, null, 17.679, null ], "simple_Rise": 3.547, "simple_Twist": 39.645, "simple_hRise": 3.560, "simple_hTwist": 40.060 }, { "index": 4, "nt1": "///I/4", "nt2": "///J/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.298, -0.919, -7.745, -5.482, 1.756 ], "step_params": [ 0.393, 0.160, 3.423, -2.404, -0.272, 35.065 ], "heli_params": [ 0.307, -1.024, 3.388, -0.450, 3.985, 35.146 ], "bp2_params": [ -0.097, -0.130, -0.281, -6.426, -0.784, -0.543 ], "groove_widths": [ 12.038, 12.007, 15.679, 15.636 ], "simple_Rise": 3.423, "simple_Twist": 36.773, "simple_hRise": 3.390, "simple_hTwist": 36.850 }, { "index": 5, "nt1": "///I/5", "nt2": "///J/193", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.130, -0.281, -6.426, -0.784, -0.543 ], "step_params": [ 0.222, -0.186, 2.961, -4.393, 5.381, 35.829 ], "heli_params": [ -0.967, -0.900, 2.858, 8.647, 7.059, 36.474 ], "bp2_params": [ -0.206, -0.119, 0.111, -0.969, 1.051, 0.616 ], "groove_widths": [ 13.073, 12.971, 15.610, 15.445 ], "simple_Rise": 2.961, "simple_Twist": 36.332, "simple_hRise": 2.860, "simple_hTwist": 36.968 }, { "index": 6, "nt1": "///I/6", "nt2": "///J/192", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.119, 0.111, -0.969, 1.051, 0.616 ], "step_params": [ 0.256, -0.327, 3.198, 1.152, 0.338, 35.406 ], "heli_params": [ -0.586, -0.255, 3.201, 0.555, -1.893, 35.426 ], "bp2_params": [ -0.187, -0.125, -0.078, 3.034, 0.308, -0.121 ], "groove_widths": [ 12.575, 12.421, 17.336, 16.998 ], "simple_Rise": 3.198, "simple_Twist": 35.327, "simple_hRise": 3.201, "simple_hTwist": 35.346 }, { "index": 7, "nt1": "///I/7", "nt2": "///J/191", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.125, -0.078, 3.034, 0.308, -0.121 ], "step_params": [ 0.685, -0.390, 3.245, 0.031, 2.453, 39.135 ], "heli_params": [ -0.870, -1.017, 3.216, 3.658, -0.047, 39.209 ], "bp2_params": [ 0.034, -0.139, -0.052, 0.477, -5.566, 4.303 ], "groove_widths": [ 11.226, 11.069, 16.877, 16.650 ], "simple_Rise": 3.245, "simple_Twist": 37.798, "simple_hRise": 3.215, "simple_hTwist": 37.875 }, { "index": 8, "nt1": "///I/8", "nt2": "///J/190", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.139, -0.052, 0.477, -5.566, 4.303 ], "step_params": [ -0.861, -0.479, 3.175, -1.303, -1.416, 38.234 ], "heli_params": [ -0.556, 1.153, 3.216, -2.161, 1.988, 38.280 ], "bp2_params": [ 0.196, -0.129, -0.149, -0.242, -7.183, 1.086 ], "groove_widths": [ 10.413, 10.270, 17.906, 17.815 ], "simple_Rise": 3.175, "simple_Twist": 37.412, "simple_hRise": 3.217, "simple_hTwist": 37.460 }, { "index": 9, "nt1": "///I/9", "nt2": "///J/189", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.129, -0.149, -0.242, -7.183, 1.086 ], "step_params": [ 0.504, -0.404, 3.194, -0.697, -1.647, 38.554 ], "heli_params": [ -0.412, -0.847, 3.199, -2.493, 1.055, 38.593 ], "bp2_params": [ 0.217, -0.121, -0.209, -1.368, -6.547, 3.423 ], "groove_widths": [ 10.096, 9.974, 17.057, 16.936 ], "simple_Rise": 3.194, "simple_Twist": 38.401, "simple_hRise": 3.199, "simple_hTwist": 38.441 }, { "index": 10, "nt1": "///I/10", "nt2": "///J/188", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.121, -0.209, -1.368, -6.547, 3.423 ], "step_params": [ -1.468, -0.314, 3.108, -2.416, 1.877, 36.617 ], "heli_params": [ -0.744, 2.012, 3.175, 2.981, 3.838, 36.740 ], "bp2_params": [ 0.178, -0.155, -0.485, -1.112, -3.405, 0.606 ], "groove_widths": [ 10.651, 10.578, 17.264, 17.214 ], "simple_Rise": 3.108, "simple_Twist": 36.867, "simple_hRise": 3.175, "simple_hTwist": 36.989 }, { "index": 11, "nt1": "///I/11", "nt2": "///J/187", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.155, -0.485, -1.112, -3.405, 0.606 ], "step_params": [ 1.227, -0.222, 3.125, 1.486, 0.200, 33.240 ], "heli_params": [ -0.421, -1.904, 3.174, 0.350, -2.596, 33.273 ], "bp2_params": [ -0.047, -0.167, -0.431, 0.167, -3.764, 8.182 ], "groove_widths": [ 11.479, 11.390, 18.324, 18.186 ], "simple_Rise": 3.125, "simple_Twist": 34.591, "simple_hRise": 3.173, "simple_hTwist": 34.623 }, { "index": 12, "nt1": "///I/12", "nt2": "///J/186", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.047, -0.167, -0.431, 0.167, -3.764, 8.182 ], "step_params": [ -1.554, 0.782, 3.699, -3.278, 3.795, 37.890 ], "heli_params": [ 0.639, 1.894, 3.873, 5.814, 5.022, 38.209 ], "bp2_params": [ 0.152, -0.339, -1.167, -4.066, -0.329, 0.950 ], "groove_widths": [ 11.988, 11.858, 17.422, 17.265 ], "simple_Rise": 3.699, "simple_Twist": 36.634, "simple_hRise": 3.878, "simple_hTwist": 36.964 }, { "index": 13, "nt1": "///I/13", "nt2": "///J/185", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.339, -1.167, -4.066, -0.329, 0.950 ], "step_params": [ -0.056, -1.171, 3.228, -0.987, 3.010, 27.403 ], "heli_params": [ -3.167, -0.116, 3.084, 6.327, 2.075, 27.582 ], "bp2_params": [ -0.095, -0.391, -1.087, -0.499, -2.434, 4.715 ], "groove_widths": [ 12.318, 12.176, 16.964, 16.946 ], "simple_Rise": 3.228, "simple_Twist": 28.928, "simple_hRise": 3.093, "simple_hTwist": 29.097 }, { "index": 14, "nt1": "///I/14", "nt2": "///J/184", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.391, -1.087, -0.499, -2.434, 4.715 ], "step_params": [ -0.321, 2.084, 4.032, 0.414, 1.897, 49.049 ], "heli_params": [ 2.331, 0.425, 4.102, 2.285, -0.498, 49.085 ], "bp2_params": [ 0.155, -0.441, -1.305, -5.079, -4.880, 1.660 ], "groove_widths": [ 12.350, 12.202, 16.767, 16.649 ], "simple_Rise": 4.032, "simple_Twist": 47.378, "simple_hRise": 4.104, "simple_hTwist": 47.415 }, { "index": 15, "nt1": "///I/15", "nt2": "///J/183", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.441, -1.305, -5.079, -4.880, 1.660 ], "step_params": [ 0.533, -0.287, 3.771, -3.021, -0.773, 32.696 ], "heli_params": [ -0.355, -1.536, 3.714, -1.370, 5.351, 32.840 ], "bp2_params": [ 0.183, -0.234, -0.763, -3.496, -1.699, 1.609 ], "groove_widths": [ 12.223, 12.145, 18.313, 18.215 ], "simple_Rise": 3.771, "simple_Twist": 32.699, "simple_hRise": 3.714, "simple_hTwist": 32.843 }, { "index": 16, "nt1": "///I/16", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.234, -0.763, -3.496, -1.699, 1.609 ], "step_params": [ -0.345, 0.563, 3.762, -0.289, -0.436, 34.329 ], "heli_params": [ 1.033, 0.532, 3.757, -0.738, 0.489, 34.333 ], "bp2_params": [ -0.165, -0.107, -0.441, -6.148, 0.295, -0.370 ], "groove_widths": [ 12.434, 12.413, 17.733, 17.731 ], "simple_Rise": 3.762, "simple_Twist": 36.339, "simple_hRise": 3.758, "simple_hTwist": 36.343 }, { "index": 17, "nt1": "///I/17", "nt2": "///J/181", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.107, -0.441, -6.148, 0.295, -0.370 ], "step_params": [ -0.301, 0.061, 3.317, -4.081, 0.383, 36.391 ], "heli_params": [ 0.044, -0.092, 3.330, 0.611, 6.508, 36.613 ], "bp2_params": [ 0.174, -0.136, -0.284, -0.978, 3.305, -0.532 ], "groove_widths": [ 12.877, 12.816, 16.569, 16.546 ], "simple_Rise": 3.317, "simple_Twist": 34.493, "simple_hRise": 3.330, "simple_hTwist": 34.729 }, { "index": 18, "nt1": "///I/18", "nt2": "///J/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.174, -0.136, -0.284, -0.978, 3.305, -0.532 ], "step_params": [ 0.327, 0.214, 3.154, 1.039, 9.846, 40.119 ], "heli_params": [ -0.729, -0.355, 3.126, 14.094, -1.487, 41.274 ], "bp2_params": [ -0.246, -0.173, -0.452, -4.755, -7.045, 1.892 ], "groove_widths": [ 12.384, 12.204, 14.617, 14.611 ], "simple_Rise": 3.154, "simple_Twist": 42.313, "simple_hRise": 3.132, "simple_hTwist": 43.404 }, { "index": 19, "nt1": "///I/19", "nt2": "///J/179", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.173, -0.452, -4.755, -7.045, 1.892 ], "step_params": [ -0.254, -0.189, 3.315, -0.135, -0.036, 40.055 ], "heli_params": [ -0.271, 0.355, 3.316, -0.052, 0.197, 40.056 ], "bp2_params": [ -0.210, -0.189, -0.763, -6.403, -4.119, 0.751 ], "groove_widths": [ 11.405, 11.210, 15.150, 15.094 ], "simple_Rise": 3.315, "simple_Twist": 39.900, "simple_hRise": 3.316, "simple_hTwist": 39.900 }, { "index": 20, "nt1": "///I/20", "nt2": "///J/178", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.189, -0.763, -6.403, -4.119, 0.751 ], "step_params": [ 0.391, -0.312, 3.231, -0.890, -0.384, 35.954 ], "heli_params": [ -0.451, -0.758, 3.224, -0.622, 1.441, 35.966 ], "bp2_params": [ 0.188, -0.183, -0.590, -4.060, -1.722, 0.719 ], "groove_widths": [ 11.886, 11.806, 16.694, 16.664 ], "simple_Rise": 3.231, "simple_Twist": 33.806, "simple_hRise": 3.224, "simple_hTwist": 33.819 }, { "index": 21, "nt1": "///I/21", "nt2": "///J/177", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.183, -0.590, -4.060, -1.722, 0.719 ], "step_params": [ 0.192, 0.348, 3.567, -2.560, -0.557, 36.367 ], "heli_params": [ 0.640, -0.693, 3.540, -0.890, 4.095, 36.458 ], "bp2_params": [ 0.185, -0.120, 0.152, -3.035, 0.420, -0.423 ], "groove_widths": [ 12.529, 12.497, 18.437, 18.183 ], "simple_Rise": 3.567, "simple_Twist": 36.377, "simple_hRise": 3.540, "simple_hTwist": 36.468 }, { "index": 22, "nt1": "///I/22", "nt2": "///J/176", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.120, 0.152, -3.035, 0.420, -0.423 ], "step_params": [ 0.194, -0.683, 2.913, -6.095, 1.539, 32.902 ], "heli_params": [ -1.409, -1.222, 2.800, 2.686, 10.640, 33.481 ], "bp2_params": [ -0.177, -0.276, 0.983, 3.522, -1.691, 0.464 ], "groove_widths": [ 12.300, 12.202, 17.445, 16.911 ], "simple_Rise": 2.913, "simple_Twist": 34.975, "simple_hRise": 2.809, "simple_hTwist": 35.518 }, { "index": 23, "nt1": "///I/23", "nt2": "///J/175", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.276, 0.983, 3.522, -1.691, 0.464 ], "step_params": [ -0.692, -0.994, 3.161, -0.047, -0.079, 38.862 ], "heli_params": [ -1.484, 1.035, 3.164, -0.118, 0.071, 38.862 ], "bp2_params": [ 0.160, -0.262, 0.834, 3.191, -3.161, -0.290 ], "groove_widths": [ 12.383, 12.185, 16.512, 16.304 ], "simple_Rise": 3.161, "simple_Twist": 36.936, "simple_hRise": 3.164, "simple_hTwist": 36.936 }, { "index": 24, "nt1": "///I/24", "nt2": "///J/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.262, 0.834, 3.191, -3.161, -0.290 ], "step_params": [ 0.292, -0.509, 3.134, 1.577, 0.018, 35.953 ], "heli_params": [ -0.826, -0.258, 3.143, 0.030, -2.554, 35.986 ], "bp2_params": [ 0.145, -0.216, 0.694, 0.269, -3.305, -1.586 ], "groove_widths": [ 12.158, 12.007, 16.491, 16.182 ], "simple_Rise": 3.134, "simple_Twist": 36.015, "simple_hRise": 3.143, "simple_hTwist": 36.049 }, { "index": 25, "nt1": "///I/25", "nt2": "///J/173", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.145, -0.216, 0.694, 0.269, -3.305, -1.586 ], "step_params": [ -0.270, -0.626, 3.144, 0.292, -0.006, 36.291 ], "heli_params": [ -1.003, 0.473, 3.142, -0.009, -0.469, 36.292 ], "bp2_params": [ 0.160, -0.197, 0.629, 1.552, -2.173, -0.610 ], "groove_widths": [ 12.419, 12.387, 17.207, 16.930 ], "simple_Rise": 3.144, "simple_Twist": 36.212, "simple_hRise": 3.142, "simple_hTwist": 36.213 }, { "index": 26, "nt1": "///I/26", "nt2": "///J/172", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.197, 0.629, 1.552, -2.173, -0.610 ], "step_params": [ -0.178, -0.387, 3.317, -0.407, 0.309, 26.412 ], "heli_params": [ -0.930, 0.280, 3.315, 0.677, 0.890, 26.417 ], "bp2_params": [ -0.141, -0.243, 0.918, 2.030, -5.261, -4.993 ], "groove_widths": [ 13.330, 13.329, 18.337, 18.336 ], "simple_Rise": 3.317, "simple_Twist": 28.257, "simple_hRise": 3.315, "simple_hTwist": 28.261 }, { "index": 27, "nt1": "///I/27", "nt2": "///J/171", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.243, 0.918, 2.030, -5.261, -4.993 ], "step_params": [ -0.029, 1.194, 3.488, 1.556, -1.661, 41.361 ], "heli_params": [ 1.875, 0.217, 3.437, -2.349, -2.200, 41.421 ], "bp2_params": [ -0.239, -0.158, 0.374, -3.297, -4.079, -0.273 ], "groove_widths": [ 13.511, 13.508, 17.501, 17.495 ], "simple_Rise": 3.488, "simple_Twist": 41.676, "simple_hRise": 3.437, "simple_hTwist": 41.735 }, { "index": 28, "nt1": "///I/28", "nt2": "///J/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.158, 0.374, -3.297, -4.079, -0.273 ], "step_params": [ -0.515, -0.099, 3.482, -2.674, 4.610, 28.243 ], "heli_params": [ -1.308, 0.396, 3.455, 9.343, 5.419, 28.731 ], "bp2_params": [ -0.211, -0.101, -0.315, -4.136, -2.541, 1.662 ], "groove_widths": [ 13.434, 13.412, 16.987, 16.946 ], "simple_Rise": 3.482, "simple_Twist": 28.154, "simple_hRise": 3.455, "simple_hTwist": 28.644 }, { "index": 29, "nt1": "///I/29", "nt2": "///J/169", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.101, -0.315, -4.136, -2.541, 1.662 ], "step_params": [ -0.685, 0.332, 3.224, -5.736, 4.163, 40.126 ], "heli_params": [ 0.014, 0.346, 3.304, 6.011, 8.282, 40.721 ], "bp2_params": [ 0.095, -0.119, -0.326, -1.658, -1.260, -0.894 ], "groove_widths": [ 13.161, 13.103, 15.885, 15.769 ], "simple_Rise": 3.224, "simple_Twist": 38.318, "simple_hRise": 3.306, "simple_hTwist": 38.944 }, { "index": 30, "nt1": "///I/30", "nt2": "///J/168", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.119, -0.326, -1.658, -1.260, -0.894 ], "step_params": [ 0.560, -0.518, 3.199, -0.823, 1.686, 27.057 ], "heli_params": [ -1.517, -1.396, 3.143, 3.597, 1.755, 27.120 ], "bp2_params": [ -0.144, -0.162, -0.336, 3.575, -2.159, 0.736 ], "groove_widths": [ 12.616, 12.567, 16.727, 16.539 ], "simple_Rise": 3.199, "simple_Twist": 28.662, "simple_hRise": 3.147, "simple_hTwist": 28.722 }, { "index": 31, "nt1": "///I/31", "nt2": "///J/167", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.162, -0.336, 3.575, -2.159, 0.736 ], "step_params": [ -0.194, 0.453, 3.296, -0.829, -1.680, 39.949 ], "heli_params": [ 0.857, 0.188, 3.279, -2.457, 1.212, 39.991 ], "bp2_params": [ 0.111, -0.109, -0.325, 2.637, -6.214, -0.124 ], "groove_widths": [ 11.573, 11.561, 17.635, 17.508 ], "simple_Rise": 3.296, "simple_Twist": 38.333, "simple_hRise": 3.278, "simple_hTwist": 38.377 }, { "index": 32, "nt1": "///I/32", "nt2": "///J/166", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, -0.109, -0.325, 2.637, -6.214, -0.124 ], "step_params": [ -0.088, -0.309, 3.378, -0.584, 1.025, 36.736 ], "heli_params": [ -0.634, 0.058, 3.370, 1.626, 0.927, 36.754 ], "bp2_params": [ 0.100, -0.226, -0.734, 0.656, -9.909, 3.970 ], "groove_widths": [ 10.665, 10.654, 18.455, 18.245 ], "simple_Rise": 3.378, "simple_Twist": 36.804, "simple_hRise": 3.370, "simple_hTwist": 36.823 }, { "index": 33, "nt1": "///I/33", "nt2": "///J/165", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.226, -0.734, 0.656, -9.909, 3.970 ], "step_params": [ 0.035, -0.146, 3.491, 1.470, 0.486, 33.570 ], "heli_params": [ -0.337, 0.196, 3.487, 0.840, -2.543, 33.605 ], "bp2_params": [ -0.055, -0.331, -0.737, -6.161, -10.950, 7.524 ], "groove_widths": [ 10.760, 10.725, 17.558, 17.557 ], "simple_Rise": 3.491, "simple_Twist": 34.433, "simple_hRise": 3.487, "simple_hTwist": 34.467 }, { "index": 34, "nt1": "///I/34", "nt2": "///J/164", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.055, -0.331, -0.737, -6.161, -10.950, 7.524 ], "step_params": [ -0.095, 0.086, 3.407, -3.592, 1.291, 40.586 ], "heli_params": [ -0.026, -0.278, 3.403, 1.856, 5.165, 40.757 ], "bp2_params": [ 0.165, -0.199, -0.633, -8.245, -3.602, 1.082 ], "groove_widths": [ 11.136, 11.043, 17.416, 17.324 ], "simple_Rise": 3.407, "simple_Twist": 39.309, "simple_hRise": 3.403, "simple_hTwist": 39.487 }, { "index": 35, "nt1": "///I/35", "nt2": "///J/163", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.199, -0.633, -8.245, -3.602, 1.082 ], "step_params": [ -0.302, 0.153, 3.306, -3.383, 2.175, 35.178 ], "heli_params": [ -0.074, -0.009, 3.323, 3.584, 5.576, 35.400 ], "bp2_params": [ 0.174, -0.155, -0.272, -8.678, 1.087, 0.672 ], "groove_widths": [ 12.290, 12.167, 18.652, 18.223 ], "simple_Rise": 3.306, "simple_Twist": 35.189, "simple_hRise": 3.323, "simple_hTwist": 35.411 }, { "index": 36, "nt1": "///I/36", "nt2": "///J/162", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.174, -0.155, -0.272, -8.678, 1.087, 0.672 ], "step_params": [ -0.049, -0.963, 3.136, -4.489, 4.996, 28.028 ], "heli_params": [ -2.980, -0.840, 2.897, 10.133, 9.104, 28.805 ], "bp2_params": [ 0.193, -0.143, 0.393, -3.705, 3.422, -0.294 ], "groove_widths": [ 13.811, 13.705, 17.983, 17.210 ], "simple_Rise": 3.136, "simple_Twist": 28.025, "simple_hRise": 2.897, "simple_hTwist": 28.803 }, { "index": 37, "nt1": "///I/37", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.143, 0.393, -3.705, 3.422, -0.294 ], "step_params": [ 0.126, -0.557, 2.869, -2.202, 5.512, 30.888 ], "heli_params": [ -1.917, -0.587, 2.716, 10.231, 4.087, 31.439 ], "bp2_params": [ -0.173, -0.240, 0.762, 0.987, 1.727, 0.100 ], "groove_widths": [ 14.051, 13.807, 17.769, 16.395 ], "simple_Rise": 2.869, "simple_Twist": 32.872, "simple_hRise": 2.729, "simple_hTwist": 33.389 }, { "index": 38, "nt1": "///I/38", "nt2": "///J/160", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.173, -0.240, 0.762, 0.987, 1.727, 0.100 ], "step_params": [ -0.210, -0.730, 3.061, -1.900, 3.490, 37.113 ], "heli_params": [ -1.569, 0.096, 2.989, 5.464, 2.975, 37.318 ], "bp2_params": [ -0.184, -0.230, 0.849, 2.790, 0.602, 0.496 ], "groove_widths": [ 13.399, 13.066, 17.489, 16.713 ], "simple_Rise": 3.061, "simple_Twist": 37.153, "simple_hRise": 2.989, "simple_hTwist": 37.358 }, { "index": 39, "nt1": "///I/39", "nt2": "///J/159", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.230, 0.849, 2.790, 0.602, 0.496 ], "step_params": [ -0.285, -0.921, 3.241, 2.919, 2.019, 33.465 ], "heli_params": [ -1.913, 0.958, 3.146, 3.494, -5.051, 33.647 ], "bp2_params": [ -0.114, -0.164, 0.542, 3.397, -3.168, -2.205 ], "groove_widths": [ 12.799, 12.626, 16.727, 16.514 ], "simple_Rise": 3.241, "simple_Twist": 33.200, "simple_hRise": 3.146, "simple_hTwist": 33.384 }, { "index": 40, "nt1": "///I/40", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, -0.164, 0.542, 3.397, -3.168, -2.205 ], "step_params": [ 0.700, 0.510, 3.152, 3.278, 0.553, 36.338 ], "heli_params": [ 0.740, -0.677, 3.208, 0.885, -5.242, 36.484 ], "bp2_params": [ -0.214, -0.147, 0.386, 4.232, -2.012, 1.624 ], "groove_widths": [ 12.403, 12.355, 16.618, 16.586 ], "simple_Rise": 3.152, "simple_Twist": 36.782, "simple_hRise": 3.208, "simple_hTwist": 36.926 }, { "index": 41, "nt1": "///I/41", "nt2": "///J/157", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.214, -0.147, 0.386, 4.232, -2.012, 1.624 ], "step_params": [ -0.855, 0.534, 3.663, 0.472, -0.809, 33.262 ], "heli_params": [ 1.082, 1.581, 3.638, -1.412, -0.825, 33.275 ], "bp2_params": [ 0.211, -0.154, 0.098, 4.737, -8.886, -0.404 ], "groove_widths": [ 12.088, 11.932, 17.094, 16.853 ], "simple_Rise": 3.663, "simple_Twist": 31.020, "simple_hRise": 3.636, "simple_hTwist": 31.034 }, { "index": 42, "nt1": "///I/42", "nt2": "///J/156", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.154, 0.098, 4.737, -8.886, -0.404 ], "step_params": [ 0.471, 2.023, 3.511, 1.029, -2.733, 41.871 ], "heli_params": [ 3.125, -0.545, 3.389, -3.818, -1.438, 41.968 ], "bp2_params": [ 0.195, -0.169, 0.488, 0.019, -11.370, 0.331 ], "groove_widths": [ 11.204, 10.884, 17.568, 16.943 ], "simple_Rise": 3.511, "simple_Twist": 41.802, "simple_hRise": 3.389, "simple_hTwist": 41.899 }, { "index": 43, "nt1": "///I/43", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.169, 0.488, 0.019, -11.370, 0.331 ], "step_params": [ -0.072, 2.065, 3.478, 0.943, -0.551, 39.225 ], "heli_params": [ 3.144, 0.226, 3.448, -0.821, -1.405, 39.240 ], "bp2_params": [ -0.268, -0.127, -0.277, -7.270, -11.101, 4.085 ], "groove_widths": [ 10.578, 10.344, 16.654, 15.910 ], "simple_Rise": 3.478, "simple_Twist": 41.668, "simple_hRise": 3.450, "simple_hTwist": 41.682 }, { "index": 44, "nt1": "///I/44", "nt2": "///J/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.268, -0.127, -0.277, -7.270, -11.101, 4.085 ], "step_params": [ -0.990, 1.981, 3.547, -3.996, 1.150, 43.077 ], "heli_params": [ 2.563, 0.912, 3.670, 1.562, 5.427, 43.268 ], "bp2_params": [ 0.129, -0.325, -1.216, -10.675, -8.742, 3.169 ], "groove_widths": [ 11.564, 11.508, 16.761, 16.252 ], "simple_Rise": 3.547, "simple_Twist": 40.719, "simple_hRise": 3.677, "simple_hTwist": 40.922 }, { "index": 45, "nt1": "///I/45", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.325, -1.216, -10.675, -8.742, 3.169 ], "step_params": [ -0.082, 0.893, 3.423, -3.632, 3.160, 31.917 ], "heli_params": [ 1.012, -0.538, 3.481, 5.705, 6.558, 32.268 ], "bp2_params": [ -0.141, -0.396, -1.391, -10.019, -1.268, -0.339 ], "groove_widths": [ 12.668, 12.663, 16.648, 16.625 ], "simple_Rise": 3.423, "simple_Twist": 33.767, "simple_hRise": 3.479, "simple_hTwist": 34.098 }, { "index": 46, "nt1": "///I/46", "nt2": "///J/152", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.396, -1.391, -10.019, -1.268, -0.339 ], "step_params": [ -0.021, 0.020, 3.209, -3.035, 4.456, 30.553 ], "heli_params": [ -0.804, -0.534, 3.167, 8.374, 5.703, 31.014 ], "bp2_params": [ -0.133, -0.321, -1.079, -4.436, 2.342, -1.436 ], "groove_widths": [ 13.227, 13.192, 17.243, 16.994 ], "simple_Rise": 3.209, "simple_Twist": 30.565, "simple_hRise": 3.168, "simple_hTwist": 31.026 }, { "index": 47, "nt1": "///I/47", "nt2": "///J/151", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.321, -1.079, -4.436, 2.342, -1.436 ], "step_params": [ 0.217, -0.280, 3.255, -3.126, 5.237, 37.838 ], "heli_params": [ -1.075, -0.717, 3.163, 8.012, 4.782, 38.309 ], "bp2_params": [ 0.175, -0.182, -0.384, 0.864, 2.442, -0.216 ], "groove_widths": [ 13.525, 13.334, 16.660, 16.274 ], "simple_Rise": 3.255, "simple_Twist": 35.985, "simple_hRise": 3.155, "simple_hTwist": 36.481 }, { "index": 48, "nt1": "///I/48", "nt2": "///J/150", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.182, -0.384, 0.864, 2.442, -0.216 ], "step_params": [ 0.155, -0.331, 3.261, 1.509, 4.386, 34.298 ], "heli_params": [ -1.227, -0.030, 3.199, 7.396, -2.545, 34.601 ], "bp2_params": [ 0.222, -0.120, -0.046, 1.312, 2.960, 0.493 ], "groove_widths": [ 13.648, 13.401, 15.528, 15.384 ], "simple_Rise": 3.261, "simple_Twist": 34.160, "simple_hRise": 3.199, "simple_hTwist": 34.464 }, { "index": 49, "nt1": "///I/49", "nt2": "///J/149", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.222, -0.120, -0.046, 1.312, 2.960, 0.493 ], "step_params": [ 0.602, -0.073, 3.133, 0.816, 4.160, 37.452 ], "heli_params": [ -0.629, -0.830, 3.119, 6.453, -1.266, 37.683 ], "bp2_params": [ -0.167, -0.210, 0.699, 4.092, -0.366, -0.932 ], "groove_widths": [ 13.222, 13.113, 15.552, 15.285 ], "simple_Rise": 3.133, "simple_Twist": 39.568, "simple_hRise": 3.121, "simple_hTwist": 39.785 }, { "index": 50, "nt1": "///I/50", "nt2": "///J/148", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.167, -0.210, 0.699, 4.092, -0.366, -0.932 ], "step_params": [ 0.694, -0.047, 3.289, 4.573, 1.800, 34.852 ], "heli_params": [ -0.351, -0.454, 3.344, 2.988, -7.589, 35.186 ], "bp2_params": [ 0.232, -0.200, 0.602, 7.222, -1.117, 1.562 ], "groove_widths": [ 12.473, 12.443, 15.755, 15.735 ], "simple_Rise": 3.289, "simple_Twist": 32.677, "simple_hRise": 3.345, "simple_hTwist": 33.035 }, { "index": 51, "nt1": "///I/51", "nt2": "///J/147", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.232, -0.200, 0.602, 7.222, -1.117, 1.562 ], "step_params": [ -0.626, 0.482, 3.322, 2.580, -0.747, 34.844 ], "heli_params": [ 0.916, 1.435, 3.258, -1.244, -4.300, 34.944 ], "bp2_params": [ -0.088, -0.263, 0.731, 10.133, -12.080, -7.532 ], "groove_widths": [ 11.542, 11.377, 16.999, 16.498 ], "simple_Rise": 3.322, "simple_Twist": 36.966, "simple_hRise": 3.262, "simple_hTwist": 37.060 }, { "index": 52, "nt1": "///I/52", "nt2": "///J/146", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.263, 0.731, 10.133, -12.080, -7.532 ], "step_params": [ 0.763, 1.700, 3.615, 4.421, -5.473, 44.968 ], "heli_params": [ 2.723, -0.563, 3.452, -7.103, -5.738, 45.487 ], "bp2_params": [ 0.186, -0.147, 0.279, -1.252, -14.201, 0.680 ], "groove_widths": [ 10.075, 9.635, 17.884, 17.167 ], "simple_Rise": 3.615, "simple_Twist": 42.885, "simple_hRise": 3.442, "simple_hTwist": 43.431 }, { "index": 53, "nt1": "///I/53", "nt2": "///J/145", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.147, 0.279, -1.252, -14.201, 0.680 ], "step_params": [ -0.230, 2.105, 3.676, 1.596, -1.885, 38.371 ], "heli_params": [ 3.456, 0.570, 3.561, -2.864, -2.425, 38.447 ], "bp2_params": [ 0.072, -0.192, -0.862, -12.332, -13.149, 4.724 ], "groove_widths": [ 10.038, 9.603, 18.005, 17.305 ], "simple_Rise": 3.676, "simple_Twist": 38.749, "simple_hRise": 3.562, "simple_hTwist": 38.824 }, { "index": 54, "nt1": "///I/54", "nt2": "///J/144", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.192, -0.862, -12.332, -13.149, 4.724 ], "step_params": [ -0.930, 1.594, 3.500, -5.635, 2.722, 37.796 ], "heli_params": [ 2.052, 0.635, 3.698, 4.167, 8.627, 38.292 ], "bp2_params": [ -0.028, -0.476, -1.849, -17.251, -9.537, 7.887 ], "groove_widths": [ 11.079, 10.925, 17.871, 17.506 ], "simple_Rise": 3.500, "simple_Twist": 38.235, "simple_hRise": 3.696, "simple_hTwist": 38.725 }, { "index": 55, "nt1": "///I/55", "nt2": "///J/143", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.028, -0.476, -1.849, -17.251, -9.537, 7.887 ], "step_params": [ -0.739, 0.133, 3.078, -7.525, 1.982, 31.681 ], "heli_params": [ -0.098, 0.048, 3.168, 3.563, 13.529, 32.599 ], "bp2_params": [ -0.207, -0.555, -1.404, -9.408, -1.836, -0.822 ], "groove_widths": [ 12.151, 12.065, 17.355, 17.355 ], "simple_Rise": 3.078, "simple_Twist": 33.309, "simple_hRise": 3.167, "simple_hTwist": 34.181 }, { "index": 56, "nt1": "///I/56", "nt2": "///J/142", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.555, -1.404, -9.408, -1.836, -0.822 ], "step_params": [ -0.128, -0.001, 3.579, -5.425, 6.846, 31.639 ], "heli_params": [ -1.295, -0.799, 3.477, 12.266, 9.720, 32.793 ], "bp2_params": [ -0.254, -0.375, -0.892, -2.782, 9.967, -3.959 ], "groove_widths": [ 14.207, 13.947, 16.574, 16.302 ], "simple_Rise": 3.579, "simple_Twist": 31.863, "simple_hRise": 3.478, "simple_hTwist": 33.009 }, { "index": 57, "nt1": "///I/57", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.375, -0.892, -2.782, 9.967, -3.959 ], "step_params": [ 0.645, 0.552, 3.125, -2.525, 7.894, 34.564 ], "heli_params": [ -0.213, -1.415, 3.118, 13.055, 4.176, 35.514 ], "bp2_params": [ -0.226, -0.209, -0.245, 2.343, 12.243, 0.246 ], "groove_widths": [ 15.726, 15.308, 16.829, 15.334 ], "simple_Rise": 3.125, "simple_Twist": 34.266, "simple_hRise": 3.118, "simple_hTwist": 35.225 }, { "index": 58, "nt1": "///I/58", "nt2": "///J/140", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.209, -0.245, 2.343, 12.243, 0.246 ], "step_params": [ 0.573, -0.655, 3.291, 1.373, 10.017, 30.842 ], "heli_params": [ -2.902, -0.789, 2.961, 18.230, -2.498, 32.419 ], "bp2_params": [ -0.212, -0.178, -0.185, 1.364, 5.642, -0.098 ], "groove_widths": [ 15.135, 14.683, 16.271, 14.867 ], "simple_Rise": 3.291, "simple_Twist": 30.898, "simple_hRise": 2.962, "simple_hTwist": 32.472 }, { "index": 59, "nt1": "///I/59", "nt2": "///J/139", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.212, -0.178, -0.185, 1.364, 5.642, -0.098 ], "step_params": [ 0.107, -0.796, 3.254, 0.827, 3.242, 33.248 ], "heli_params": [ -1.912, -0.051, 3.166, 5.649, -1.441, 33.412 ], "bp2_params": [ -0.057, -0.178, 0.292, 7.034, 2.655, 0.481 ], "groove_widths": [ 13.863, 13.541, 17.405, 17.163 ], "simple_Rise": 3.254, "simple_Twist": 32.397, "simple_hRise": 3.163, "simple_hTwist": 32.565 }, { "index": 60, "nt1": "///I/60", "nt2": "///J/138", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.178, 0.292, 7.034, 2.655, 0.481 ], "step_params": [ 0.737, -0.290, 3.307, 6.702, 3.381, 37.163 ], "heli_params": [ -0.891, -0.253, 3.347, 5.239, -10.385, 37.887 ], "bp2_params": [ 0.212, -0.176, 0.282, 4.062, -2.621, -0.084 ], "groove_widths": [ 12.802, 12.688, 17.684, 17.650 ], "simple_Rise": 3.307, "simple_Twist": 35.648, "simple_hRise": 3.346, "simple_hTwist": 36.405 }, { "index": 61, "nt1": "///I/61", "nt2": "///J/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.212, -0.176, 0.282, 4.062, -2.621, -0.084 ], "step_params": [ 0.271, 0.902, 3.417, -0.152, -1.310, 36.356 ], "heli_params": [ 1.635, -0.456, 3.382, -2.098, 0.243, 36.380 ], "bp2_params": [ -0.145, -0.292, 0.987, 2.036, -6.955, -1.156 ], "groove_widths": [ 12.098, 12.019, 16.597, 16.522 ], "simple_Rise": 3.417, "simple_Twist": 38.340, "simple_hRise": 3.385, "simple_hTwist": 38.361 }, { "index": 62, "nt1": "///I/62", "nt2": "///J/136", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.292, 0.987, 2.036, -6.955, -1.156 ], "step_params": [ -0.235, 0.427, 3.781, 1.034, -1.976, 35.454 ], "heli_params": [ 1.032, 0.559, 3.745, -3.241, -1.695, 35.522 ], "bp2_params": [ -0.184, -0.243, 0.893, -0.904, -9.204, -2.672 ], "groove_widths": [ 11.057, 10.791, 17.091, 16.521 ], "simple_Rise": 3.781, "simple_Twist": 35.732, "simple_hRise": 3.745, "simple_hTwist": 35.799 }, { "index": 63, "nt1": "///I/63", "nt2": "///J/135", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.243, 0.893, -0.904, -9.204, -2.672 ], "step_params": [ -0.778, 2.047, 3.608, 1.846, -7.763, 47.445 ], "heli_params": [ 3.155, 1.108, 3.224, -9.568, -2.275, 48.073 ], "bp2_params": [ 0.059, -0.108, -0.468, -11.940, -18.220, -0.301 ], "groove_widths": [ 10.361, 9.980, 17.715, 16.779 ], "simple_Rise": 3.608, "simple_Twist": 45.326, "simple_hRise": 3.202, "simple_hTwist": 45.987 }, { "index": 64, "nt1": "///I/64", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.108, -0.468, -11.940, -18.220, -0.301 ], "step_params": [ 0.280, 1.078, 3.256, -1.832, 1.212, 30.613 ], "heli_params": [ 1.798, -0.890, 3.274, 2.291, 3.464, 30.690 ], "bp2_params": [ -0.235, -0.176, -0.891, -15.072, -8.887, 2.625 ], "groove_widths": [ 11.160, 10.916, 16.798, 16.440 ], "simple_Rise": 3.256, "simple_Twist": 32.617, "simple_hRise": 3.273, "simple_hTwist": 32.689 }, { "index": 65, "nt1": "///I/65", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, -0.176, -0.891, -15.072, -8.887, 2.625 ], "step_params": [ -1.224, 0.980, 3.237, -8.817, 2.643, 37.378 ], "heli_params": [ 1.145, 0.715, 3.485, 4.049, 13.508, 38.455 ], "bp2_params": [ 0.098, -0.249, -1.130, -13.850, -1.564, 1.019 ], "groove_widths": [ 12.654, 12.564, 16.478, 16.462 ], "simple_Rise": 3.237, "simple_Twist": 35.685, "simple_hRise": 3.492, "simple_hTwist": 36.816 }, { "index": 66, "nt1": "///I/66", "nt2": "///J/132", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.098, -0.249, -1.130, -13.850, -1.564, 1.019 ], "step_params": [ 0.363, -0.252, 3.131, -6.989, 7.978, 33.493 ], "heli_params": [ -1.541, -1.586, 2.868, 13.432, 11.767, 35.086 ], "bp2_params": [ 0.195, -0.206, -0.526, -7.977, 3.415, 2.343 ], "groove_widths": [ 13.685, 13.482, 15.856, 15.491 ], "simple_Rise": 3.131, "simple_Twist": 33.083, "simple_hRise": 2.863, "simple_hTwist": 34.696 }, { "index": 67, "nt1": "///I/67", "nt2": "///J/131", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.206, -0.526, -7.977, 3.415, 2.343 ], "step_params": [ -0.487, -0.046, 3.109, -2.513, 10.140, 36.222 ], "heli_params": [ -1.329, 0.443, 3.014, 15.906, 3.942, 37.650 ], "bp2_params": [ 0.070, -0.126, -0.322, -7.067, 3.859, 0.738 ], "groove_widths": [ 13.979, 13.639, 16.435, 15.876 ], "simple_Rise": 3.109, "simple_Twist": 36.830, "simple_hRise": 3.018, "simple_hTwist": 38.234 }, { "index": 68, "nt1": "///I/68", "nt2": "///J/130", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.070, -0.126, -0.322, -7.067, 3.859, 0.738 ], "step_params": [ 0.124, -0.341, 3.288, -0.946, 3.253, 29.695 ], "heli_params": [ -1.335, -0.436, 3.227, 6.322, 1.839, 29.884 ], "bp2_params": [ -0.195, -0.172, -0.598, -1.944, 0.926, -0.345 ], "groove_widths": [ 13.778, 13.546, 18.615, 17.574 ], "simple_Rise": 3.288, "simple_Twist": 31.203, "simple_hRise": 3.231, "simple_hTwist": 31.382 }, { "index": 69, "nt1": "///I/69", "nt2": "///J/129", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.172, -0.598, -1.944, 0.926, -0.345 ], "step_params": [ -0.213, -0.351, 3.050, -0.350, 2.523, 33.701 ], "heli_params": [ -0.982, 0.314, 3.019, 4.344, 0.603, 33.794 ], "bp2_params": [ 0.199, -0.184, -0.535, 4.974, -0.893, 0.453 ], "groove_widths": [ 13.194, 13.113, 17.075, 16.651 ], "simple_Rise": 3.050, "simple_Twist": 31.562, "simple_hRise": 3.016, "simple_hTwist": 31.662 }, { "index": 70, "nt1": "///I/70", "nt2": "///J/128", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, -0.184, -0.535, 4.974, -0.893, 0.453 ], "step_params": [ -0.081, -0.232, 3.194, 0.775, 3.231, 31.260 ], "heli_params": [ -1.017, 0.292, 3.152, 5.974, -1.434, 31.432 ], "bp2_params": [ -0.039, -0.213, -0.509, 8.957, -6.922, 1.349 ], "groove_widths": [ 12.421, 12.396, 17.919, 17.848 ], "simple_Rise": 3.194, "simple_Twist": 32.870, "simple_hRise": 3.155, "simple_hTwist": 33.033 }, { "index": 71, "nt1": "///I/71", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.039, -0.213, -0.509, 8.957, -6.922, 1.349 ], "step_params": [ 1.044, 1.359, 3.462, 6.697, 0.045, 42.534 ], "heli_params": [ 1.847, -0.707, 3.580, 0.061, -9.163, 43.034 ], "bp2_params": [ 0.273, -0.116, -0.393, 5.789, -7.199, 4.006 ], "groove_widths": [ 10.661, 10.601, 15.980, 15.951 ], "simple_Rise": 3.462, "simple_Twist": 40.559, "simple_hRise": 3.584, "simple_hTwist": 41.085 }, { "index": 72, "nt1": "///I/72", "nt2": "///J/126", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.273, -0.116, -0.393, 5.789, -7.199, 4.006 ], "step_params": [ -0.933, 0.652, 3.437, -0.898, 1.167, 33.102 ], "heli_params": [ 0.935, 1.477, 3.481, 2.048, 1.575, 33.134 ], "bp2_params": [ -0.061, -0.170, -0.336, 3.253, -16.610, 1.806 ], "groove_widths": [ 9.834, 9.685, 16.721, 16.420 ], "simple_Rise": 3.437, "simple_Twist": 35.101, "simple_hRise": 3.478, "simple_hTwist": 35.131 }, { "index": 73, "nt1": "///I/73", "nt2": "///J/125", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.061, -0.170, -0.336, 3.253, -16.610, 1.806 ], "step_params": [ 0.705, 1.875, 3.614, -0.030, -7.472, 42.769 ], "heli_params": [ 3.305, -0.957, 3.257, -10.153, 0.040, 43.386 ], "bp2_params": [ 0.109, -0.108, -0.227, -5.765, -6.481, 1.999 ], "groove_widths": [ 10.381, 10.181, 18.531, 18.106 ], "simple_Rise": 3.614, "simple_Twist": 41.478, "simple_hRise": 3.243, "simple_hTwist": 42.116 }, { "index": 74, "nt1": "///I/74", "nt2": "///J/124", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.108, -0.227, -5.765, -6.481, 1.999 ], "step_params": [ -0.625, 0.760, 3.543, -3.491, 0.635, 34.523 ], "heli_params": [ 1.169, 0.462, 3.600, 1.067, 5.863, 34.700 ], "bp2_params": [ -0.209, -0.148, -0.500, -11.522, -4.215, 0.936 ], "groove_widths": [ 11.482, 11.367, 18.924, 18.790 ], "simple_Rise": 3.543, "simple_Twist": 36.312, "simple_hRise": 3.598, "simple_hTwist": 36.479 }, { "index": 75, "nt1": "///I/75", "nt2": "///J/123", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.209, -0.148, -0.500, -11.522, -4.215, 0.936 ], "step_params": [ -0.028, -0.399, 3.234, -6.813, 2.703, 31.807 ], "heli_params": [ -1.174, -1.116, 3.129, 4.851, 12.228, 32.619 ], "bp2_params": [ 0.196, -0.118, 0.096, -5.426, 0.199, 1.023 ], "groove_widths": [ 13.158, 13.072, 19.725, 19.668 ], "simple_Rise": 3.234, "simple_Twist": 29.646, "simple_hRise": 3.115, "simple_hTwist": 30.519 }, { "index": 76, "nt1": "///I/76", "nt2": "///J/122", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.118, 0.096, -5.426, 0.199, 1.023 ], "step_params": [ -0.432, -0.831, 2.964, -2.988, 5.405, 30.789 ], "heli_params": [ -2.441, 0.298, 2.809, 10.053, 5.558, 31.388 ], "bp2_params": [ 0.038, -0.118, 0.413, -2.730, 0.554, 0.659 ], "groove_widths": [ 13.919, 13.612, 19.747, 19.287 ], "simple_Rise": 2.964, "simple_Twist": 31.643, "simple_hRise": 2.815, "simple_hTwist": 32.225 }, { "index": 77, "nt1": "///I/77", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, -0.118, 0.413, -2.730, 0.554, 0.659 ], "step_params": [ 0.174, -1.301, 3.396, -2.451, 4.153, 31.793 ], "heli_params": [ -3.102, -0.757, 3.183, 7.526, 4.442, 32.148 ], "bp2_params": [ 0.203, -0.155, 0.456, -2.158, 1.530, 0.121 ], "groove_widths": [ 14.205, 13.701, 19.105, 17.596 ], "simple_Rise": 3.396, "simple_Twist": 30.929, "simple_hRise": 3.176, "simple_hTwist": 31.294 }, { "index": 78, "nt1": "///I/78", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.155, 0.456, -2.158, 1.530, 0.121 ], "step_params": [ -0.305, -1.007, 3.119, -1.907, 5.901, 30.546 ], "heli_params": [ -2.920, 0.230, 2.891, 11.058, 3.573, 31.155 ], "bp2_params": [ 0.173, -0.227, 0.682, 0.535, 3.254, 0.506 ], "groove_widths": [ 14.654, 14.104, 19.369, 17.866 ], "simple_Rise": 3.119, "simple_Twist": 30.620, "simple_hRise": 2.892, "simple_hTwist": 31.227 }, { "index": 79, "nt1": "///I/79", "nt2": "///J/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, -0.227, 0.682, 0.535, 3.254, 0.506 ], "step_params": [ -0.196, -0.539, 3.004, 0.284, 4.697, 31.723 ], "heli_params": [ -1.742, 0.401, 2.895, 8.534, -0.515, 32.061 ], "bp2_params": [ -0.195, -0.216, 0.566, 4.379, 3.346, -0.211 ], "groove_widths": [ 14.806, 14.442, 18.565, 16.992 ], "simple_Rise": 3.004, "simple_Twist": 33.850, "simple_hRise": 2.904, "simple_hTwist": 34.167 }, { "index": 80, "nt1": "///I/80", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.216, 0.566, 4.379, 3.346, -0.211 ], "step_params": [ -0.105, -0.702, 3.421, 2.473, 3.312, 32.927 ], "heli_params": [ -1.805, 0.614, 3.320, 5.815, -4.342, 33.178 ], "bp2_params": [ 0.154, -0.327, 0.901, 6.974, -3.184, -0.956 ], "groove_widths": [ 14.391, 14.270, 16.890, 16.489 ], "simple_Rise": 3.421, "simple_Twist": 31.036, "simple_hRise": 3.312, "simple_hTwist": 31.304 }, { "index": 81, "nt1": "///I/81", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.327, 0.901, 6.974, -3.184, -0.956 ], "step_params": [ -0.214, -0.116, 3.317, 6.127, 0.478, 33.186 ], "heli_params": [ -0.278, 1.371, 3.226, 0.829, -10.613, 33.734 ], "bp2_params": [ -0.117, -0.089, -0.119, 7.621, -9.279, -4.335 ], "groove_widths": [ 13.277, 13.246, 17.722, 17.722 ], "simple_Rise": 3.317, "simple_Twist": 34.941, "simple_hRise": 3.233, "simple_hTwist": 35.461 }, { "index": 82, "nt1": "///I/82", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.089, -0.119, 7.621, -9.279, -4.335 ], "step_params": [ 1.253, 0.903, 3.357, 7.964, 1.078, 37.813 ], "heli_params": [ 1.223, -0.844, 3.562, 1.641, -12.122, 38.627 ], "bp2_params": [ -0.109, -0.057, -0.258, 3.833, -10.015, 3.354 ], "groove_widths": [ 11.385, 11.245, 17.674, 17.625 ], "simple_Rise": 3.357, "simple_Twist": 37.634, "simple_hRise": 3.563, "simple_hTwist": 38.452 }, { "index": 83, "nt1": "///I/83", "nt2": "///J/115", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.057, -0.258, 3.833, -10.015, 3.354 ], "step_params": [ -0.753, 1.810, 3.547, -1.064, -3.574, 39.507 ], "heli_params": [ 3.110, 0.978, 3.396, -5.273, 1.570, 39.675 ], "bp2_params": [ 0.046, -0.217, -0.700, -2.616, -12.925, 3.623 ], "groove_widths": [ 10.135, 9.870, 17.645, 17.320 ], "simple_Rise": 3.547, "simple_Twist": 38.388, "simple_hRise": 3.391, "simple_hTwist": 38.562 }, { "index": 84, "nt1": "///I/84", "nt2": "///J/114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, -0.217, -0.700, -2.616, -12.925, 3.623 ], "step_params": [ -0.604, 0.722, 3.375, -3.434, 0.635, 36.532 ], "heli_params": [ 1.056, 0.470, 3.427, 1.011, 5.463, 36.693 ], "bp2_params": [ 0.034, -0.207, -0.970, -8.378, -15.417, 2.189 ], "groove_widths": [ 9.463, 9.301, 17.835, 17.571 ], "simple_Rise": 3.375, "simple_Twist": 36.307, "simple_hRise": 3.427, "simple_hTwist": 36.469 }, { "index": 85, "nt1": "///I/85", "nt2": "///J/113", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.207, -0.970, -8.378, -15.417, 2.189 ], "step_params": [ -0.315, 0.370, 3.428, -3.951, 0.388, 38.937 ], "heli_params": [ 0.503, -0.028, 3.446, 0.581, 5.909, 39.131 ], "bp2_params": [ 0.142, -0.352, -1.332, -9.418, -10.461, 3.797 ], "groove_widths": [ 9.520, 9.484, 16.840, 16.789 ], "simple_Rise": 3.428, "simple_Twist": 38.498, "simple_hRise": 3.446, "simple_hTwist": 38.694 }, { "index": 86, "nt1": "///I/86", "nt2": "///J/112", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.142, -0.352, -1.332, -9.418, -10.461, 3.797 ], "step_params": [ 0.122, -0.180, 3.348, -5.658, -1.059, 36.766 ], "heli_params": [ -0.139, -0.960, 3.297, -1.667, 8.903, 37.198 ], "bp2_params": [ 0.226, -0.285, -0.794, -6.388, -5.301, 4.784 ], "groove_widths": [ 11.155, 11.085, 16.266, 16.150 ], "simple_Rise": 3.348, "simple_Twist": 36.364, "simple_hRise": 3.296, "simple_hTwist": 36.802 }, { "index": 87, "nt1": "///I/87", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.285, -0.794, -6.388, -5.301, 4.784 ], "step_params": [ 0.109, 0.267, 3.384, -4.048, 3.315, 33.374 ], "heli_params": [ -0.098, -0.867, 3.358, 5.729, 6.996, 33.770 ], "bp2_params": [ -0.198, -0.124, 0.140, -7.531, 0.473, 1.430 ], "groove_widths": [ 13.084, 12.886, 16.447, 16.085 ], "simple_Rise": 3.384, "simple_Twist": 35.999, "simple_hRise": 3.363, "simple_hTwist": 36.365 }, { "index": 88, "nt1": "///I/88", "nt2": "///J/110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.124, 0.140, -7.531, 0.473, 1.430 ], "step_params": [ 0.742, -0.540, 3.272, -1.916, 5.857, 35.415 ], "heli_params": [ -1.696, -1.471, 3.103, 9.539, 3.120, 35.930 ], "bp2_params": [ 0.257, -0.165, 0.633, -7.537, 5.623, 1.498 ], "groove_widths": [ 14.062, 13.736, 17.436, 16.175 ], "simple_Rise": 3.272, "simple_Twist": 32.906, "simple_hRise": 3.086, "simple_hTwist": 33.462 }, { "index": 89, "nt1": "///I/89", "nt2": "///J/109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.257, -0.165, 0.633, -7.537, 5.623, 1.498 ], "step_params": [ -0.325, -0.577, 2.855, 0.138, 7.929, 34.311 ], "heli_params": [ -1.964, 0.555, 2.658, 13.222, -0.231, 35.189 ], "bp2_params": [ 0.152, -0.278, 0.829, -2.959, 2.024, -1.830 ], "groove_widths": [ 14.386, 14.068, 16.826, 16.126 ], "simple_Rise": 2.855, "simple_Twist": 34.714, "simple_hRise": 2.661, "simple_hTwist": 35.581 }, { "index": 90, "nt1": "///I/90", "nt2": "///J/108", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.278, 0.829, -2.959, 2.024, -1.830 ], "step_params": [ 0.424, -0.749, 2.953, 0.654, 3.434, 31.912 ], "heli_params": [ -1.905, -0.661, 2.867, 6.223, -1.185, 32.098 ], "bp2_params": [ 0.194, -0.199, 0.704, 8.175, 1.069, 1.335 ], "groove_widths": [ 14.029, 13.882, 18.589, 18.505 ], "simple_Rise": 2.953, "simple_Twist": 31.727, "simple_hRise": 2.866, "simple_hTwist": 31.914 }, { "index": 91, "nt1": "///I/91", "nt2": "///J/107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.199, 0.704, 8.175, 1.069, 1.335 ], "step_params": [ 0.498, 0.401, 3.166, 2.615, -0.046, 34.937 ], "heli_params": [ 0.672, -0.445, 3.193, -0.077, -4.349, 35.031 ], "bp2_params": [ -0.162, -0.134, 0.599, 8.357, -6.717, 1.458 ], "groove_widths": [ 12.087, 12.041, 16.969, 16.960 ], "simple_Rise": 3.166, "simple_Twist": 37.082, "simple_hRise": 3.192, "simple_hTwist": 37.171 }, { "index": 92, "nt1": "///I/92", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.162, -0.134, 0.599, 8.357, -6.717, 1.458 ], "step_params": [ -0.947, 0.605, 3.918, 0.303, -1.341, 35.459 ], "heli_params": [ 1.226, 1.607, 3.885, -2.201, -0.497, 35.484 ], "bp2_params": [ -0.021, -0.173, 0.354, 7.822, -17.129, 0.087 ], "groove_widths": [ 10.825, 10.701, 17.478, 17.210 ], "simple_Rise": 3.918, "simple_Twist": 35.022, "simple_hRise": 3.885, "simple_hTwist": 35.048 }, { "index": 93, "nt1": "///I/93", "nt2": "///J/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.173, 0.354, 7.822, -17.129, 0.087 ], "step_params": [ -0.167, 1.942, 3.557, 3.970, -3.338, 44.380 ], "heli_params": [ 2.880, 0.606, 3.383, -4.401, -5.235, 44.667 ], "bp2_params": [ -0.027, -0.164, -0.692, -5.936, -20.885, 1.488 ], "groove_widths": [ 10.056, 9.716, 17.225, 16.402 ], "simple_Rise": 3.557, "simple_Twist": 43.468, "simple_hRise": 3.379, "simple_hTwist": 43.761 }, { "index": 94, "nt1": "///I/94", "nt2": "///J/104", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.164, -0.692, -5.936, -20.885, 1.488 ], "step_params": [ -0.463, 1.697, 3.422, -5.166, -11.105, 42.011 ], "heli_params": [ 3.338, 0.130, 2.938, -15.109, 7.028, 43.682 ], "bp2_params": [ 0.221, -0.249, -0.708, -8.444, -7.577, 2.262 ], "groove_widths": [ 10.194, 9.771, 17.113, 16.797 ], "simple_Rise": 3.422, "simple_Twist": 40.881, "simple_hRise": 2.920, "simple_hTwist": 42.601 }, { "index": 95, "nt1": "///I/95", "nt2": "///J/103", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.221, -0.249, -0.708, -8.444, -7.577, 2.262 ], "step_params": [ -0.109, 1.486, 3.474, -3.102, 2.023, 34.999 ], "heli_params": [ 2.134, -0.316, 3.548, 3.353, 5.141, 35.188 ], "bp2_params": [ -0.201, -0.141, -0.625, -9.653, 0.806, 1.530 ], "groove_widths": [ 12.066, 11.872, 16.441, 16.373 ], "simple_Rise": 3.474, "simple_Twist": 37.581, "simple_hRise": 3.544, "simple_hTwist": 37.757 }, { "index": 96, "nt1": "///I/96", "nt2": "///J/102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, -0.141, -0.625, -9.653, 0.806, 1.530 ], "step_params": [ 0.215, -0.004, 2.982, -1.262, 4.183, 31.415 ], "heli_params": [ -0.709, -0.604, 2.946, 7.679, 2.316, 31.710 ], "bp2_params": [ 0.217, -0.174, -0.495, -1.874, 0.542, 2.500 ], "groove_widths": [ 12.831, 12.759, 16.071, 16.071 ], "simple_Rise": 2.982, "simple_Twist": 29.033, "simple_hRise": 2.941, "simple_hTwist": 29.353 }, { "index": 97, "nt1": "///I/97", "nt2": "///J/101", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.174, -0.495, -1.874, 0.542, 2.500 ], "step_params": [ 0.391, -0.089, 3.088, -3.658, 5.504, 37.703 ], "heli_params": [ -0.783, -1.028, 2.996, 8.438, 5.607, 38.257 ], "bp2_params": [ -0.213, -0.138, 0.468, -3.613, 1.407, 0.948 ], "groove_widths": [ 13.160, 12.979, 17.378, 17.077 ], "simple_Rise": 3.088, "simple_Twist": 40.106, "simple_hRise": 3.005, "simple_hTwist": 40.624 }, { "index": 98, "nt1": "///I/98", "nt2": "///J/100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.213, -0.138, 0.468, -3.613, 1.407, 0.948 ], "step_params": [ 0.144, -0.784, 3.083, -2.403, 4.047, 33.721 ], "heli_params": [ -1.937, -0.602, 2.955, 6.935, 4.118, 34.039 ], "bp2_params": [ 0.223, -0.284, 0.864, -0.313, 2.951, 1.654 ], "groove_widths": [ 13.755, 13.532, 18.009, 17.334 ], "simple_Rise": 3.083, "simple_Twist": 31.266, "simple_hRise": 2.942, "simple_hTwist": 31.610 }, { "index": 99, "nt1": "///I/99", "nt2": "///J/99", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.284, 0.864, -0.313, 2.951, 1.654 ], "step_params": [ -0.208, -0.960, 3.060, 1.986, 3.519, 30.151 ], "heli_params": [ -2.475, 0.762, 2.913, 6.726, -3.797, 30.415 ], "bp2_params": [ -0.115, -0.233, 0.830, 2.901, -1.003, -2.061 ], "groove_widths": [ 13.838, 13.621, 18.202, 17.139 ], "simple_Rise": 3.060, "simple_Twist": 32.158, "simple_hRise": 2.924, "simple_hTwist": 32.405 }, { "index": 100, "nt1": "///I/100", "nt2": "///J/98", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.233, 0.830, 2.901, -1.003, -2.061 ], "step_params": [ 0.419, -0.286, 3.059, 2.253, 0.837, 36.881 ], "heli_params": [ -0.556, -0.375, 3.072, 1.321, -3.557, 36.956 ], "bp2_params": [ -0.245, -0.161, 0.579, 3.027, 3.255, 2.531 ], "groove_widths": [ 13.298, 13.099, 18.185, 17.580 ], "simple_Rise": 3.059, "simple_Twist": 37.462, "simple_hRise": 3.072, "simple_hTwist": 37.537 }, { "index": 101, "nt1": "///I/101", "nt2": "///J/97", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.161, 0.579, 3.027, 3.255, 2.531 ], "step_params": [ -0.843, -0.621, 3.179, 2.738, 2.537, 30.074 ], "heli_params": [ -1.676, 2.139, 3.030, 4.866, -5.252, 30.300 ], "bp2_params": [ -0.063, -0.157, -0.042, 8.780, -2.097, -1.864 ], "groove_widths": [ 12.395, 12.308, 16.676, 16.671 ], "simple_Rise": 3.179, "simple_Twist": 29.358, "simple_hRise": 3.026, "simple_hTwist": 29.589 }, { "index": 102, "nt1": "///I/102", "nt2": "///J/96", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.157, -0.042, 8.780, -2.097, -1.864 ], "step_params": [ 0.579, 0.565, 3.359, 4.219, 2.839, 38.159 ], "heli_params": [ 0.489, -0.332, 3.433, 4.319, -6.418, 38.484 ], "bp2_params": [ 0.235, -0.169, -0.119, 11.053, -6.923, 0.567 ], "groove_widths": [ 10.929, 10.809, 17.582, 17.538 ], "simple_Rise": 3.359, "simple_Twist": 36.439, "simple_hRise": 3.435, "simple_hTwist": 36.781 }, { "index": 103, "nt1": "///I/103", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.169, -0.119, 11.053, -6.923, 0.567 ], "step_params": [ 0.077, 1.556, 3.720, 3.817, -5.371, 42.118 ], "heli_params": [ 2.742, 0.322, 3.499, -7.418, -5.272, 42.607 ], "bp2_params": [ 0.265, -0.179, -0.404, 1.369, -12.312, 3.728 ], "groove_widths": [ 9.741, 9.374, 17.335, 17.056 ], "simple_Rise": 3.720, "simple_Twist": 41.747, "simple_hRise": 3.496, "simple_hTwist": 42.241 }, { "index": 104, "nt1": "///I/104", "nt2": "///J/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.265, -0.179, -0.404, 1.369, -12.312, 3.728 ], "step_params": [ -0.102, 2.003, 3.585, 0.029, -4.371, 36.728 ], "heli_params": [ 3.783, 0.166, 3.332, -6.906, -0.046, 36.978 ], "bp2_params": [ 0.241, -0.243, -0.570, -6.016, -12.523, 4.780 ], "groove_widths": [ 10.252, 9.905, 17.384, 16.832 ], "simple_Rise": 3.585, "simple_Twist": 36.648, "simple_hRise": 3.332, "simple_hTwist": 36.899 }, { "index": 105, "nt1": "///I/105", "nt2": "///J/93", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.241, -0.243, -0.570, -6.016, -12.523, 4.780 ], "step_params": [ 0.089, 1.942, 3.590, -3.896, -3.599, 40.977 ], "heli_params": [ 3.167, -0.575, 3.393, -5.116, 5.537, 41.305 ], "bp2_params": [ 0.163, -0.154, -0.465, -11.024, -4.432, 2.318 ], "groove_widths": [ 10.861, 10.751, 16.810, 16.509 ], "simple_Rise": 3.590, "simple_Twist": 41.418, "simple_hRise": 3.395, "simple_hTwist": 41.742 }, { "index": 106, "nt1": "///I/106", "nt2": "///J/92", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.163, -0.154, -0.465, -11.024, -4.432, 2.318 ], "step_params": [ -0.578, 0.204, 3.395, -5.636, 3.569, 35.483 ], "heli_params": [ -0.204, 0.091, 3.447, 5.792, 9.148, 36.085 ], "bp2_params": [ 0.162, -0.117, 0.023, -7.806, 2.086, 0.193 ], "groove_widths": [ 12.169, 12.130, 17.472, 17.452 ], "simple_Rise": 3.395, "simple_Twist": 35.706, "simple_hRise": 3.447, "simple_hTwist": 36.304 }, { "index": 107, "nt1": "///I/107", "nt2": "///J/91", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.117, 0.023, -7.806, 2.086, 0.193 ], "step_params": [ 0.455, 0.122, 3.035, -2.020, 5.863, 34.426 ], "heli_params": [ -0.617, -1.039, 2.984, 9.807, 3.379, 34.963 ], "bp2_params": [ -0.234, -0.176, 0.482, -4.048, 7.006, 2.875 ], "groove_widths": [ 14.235, 14.105, 17.778, 17.771 ], "simple_Rise": 3.035, "simple_Twist": 36.688, "simple_hRise": 2.990, "simple_hTwist": 37.191 }, { "index": 108, "nt1": "///I/108", "nt2": "///J/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.176, 0.482, -4.048, 7.006, 2.875 ], "step_params": [ 0.535, -0.623, 3.196, -2.515, 6.412, 30.929 ], "heli_params": [ -2.269, -1.422, 2.959, 11.840, 4.645, 31.669 ], "bp2_params": [ 0.243, -0.276, 0.878, 0.475, 5.629, 4.152 ], "groove_widths": [ 14.681, 14.388, 17.202, 16.354 ], "simple_Rise": 3.196, "simple_Twist": 28.228, "simple_hRise": 2.929, "simple_hTwist": 29.040 }, { "index": 109, "nt1": "///I/109", "nt2": "///J/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.276, 0.878, 0.475, 5.629, 4.152 ], "step_params": [ -0.641, -0.249, 2.989, -1.145, 3.296, 35.642 ], "heli_params": [ -0.838, 0.892, 2.974, 5.368, 1.865, 35.807 ], "bp2_params": [ -0.211, -0.232, 0.885, 3.118, 0.955, 2.094 ], "groove_widths": [ 13.944, 13.584, 17.682, 16.401 ], "simple_Rise": 2.989, "simple_Twist": 38.104, "simple_hRise": 2.976, "simple_hTwist": 38.258 }, { "index": 110, "nt1": "///I/110", "nt2": "///J/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.232, 0.885, 3.118, 0.955, 2.094 ], "step_params": [ -0.451, -1.061, 3.211, 3.399, 1.430, 32.726 ], "heli_params": [ -2.107, 1.356, 3.101, 2.529, -6.008, 32.927 ], "bp2_params": [ -0.119, -0.225, 0.377, 5.446, -6.708, -1.084 ], "groove_widths": [ 12.516, 12.268, 17.105, 16.685 ], "simple_Rise": 3.211, "simple_Twist": 32.414, "simple_hRise": 3.100, "simple_hTwist": 32.617 }, { "index": 111, "nt1": "///I/111", "nt2": "///J/87", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.119, -0.225, 0.377, 5.446, -6.708, -1.084 ], "step_params": [ -0.015, -0.430, 3.094, 5.636, -0.869, 37.419 ], "heli_params": [ -0.557, 0.710, 3.069, -1.345, -8.723, 37.836 ], "bp2_params": [ -0.077, -0.174, -0.318, 6.812, -12.218, 0.793 ], "groove_widths": [ 10.793, 10.716, 16.809, 16.703 ], "simple_Rise": 3.094, "simple_Twist": 37.299, "simple_hRise": 3.068, "simple_hTwist": 37.717 }, { "index": 112, "nt1": "///I/112", "nt2": "///J/86", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.174, -0.318, 6.812, -12.218, 0.793 ], "step_params": [ 0.185, 0.013, 3.447, 3.430, 0.364, 38.580 ], "heli_params": [ -0.028, 0.166, 3.450, 0.550, -5.179, 38.728 ], "bp2_params": [ -0.040, -0.261, -0.773, 1.363, -15.002, 3.034 ], "groove_widths": [ 9.706, 9.664, 17.575, 17.540 ], "simple_Rise": 3.447, "simple_Twist": 38.243, "simple_hRise": 3.450, "simple_hTwist": 38.392 }, { "index": 113, "nt1": "///I/113", "nt2": "///J/85", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.261, -0.773, 1.363, -15.002, 3.034 ], "step_params": [ -0.357, 0.456, 3.351, 1.176, 2.287, 32.626 ], "heli_params": [ 0.404, 0.841, 3.360, 4.064, -2.089, 32.724 ], "bp2_params": [ -0.006, -0.209, -0.772, -4.014, -14.652, 1.943 ], "groove_widths": [ 9.791, 9.579, 18.199, 17.693 ], "simple_Rise": 3.351, "simple_Twist": 32.332, "simple_hRise": 3.360, "simple_hTwist": 32.432 }, { "index": 114, "nt1": "///I/114", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.006, -0.209, -0.772, -4.014, -14.652, 1.943 ], "step_params": [ 0.159, 2.087, 3.798, -3.006, -1.782, 44.373 ], "heli_params": [ 2.944, -0.527, 3.698, -2.355, 3.973, 44.504 ], "bp2_params": [ 0.232, -0.246, -1.295, -9.065, -8.185, -0.551 ], "groove_widths": [ 10.177, 9.809, 18.393, 18.109 ], "simple_Rise": 3.798, "simple_Twist": 42.905, "simple_hRise": 3.694, "simple_hTwist": 43.041 }, { "index": 115, "nt1": "///I/115", "nt2": "///J/83", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.232, -0.246, -1.295, -9.065, -8.185, -0.551 ], "step_params": [ -1.571, 1.811, 3.216, -7.352, -4.326, 38.121 ], "heli_params": [ 3.233, 1.466, 3.236, -6.524, 11.087, 39.029 ], "bp2_params": [ 0.197, -0.321, -1.251, -16.003, -10.327, 2.122 ], "groove_widths": [ 11.260, 11.041, 17.806, 17.617 ], "simple_Rise": 3.216, "simple_Twist": 37.886, "simple_hRise": 3.236, "simple_hTwist": 38.800 }, { "index": 116, "nt1": "///I/116", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.321, -1.251, -16.003, -10.327, 2.122 ], "step_params": [ 0.080, 0.294, 3.197, -6.084, 3.492, 34.077 ], "heli_params": [ -0.031, -1.044, 3.150, 5.881, 10.248, 34.770 ], "bp2_params": [ 0.146, -0.283, -0.784, -9.336, -0.549, 1.077 ], "groove_widths": [ 13.149, 13.105, 17.376, 17.366 ], "simple_Rise": 3.197, "simple_Twist": 34.718, "simple_hRise": 3.152, "simple_hTwist": 35.399 }, { "index": 117, "nt1": "///I/117", "nt2": "///J/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.146, -0.283, -0.784, -9.336, -0.549, 1.077 ], "step_params": [ 0.253, -0.067, 3.358, -4.570, 6.103, 30.118 ], "heli_params": [ -1.321, -1.368, 3.211, 11.513, 8.621, 31.046 ], "bp2_params": [ 0.197, -0.160, -0.084, -5.574, 4.429, -0.302 ], "groove_widths": [ 14.273, 14.109, 16.463, 15.928 ], "simple_Rise": 3.358, "simple_Twist": 30.049, "simple_hRise": 3.210, "simple_hTwist": 30.979 }, { "index": 118, "nt1": "///I/118", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.160, -0.084, -5.574, 4.429, -0.302 ], "step_params": [ 0.273, -0.175, 2.997, -2.291, 6.775, 30.320 ], "heli_params": [ -1.501, -0.906, 2.864, 12.731, 4.305, 31.132 ], "bp2_params": [ -0.226, -0.168, 0.418, -1.599, 5.694, 1.034 ], "groove_widths": [ 14.972, 14.646, 18.131, 16.508 ], "simple_Rise": 2.997, "simple_Twist": 32.718, "simple_hRise": 2.879, "simple_hTwist": 33.470 }, { "index": 119, "nt1": "///I/119", "nt2": "///J/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.168, 0.418, -1.599, 5.694, 1.034 ], "step_params": [ 0.612, -1.012, 3.153, 0.289, 6.673, 32.799 ], "heli_params": [ -2.788, -1.019, 2.902, 11.667, -0.506, 33.454 ], "bp2_params": [ 0.215, -0.198, 0.531, 1.739, 3.906, 0.745 ], "groove_widths": [ 15.027, 14.540, 19.216, 17.697 ], "simple_Rise": 3.153, "simple_Twist": 30.315, "simple_hRise": 2.876, "simple_hTwist": 31.025 }, { "index": 120, "nt1": "///I/120", "nt2": "///J/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.215, -0.198, 0.531, 1.739, 3.906, 0.745 ], "step_params": [ 0.302, -1.429, 3.198, 2.104, 6.383, 29.363 ], "heli_params": [ -3.971, -0.178, 2.845, 12.389, -4.083, 30.106 ], "bp2_params": [ 0.179, -0.255, 0.892, 1.258, 1.558, 0.352 ], "groove_widths": [ 14.457, 14.005, 19.171, 17.690 ], "simple_Rise": 3.198, "simple_Twist": 29.548, "simple_hRise": 2.848, "simple_hTwist": 30.286 }, { "index": 121, "nt1": "///I/121", "nt2": "///J/77", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.255, 0.892, 1.258, 1.558, 0.352 ], "step_params": [ -0.165, -0.922, 2.844, 1.400, 5.817, 32.075 ], "heli_params": [ -2.495, 0.500, 2.631, 10.415, -2.507, 32.614 ], "bp2_params": [ 0.187, -0.209, 0.805, 2.309, -3.016, -2.902 ], "groove_widths": [ 13.896, 13.708, 19.721, 19.393 ], "simple_Rise": 2.844, "simple_Twist": 32.030, "simple_hRise": 2.631, "simple_hTwist": 32.569 }, { "index": 122, "nt1": "///I/122", "nt2": "///J/76", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.187, -0.209, 0.805, 2.309, -3.016, -2.902 ], "step_params": [ -0.479, -0.447, 3.229, 1.802, 1.509, 35.609 ], "heli_params": [ -0.944, 1.037, 3.181, 2.465, -2.943, 35.684 ], "bp2_params": [ 0.167, -0.151, 0.516, 4.536, -8.070, -2.379 ], "groove_widths": [ 12.910, 12.866, 19.593, 19.578 ], "simple_Rise": 3.229, "simple_Twist": 35.701, "simple_hRise": 3.181, "simple_hTwist": 35.776 }, { "index": 123, "nt1": "///I/123", "nt2": "///J/75", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.151, 0.516, 4.536, -8.070, -2.379 ], "step_params": [ 0.754, 0.240, 3.512, 3.537, -2.062, 31.096 ], "heli_params": [ 0.866, -0.672, 3.551, -3.826, -6.562, 31.358 ], "bp2_params": [ -0.171, -0.135, 0.331, 3.185, -9.438, 1.582 ], "groove_widths": [ 11.641, 11.535, 17.718, 17.604 ], "simple_Rise": 3.512, "simple_Twist": 33.106, "simple_hRise": 3.551, "simple_hTwist": 33.351 }, { "index": 124, "nt1": "///I/124", "nt2": "///J/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.135, 0.331, 3.185, -9.438, 1.582 ], "step_params": [ -1.027, 1.604, 3.621, -1.184, -2.619, 42.026 ], "heli_params": [ 2.528, 1.295, 3.545, -3.647, 1.649, 42.120 ], "bp2_params": [ -0.296, -0.156, -0.452, -8.177, -14.967, 3.960 ], "groove_widths": [ 10.686, 10.493, 17.218, 16.950 ], "simple_Rise": 3.621, "simple_Twist": 42.288, "simple_hRise": 3.546, "simple_hTwist": 42.381 }, { "index": 125, "nt1": "///I/125", "nt2": "///J/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.296, -0.156, -0.452, -8.177, -14.967, 3.960 ], "step_params": [ 0.309, 1.336, 3.479, 1.591, 0.786, 35.149 ], "heli_params": [ 2.085, -0.258, 3.517, 1.301, -2.633, 35.192 ], "bp2_params": [ -0.276, -0.255, -1.164, -13.003, -10.250, 5.007 ], "groove_widths": [ 10.096, 9.929, 17.400, 17.120 ], "simple_Rise": 3.479, "simple_Twist": 35.045, "simple_hRise": 3.517, "simple_hTwist": 35.089 }, { "index": 126, "nt1": "///I/126", "nt2": "///J/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, -0.255, -1.164, -13.003, -10.250, 5.007 ], "step_params": [ -1.502, 1.710, 3.334, -6.279, 0.651, 37.586 ], "heli_params": [ 2.532, 1.457, 3.558, 1.002, 9.662, 38.094 ], "bp2_params": [ -0.191, -0.393, -1.599, -15.333, -5.896, 3.214 ], "groove_widths": [ 11.253, 11.170, 16.413, 16.320 ], "simple_Rise": 3.334, "simple_Twist": 37.207, "simple_hRise": 3.560, "simple_hTwist": 37.720 }, { "index": 127, "nt1": "///I/127", "nt2": "///J/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.393, -1.599, -15.333, -5.896, 3.214 ], "step_params": [ 0.041, 0.640, 3.228, -5.365, 5.718, 35.323 ], "heli_params": [ 0.224, -0.824, 3.248, 9.282, 8.709, 36.156 ], "bp2_params": [ 0.224, -0.422, -1.441, -8.998, 1.297, -1.636 ], "groove_widths": [ 13.115, 13.090, 17.398, 17.336 ], "simple_Rise": 3.228, "simple_Twist": 33.120, "simple_hRise": 3.244, "simple_hTwist": 34.011 }, { "index": 128, "nt1": "///I/128", "nt2": "///J/70", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, -0.422, -1.441, -8.998, 1.297, -1.636 ], "step_params": [ 0.296, -0.304, 3.190, -5.078, 1.267, 29.850 ], "heli_params": [ -0.829, -1.557, 3.083, 2.435, 9.763, 30.295 ], "bp2_params": [ -0.232, -0.217, -0.665, -2.572, 4.045, -0.694 ], "groove_widths": [ 13.527, 13.421, 17.083, 16.763 ], "simple_Rise": 3.190, "simple_Twist": 32.505, "simple_hRise": 3.096, "simple_hTwist": 32.912 }, { "index": 129, "nt1": "///I/129", "nt2": "///J/69", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.232, -0.217, -0.665, -2.572, 4.045, -0.694 ], "step_params": [ 0.292, -0.658, 3.428, -0.777, 5.645, 32.992 ], "heli_params": [ -2.103, -0.640, 3.266, 9.848, 1.355, 33.467 ], "bp2_params": [ -0.087, -0.065, 0.010, -1.437, 6.824, -0.221 ], "groove_widths": [ 13.756, 13.495, 17.906, 17.075 ], "simple_Rise": 3.428, "simple_Twist": 32.238, "simple_hRise": 3.261, "simple_hTwist": 32.725 }, { "index": 130, "nt1": "///I/130", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.065, 0.010, -1.437, 6.824, -0.221 ], "step_params": [ 0.479, -0.072, 3.003, 0.542, 7.093, 39.576 ], "heli_params": [ -0.845, -0.640, 2.953, 10.374, -0.793, 40.185 ], "bp2_params": [ 0.109, -0.138, 0.301, 0.350, 4.274, 0.071 ], "groove_widths": [ 14.131, 13.806, 16.624, 15.927 ], "simple_Rise": 3.003, "simple_Twist": 38.251, "simple_hRise": 2.949, "simple_hTwist": 38.882 }, { "index": 131, "nt1": "///I/131", "nt2": "///J/67", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.138, 0.301, 0.350, 4.274, 0.071 ], "step_params": [ 0.313, -0.977, 3.091, 2.248, 1.254, 29.940 ], "heli_params": [ -2.128, -0.169, 3.063, 2.422, -4.340, 30.048 ], "bp2_params": [ 0.225, -0.140, 0.345, 9.917, 3.490, 0.999 ], "groove_widths": [ 13.553, 13.358, 16.678, 16.194 ], "simple_Rise": 3.091, "simple_Twist": 29.433, "simple_hRise": 3.062, "simple_hTwist": 29.542 }, { "index": 132, "nt1": "///I/132", "nt2": "///J/66", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.225, -0.140, 0.345, 9.917, 3.490, 0.999 ], "step_params": [ 0.816, -0.328, 3.379, 7.341, 0.886, 32.985 ], "heli_params": [ -0.716, -0.145, 3.466, 1.536, -12.730, 33.781 ], "bp2_params": [ -0.063, -0.145, 0.152, 8.882, -0.450, 1.128 ], "groove_widths": [ 12.261, 12.198, 17.201, 17.174 ], "simple_Rise": 3.379, "simple_Twist": 34.737, "simple_hRise": 3.465, "simple_hTwist": 35.492 }, { "index": 133, "nt1": "///I/133", "nt2": "///J/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.145, 0.152, 8.882, -0.450, 1.128 ], "step_params": [ -0.001, 0.552, 3.375, 1.480, -0.681, 38.085 ], "heli_params": [ 0.934, 0.195, 3.362, -1.043, -2.267, 38.118 ], "bp2_params": [ 0.191, -0.202, 0.599, 9.229, -9.322, -2.519 ], "groove_widths": [ 10.934, 10.786, 17.604, 17.225 ], "simple_Rise": 3.375, "simple_Twist": 36.797, "simple_hRise": 3.362, "simple_hTwist": 36.831 }, { "index": 134, "nt1": "///I/134", "nt2": "///J/64", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.191, -0.202, 0.599, 9.229, -9.322, -2.519 ], "step_params": [ 0.423, 1.583, 3.617, 4.740, -5.736, 42.015 ], "heli_params": [ 2.802, -0.065, 3.408, -7.925, -6.550, 42.639 ], "bp2_params": [ 0.207, -0.177, 0.248, -1.121, -15.595, 0.627 ], "groove_widths": [ 10.236, 9.927, 18.057, 17.321 ], "simple_Rise": 3.617, "simple_Twist": 41.625, "simple_hRise": 3.406, "simple_hTwist": 42.255 }, { "index": 135, "nt1": "///I/135", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.207, -0.177, 0.248, -1.121, -15.595, 0.627 ], "step_params": [ -0.495, 1.689, 3.592, -0.616, -4.352, 41.062 ], "heli_params": [ 2.898, 0.630, 3.410, -6.184, 0.875, 41.287 ], "bp2_params": [ 0.234, -0.163, -0.238, -10.350, -10.917, 3.037 ], "groove_widths": [ 11.038, 10.742, 17.732, 17.324 ], "simple_Rise": 3.592, "simple_Twist": 40.687, "simple_hRise": 3.408, "simple_hTwist": 40.913 }, { "index": 136, "nt1": "///I/136", "nt2": "///J/62", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.163, -0.238, -10.350, -10.917, 3.037 ], "step_params": [ -0.740, 0.899, 3.538, -5.915, 0.213, 28.693 ], "heli_params": [ 1.727, 0.050, 3.621, 0.424, 11.776, 29.285 ], "bp2_params": [ -0.153, -0.159, -0.403, -8.526, -6.457, 1.924 ], "groove_widths": [ 12.161, 12.046, 16.751, 16.518 ], "simple_Rise": 3.538, "simple_Twist": 31.133, "simple_hRise": 3.619, "simple_hTwist": 31.676 }, { "index": 137, "nt1": "///I/137", "nt2": "///J/61", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.159, -0.403, -8.526, -6.457, 1.924 ], "step_params": [ -0.617, 0.725, 3.648, -4.574, 7.076, 42.703 ], "heli_params": [ 0.197, 0.327, 3.759, 9.606, 6.208, 43.488 ], "bp2_params": [ 0.227, -0.302, -1.274, -13.472, 0.945, -0.782 ], "groove_widths": [ 12.858, 12.736, 17.589, 17.547 ], "simple_Rise": 3.648, "simple_Twist": 40.531, "simple_hRise": 3.762, "simple_hTwist": 41.361 }, { "index": 138, "nt1": "///I/138", "nt2": "///J/60", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, -0.302, -1.274, -13.472, 0.945, -0.782 ], "step_params": [ 0.064, -0.415, 3.136, -3.512, 3.425, 30.398 ], "heli_params": [ -1.418, -0.772, 3.045, 6.479, 6.642, 30.782 ], "bp2_params": [ -0.124, -0.272, -1.058, -8.483, 4.501, -2.471 ], "groove_widths": [ 13.809, 13.464, 17.638, 17.452 ], "simple_Rise": 3.136, "simple_Twist": 32.518, "simple_hRise": 3.054, "simple_hTwist": 32.876 }, { "index": 139, "nt1": "///I/139", "nt2": "///J/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.124, -0.272, -1.058, -8.483, 4.501, -2.471 ], "step_params": [ -0.006, -0.627, 3.119, -4.551, 5.291, 29.391 ], "heli_params": [ -2.212, -0.856, 2.932, 10.246, 8.814, 30.191 ], "bp2_params": [ -0.090, -0.203, -0.136, 2.820, 10.836, 0.541 ], "groove_widths": [ 15.042, 14.634, 16.254, 14.483 ], "simple_Rise": 3.119, "simple_Twist": 29.070, "simple_hRise": 2.929, "simple_hTwist": 29.878 }, { "index": 140, "nt1": "///I/140", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.203, -0.136, 2.820, 10.836, 0.541 ], "step_params": [ 0.295, -0.325, 3.305, 0.537, 9.227, 33.986 ], "heli_params": [ -1.913, -0.409, 3.118, 15.434, -0.898, 35.185 ], "bp2_params": [ 0.193, -0.191, 0.228, 4.425, 7.846, 0.593 ], "groove_widths": [ 14.953, 14.503, 16.703, 14.966 ], "simple_Rise": 3.305, "simple_Twist": 32.366, "simple_hRise": 3.102, "simple_hTwist": 33.626 }, { "index": 141, "nt1": "///I/141", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.191, 0.228, 4.425, 7.846, 0.593 ], "step_params": [ 0.534, -0.491, 3.181, 3.404, 3.985, 33.958 ], "heli_params": [ -1.437, -0.386, 3.142, 6.772, -5.785, 34.348 ], "bp2_params": [ -0.005, -0.232, 0.125, 7.759, 0.569, 2.103 ], "groove_widths": [ 13.497, 13.143, 16.570, 16.269 ], "simple_Rise": 3.181, "simple_Twist": 35.301, "simple_hRise": 3.145, "simple_hTwist": 35.676 }, { "index": 142, "nt1": "///I/142", "nt2": "///J/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.232, 0.125, 7.759, 0.569, 2.103 ], "step_params": [ 0.739, 0.009, 3.137, 8.002, 3.904, 35.343 ], "heli_params": [ -0.520, -0.087, 3.206, 6.307, -12.928, 36.412 ], "bp2_params": [ 0.227, -0.144, -0.110, 12.810, -1.355, 1.841 ], "groove_widths": [ 11.838, 11.738, 17.023, 17.021 ], "simple_Rise": 3.137, "simple_Twist": 33.955, "simple_hRise": 3.205, "simple_hTwist": 35.069 }, { "index": 143, "nt1": "///I/143", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, -0.144, -0.110, 12.810, -1.355, 1.841 ], "step_params": [ 0.289, 1.138, 3.465, 3.648, -2.815, 40.482 ], "heli_params": [ 1.963, 0.009, 3.394, -4.053, -5.252, 40.733 ], "bp2_params": [ 0.239, -0.141, 0.204, 8.137, -11.159, 1.274 ], "groove_widths": [ 10.581, 10.448, 17.180, 16.892 ], "simple_Rise": 3.465, "simple_Twist": 40.523, "simple_hRise": 3.394, "simple_hTwist": 40.773 }, { "index": 144, "nt1": "///I/144", "nt2": "///J/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.239, -0.141, 0.204, 8.137, -11.159, 1.274 ], "step_params": [ -0.000, 1.874, 3.899, 2.566, -3.287, 39.900 ], "heli_params": [ 3.170, 0.343, 3.732, -4.802, -3.748, 40.108 ], "bp2_params": [ 0.065, -0.130, -0.016, -3.128, -14.771, 2.490 ], "groove_widths": [ 10.004, 9.600, 18.638, 17.778 ], "simple_Rise": 3.899, "simple_Twist": 40.550, "simple_hRise": 3.735, "simple_hTwist": 40.755 }, { "index": 145, "nt1": "///I/145", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.065, -0.130, -0.016, -3.128, -14.771, 2.490 ], "step_params": [ -0.650, 2.088, 3.424, -0.344, -2.948, 40.562 ], "heli_params": [ 3.340, 0.896, 3.276, -4.245, 0.495, 40.666 ], "bp2_params": [ -0.306, -0.147, -0.571, -14.950, -13.250, 3.036 ], "groove_widths": [ 10.332, 9.872, 17.577, 16.548 ], "simple_Rise": 3.424, "simple_Twist": 42.290, "simple_hRise": 3.283, "simple_hTwist": 42.389 }, { "index": 146, "nt1": "///I/146", "nt2": "///J/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.147, -0.571, -14.950, -13.250, 3.036 ], "step_params": [ -0.016, 1.723, 3.326, -2.363, 2.590, 35.777 ], "heli_params": [ 2.409, -0.323, 3.432, 4.204, 3.836, 35.943 ], "bp2_params": [ -0.262, -0.174, -0.926, -17.456, -6.910, 2.758 ], "groove_widths": [ 11.820, 11.629, 17.752, 17.353 ], "simple_Rise": 3.326, "simple_Twist": 35.786, "simple_hRise": 3.432, "simple_hTwist": 35.952 }, { "index": 147, "nt1": "///I/147", "nt2": "///J/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.262, -0.174, -0.926, -17.456, -6.910, 2.758 ], "step_params": [ -0.978, 0.509, 3.366, -12.461, 3.900, 33.122 ], "heli_params": [ 0.211, -0.389, 3.531, 6.533, 20.876, 35.536 ], "bp2_params": [ 0.178, -0.147, -0.377, -8.558, 3.654, 0.260 ], "groove_widths": [ 12.774, 12.719, 16.551, 16.551 ], "simple_Rise": 3.366, "simple_Twist": 30.963, "simple_hRise": 3.526, "simple_hTwist": 33.541 }, { "index": 148, "nt1": "///I/148", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.147, -0.377, -8.558, 3.654, 0.260 ], "step_params": [ -0.407, 0.333, 3.017, -5.143, 5.989, 39.451 ], "heli_params": [ -0.154, 0.045, 3.060, 8.765, 7.528, 40.202 ], "bp2_params": [ 0.087, -0.145, -0.103, -4.049, 3.731, 0.701 ], "groove_widths": [ 13.397, 13.223, 15.569, 15.405 ], "simple_Rise": 3.017, "simple_Twist": 39.759, "simple_hRise": 3.060, "simple_hTwist": 40.504 }, { "index": 149, "nt1": "///I/149", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.145, -0.103, -4.049, 3.731, 0.701 ], "step_params": [ 0.134, -0.684, 3.231, -1.342, 3.403, 34.362 ], "heli_params": [ -1.666, -0.429, 3.144, 5.739, 2.264, 34.551 ], "bp2_params": [ 0.197, -0.149, -0.109, 0.941, 0.552, 0.243 ], "groove_widths": [ 13.466, 13.145, 16.045, 15.818 ], "simple_Rise": 3.231, "simple_Twist": 33.801, "simple_hRise": 3.142, "simple_hTwist": 33.993 }, { "index": 150, "nt1": "///I/150", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.149, -0.109, 0.941, 0.552, 0.243 ], "step_params": [ 0.057, -0.414, 3.249, 0.261, 2.600, 34.773 ], "heli_params": [ -1.080, -0.056, 3.211, 4.342, -0.436, 34.868 ], "bp2_params": [ -0.193, -0.176, -0.220, 1.300, 0.872, 0.109 ], "groove_widths": [ 12.998, 12.744, 16.717, 16.163 ], "simple_Rise": 3.249, "simple_Twist": 37.037, "simple_hRise": 3.214, "simple_hTwist": 37.126 }, { "index": 151, "nt1": "///I/151", "nt2": "///J/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.176, -0.220, 1.300, 0.872, 0.109 ], "step_params": [ -0.063, -0.504, 3.291, 1.550, 2.633, 31.581 ], "heli_params": [ -1.405, 0.400, 3.233, 4.823, -2.839, 31.725 ], "bp2_params": [ -0.078, -0.156, -0.301, 4.904, -1.146, -0.270 ], "groove_widths": [ 13.052, 12.985, 17.214, 17.031 ], "simple_Rise": 3.291, "simple_Twist": 31.023, "simple_hRise": 3.231, "simple_hTwist": 31.169 }, { "index": 152, "nt1": "///I/152", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.078, -0.156, -0.301, 4.904, -1.146, -0.270 ], "step_params": [ 0.257, 0.703, 3.512, 1.661, 2.005, 36.917 ], "heli_params": [ 0.816, -0.163, 3.552, 3.161, -2.619, 37.005 ], "bp2_params": [ -0.200, -0.147, -0.203, 3.393, -5.525, 1.382 ], "groove_widths": [ 12.426, 12.418, 16.304, 16.281 ], "simple_Rise": 3.512, "simple_Twist": 37.602, "simple_hRise": 3.551, "simple_hTwist": 37.688 }, { "index": 153, "nt1": "///I/153", "nt2": "///J/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.147, -0.203, 3.393, -5.525, 1.382 ], "step_params": [ -0.093, 0.826, 3.409, 1.586, -0.541, 36.864 ], "heli_params": [ 1.381, 0.370, 3.390, -0.856, -2.507, 36.900 ], "bp2_params": [ -0.019, -0.161, 0.131, 6.751, -10.578, 0.512 ], "groove_widths": [ 11.120, 11.033, 16.787, 16.386 ], "simple_Rise": 3.409, "simple_Twist": 36.106, "simple_hRise": 3.389, "simple_hTwist": 36.144 }, { "index": 154, "nt1": "///I/154", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.019, -0.161, 0.131, 6.751, -10.578, 0.512 ], "step_params": [ 0.444, 1.900, 3.484, 2.345, -2.986, 46.057 ], "heli_params": [ 2.689, -0.356, 3.379, -3.809, -2.992, 46.205 ], "bp2_params": [ 0.213, -0.143, 0.043, 1.174, -10.062, 2.877 ], "groove_widths": [ 10.651, 10.336, 16.573, 15.786 ], "simple_Rise": 3.484, "simple_Twist": 44.298, "simple_hRise": 3.374, "simple_hTwist": 44.452 }, { "index": 155, "nt1": "///I/155", "nt2": "///J/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.213, -0.143, 0.043, 1.174, -10.062, 2.877 ], "step_params": [ -0.812, 2.427, 3.579, -1.438, -1.569, 41.688 ], "heli_params": [ 3.586, 0.975, 3.515, -2.204, 2.019, 41.740 ], "bp2_params": [ 0.081, -0.136, -0.493, -9.013, -11.115, 1.486 ], "groove_widths": [ 11.038, 10.679, 17.093, 16.638 ], "simple_Rise": 3.579, "simple_Twist": 42.195, "simple_hRise": 3.516, "simple_hTwist": 42.246 }, { "index": 156, "nt1": "///I/156", "nt2": "///J/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.136, -0.493, -9.013, -11.115, 1.486 ], "step_params": [ 0.458, 1.252, 3.469, -0.037, 0.850, 30.499 ], "heli_params": [ 2.200, -0.878, 3.502, 1.614, 0.071, 30.511 ], "bp2_params": [ -0.200, -0.248, -1.014, -10.948, -4.547, 2.959 ], "groove_widths": [ 11.454, 11.320, 16.780, 16.585 ], "simple_Rise": 3.469, "simple_Twist": 32.370, "simple_hRise": 3.500, "simple_hTwist": 32.380 }, { "index": 157, "nt1": "///I/157", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.248, -1.014, -10.948, -4.547, 2.959 ], "step_params": [ -0.883, 0.725, 3.240, -6.387, 4.960, 38.158 ], "heli_params": [ 0.471, 0.531, 3.402, 7.484, 9.637, 38.975 ], "bp2_params": [ 0.167, -0.234, -1.015, -11.250, -3.793, 2.164 ], "groove_widths": [ 11.771, 11.698, 16.735, 16.733 ], "simple_Rise": 3.240, "simple_Twist": 35.924, "simple_hRise": 3.408, "simple_hTwist": 36.794 }, { "index": 158, "nt1": "///I/158", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.234, -1.015, -11.250, -3.793, 2.164 ], "step_params": [ 0.553, -0.675, 3.172, -6.548, 1.934, 33.519 ], "heli_params": [ -1.438, -1.922, 2.972, 3.310, 11.208, 34.188 ], "bp2_params": [ -0.040, -0.149, -0.002, -3.833, 2.857, 5.376 ], "groove_widths": [ 12.481, 12.161, 16.919, 16.595 ], "simple_Rise": 3.172, "simple_Twist": 35.001, "simple_hRise": 2.983, "simple_hTwist": 35.640 }, { "index": 159, "nt1": "///I/159", "nt2": "///J/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.149, -0.002, -3.833, 2.857, 5.376 ], "step_params": [ 0.153, -0.326, 3.000, 1.309, 7.816, 36.279 ], "heli_params": [ -1.462, -0.082, 2.874, 12.371, -2.071, 37.106 ], "bp2_params": [ 0.040, -0.167, -0.067, -3.797, 2.811, 1.632 ], "groove_widths": [ 13.623, 13.136, 17.546, 16.781 ], "simple_Rise": 3.000, "simple_Twist": 35.658, "simple_hRise": 2.871, "simple_hTwist": 36.500 }, { "index": 160, "nt1": "///I/160", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, -0.167, -0.067, -3.797, 2.811, 1.632 ], "step_params": [ 0.256, -1.189, 3.379, 0.082, 3.307, 30.156 ], "heli_params": [ -2.948, -0.473, 3.234, 6.333, -0.157, 30.333 ], "bp2_params": [ -0.106, -0.136, 0.376, -0.478, 4.848, -0.235 ], "groove_widths": [ 14.002, 13.610, 19.069, 17.666 ], "simple_Rise": 3.379, "simple_Twist": 31.059, "simple_hRise": 3.239, "simple_hTwist": 31.231 }, { "index": 161, "nt1": "///I/161", "nt2": "///J/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.136, 0.376, -0.478, 4.848, -0.235 ], "step_params": [ 0.248, -0.437, 3.107, 3.538, 11.853, 33.415 ], "heli_params": [ -2.330, 0.075, 2.807, 19.791, -5.908, 35.570 ], "bp2_params": [ 0.034, -0.146, -0.006, -4.054, -7.714, 1.695 ], "groove_widths": [ 13.437, 13.164, 19.228, 18.353 ], "simple_Rise": 3.107, "simple_Twist": 32.474, "simple_hRise": 2.794, "simple_hTwist": 34.691 }, { "index": 162, "nt1": "///I/162", "nt2": "///J/36", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.146, -0.006, -4.054, -7.714, 1.695 ], "step_params": [ -0.195, -0.949, 3.394, -1.421, -1.277, 30.341 ], "heli_params": [ -1.543, 0.075, 3.435, -2.438, 2.712, 30.400 ], "bp2_params": [ -0.046, -0.118, 0.040, -1.506, -6.746, 2.583 ], "groove_widths": [ 12.391, 12.218, 18.579, 18.317 ], "simple_Rise": 3.394, "simple_Twist": 30.986, "simple_hRise": 3.435, "simple_hTwist": 31.043 }, { "index": 163, "nt1": "///I/163", "nt2": "///J/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, -0.118, 0.040, -1.506, -6.746, 2.583 ], "step_params": [ 0.092, 0.332, 3.232, -1.644, 0.288, 41.680 ], "heli_params": [ 0.437, -0.300, 3.228, 0.405, 2.309, 41.712 ], "bp2_params": [ 0.094, -0.105, 0.169, -2.314, -8.696, 1.540 ], "groove_widths": [ 11.395, 11.300, 17.544, 17.498 ], "simple_Rise": 3.232, "simple_Twist": 40.730, "simple_hRise": 3.228, "simple_hTwist": 40.762 }, { "index": 164, "nt1": "///I/164", "nt2": "///J/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.094, -0.105, 0.169, -2.314, -8.696, 1.540 ], "step_params": [ -0.109, -0.440, 3.287, 0.136, -2.435, 33.934 ], "heli_params": [ -0.360, 0.208, 3.309, -4.165, -0.233, 34.019 ], "bp2_params": [ 0.195, -0.111, -0.086, -2.655, -7.593, 1.520 ], "groove_widths": [ 10.820, 10.778, 17.916, 17.916 ], "simple_Rise": 3.287, "simple_Twist": 33.449, "simple_hRise": 3.309, "simple_hTwist": 33.536 }, { "index": 165, "nt1": "///I/165", "nt2": "///J/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.111, -0.086, -2.655, -7.593, 1.520 ], "step_params": [ -0.364, -0.301, 3.762, 1.492, -1.308, 36.945 ], "heli_params": [ -0.272, 0.805, 3.753, -2.062, -2.352, 36.997 ], "bp2_params": [ 0.121, -0.118, -0.485, -7.322, -6.072, 0.827 ], "groove_widths": [ 11.203, 11.200, 18.967, 18.883 ], "simple_Rise": 3.762, "simple_Twist": 37.255, "simple_hRise": 3.753, "simple_hTwist": 37.306 }, { "index": 166, "nt1": "///I/166", "nt2": "///J/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.118, -0.485, -7.322, -6.072, 0.827 ], "step_params": [ -0.304, -0.036, 3.138, -1.607, -0.578, 31.029 ], "heli_params": [ 0.038, 0.271, 3.149, -1.080, 3.001, 31.075 ], "bp2_params": [ -0.120, -0.173, -0.422, -1.504, -6.079, -1.304 ], "groove_widths": [ 12.006, 11.997, 17.941, 17.830 ], "simple_Rise": 3.138, "simple_Twist": 32.653, "simple_hRise": 3.149, "simple_hTwist": 32.696 }, { "index": 167, "nt1": "///I/167", "nt2": "///J/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.173, -0.422, -1.504, -6.079, -1.304 ], "step_params": [ 0.091, -0.459, 3.253, -1.844, 3.365, 36.518 ], "heli_params": [ -1.182, -0.394, 3.191, 5.352, 2.932, 36.712 ], "bp2_params": [ 0.197, -0.134, -0.344, -1.623, -5.826, 1.335 ], "groove_widths": [ 12.643, 12.596, 17.146, 16.919 ], "simple_Rise": 3.253, "simple_Twist": 34.638, "simple_hRise": 3.187, "simple_hTwist": 34.844 }, { "index": 168, "nt1": "///I/168", "nt2": "///J/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.134, -0.344, -1.623, -5.826, 1.335 ], "step_params": [ 0.851, 0.349, 3.248, 3.189, 2.301, 37.235 ], "heli_params": [ 0.240, -0.904, 3.322, 3.591, -4.977, 37.435 ], "bp2_params": [ 0.226, -0.103, -0.197, -2.462, -2.753, 2.824 ], "groove_widths": [ 12.468, 12.375, 16.401, 16.158 ], "simple_Rise": 3.248, "simple_Twist": 36.946, "simple_hRise": 3.323, "simple_hTwist": 37.148 }, { "index": 169, "nt1": "///I/169", "nt2": "///J/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.103, -0.197, -2.462, -2.753, 2.824 ], "step_params": [ -0.066, 0.038, 3.462, -0.975, 2.070, 27.993 ], "heli_params": [ -0.437, -0.107, 3.455, 4.270, 2.011, 28.084 ], "bp2_params": [ 0.040, -0.078, 0.297, -1.131, -2.506, 2.747 ], "groove_widths": [ 12.611, 12.518, 16.636, 16.405 ], "simple_Rise": 3.462, "simple_Twist": 29.285, "simple_hRise": 3.456, "simple_hTwist": 29.372 }, { "index": 170, "nt1": "///I/170", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, -0.078, 0.297, -1.131, -2.506, 2.747 ], "step_params": [ 0.241, 0.587, 3.266, -1.069, 1.002, 40.647 ], "heli_params": [ 0.733, -0.465, 3.272, 1.442, 1.538, 40.672 ], "bp2_params": [ -0.185, -0.203, 0.632, -3.611, 0.133, -0.004 ], "groove_widths": [ 13.388, 13.292, 17.806, 17.666 ], "simple_Rise": 3.266, "simple_Twist": 41.674, "simple_hRise": 3.272, "simple_hTwist": 41.699 }, { "index": 171, "nt1": "///I/171", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.203, 0.632, -3.611, 0.133, -0.004 ], "step_params": [ -0.098, -0.909, 3.295, 0.217, 2.269, 29.186 ], "heli_params": [ -2.288, 0.240, 3.216, 4.493, -0.429, 29.273 ], "bp2_params": [ -0.067, -0.205, 0.659, -0.835, 3.610, -1.298 ], "groove_widths": [ 13.861, 13.730, 18.251, 17.756 ], "simple_Rise": 3.295, "simple_Twist": 28.698, "simple_hRise": 3.214, "simple_hTwist": 28.787 }, { "index": 172, "nt1": "///I/172", "nt2": "///J/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, -0.205, 0.659, -0.835, 3.610, -1.298 ], "step_params": [ 0.367, -0.387, 3.007, 1.842, 11.007, 33.367 ], "heli_params": [ -2.132, -0.358, 2.761, 18.537, -3.103, 35.134 ], "bp2_params": [ -0.182, -0.158, 0.411, -0.858, -4.654, -0.091 ], "groove_widths": [ 14.087, 13.897, 17.838, 17.037 ], "simple_Rise": 3.007, "simple_Twist": 33.981, "simple_hRise": 2.768, "simple_hTwist": 35.716 }, { "index": 173, "nt1": "///I/173", "nt2": "///J/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.158, 0.411, -0.858, -4.654, -0.091 ], "step_params": [ -0.279, -0.795, 3.345, 0.450, 1.294, 33.654 ], "heli_params": [ -1.587, 0.556, 3.309, 2.235, -0.776, 33.681 ], "bp2_params": [ 0.223, -0.132, 0.046, -0.521, -5.134, 0.718 ], "groove_widths": [ 13.334, 12.843, 17.538, 17.220 ], "simple_Rise": 3.345, "simple_Twist": 31.307, "simple_hRise": 3.306, "simple_hTwist": 31.337 }, { "index": 174, "nt1": "///I/174", "nt2": "///J/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.132, 0.046, -0.521, -5.134, 0.718 ], "step_params": [ 0.156, -0.369, 3.212, -1.902, 1.484, 40.200 ], "heli_params": [ -0.701, -0.437, 3.186, 2.157, 2.765, 40.269 ], "bp2_params": [ 0.083, -0.158, 0.593, -0.679, -3.857, 0.002 ], "groove_widths": [ 13.601, 12.779, 18.967, 18.637 ], "simple_Rise": 3.212, "simple_Twist": 40.902, "simple_hRise": 3.187, "simple_hTwist": 40.970 }, { "index": 175, "nt1": "///I/175", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.083, -0.158, 0.593, -0.679, -3.857, 0.002 ], "step_params": [ -0.323, -0.874, 3.725, 1.289, 0.188, 33.913 ], "heli_params": [ -1.531, 0.788, 3.706, 0.323, -2.209, 33.938 ], "bp2_params": [ -0.088, -0.149, -0.189, -1.654, -4.006, 0.566 ], "groove_widths": [ 14.904, 14.164, 18.695, 18.081 ], "simple_Rise": 3.725, "simple_Twist": 35.045, "simple_hRise": 3.707, "simple_hTwist": 35.069 }, { "index": 176, "nt1": "///I/176", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.149, -0.189, -1.654, -4.006, 0.566 ], "step_params": [ 0.522, -1.224, 3.050, -2.273, 7.487, 28.996 ], "heli_params": [ -3.721, -1.420, 2.612, 14.620, 4.438, 30.011 ], "bp2_params": [ -0.211, -0.184, 0.376, -1.397, 1.718, 2.326 ], "groove_widths": [ 15.493, 15.010, 19.990, 18.383 ], "simple_Rise": 3.050, "simple_Twist": 29.690, "simple_hRise": 2.624, "simple_hTwist": 30.681 }, { "index": 177, "nt1": "///I/177", "nt2": "///J/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.184, 0.376, -1.397, 1.718, 2.326 ], "step_params": [ 0.169, -1.599, 3.201, -0.086, 2.209, 32.410 ], "heli_params": [ -3.231, -0.317, 3.087, 3.951, 0.154, 32.483 ], "bp2_params": [ -0.103, -0.138, 0.579, 0.463, -1.693, 5.188 ], "groove_widths": [ 14.315, 13.945, 20.088, 18.514 ], "simple_Rise": 3.201, "simple_Twist": 31.794, "simple_hRise": 3.085, "simple_hTwist": 31.869 }, { "index": 178, "nt1": "///I/178", "nt2": "///J/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.138, 0.579, 0.463, -1.693, 5.188 ], "step_params": [ -0.684, -0.963, 2.786, 6.046, 8.689, 31.556 ], "heli_params": [ -2.841, 2.001, 2.282, 15.443, -10.746, 33.241 ], "bp2_params": [ 0.133, -0.127, 0.133, 7.457, -4.665, -1.610 ], "groove_widths": [ 12.146, 11.806, 17.074, 16.674 ], "simple_Rise": 2.786, "simple_Twist": 30.298, "simple_hRise": 2.256, "simple_hTwist": 32.053 }, { "index": 179, "nt1": "///I/179", "nt2": "///J/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.127, 0.133, 7.457, -4.665, -1.610 ], "step_params": [ -0.385, -1.431, 3.377, 1.888, -2.399, 35.267 ], "heli_params": [ -1.985, 0.923, 3.439, -3.950, -3.109, 35.394 ], "bp2_params": [ -0.082, -0.114, -0.208, -1.191, -8.483, -2.513 ], "groove_widths": [ 11.208, 11.003, 17.419, 17.335 ], "simple_Rise": 3.377, "simple_Twist": 36.434, "simple_hRise": 3.438, "simple_hTwist": 36.557 }, { "index": 180, "nt1": "///I/180", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.114, -0.208, -1.191, -8.483, -2.513 ], "step_params": [ 0.176, 0.123, 3.446, 0.003, 3.844, 31.421 ], "heli_params": [ -0.524, -0.322, 3.436, 7.065, -0.006, 31.649 ], "bp2_params": [ -0.016, -0.165, -0.372, 1.573, -6.633, 5.523 ], "groove_widths": [ 11.627, 11.555, 15.950, 15.950 ], "simple_Rise": 3.446, "simple_Twist": 31.156, "simple_hRise": 3.436, "simple_hTwist": 31.386 }, { "index": 181, "nt1": "///I/181", "nt2": "///J/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.016, -0.165, -0.372, 1.573, -6.633, 5.523 ], "step_params": [ -0.953, 1.608, 3.368, -1.399, -0.277, 43.649 ], "heli_params": [ 2.190, 1.142, 3.386, -0.372, 1.881, 43.671 ], "bp2_params": [ -0.226, -0.154, -0.670, -3.866, -7.464, 1.256 ], "groove_widths": [ 12.194, 12.116, 17.639, 17.614 ], "simple_Rise": 3.368, "simple_Twist": 44.470, "simple_hRise": 3.386, "simple_hTwist": 44.492 }, { "index": 182, "nt1": "///I/182", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.154, -0.670, -3.866, -7.464, 1.256 ], "step_params": [ 0.197, 0.948, 3.583, 1.521, -2.293, 37.252 ], "heli_params": [ 1.809, -0.089, 3.526, -3.584, -2.377, 37.350 ], "bp2_params": [ 0.150, -0.459, -1.534, -4.792, -2.884, 1.573 ], "groove_widths": [ 11.638, 11.588, 18.569, 18.484 ], "simple_Rise": 3.583, "simple_Twist": 35.091, "simple_hRise": 3.521, "simple_hTwist": 35.196 }, { "index": 183, "nt1": "///I/183", "nt2": "///J/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.459, -1.534, -4.792, -2.884, 1.573 ], "step_params": [ -1.720, 1.216, 3.601, -10.209, 0.748, 37.851 ], "heli_params": [ 1.709, 1.131, 3.939, 1.129, 15.397, 39.161 ], "bp2_params": [ 0.235, -0.575, -1.528, -7.732, -0.530, -2.921 ], "groove_widths": [ 11.798, 11.793, 15.750, 15.635 ], "simple_Rise": 3.601, "simple_Twist": 37.419, "simple_hRise": 3.942, "simple_hTwist": 38.746 }, { "index": 184, "nt1": "///I/184", "nt2": "///J/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.575, -1.528, -7.732, -0.530, -2.921 ], "step_params": [ 0.447, -0.481, 3.254, -4.391, 4.293, 31.558 ], "heli_params": [ -1.620, -1.576, 3.075, 7.801, 7.979, 32.135 ], "bp2_params": [ 0.129, -0.366, -0.988, -5.568, 2.644, -0.324 ], "groove_widths": [ 12.608, 12.542, 15.667, 15.662 ], "simple_Rise": 3.254, "simple_Twist": 32.290, "simple_hRise": 3.081, "simple_hTwist": 32.853 }, { "index": 185, "nt1": "///I/185", "nt2": "///J/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.366, -0.988, -5.568, 2.644, -0.324 ], "step_params": [ 0.748, 0.627, 3.506, -0.682, 6.486, 40.879 ], "heli_params": [ 0.134, -1.138, 3.548, 9.216, 0.969, 41.374 ], "bp2_params": [ 0.068, -0.154, -0.530, -8.089, -2.806, 3.869 ], "groove_widths": [ 12.380, 12.220, 16.431, 16.261 ], "simple_Rise": 3.506, "simple_Twist": 41.104, "simple_hRise": 3.548, "simple_hTwist": 41.596 }, { "index": 186, "nt1": "///I/186", "nt2": "///J/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.068, -0.154, -0.530, -8.089, -2.806, 3.869 ], "step_params": [ -1.256, -0.238, 3.356, -0.751, -0.076, 33.734 ], "heli_params": [ -0.398, 2.038, 3.383, -0.130, 1.294, 33.743 ], "bp2_params": [ -0.176, -0.186, -0.760, -4.883, -2.060, -0.233 ], "groove_widths": [ 12.404, 12.272, 17.273, 17.087 ], "simple_Rise": 3.356, "simple_Twist": 35.197, "simple_hRise": 3.382, "simple_hTwist": 35.205 }, { "index": 187, "nt1": "///I/187", "nt2": "///J/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, -0.186, -0.760, -4.883, -2.060, -0.233 ], "step_params": [ 0.391, 0.029, 3.166, -2.764, 1.835, 36.436 ], "heli_params": [ -0.197, -0.990, 3.127, 2.928, 4.409, 36.581 ], "bp2_params": [ 0.219, -0.136, -0.281, 0.176, -1.877, 1.068 ], "groove_widths": [ 12.369, 12.274, 15.436, 15.405 ], "simple_Rise": 3.166, "simple_Twist": 34.337, "simple_hRise": 3.123, "simple_hTwist": 34.492 }, { "index": 188, "nt1": "///I/188", "nt2": "///J/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.136, -0.281, 0.176, -1.877, 1.068 ], "step_params": [ -0.473, 0.203, 3.102, -3.010, 3.722, 39.977 ], "heli_params": [ -0.108, 0.361, 3.133, 5.421, 4.383, 40.251 ], "bp2_params": [ -0.185, -0.118, -0.023, -1.949, -1.082, -0.771 ], "groove_widths": [ 12.076, 11.956, 15.735, 15.592 ], "simple_Rise": 3.102, "simple_Twist": 42.127, "simple_hRise": 3.133, "simple_hTwist": 42.386 }, { "index": 189, "nt1": "///I/189", "nt2": "///J/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.118, -0.023, -1.949, -1.082, -0.771 ], "step_params": [ 0.607, -0.119, 3.145, 0.642, 2.277, 38.345 ], "heli_params": [ -0.454, -0.846, 3.142, 3.463, -0.976, 38.415 ], "bp2_params": [ 0.075, -0.113, 0.053, -1.945, -3.244, 2.600 ], "groove_widths": [ 11.835, 11.744, 14.880, 14.692 ], "simple_Rise": 3.145, "simple_Twist": 36.843, "simple_hRise": 3.142, "simple_hTwist": 36.916 }, { "index": 190, "nt1": "///I/190", "nt2": "///J/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.075, -0.113, 0.053, -1.945, -3.244, 2.600 ], "step_params": [ -1.125, 0.076, 3.128, -1.833, 0.368, 37.574 ], "heli_params": [ 0.071, 1.515, 3.178, 0.571, 2.844, 37.619 ], "bp2_params": [ 0.180, -0.116, 0.018, 0.747, -4.107, -0.697 ], "groove_widths": [ 11.662, 11.620, 14.470, 14.457 ], "simple_Rise": 3.128, "simple_Twist": 37.098, "simple_hRise": 3.178, "simple_hTwist": 37.144 }, { "index": 191, "nt1": "///I/191", "nt2": "///J/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.116, 0.018, 0.747, -4.107, -0.697 ], "step_params": [ 0.331, -0.211, 3.178, 0.624, -0.103, 38.663 ], "heli_params": [ -0.306, -0.425, 3.184, -0.155, -0.942, 38.668 ], "bp2_params": [ 0.189, -0.127, 0.064, -0.689, -4.069, 0.165 ], "groove_widths": [ 11.477, 11.458, 16.133, 16.085 ], "simple_Rise": 3.178, "simple_Twist": 38.642, "simple_hRise": 3.184, "simple_hTwist": 38.647 }, { "index": 192, "nt1": "///I/192", "nt2": "///J/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.127, 0.064, -0.689, -4.069, 0.165 ], "step_params": [ -0.635, 1.439, 3.581, 0.654, -0.831, 43.118 ], "heli_params": [ 2.047, 0.933, 3.544, -1.131, -0.890, 43.130 ], "bp2_params": [ 0.110, -0.138, -0.483, -2.756, -3.214, -0.041 ], "groove_widths": [ 12.060, 12.049, 16.462, 16.418 ], "simple_Rise": 3.581, "simple_Twist": 43.409, "simple_hRise": 3.545, "simple_hTwist": 43.422 }, { "index": 193, "nt1": "///I/193", "nt2": "///J/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.138, -0.483, -2.756, -3.214, -0.041 ], "step_params": [ 0.930, 0.136, 3.792, -0.438, 0.569, 33.032 ], "heli_params": [ 0.128, -1.722, 3.782, 1.001, 0.771, 33.040 ], "bp2_params": [ 0.189, -0.349, -1.111, -1.342, -1.108, 3.262 ], "groove_widths": [ 12.863, 12.822, 15.942, 15.922 ], "simple_Rise": 3.792, "simple_Twist": 32.622, "simple_hRise": 3.781, "simple_hTwist": 32.630 }, { "index": 194, "nt1": "///I/194", "nt2": "///J/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.349, -1.111, -1.342, -1.108, 3.262 ], "step_params": [ -1.261, 0.155, 3.494, -2.102, 3.372, 35.614 ], "heli_params": [ -0.271, 1.723, 3.559, 5.492, 3.424, 35.828 ], "bp2_params": [ 0.154, -0.291, -0.980, -0.979, 1.442, -0.934 ], "groove_widths": [ 12.833, null, 15.084, null ], "simple_Rise": 3.494, "simple_Twist": 35.921, "simple_hRise": 3.559, "simple_hTwist": 36.133 }, { "index": 195, "nt1": "///I/195", "nt2": "///J/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.291, -0.980, -0.979, 1.442, -0.934 ], "step_params": [ 0.535, 0.257, 3.272, 2.177, 0.982, 40.325 ], "heli_params": [ 0.261, -0.528, 3.300, 1.423, -3.155, 40.393 ], "bp2_params": [ 0.159, -0.242, -0.825, 2.860, 1.163, -0.869 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.272, "simple_Twist": 40.235, "simple_hRise": 3.300, "simple_hTwist": 40.303 }, { "index": 196, "nt1": "///I/196", "nt2": "///J/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.159, -0.242, -0.825, 2.860, 1.163, -0.869 ], "step_params": [ 1.097, 0.704, 3.535, 2.659, 0.259, 35.558 ], "heli_params": [ 1.108, -1.370, 3.610, 0.424, -4.346, 35.655 ], "bp2_params": [ 0.186, -0.178, -0.540, 3.567, 0.441, 1.573 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.535, "simple_Twist": 35.383, "simple_hRise": 3.610, "simple_hTwist": 35.481 }, { "index": 197, "nt1": "///I/197", "nt2": "///J/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGGCTGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCACCCC", "strand2": "CCCGACCTGGGATATGCGCCGGCGGGACCTCTTAGGGCCACGGCTCCGGCGAGTTAACCAGCATCTGTCGAGATCGTGGCGAATTTGCGTGCATGCGCGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACGTACATAACTTGTCGCTGGTGGGG", "bp_type": "|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||", "helix_form": "B.BBBBBBBBB....BBBB.BBBBBBBBBBBBBBBBBBBBB.B....BBBB.B.....BBBB.BB.B..BBB.BBBBBBBBB.B..BBBBBBBBBBBBBBBBBBBBBBBBBBB..BBBBBBBB.B....BBBBBBB...BBBBBBBBBBBBBBB.BB.B.BBBBBBBBBBBBBBB....B.B....BBBBB.....", "helical_rise": 0.205, "helical_rise_std": 2.360, "helical_axis": [ -0.925, 0.379, -0.028 ], "point1": [ null, null, null ], "point2": [ null, null, null ], "num_pairs": 197, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/197", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.179, -0.446, 8.258, -0.754, 1.383 ], "step_params": [ -0.209, 0.375, 4.487, 1.557, -1.850, 36.120 ], "heli_params": [ 0.960, 0.636, 4.451, -2.979, -2.507, 36.198 ], "bp2_params": [ -0.177, -0.128, 0.163, 5.489, -8.049, 1.112 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.487, "simple_Twist": 36.142, "simple_hRise": 4.451, "simple_hTwist": 36.220 }, { "index": 2, "nt1": "///I/2", "nt2": "///J/196", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.128, 0.163, 5.489, -8.049, 1.112 ], "step_params": [ -0.173, 1.600, 4.298, 1.085, -4.561, 43.333 ], "heli_params": [ 2.721, 0.367, 4.112, -6.155, -1.464, 43.574 ], "bp2_params": [ -0.246, -0.201, -0.690, -4.523, -10.865, 3.502 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.298, "simple_Twist": 43.464, "simple_hRise": 4.113, "simple_hTwist": 43.704 }, { "index": 3, "nt1": "///I/3", "nt2": "///J/195", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.201, -0.690, -4.523, -10.865, 3.502 ], "step_params": [ -0.827, 0.241, 3.547, -3.754, -4.509, 41.994 ], "heli_params": [ 0.836, 0.727, 3.562, -6.255, 5.207, 42.384 ], "bp2_params": [ 0.180, -0.298, -0.919, -7.745, -5.482, 1.756 ], "groove_widths": [ 10.785, null, 17.679, null ], "simple_Rise": 3.547, "simple_Twist": 39.645, "simple_hRise": 3.560, "simple_hTwist": 40.060 }, { "index": 4, "nt1": "///I/4", "nt2": "///J/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.298, -0.919, -7.745, -5.482, 1.756 ], "step_params": [ 0.393, 0.160, 3.423, -2.404, -0.272, 35.065 ], "heli_params": [ 0.307, -1.024, 3.388, -0.450, 3.985, 35.146 ], "bp2_params": [ -0.097, -0.130, -0.281, -6.426, -0.784, -0.543 ], "groove_widths": [ 12.038, 12.007, 15.679, 15.636 ], "simple_Rise": 3.423, "simple_Twist": 36.773, "simple_hRise": 3.390, "simple_hTwist": 36.850 }, { "index": 5, "nt1": "///I/5", "nt2": "///J/193", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.130, -0.281, -6.426, -0.784, -0.543 ], "step_params": [ 0.222, -0.186, 2.961, -4.393, 5.381, 35.829 ], "heli_params": [ -0.967, -0.900, 2.858, 8.647, 7.059, 36.474 ], "bp2_params": [ -0.206, -0.119, 0.111, -0.969, 1.051, 0.616 ], "groove_widths": [ 13.073, 12.971, 15.610, 15.445 ], "simple_Rise": 2.961, "simple_Twist": 36.332, "simple_hRise": 2.860, "simple_hTwist": 36.968 }, { "index": 6, "nt1": "///I/6", "nt2": "///J/192", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.119, 0.111, -0.969, 1.051, 0.616 ], "step_params": [ 0.256, -0.327, 3.198, 1.152, 0.338, 35.406 ], "heli_params": [ -0.586, -0.255, 3.201, 0.555, -1.893, 35.426 ], "bp2_params": [ -0.187, -0.125, -0.078, 3.034, 0.308, -0.121 ], "groove_widths": [ 12.575, 12.421, 17.336, 16.998 ], "simple_Rise": 3.198, "simple_Twist": 35.327, "simple_hRise": 3.201, "simple_hTwist": 35.346 }, { "index": 7, "nt1": "///I/7", "nt2": "///J/191", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.125, -0.078, 3.034, 0.308, -0.121 ], "step_params": [ 0.685, -0.390, 3.245, 0.031, 2.453, 39.135 ], "heli_params": [ -0.870, -1.017, 3.216, 3.658, -0.047, 39.209 ], "bp2_params": [ 0.034, -0.139, -0.052, 0.477, -5.566, 4.303 ], "groove_widths": [ 11.226, 11.069, 16.877, 16.650 ], "simple_Rise": 3.245, "simple_Twist": 37.798, "simple_hRise": 3.215, "simple_hTwist": 37.875 }, { "index": 8, "nt1": "///I/8", "nt2": "///J/190", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.139, -0.052, 0.477, -5.566, 4.303 ], "step_params": [ -0.861, -0.479, 3.175, -1.303, -1.416, 38.234 ], "heli_params": [ -0.556, 1.153, 3.216, -2.161, 1.988, 38.280 ], "bp2_params": [ 0.196, -0.129, -0.149, -0.242, -7.183, 1.086 ], "groove_widths": [ 10.413, 10.270, 17.906, 17.815 ], "simple_Rise": 3.175, "simple_Twist": 37.412, "simple_hRise": 3.217, "simple_hTwist": 37.460 }, { "index": 9, "nt1": "///I/9", "nt2": "///J/189", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.129, -0.149, -0.242, -7.183, 1.086 ], "step_params": [ 0.504, -0.404, 3.194, -0.697, -1.647, 38.554 ], "heli_params": [ -0.412, -0.847, 3.199, -2.493, 1.055, 38.593 ], "bp2_params": [ 0.217, -0.121, -0.209, -1.368, -6.547, 3.423 ], "groove_widths": [ 10.096, 9.974, 17.057, 16.936 ], "simple_Rise": 3.194, "simple_Twist": 38.401, "simple_hRise": 3.199, "simple_hTwist": 38.441 }, { "index": 10, "nt1": "///I/10", "nt2": "///J/188", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.121, -0.209, -1.368, -6.547, 3.423 ], "step_params": [ -1.468, -0.314, 3.108, -2.416, 1.877, 36.617 ], "heli_params": [ -0.744, 2.012, 3.175, 2.981, 3.838, 36.740 ], "bp2_params": [ 0.178, -0.155, -0.485, -1.112, -3.405, 0.606 ], "groove_widths": [ 10.651, 10.578, 17.264, 17.214 ], "simple_Rise": 3.108, "simple_Twist": 36.867, "simple_hRise": 3.175, "simple_hTwist": 36.989 }, { "index": 11, "nt1": "///I/11", "nt2": "///J/187", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.155, -0.485, -1.112, -3.405, 0.606 ], "step_params": [ 1.227, -0.222, 3.125, 1.486, 0.200, 33.240 ], "heli_params": [ -0.421, -1.904, 3.174, 0.350, -2.596, 33.273 ], "bp2_params": [ -0.047, -0.167, -0.431, 0.167, -3.764, 8.182 ], "groove_widths": [ 11.479, 11.390, 18.324, 18.186 ], "simple_Rise": 3.125, "simple_Twist": 34.591, "simple_hRise": 3.173, "simple_hTwist": 34.623 }, { "index": 12, "nt1": "///I/12", "nt2": "///J/186", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.047, -0.167, -0.431, 0.167, -3.764, 8.182 ], "step_params": [ -1.554, 0.782, 3.699, -3.278, 3.795, 37.890 ], "heli_params": [ 0.639, 1.894, 3.873, 5.814, 5.022, 38.209 ], "bp2_params": [ 0.152, -0.339, -1.167, -4.066, -0.329, 0.950 ], "groove_widths": [ 11.988, 11.858, 17.422, 17.265 ], "simple_Rise": 3.699, "simple_Twist": 36.634, "simple_hRise": 3.878, "simple_hTwist": 36.964 }, { "index": 13, "nt1": "///I/13", "nt2": "///J/185", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.339, -1.167, -4.066, -0.329, 0.950 ], "step_params": [ -0.056, -1.171, 3.228, -0.987, 3.010, 27.403 ], "heli_params": [ -3.167, -0.116, 3.084, 6.327, 2.075, 27.582 ], "bp2_params": [ -0.095, -0.391, -1.087, -0.499, -2.434, 4.715 ], "groove_widths": [ 12.318, 12.176, 16.964, 16.946 ], "simple_Rise": 3.228, "simple_Twist": 28.928, "simple_hRise": 3.093, "simple_hTwist": 29.097 }, { "index": 14, "nt1": "///I/14", "nt2": "///J/184", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.391, -1.087, -0.499, -2.434, 4.715 ], "step_params": [ -0.321, 2.084, 4.032, 0.414, 1.897, 49.049 ], "heli_params": [ 2.331, 0.425, 4.102, 2.285, -0.498, 49.085 ], "bp2_params": [ 0.155, -0.441, -1.305, -5.079, -4.880, 1.660 ], "groove_widths": [ 12.350, 12.202, 16.767, 16.649 ], "simple_Rise": 4.032, "simple_Twist": 47.378, "simple_hRise": 4.104, "simple_hTwist": 47.415 }, { "index": 15, "nt1": "///I/15", "nt2": "///J/183", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.441, -1.305, -5.079, -4.880, 1.660 ], "step_params": [ 0.533, -0.287, 3.771, -3.021, -0.773, 32.696 ], "heli_params": [ -0.355, -1.536, 3.714, -1.370, 5.351, 32.840 ], "bp2_params": [ 0.183, -0.234, -0.763, -3.496, -1.699, 1.609 ], "groove_widths": [ 12.223, 12.145, 18.313, 18.215 ], "simple_Rise": 3.771, "simple_Twist": 32.699, "simple_hRise": 3.714, "simple_hTwist": 32.843 }, { "index": 16, "nt1": "///I/16", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.234, -0.763, -3.496, -1.699, 1.609 ], "step_params": [ -0.345, 0.563, 3.762, -0.289, -0.436, 34.329 ], "heli_params": [ 1.033, 0.532, 3.757, -0.738, 0.489, 34.333 ], "bp2_params": [ -0.165, -0.107, -0.441, -6.148, 0.295, -0.370 ], "groove_widths": [ 12.434, 12.413, 17.733, 17.731 ], "simple_Rise": 3.762, "simple_Twist": 36.339, "simple_hRise": 3.758, "simple_hTwist": 36.343 }, { "index": 17, "nt1": "///I/17", "nt2": "///J/181", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.107, -0.441, -6.148, 0.295, -0.370 ], "step_params": [ -0.301, 0.061, 3.317, -4.081, 0.383, 36.391 ], "heli_params": [ 0.044, -0.092, 3.330, 0.611, 6.508, 36.613 ], "bp2_params": [ 0.174, -0.136, -0.284, -0.978, 3.305, -0.532 ], "groove_widths": [ 12.877, 12.816, 16.569, 16.546 ], "simple_Rise": 3.317, "simple_Twist": 34.493, "simple_hRise": 3.330, "simple_hTwist": 34.729 }, { "index": 18, "nt1": "///I/18", "nt2": "///J/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.174, -0.136, -0.284, -0.978, 3.305, -0.532 ], "step_params": [ 0.327, 0.214, 3.154, 1.039, 9.846, 40.119 ], "heli_params": [ -0.729, -0.355, 3.126, 14.094, -1.487, 41.274 ], "bp2_params": [ -0.246, -0.173, -0.452, -4.755, -7.045, 1.892 ], "groove_widths": [ 12.384, 12.204, 14.617, 14.611 ], "simple_Rise": 3.154, "simple_Twist": 42.313, "simple_hRise": 3.132, "simple_hTwist": 43.404 }, { "index": 19, "nt1": "///I/19", "nt2": "///J/179", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.173, -0.452, -4.755, -7.045, 1.892 ], "step_params": [ -0.254, -0.189, 3.315, -0.135, -0.036, 40.055 ], "heli_params": [ -0.271, 0.355, 3.316, -0.052, 0.197, 40.056 ], "bp2_params": [ -0.210, -0.189, -0.763, -6.403, -4.119, 0.751 ], "groove_widths": [ 11.405, 11.210, 15.150, 15.094 ], "simple_Rise": 3.315, "simple_Twist": 39.900, "simple_hRise": 3.316, "simple_hTwist": 39.900 }, { "index": 20, "nt1": "///I/20", "nt2": "///J/178", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.189, -0.763, -6.403, -4.119, 0.751 ], "step_params": [ 0.391, -0.312, 3.231, -0.890, -0.384, 35.954 ], "heli_params": [ -0.451, -0.758, 3.224, -0.622, 1.441, 35.966 ], "bp2_params": [ 0.188, -0.183, -0.590, -4.060, -1.722, 0.719 ], "groove_widths": [ 11.886, 11.806, 16.694, 16.664 ], "simple_Rise": 3.231, "simple_Twist": 33.806, "simple_hRise": 3.224, "simple_hTwist": 33.819 }, { "index": 21, "nt1": "///I/21", "nt2": "///J/177", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.183, -0.590, -4.060, -1.722, 0.719 ], "step_params": [ 0.192, 0.348, 3.567, -2.560, -0.557, 36.367 ], "heli_params": [ 0.640, -0.693, 3.540, -0.890, 4.095, 36.458 ], "bp2_params": [ 0.185, -0.120, 0.152, -3.035, 0.420, -0.423 ], "groove_widths": [ 12.529, 12.497, 18.437, 18.183 ], "simple_Rise": 3.567, "simple_Twist": 36.377, "simple_hRise": 3.540, "simple_hTwist": 36.468 }, { "index": 22, "nt1": "///I/22", "nt2": "///J/176", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.120, 0.152, -3.035, 0.420, -0.423 ], "step_params": [ 0.194, -0.683, 2.913, -6.095, 1.539, 32.902 ], "heli_params": [ -1.409, -1.222, 2.800, 2.686, 10.640, 33.481 ], "bp2_params": [ -0.177, -0.276, 0.983, 3.522, -1.691, 0.464 ], "groove_widths": [ 12.300, 12.202, 17.445, 16.911 ], "simple_Rise": 2.913, "simple_Twist": 34.975, "simple_hRise": 2.809, "simple_hTwist": 35.518 }, { "index": 23, "nt1": "///I/23", "nt2": "///J/175", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.276, 0.983, 3.522, -1.691, 0.464 ], "step_params": [ -0.692, -0.994, 3.161, -0.047, -0.079, 38.862 ], "heli_params": [ -1.484, 1.035, 3.164, -0.118, 0.071, 38.862 ], "bp2_params": [ 0.160, -0.262, 0.834, 3.191, -3.161, -0.290 ], "groove_widths": [ 12.383, 12.185, 16.512, 16.304 ], "simple_Rise": 3.161, "simple_Twist": 36.936, "simple_hRise": 3.164, "simple_hTwist": 36.936 }, { "index": 24, "nt1": "///I/24", "nt2": "///J/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.262, 0.834, 3.191, -3.161, -0.290 ], "step_params": [ 0.292, -0.509, 3.134, 1.577, 0.018, 35.953 ], "heli_params": [ -0.826, -0.258, 3.143, 0.030, -2.554, 35.986 ], "bp2_params": [ 0.145, -0.216, 0.694, 0.269, -3.305, -1.586 ], "groove_widths": [ 12.158, 12.007, 16.491, 16.182 ], "simple_Rise": 3.134, "simple_Twist": 36.015, "simple_hRise": 3.143, "simple_hTwist": 36.049 }, { "index": 25, "nt1": "///I/25", "nt2": "///J/173", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.145, -0.216, 0.694, 0.269, -3.305, -1.586 ], "step_params": [ -0.270, -0.626, 3.144, 0.292, -0.006, 36.291 ], "heli_params": [ -1.003, 0.473, 3.142, -0.009, -0.469, 36.292 ], "bp2_params": [ 0.160, -0.197, 0.629, 1.552, -2.173, -0.610 ], "groove_widths": [ 12.419, 12.387, 17.207, 16.930 ], "simple_Rise": 3.144, "simple_Twist": 36.212, "simple_hRise": 3.142, "simple_hTwist": 36.213 }, { "index": 26, "nt1": "///I/26", "nt2": "///J/172", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.197, 0.629, 1.552, -2.173, -0.610 ], "step_params": [ -0.178, -0.387, 3.317, -0.407, 0.309, 26.412 ], "heli_params": [ -0.930, 0.280, 3.315, 0.677, 0.890, 26.417 ], "bp2_params": [ -0.141, -0.243, 0.918, 2.030, -5.261, -4.993 ], "groove_widths": [ 13.330, 13.329, 18.337, 18.336 ], "simple_Rise": 3.317, "simple_Twist": 28.257, "simple_hRise": 3.315, "simple_hTwist": 28.261 }, { "index": 27, "nt1": "///I/27", "nt2": "///J/171", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.243, 0.918, 2.030, -5.261, -4.993 ], "step_params": [ -0.029, 1.194, 3.488, 1.556, -1.661, 41.361 ], "heli_params": [ 1.875, 0.217, 3.437, -2.349, -2.200, 41.421 ], "bp2_params": [ -0.239, -0.158, 0.374, -3.297, -4.079, -0.273 ], "groove_widths": [ 13.511, 13.508, 17.501, 17.495 ], "simple_Rise": 3.488, "simple_Twist": 41.676, "simple_hRise": 3.437, "simple_hTwist": 41.735 }, { "index": 28, "nt1": "///I/28", "nt2": "///J/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.158, 0.374, -3.297, -4.079, -0.273 ], "step_params": [ -0.515, -0.099, 3.482, -2.674, 4.610, 28.243 ], "heli_params": [ -1.308, 0.396, 3.455, 9.343, 5.419, 28.731 ], "bp2_params": [ -0.211, -0.101, -0.315, -4.136, -2.541, 1.662 ], "groove_widths": [ 13.434, 13.412, 16.987, 16.946 ], "simple_Rise": 3.482, "simple_Twist": 28.154, "simple_hRise": 3.455, "simple_hTwist": 28.644 }, { "index": 29, "nt1": "///I/29", "nt2": "///J/169", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.101, -0.315, -4.136, -2.541, 1.662 ], "step_params": [ -0.685, 0.332, 3.224, -5.736, 4.163, 40.126 ], "heli_params": [ 0.014, 0.346, 3.304, 6.011, 8.282, 40.721 ], "bp2_params": [ 0.095, -0.119, -0.326, -1.658, -1.260, -0.894 ], "groove_widths": [ 13.161, 13.103, 15.885, 15.769 ], "simple_Rise": 3.224, "simple_Twist": 38.318, "simple_hRise": 3.306, "simple_hTwist": 38.944 }, { "index": 30, "nt1": "///I/30", "nt2": "///J/168", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.119, -0.326, -1.658, -1.260, -0.894 ], "step_params": [ 0.560, -0.518, 3.199, -0.823, 1.686, 27.057 ], "heli_params": [ -1.517, -1.396, 3.143, 3.597, 1.755, 27.120 ], "bp2_params": [ -0.144, -0.162, -0.336, 3.575, -2.159, 0.736 ], "groove_widths": [ 12.616, 12.567, 16.727, 16.539 ], "simple_Rise": 3.199, "simple_Twist": 28.662, "simple_hRise": 3.147, "simple_hTwist": 28.722 }, { "index": 31, "nt1": "///I/31", "nt2": "///J/167", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.162, -0.336, 3.575, -2.159, 0.736 ], "step_params": [ -0.194, 0.453, 3.296, -0.829, -1.680, 39.949 ], "heli_params": [ 0.857, 0.188, 3.279, -2.457, 1.212, 39.991 ], "bp2_params": [ 0.111, -0.109, -0.325, 2.637, -6.214, -0.124 ], "groove_widths": [ 11.573, 11.561, 17.635, 17.508 ], "simple_Rise": 3.296, "simple_Twist": 38.333, "simple_hRise": 3.278, "simple_hTwist": 38.377 }, { "index": 32, "nt1": "///I/32", "nt2": "///J/166", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, -0.109, -0.325, 2.637, -6.214, -0.124 ], "step_params": [ -0.088, -0.309, 3.378, -0.584, 1.025, 36.736 ], "heli_params": [ -0.634, 0.058, 3.370, 1.626, 0.927, 36.754 ], "bp2_params": [ 0.100, -0.226, -0.734, 0.656, -9.909, 3.970 ], "groove_widths": [ 10.665, 10.654, 18.455, 18.245 ], "simple_Rise": 3.378, "simple_Twist": 36.804, "simple_hRise": 3.370, "simple_hTwist": 36.823 }, { "index": 33, "nt1": "///I/33", "nt2": "///J/165", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.226, -0.734, 0.656, -9.909, 3.970 ], "step_params": [ 0.035, -0.146, 3.491, 1.470, 0.486, 33.570 ], "heli_params": [ -0.337, 0.196, 3.487, 0.840, -2.543, 33.605 ], "bp2_params": [ -0.055, -0.331, -0.737, -6.161, -10.950, 7.524 ], "groove_widths": [ 10.760, 10.725, 17.558, 17.557 ], "simple_Rise": 3.491, "simple_Twist": 34.433, "simple_hRise": 3.487, "simple_hTwist": 34.467 }, { "index": 34, "nt1": "///I/34", "nt2": "///J/164", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.055, -0.331, -0.737, -6.161, -10.950, 7.524 ], "step_params": [ -0.095, 0.086, 3.407, -3.592, 1.291, 40.586 ], "heli_params": [ -0.026, -0.278, 3.403, 1.856, 5.165, 40.757 ], "bp2_params": [ 0.165, -0.199, -0.633, -8.245, -3.602, 1.082 ], "groove_widths": [ 11.136, 11.043, 17.416, 17.324 ], "simple_Rise": 3.407, "simple_Twist": 39.309, "simple_hRise": 3.403, "simple_hTwist": 39.487 }, { "index": 35, "nt1": "///I/35", "nt2": "///J/163", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.199, -0.633, -8.245, -3.602, 1.082 ], "step_params": [ -0.302, 0.153, 3.306, -3.383, 2.175, 35.178 ], "heli_params": [ -0.074, -0.009, 3.323, 3.584, 5.576, 35.400 ], "bp2_params": [ 0.174, -0.155, -0.272, -8.678, 1.087, 0.672 ], "groove_widths": [ 12.290, 12.167, 18.652, 18.223 ], "simple_Rise": 3.306, "simple_Twist": 35.189, "simple_hRise": 3.323, "simple_hTwist": 35.411 }, { "index": 36, "nt1": "///I/36", "nt2": "///J/162", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.174, -0.155, -0.272, -8.678, 1.087, 0.672 ], "step_params": [ -0.049, -0.963, 3.136, -4.489, 4.996, 28.028 ], "heli_params": [ -2.980, -0.840, 2.897, 10.133, 9.104, 28.805 ], "bp2_params": [ 0.193, -0.143, 0.393, -3.705, 3.422, -0.294 ], "groove_widths": [ 13.811, 13.705, 17.983, 17.210 ], "simple_Rise": 3.136, "simple_Twist": 28.025, "simple_hRise": 2.897, "simple_hTwist": 28.803 }, { "index": 37, "nt1": "///I/37", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.143, 0.393, -3.705, 3.422, -0.294 ], "step_params": [ 0.126, -0.557, 2.869, -2.202, 5.512, 30.888 ], "heli_params": [ -1.917, -0.587, 2.716, 10.231, 4.087, 31.439 ], "bp2_params": [ -0.173, -0.240, 0.762, 0.987, 1.727, 0.100 ], "groove_widths": [ 14.051, 13.807, 17.769, 16.395 ], "simple_Rise": 2.869, "simple_Twist": 32.872, "simple_hRise": 2.729, "simple_hTwist": 33.389 }, { "index": 38, "nt1": "///I/38", "nt2": "///J/160", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.173, -0.240, 0.762, 0.987, 1.727, 0.100 ], "step_params": [ -0.210, -0.730, 3.061, -1.900, 3.490, 37.113 ], "heli_params": [ -1.569, 0.096, 2.989, 5.464, 2.975, 37.318 ], "bp2_params": [ -0.184, -0.230, 0.849, 2.790, 0.602, 0.496 ], "groove_widths": [ 13.399, 13.066, 17.489, 16.713 ], "simple_Rise": 3.061, "simple_Twist": 37.153, "simple_hRise": 2.989, "simple_hTwist": 37.358 }, { "index": 39, "nt1": "///I/39", "nt2": "///J/159", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.230, 0.849, 2.790, 0.602, 0.496 ], "step_params": [ -0.285, -0.921, 3.241, 2.919, 2.019, 33.465 ], "heli_params": [ -1.913, 0.958, 3.146, 3.494, -5.051, 33.647 ], "bp2_params": [ -0.114, -0.164, 0.542, 3.397, -3.168, -2.205 ], "groove_widths": [ 12.799, 12.626, 16.727, 16.514 ], "simple_Rise": 3.241, "simple_Twist": 33.200, "simple_hRise": 3.146, "simple_hTwist": 33.384 }, { "index": 40, "nt1": "///I/40", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, -0.164, 0.542, 3.397, -3.168, -2.205 ], "step_params": [ 0.700, 0.510, 3.152, 3.278, 0.553, 36.338 ], "heli_params": [ 0.740, -0.677, 3.208, 0.885, -5.242, 36.484 ], "bp2_params": [ -0.214, -0.147, 0.386, 4.232, -2.012, 1.624 ], "groove_widths": [ 12.403, 12.355, 16.618, 16.586 ], "simple_Rise": 3.152, "simple_Twist": 36.782, "simple_hRise": 3.208, "simple_hTwist": 36.926 }, { "index": 41, "nt1": "///I/41", "nt2": "///J/157", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.214, -0.147, 0.386, 4.232, -2.012, 1.624 ], "step_params": [ -0.855, 0.534, 3.663, 0.472, -0.809, 33.262 ], "heli_params": [ 1.082, 1.581, 3.638, -1.412, -0.825, 33.275 ], "bp2_params": [ 0.211, -0.154, 0.098, 4.737, -8.886, -0.404 ], "groove_widths": [ 12.088, 11.932, 17.094, 16.853 ], "simple_Rise": 3.663, "simple_Twist": 31.020, "simple_hRise": 3.636, "simple_hTwist": 31.034 }, { "index": 42, "nt1": "///I/42", "nt2": "///J/156", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.154, 0.098, 4.737, -8.886, -0.404 ], "step_params": [ 0.471, 2.023, 3.511, 1.029, -2.733, 41.871 ], "heli_params": [ 3.125, -0.545, 3.389, -3.818, -1.438, 41.968 ], "bp2_params": [ 0.195, -0.169, 0.488, 0.019, -11.370, 0.331 ], "groove_widths": [ 11.204, 10.884, 17.568, 16.943 ], "simple_Rise": 3.511, "simple_Twist": 41.802, "simple_hRise": 3.389, "simple_hTwist": 41.899 }, { "index": 43, "nt1": "///I/43", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.169, 0.488, 0.019, -11.370, 0.331 ], "step_params": [ -0.072, 2.065, 3.478, 0.943, -0.551, 39.225 ], "heli_params": [ 3.144, 0.226, 3.448, -0.821, -1.405, 39.240 ], "bp2_params": [ -0.268, -0.127, -0.277, -7.270, -11.101, 4.085 ], "groove_widths": [ 10.578, 10.344, 16.654, 15.910 ], "simple_Rise": 3.478, "simple_Twist": 41.668, "simple_hRise": 3.450, "simple_hTwist": 41.682 }, { "index": 44, "nt1": "///I/44", "nt2": "///J/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.268, -0.127, -0.277, -7.270, -11.101, 4.085 ], "step_params": [ -0.990, 1.981, 3.547, -3.996, 1.150, 43.077 ], "heli_params": [ 2.563, 0.912, 3.670, 1.562, 5.427, 43.268 ], "bp2_params": [ 0.129, -0.325, -1.216, -10.675, -8.742, 3.169 ], "groove_widths": [ 11.564, 11.508, 16.761, 16.252 ], "simple_Rise": 3.547, "simple_Twist": 40.719, "simple_hRise": 3.677, "simple_hTwist": 40.922 }, { "index": 45, "nt1": "///I/45", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.325, -1.216, -10.675, -8.742, 3.169 ], "step_params": [ -0.082, 0.893, 3.423, -3.632, 3.160, 31.917 ], "heli_params": [ 1.012, -0.538, 3.481, 5.705, 6.558, 32.268 ], "bp2_params": [ -0.141, -0.396, -1.391, -10.019, -1.268, -0.339 ], "groove_widths": [ 12.668, 12.663, 16.648, 16.625 ], "simple_Rise": 3.423, "simple_Twist": 33.767, "simple_hRise": 3.479, "simple_hTwist": 34.098 }, { "index": 46, "nt1": "///I/46", "nt2": "///J/152", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.396, -1.391, -10.019, -1.268, -0.339 ], "step_params": [ -0.021, 0.020, 3.209, -3.035, 4.456, 30.553 ], "heli_params": [ -0.804, -0.534, 3.167, 8.374, 5.703, 31.014 ], "bp2_params": [ -0.133, -0.321, -1.079, -4.436, 2.342, -1.436 ], "groove_widths": [ 13.227, 13.192, 17.243, 16.994 ], "simple_Rise": 3.209, "simple_Twist": 30.565, "simple_hRise": 3.168, "simple_hTwist": 31.026 }, { "index": 47, "nt1": "///I/47", "nt2": "///J/151", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.321, -1.079, -4.436, 2.342, -1.436 ], "step_params": [ 0.217, -0.280, 3.255, -3.126, 5.237, 37.838 ], "heli_params": [ -1.075, -0.717, 3.163, 8.012, 4.782, 38.309 ], "bp2_params": [ 0.175, -0.182, -0.384, 0.864, 2.442, -0.216 ], "groove_widths": [ 13.525, 13.334, 16.660, 16.274 ], "simple_Rise": 3.255, "simple_Twist": 35.985, "simple_hRise": 3.155, "simple_hTwist": 36.481 }, { "index": 48, "nt1": "///I/48", "nt2": "///J/150", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.182, -0.384, 0.864, 2.442, -0.216 ], "step_params": [ 0.155, -0.331, 3.261, 1.509, 4.386, 34.298 ], "heli_params": [ -1.227, -0.030, 3.199, 7.396, -2.545, 34.601 ], "bp2_params": [ 0.222, -0.120, -0.046, 1.312, 2.960, 0.493 ], "groove_widths": [ 13.648, 13.401, 15.528, 15.384 ], "simple_Rise": 3.261, "simple_Twist": 34.160, "simple_hRise": 3.199, "simple_hTwist": 34.464 }, { "index": 49, "nt1": "///I/49", "nt2": "///J/149", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.222, -0.120, -0.046, 1.312, 2.960, 0.493 ], "step_params": [ 0.602, -0.073, 3.133, 0.816, 4.160, 37.452 ], "heli_params": [ -0.629, -0.830, 3.119, 6.453, -1.266, 37.683 ], "bp2_params": [ -0.167, -0.210, 0.699, 4.092, -0.366, -0.932 ], "groove_widths": [ 13.222, 13.113, 15.552, 15.285 ], "simple_Rise": 3.133, "simple_Twist": 39.568, "simple_hRise": 3.121, "simple_hTwist": 39.785 }, { "index": 50, "nt1": "///I/50", "nt2": "///J/148", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.167, -0.210, 0.699, 4.092, -0.366, -0.932 ], "step_params": [ 0.694, -0.047, 3.289, 4.573, 1.800, 34.852 ], "heli_params": [ -0.351, -0.454, 3.344, 2.988, -7.589, 35.186 ], "bp2_params": [ 0.232, -0.200, 0.602, 7.222, -1.117, 1.562 ], "groove_widths": [ 12.473, 12.443, 15.755, 15.735 ], "simple_Rise": 3.289, "simple_Twist": 32.677, "simple_hRise": 3.345, "simple_hTwist": 33.035 }, { "index": 51, "nt1": "///I/51", "nt2": "///J/147", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.232, -0.200, 0.602, 7.222, -1.117, 1.562 ], "step_params": [ -0.626, 0.482, 3.322, 2.580, -0.747, 34.844 ], "heli_params": [ 0.916, 1.435, 3.258, -1.244, -4.300, 34.944 ], "bp2_params": [ -0.088, -0.263, 0.731, 10.133, -12.080, -7.532 ], "groove_widths": [ 11.542, 11.377, 16.999, 16.498 ], "simple_Rise": 3.322, "simple_Twist": 36.966, "simple_hRise": 3.262, "simple_hTwist": 37.060 }, { "index": 52, "nt1": "///I/52", "nt2": "///J/146", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.263, 0.731, 10.133, -12.080, -7.532 ], "step_params": [ 0.763, 1.700, 3.615, 4.421, -5.473, 44.968 ], "heli_params": [ 2.723, -0.563, 3.452, -7.103, -5.738, 45.487 ], "bp2_params": [ 0.186, -0.147, 0.279, -1.252, -14.201, 0.680 ], "groove_widths": [ 10.075, 9.635, 17.884, 17.167 ], "simple_Rise": 3.615, "simple_Twist": 42.885, "simple_hRise": 3.442, "simple_hTwist": 43.431 }, { "index": 53, "nt1": "///I/53", "nt2": "///J/145", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.147, 0.279, -1.252, -14.201, 0.680 ], "step_params": [ -0.230, 2.105, 3.676, 1.596, -1.885, 38.371 ], "heli_params": [ 3.456, 0.570, 3.561, -2.864, -2.425, 38.447 ], "bp2_params": [ 0.072, -0.192, -0.862, -12.332, -13.149, 4.724 ], "groove_widths": [ 10.038, 9.603, 18.005, 17.305 ], "simple_Rise": 3.676, "simple_Twist": 38.749, "simple_hRise": 3.562, "simple_hTwist": 38.824 }, { "index": 54, "nt1": "///I/54", "nt2": "///J/144", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.192, -0.862, -12.332, -13.149, 4.724 ], "step_params": [ -0.930, 1.594, 3.500, -5.635, 2.722, 37.796 ], "heli_params": [ 2.052, 0.635, 3.698, 4.167, 8.627, 38.292 ], "bp2_params": [ -0.028, -0.476, -1.849, -17.251, -9.537, 7.887 ], "groove_widths": [ 11.079, 10.925, 17.871, 17.506 ], "simple_Rise": 3.500, "simple_Twist": 38.235, "simple_hRise": 3.696, "simple_hTwist": 38.725 }, { "index": 55, "nt1": "///I/55", "nt2": "///J/143", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.028, -0.476, -1.849, -17.251, -9.537, 7.887 ], "step_params": [ -0.739, 0.133, 3.078, -7.525, 1.982, 31.681 ], "heli_params": [ -0.098, 0.048, 3.168, 3.563, 13.529, 32.599 ], "bp2_params": [ -0.207, -0.555, -1.404, -9.408, -1.836, -0.822 ], "groove_widths": [ 12.151, 12.065, 17.355, 17.355 ], "simple_Rise": 3.078, "simple_Twist": 33.309, "simple_hRise": 3.167, "simple_hTwist": 34.181 }, { "index": 56, "nt1": "///I/56", "nt2": "///J/142", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.555, -1.404, -9.408, -1.836, -0.822 ], "step_params": [ -0.128, -0.001, 3.579, -5.425, 6.846, 31.639 ], "heli_params": [ -1.295, -0.799, 3.477, 12.266, 9.720, 32.793 ], "bp2_params": [ -0.254, -0.375, -0.892, -2.782, 9.967, -3.959 ], "groove_widths": [ 14.207, 13.947, 16.574, 16.302 ], "simple_Rise": 3.579, "simple_Twist": 31.863, "simple_hRise": 3.478, "simple_hTwist": 33.009 }, { "index": 57, "nt1": "///I/57", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.375, -0.892, -2.782, 9.967, -3.959 ], "step_params": [ 0.645, 0.552, 3.125, -2.525, 7.894, 34.564 ], "heli_params": [ -0.213, -1.415, 3.118, 13.055, 4.176, 35.514 ], "bp2_params": [ -0.226, -0.209, -0.245, 2.343, 12.243, 0.246 ], "groove_widths": [ 15.726, 15.308, 16.829, 15.334 ], "simple_Rise": 3.125, "simple_Twist": 34.266, "simple_hRise": 3.118, "simple_hTwist": 35.225 }, { "index": 58, "nt1": "///I/58", "nt2": "///J/140", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.209, -0.245, 2.343, 12.243, 0.246 ], "step_params": [ 0.573, -0.655, 3.291, 1.373, 10.017, 30.842 ], "heli_params": [ -2.902, -0.789, 2.961, 18.230, -2.498, 32.419 ], "bp2_params": [ -0.212, -0.178, -0.185, 1.364, 5.642, -0.098 ], "groove_widths": [ 15.135, 14.683, 16.271, 14.867 ], "simple_Rise": 3.291, "simple_Twist": 30.898, "simple_hRise": 2.962, "simple_hTwist": 32.472 }, { "index": 59, "nt1": "///I/59", "nt2": "///J/139", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.212, -0.178, -0.185, 1.364, 5.642, -0.098 ], "step_params": [ 0.107, -0.796, 3.254, 0.827, 3.242, 33.248 ], "heli_params": [ -1.912, -0.051, 3.166, 5.649, -1.441, 33.412 ], "bp2_params": [ -0.057, -0.178, 0.292, 7.034, 2.655, 0.481 ], "groove_widths": [ 13.863, 13.541, 17.405, 17.163 ], "simple_Rise": 3.254, "simple_Twist": 32.397, "simple_hRise": 3.163, "simple_hTwist": 32.565 }, { "index": 60, "nt1": "///I/60", "nt2": "///J/138", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.178, 0.292, 7.034, 2.655, 0.481 ], "step_params": [ 0.737, -0.290, 3.307, 6.702, 3.381, 37.163 ], "heli_params": [ -0.891, -0.253, 3.347, 5.239, -10.385, 37.887 ], "bp2_params": [ 0.212, -0.176, 0.282, 4.062, -2.621, -0.084 ], "groove_widths": [ 12.802, 12.688, 17.684, 17.650 ], "simple_Rise": 3.307, "simple_Twist": 35.648, "simple_hRise": 3.346, "simple_hTwist": 36.405 }, { "index": 61, "nt1": "///I/61", "nt2": "///J/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.212, -0.176, 0.282, 4.062, -2.621, -0.084 ], "step_params": [ 0.271, 0.902, 3.417, -0.152, -1.310, 36.356 ], "heli_params": [ 1.635, -0.456, 3.382, -2.098, 0.243, 36.380 ], "bp2_params": [ -0.145, -0.292, 0.987, 2.036, -6.955, -1.156 ], "groove_widths": [ 12.098, 12.019, 16.597, 16.522 ], "simple_Rise": 3.417, "simple_Twist": 38.340, "simple_hRise": 3.385, "simple_hTwist": 38.361 }, { "index": 62, "nt1": "///I/62", "nt2": "///J/136", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.292, 0.987, 2.036, -6.955, -1.156 ], "step_params": [ -0.235, 0.427, 3.781, 1.034, -1.976, 35.454 ], "heli_params": [ 1.032, 0.559, 3.745, -3.241, -1.695, 35.522 ], "bp2_params": [ -0.184, -0.243, 0.893, -0.904, -9.204, -2.672 ], "groove_widths": [ 11.057, 10.791, 17.091, 16.521 ], "simple_Rise": 3.781, "simple_Twist": 35.732, "simple_hRise": 3.745, "simple_hTwist": 35.799 }, { "index": 63, "nt1": "///I/63", "nt2": "///J/135", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.243, 0.893, -0.904, -9.204, -2.672 ], "step_params": [ -0.778, 2.047, 3.608, 1.846, -7.763, 47.445 ], "heli_params": [ 3.155, 1.108, 3.224, -9.568, -2.275, 48.073 ], "bp2_params": [ 0.059, -0.108, -0.468, -11.940, -18.220, -0.301 ], "groove_widths": [ 10.361, 9.980, 17.715, 16.779 ], "simple_Rise": 3.608, "simple_Twist": 45.326, "simple_hRise": 3.202, "simple_hTwist": 45.987 }, { "index": 64, "nt1": "///I/64", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.108, -0.468, -11.940, -18.220, -0.301 ], "step_params": [ 0.280, 1.078, 3.256, -1.832, 1.212, 30.613 ], "heli_params": [ 1.798, -0.890, 3.274, 2.291, 3.464, 30.690 ], "bp2_params": [ -0.235, -0.176, -0.891, -15.072, -8.887, 2.625 ], "groove_widths": [ 11.160, 10.916, 16.798, 16.440 ], "simple_Rise": 3.256, "simple_Twist": 32.617, "simple_hRise": 3.273, "simple_hTwist": 32.689 }, { "index": 65, "nt1": "///I/65", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, -0.176, -0.891, -15.072, -8.887, 2.625 ], "step_params": [ -1.224, 0.980, 3.237, -8.817, 2.643, 37.378 ], "heli_params": [ 1.145, 0.715, 3.485, 4.049, 13.508, 38.455 ], "bp2_params": [ 0.098, -0.249, -1.130, -13.850, -1.564, 1.019 ], "groove_widths": [ 12.654, 12.564, 16.478, 16.462 ], "simple_Rise": 3.237, "simple_Twist": 35.685, "simple_hRise": 3.492, "simple_hTwist": 36.816 }, { "index": 66, "nt1": "///I/66", "nt2": "///J/132", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.098, -0.249, -1.130, -13.850, -1.564, 1.019 ], "step_params": [ 0.363, -0.252, 3.131, -6.989, 7.978, 33.493 ], "heli_params": [ -1.541, -1.586, 2.868, 13.432, 11.767, 35.086 ], "bp2_params": [ 0.195, -0.206, -0.526, -7.977, 3.415, 2.343 ], "groove_widths": [ 13.685, 13.482, 15.856, 15.491 ], "simple_Rise": 3.131, "simple_Twist": 33.083, "simple_hRise": 2.863, "simple_hTwist": 34.696 }, { "index": 67, "nt1": "///I/67", "nt2": "///J/131", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.206, -0.526, -7.977, 3.415, 2.343 ], "step_params": [ -0.487, -0.046, 3.109, -2.513, 10.140, 36.222 ], "heli_params": [ -1.329, 0.443, 3.014, 15.906, 3.942, 37.650 ], "bp2_params": [ 0.070, -0.126, -0.322, -7.067, 3.859, 0.738 ], "groove_widths": [ 13.979, 13.639, 16.435, 15.876 ], "simple_Rise": 3.109, "simple_Twist": 36.830, "simple_hRise": 3.018, "simple_hTwist": 38.234 }, { "index": 68, "nt1": "///I/68", "nt2": "///J/130", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.070, -0.126, -0.322, -7.067, 3.859, 0.738 ], "step_params": [ 0.124, -0.341, 3.288, -0.946, 3.253, 29.695 ], "heli_params": [ -1.335, -0.436, 3.227, 6.322, 1.839, 29.884 ], "bp2_params": [ -0.195, -0.172, -0.598, -1.944, 0.926, -0.345 ], "groove_widths": [ 13.778, 13.546, 18.615, 17.574 ], "simple_Rise": 3.288, "simple_Twist": 31.203, "simple_hRise": 3.231, "simple_hTwist": 31.382 }, { "index": 69, "nt1": "///I/69", "nt2": "///J/129", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.172, -0.598, -1.944, 0.926, -0.345 ], "step_params": [ -0.213, -0.351, 3.050, -0.350, 2.523, 33.701 ], "heli_params": [ -0.982, 0.314, 3.019, 4.344, 0.603, 33.794 ], "bp2_params": [ 0.199, -0.184, -0.535, 4.974, -0.893, 0.453 ], "groove_widths": [ 13.194, 13.113, 17.075, 16.651 ], "simple_Rise": 3.050, "simple_Twist": 31.562, "simple_hRise": 3.016, "simple_hTwist": 31.662 }, { "index": 70, "nt1": "///I/70", "nt2": "///J/128", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, -0.184, -0.535, 4.974, -0.893, 0.453 ], "step_params": [ -0.081, -0.232, 3.194, 0.775, 3.231, 31.260 ], "heli_params": [ -1.017, 0.292, 3.152, 5.974, -1.434, 31.432 ], "bp2_params": [ -0.039, -0.213, -0.509, 8.957, -6.922, 1.349 ], "groove_widths": [ 12.421, 12.396, 17.919, 17.848 ], "simple_Rise": 3.194, "simple_Twist": 32.870, "simple_hRise": 3.155, "simple_hTwist": 33.033 }, { "index": 71, "nt1": "///I/71", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.039, -0.213, -0.509, 8.957, -6.922, 1.349 ], "step_params": [ 1.044, 1.359, 3.462, 6.697, 0.045, 42.534 ], "heli_params": [ 1.847, -0.707, 3.580, 0.061, -9.163, 43.034 ], "bp2_params": [ 0.273, -0.116, -0.393, 5.789, -7.199, 4.006 ], "groove_widths": [ 10.661, 10.601, 15.980, 15.951 ], "simple_Rise": 3.462, "simple_Twist": 40.559, "simple_hRise": 3.584, "simple_hTwist": 41.085 }, { "index": 72, "nt1": "///I/72", "nt2": "///J/126", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.273, -0.116, -0.393, 5.789, -7.199, 4.006 ], "step_params": [ -0.933, 0.652, 3.437, -0.898, 1.167, 33.102 ], "heli_params": [ 0.935, 1.477, 3.481, 2.048, 1.575, 33.134 ], "bp2_params": [ -0.061, -0.170, -0.336, 3.253, -16.610, 1.806 ], "groove_widths": [ 9.834, 9.685, 16.721, 16.420 ], "simple_Rise": 3.437, "simple_Twist": 35.101, "simple_hRise": 3.478, "simple_hTwist": 35.131 }, { "index": 73, "nt1": "///I/73", "nt2": "///J/125", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.061, -0.170, -0.336, 3.253, -16.610, 1.806 ], "step_params": [ 0.705, 1.875, 3.614, -0.030, -7.472, 42.769 ], "heli_params": [ 3.305, -0.957, 3.257, -10.153, 0.040, 43.386 ], "bp2_params": [ 0.109, -0.108, -0.227, -5.765, -6.481, 1.999 ], "groove_widths": [ 10.381, 10.181, 18.531, 18.106 ], "simple_Rise": 3.614, "simple_Twist": 41.478, "simple_hRise": 3.243, "simple_hTwist": 42.116 }, { "index": 74, "nt1": "///I/74", "nt2": "///J/124", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.108, -0.227, -5.765, -6.481, 1.999 ], "step_params": [ -0.625, 0.760, 3.543, -3.491, 0.635, 34.523 ], "heli_params": [ 1.169, 0.462, 3.600, 1.067, 5.863, 34.700 ], "bp2_params": [ -0.209, -0.148, -0.500, -11.522, -4.215, 0.936 ], "groove_widths": [ 11.482, 11.367, 18.924, 18.790 ], "simple_Rise": 3.543, "simple_Twist": 36.312, "simple_hRise": 3.598, "simple_hTwist": 36.479 }, { "index": 75, "nt1": "///I/75", "nt2": "///J/123", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.209, -0.148, -0.500, -11.522, -4.215, 0.936 ], "step_params": [ -0.028, -0.399, 3.234, -6.813, 2.703, 31.807 ], "heli_params": [ -1.174, -1.116, 3.129, 4.851, 12.228, 32.619 ], "bp2_params": [ 0.196, -0.118, 0.096, -5.426, 0.199, 1.023 ], "groove_widths": [ 13.158, 13.072, 19.725, 19.668 ], "simple_Rise": 3.234, "simple_Twist": 29.646, "simple_hRise": 3.115, "simple_hTwist": 30.519 }, { "index": 76, "nt1": "///I/76", "nt2": "///J/122", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.118, 0.096, -5.426, 0.199, 1.023 ], "step_params": [ -0.432, -0.831, 2.964, -2.988, 5.405, 30.789 ], "heli_params": [ -2.441, 0.298, 2.809, 10.053, 5.558, 31.388 ], "bp2_params": [ 0.038, -0.118, 0.413, -2.730, 0.554, 0.659 ], "groove_widths": [ 13.919, 13.612, 19.747, 19.287 ], "simple_Rise": 2.964, "simple_Twist": 31.643, "simple_hRise": 2.815, "simple_hTwist": 32.225 }, { "index": 77, "nt1": "///I/77", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, -0.118, 0.413, -2.730, 0.554, 0.659 ], "step_params": [ 0.174, -1.301, 3.396, -2.451, 4.153, 31.793 ], "heli_params": [ -3.102, -0.757, 3.183, 7.526, 4.442, 32.148 ], "bp2_params": [ 0.203, -0.155, 0.456, -2.158, 1.530, 0.121 ], "groove_widths": [ 14.205, 13.701, 19.105, 17.596 ], "simple_Rise": 3.396, "simple_Twist": 30.929, "simple_hRise": 3.176, "simple_hTwist": 31.294 }, { "index": 78, "nt1": "///I/78", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.155, 0.456, -2.158, 1.530, 0.121 ], "step_params": [ -0.305, -1.007, 3.119, -1.907, 5.901, 30.546 ], "heli_params": [ -2.920, 0.230, 2.891, 11.058, 3.573, 31.155 ], "bp2_params": [ 0.173, -0.227, 0.682, 0.535, 3.254, 0.506 ], "groove_widths": [ 14.654, 14.104, 19.369, 17.866 ], "simple_Rise": 3.119, "simple_Twist": 30.620, "simple_hRise": 2.892, "simple_hTwist": 31.227 }, { "index": 79, "nt1": "///I/79", "nt2": "///J/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, -0.227, 0.682, 0.535, 3.254, 0.506 ], "step_params": [ -0.196, -0.539, 3.004, 0.284, 4.697, 31.723 ], "heli_params": [ -1.742, 0.401, 2.895, 8.534, -0.515, 32.061 ], "bp2_params": [ -0.195, -0.216, 0.566, 4.379, 3.346, -0.211 ], "groove_widths": [ 14.806, 14.442, 18.565, 16.992 ], "simple_Rise": 3.004, "simple_Twist": 33.850, "simple_hRise": 2.904, "simple_hTwist": 34.167 }, { "index": 80, "nt1": "///I/80", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.216, 0.566, 4.379, 3.346, -0.211 ], "step_params": [ -0.105, -0.702, 3.421, 2.473, 3.312, 32.927 ], "heli_params": [ -1.805, 0.614, 3.320, 5.815, -4.342, 33.178 ], "bp2_params": [ 0.154, -0.327, 0.901, 6.974, -3.184, -0.956 ], "groove_widths": [ 14.391, 14.270, 16.890, 16.489 ], "simple_Rise": 3.421, "simple_Twist": 31.036, "simple_hRise": 3.312, "simple_hTwist": 31.304 }, { "index": 81, "nt1": "///I/81", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.327, 0.901, 6.974, -3.184, -0.956 ], "step_params": [ -0.214, -0.116, 3.317, 6.127, 0.478, 33.186 ], "heli_params": [ -0.278, 1.371, 3.226, 0.829, -10.613, 33.734 ], "bp2_params": [ -0.117, -0.089, -0.119, 7.621, -9.279, -4.335 ], "groove_widths": [ 13.277, 13.246, 17.722, 17.722 ], "simple_Rise": 3.317, "simple_Twist": 34.941, "simple_hRise": 3.233, "simple_hTwist": 35.461 }, { "index": 82, "nt1": "///I/82", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.089, -0.119, 7.621, -9.279, -4.335 ], "step_params": [ 1.253, 0.903, 3.357, 7.964, 1.078, 37.813 ], "heli_params": [ 1.223, -0.844, 3.562, 1.641, -12.122, 38.627 ], "bp2_params": [ -0.109, -0.057, -0.258, 3.833, -10.015, 3.354 ], "groove_widths": [ 11.385, 11.245, 17.674, 17.625 ], "simple_Rise": 3.357, "simple_Twist": 37.634, "simple_hRise": 3.563, "simple_hTwist": 38.452 }, { "index": 83, "nt1": "///I/83", "nt2": "///J/115", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.057, -0.258, 3.833, -10.015, 3.354 ], "step_params": [ -0.753, 1.810, 3.547, -1.064, -3.574, 39.507 ], "heli_params": [ 3.110, 0.978, 3.396, -5.273, 1.570, 39.675 ], "bp2_params": [ 0.046, -0.217, -0.700, -2.616, -12.925, 3.623 ], "groove_widths": [ 10.135, 9.870, 17.645, 17.320 ], "simple_Rise": 3.547, "simple_Twist": 38.388, "simple_hRise": 3.391, "simple_hTwist": 38.562 }, { "index": 84, "nt1": "///I/84", "nt2": "///J/114", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, -0.217, -0.700, -2.616, -12.925, 3.623 ], "step_params": [ -0.604, 0.722, 3.375, -3.434, 0.635, 36.532 ], "heli_params": [ 1.056, 0.470, 3.427, 1.011, 5.463, 36.693 ], "bp2_params": [ 0.034, -0.207, -0.970, -8.378, -15.417, 2.189 ], "groove_widths": [ 9.463, 9.301, 17.835, 17.571 ], "simple_Rise": 3.375, "simple_Twist": 36.307, "simple_hRise": 3.427, "simple_hTwist": 36.469 }, { "index": 85, "nt1": "///I/85", "nt2": "///J/113", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.207, -0.970, -8.378, -15.417, 2.189 ], "step_params": [ -0.315, 0.370, 3.428, -3.951, 0.388, 38.937 ], "heli_params": [ 0.503, -0.028, 3.446, 0.581, 5.909, 39.131 ], "bp2_params": [ 0.142, -0.352, -1.332, -9.418, -10.461, 3.797 ], "groove_widths": [ 9.520, 9.484, 16.840, 16.789 ], "simple_Rise": 3.428, "simple_Twist": 38.498, "simple_hRise": 3.446, "simple_hTwist": 38.694 }, { "index": 86, "nt1": "///I/86", "nt2": "///J/112", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.142, -0.352, -1.332, -9.418, -10.461, 3.797 ], "step_params": [ 0.122, -0.180, 3.348, -5.658, -1.059, 36.766 ], "heli_params": [ -0.139, -0.960, 3.297, -1.667, 8.903, 37.198 ], "bp2_params": [ 0.226, -0.285, -0.794, -6.388, -5.301, 4.784 ], "groove_widths": [ 11.155, 11.085, 16.266, 16.150 ], "simple_Rise": 3.348, "simple_Twist": 36.364, "simple_hRise": 3.296, "simple_hTwist": 36.802 }, { "index": 87, "nt1": "///I/87", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.285, -0.794, -6.388, -5.301, 4.784 ], "step_params": [ 0.109, 0.267, 3.384, -4.048, 3.315, 33.374 ], "heli_params": [ -0.098, -0.867, 3.358, 5.729, 6.996, 33.770 ], "bp2_params": [ -0.198, -0.124, 0.140, -7.531, 0.473, 1.430 ], "groove_widths": [ 13.084, 12.886, 16.447, 16.085 ], "simple_Rise": 3.384, "simple_Twist": 35.999, "simple_hRise": 3.363, "simple_hTwist": 36.365 }, { "index": 88, "nt1": "///I/88", "nt2": "///J/110", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.124, 0.140, -7.531, 0.473, 1.430 ], "step_params": [ 0.742, -0.540, 3.272, -1.916, 5.857, 35.415 ], "heli_params": [ -1.696, -1.471, 3.103, 9.539, 3.120, 35.930 ], "bp2_params": [ 0.257, -0.165, 0.633, -7.537, 5.623, 1.498 ], "groove_widths": [ 14.062, 13.736, 17.436, 16.175 ], "simple_Rise": 3.272, "simple_Twist": 32.906, "simple_hRise": 3.086, "simple_hTwist": 33.462 }, { "index": 89, "nt1": "///I/89", "nt2": "///J/109", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.257, -0.165, 0.633, -7.537, 5.623, 1.498 ], "step_params": [ -0.325, -0.577, 2.855, 0.138, 7.929, 34.311 ], "heli_params": [ -1.964, 0.555, 2.658, 13.222, -0.231, 35.189 ], "bp2_params": [ 0.152, -0.278, 0.829, -2.959, 2.024, -1.830 ], "groove_widths": [ 14.386, 14.068, 16.826, 16.126 ], "simple_Rise": 2.855, "simple_Twist": 34.714, "simple_hRise": 2.661, "simple_hTwist": 35.581 }, { "index": 90, "nt1": "///I/90", "nt2": "///J/108", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.278, 0.829, -2.959, 2.024, -1.830 ], "step_params": [ 0.424, -0.749, 2.953, 0.654, 3.434, 31.912 ], "heli_params": [ -1.905, -0.661, 2.867, 6.223, -1.185, 32.098 ], "bp2_params": [ 0.194, -0.199, 0.704, 8.175, 1.069, 1.335 ], "groove_widths": [ 14.029, 13.882, 18.589, 18.505 ], "simple_Rise": 2.953, "simple_Twist": 31.727, "simple_hRise": 2.866, "simple_hTwist": 31.914 }, { "index": 91, "nt1": "///I/91", "nt2": "///J/107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.199, 0.704, 8.175, 1.069, 1.335 ], "step_params": [ 0.498, 0.401, 3.166, 2.615, -0.046, 34.937 ], "heli_params": [ 0.672, -0.445, 3.193, -0.077, -4.349, 35.031 ], "bp2_params": [ -0.162, -0.134, 0.599, 8.357, -6.717, 1.458 ], "groove_widths": [ 12.087, 12.041, 16.969, 16.960 ], "simple_Rise": 3.166, "simple_Twist": 37.082, "simple_hRise": 3.192, "simple_hTwist": 37.171 }, { "index": 92, "nt1": "///I/92", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.162, -0.134, 0.599, 8.357, -6.717, 1.458 ], "step_params": [ -0.947, 0.605, 3.918, 0.303, -1.341, 35.459 ], "heli_params": [ 1.226, 1.607, 3.885, -2.201, -0.497, 35.484 ], "bp2_params": [ -0.021, -0.173, 0.354, 7.822, -17.129, 0.087 ], "groove_widths": [ 10.825, 10.701, 17.478, 17.210 ], "simple_Rise": 3.918, "simple_Twist": 35.022, "simple_hRise": 3.885, "simple_hTwist": 35.048 }, { "index": 93, "nt1": "///I/93", "nt2": "///J/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.173, 0.354, 7.822, -17.129, 0.087 ], "step_params": [ -0.167, 1.942, 3.557, 3.970, -3.338, 44.380 ], "heli_params": [ 2.880, 0.606, 3.383, -4.401, -5.235, 44.667 ], "bp2_params": [ -0.027, -0.164, -0.692, -5.936, -20.885, 1.488 ], "groove_widths": [ 10.056, 9.716, 17.225, 16.402 ], "simple_Rise": 3.557, "simple_Twist": 43.468, "simple_hRise": 3.379, "simple_hTwist": 43.761 }, { "index": 94, "nt1": "///I/94", "nt2": "///J/104", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.164, -0.692, -5.936, -20.885, 1.488 ], "step_params": [ -0.463, 1.697, 3.422, -5.166, -11.105, 42.011 ], "heli_params": [ 3.338, 0.130, 2.938, -15.109, 7.028, 43.682 ], "bp2_params": [ 0.221, -0.249, -0.708, -8.444, -7.577, 2.262 ], "groove_widths": [ 10.194, 9.771, 17.113, 16.797 ], "simple_Rise": 3.422, "simple_Twist": 40.881, "simple_hRise": 2.920, "simple_hTwist": 42.601 }, { "index": 95, "nt1": "///I/95", "nt2": "///J/103", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.221, -0.249, -0.708, -8.444, -7.577, 2.262 ], "step_params": [ -0.109, 1.486, 3.474, -3.102, 2.023, 34.999 ], "heli_params": [ 2.134, -0.316, 3.548, 3.353, 5.141, 35.188 ], "bp2_params": [ -0.201, -0.141, -0.625, -9.653, 0.806, 1.530 ], "groove_widths": [ 12.066, 11.872, 16.441, 16.373 ], "simple_Rise": 3.474, "simple_Twist": 37.581, "simple_hRise": 3.544, "simple_hTwist": 37.757 }, { "index": 96, "nt1": "///I/96", "nt2": "///J/102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, -0.141, -0.625, -9.653, 0.806, 1.530 ], "step_params": [ 0.215, -0.004, 2.982, -1.262, 4.183, 31.415 ], "heli_params": [ -0.709, -0.604, 2.946, 7.679, 2.316, 31.710 ], "bp2_params": [ 0.217, -0.174, -0.495, -1.874, 0.542, 2.500 ], "groove_widths": [ 12.831, 12.759, 16.071, 16.071 ], "simple_Rise": 2.982, "simple_Twist": 29.033, "simple_hRise": 2.941, "simple_hTwist": 29.353 }, { "index": 97, "nt1": "///I/97", "nt2": "///J/101", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.174, -0.495, -1.874, 0.542, 2.500 ], "step_params": [ 0.391, -0.089, 3.088, -3.658, 5.504, 37.703 ], "heli_params": [ -0.783, -1.028, 2.996, 8.438, 5.607, 38.257 ], "bp2_params": [ -0.213, -0.138, 0.468, -3.613, 1.407, 0.948 ], "groove_widths": [ 13.160, 12.979, 17.378, 17.077 ], "simple_Rise": 3.088, "simple_Twist": 40.106, "simple_hRise": 3.005, "simple_hTwist": 40.624 }, { "index": 98, "nt1": "///I/98", "nt2": "///J/100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.213, -0.138, 0.468, -3.613, 1.407, 0.948 ], "step_params": [ 0.144, -0.784, 3.083, -2.403, 4.047, 33.721 ], "heli_params": [ -1.937, -0.602, 2.955, 6.935, 4.118, 34.039 ], "bp2_params": [ 0.223, -0.284, 0.864, -0.313, 2.951, 1.654 ], "groove_widths": [ 13.755, 13.532, 18.009, 17.334 ], "simple_Rise": 3.083, "simple_Twist": 31.266, "simple_hRise": 2.942, "simple_hTwist": 31.610 }, { "index": 99, "nt1": "///I/99", "nt2": "///J/99", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.284, 0.864, -0.313, 2.951, 1.654 ], "step_params": [ -0.208, -0.960, 3.060, 1.986, 3.519, 30.151 ], "heli_params": [ -2.475, 0.762, 2.913, 6.726, -3.797, 30.415 ], "bp2_params": [ -0.115, -0.233, 0.830, 2.901, -1.003, -2.061 ], "groove_widths": [ 13.838, 13.621, 18.202, 17.139 ], "simple_Rise": 3.060, "simple_Twist": 32.158, "simple_hRise": 2.924, "simple_hTwist": 32.405 }, { "index": 100, "nt1": "///I/100", "nt2": "///J/98", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.233, 0.830, 2.901, -1.003, -2.061 ], "step_params": [ 0.419, -0.286, 3.059, 2.253, 0.837, 36.881 ], "heli_params": [ -0.556, -0.375, 3.072, 1.321, -3.557, 36.956 ], "bp2_params": [ -0.245, -0.161, 0.579, 3.027, 3.255, 2.531 ], "groove_widths": [ 13.298, 13.099, 18.185, 17.580 ], "simple_Rise": 3.059, "simple_Twist": 37.462, "simple_hRise": 3.072, "simple_hTwist": 37.537 }, { "index": 101, "nt1": "///I/101", "nt2": "///J/97", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.161, 0.579, 3.027, 3.255, 2.531 ], "step_params": [ -0.843, -0.621, 3.179, 2.738, 2.537, 30.074 ], "heli_params": [ -1.676, 2.139, 3.030, 4.866, -5.252, 30.300 ], "bp2_params": [ -0.063, -0.157, -0.042, 8.780, -2.097, -1.864 ], "groove_widths": [ 12.395, 12.308, 16.676, 16.671 ], "simple_Rise": 3.179, "simple_Twist": 29.358, "simple_hRise": 3.026, "simple_hTwist": 29.589 }, { "index": 102, "nt1": "///I/102", "nt2": "///J/96", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.157, -0.042, 8.780, -2.097, -1.864 ], "step_params": [ 0.579, 0.565, 3.359, 4.219, 2.839, 38.159 ], "heli_params": [ 0.489, -0.332, 3.433, 4.319, -6.418, 38.484 ], "bp2_params": [ 0.235, -0.169, -0.119, 11.053, -6.923, 0.567 ], "groove_widths": [ 10.929, 10.809, 17.582, 17.538 ], "simple_Rise": 3.359, "simple_Twist": 36.439, "simple_hRise": 3.435, "simple_hTwist": 36.781 }, { "index": 103, "nt1": "///I/103", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.169, -0.119, 11.053, -6.923, 0.567 ], "step_params": [ 0.077, 1.556, 3.720, 3.817, -5.371, 42.118 ], "heli_params": [ 2.742, 0.322, 3.499, -7.418, -5.272, 42.607 ], "bp2_params": [ 0.265, -0.179, -0.404, 1.369, -12.312, 3.728 ], "groove_widths": [ 9.741, 9.374, 17.335, 17.056 ], "simple_Rise": 3.720, "simple_Twist": 41.747, "simple_hRise": 3.496, "simple_hTwist": 42.241 }, { "index": 104, "nt1": "///I/104", "nt2": "///J/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.265, -0.179, -0.404, 1.369, -12.312, 3.728 ], "step_params": [ -0.102, 2.003, 3.585, 0.029, -4.371, 36.728 ], "heli_params": [ 3.783, 0.166, 3.332, -6.906, -0.046, 36.978 ], "bp2_params": [ 0.241, -0.243, -0.570, -6.016, -12.523, 4.780 ], "groove_widths": [ 10.252, 9.905, 17.384, 16.832 ], "simple_Rise": 3.585, "simple_Twist": 36.648, "simple_hRise": 3.332, "simple_hTwist": 36.899 }, { "index": 105, "nt1": "///I/105", "nt2": "///J/93", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.241, -0.243, -0.570, -6.016, -12.523, 4.780 ], "step_params": [ 0.089, 1.942, 3.590, -3.896, -3.599, 40.977 ], "heli_params": [ 3.167, -0.575, 3.393, -5.116, 5.537, 41.305 ], "bp2_params": [ 0.163, -0.154, -0.465, -11.024, -4.432, 2.318 ], "groove_widths": [ 10.861, 10.751, 16.810, 16.509 ], "simple_Rise": 3.590, "simple_Twist": 41.418, "simple_hRise": 3.395, "simple_hTwist": 41.742 }, { "index": 106, "nt1": "///I/106", "nt2": "///J/92", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.163, -0.154, -0.465, -11.024, -4.432, 2.318 ], "step_params": [ -0.578, 0.204, 3.395, -5.636, 3.569, 35.483 ], "heli_params": [ -0.204, 0.091, 3.447, 5.792, 9.148, 36.085 ], "bp2_params": [ 0.162, -0.117, 0.023, -7.806, 2.086, 0.193 ], "groove_widths": [ 12.169, 12.130, 17.472, 17.452 ], "simple_Rise": 3.395, "simple_Twist": 35.706, "simple_hRise": 3.447, "simple_hTwist": 36.304 }, { "index": 107, "nt1": "///I/107", "nt2": "///J/91", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.117, 0.023, -7.806, 2.086, 0.193 ], "step_params": [ 0.455, 0.122, 3.035, -2.020, 5.863, 34.426 ], "heli_params": [ -0.617, -1.039, 2.984, 9.807, 3.379, 34.963 ], "bp2_params": [ -0.234, -0.176, 0.482, -4.048, 7.006, 2.875 ], "groove_widths": [ 14.235, 14.105, 17.778, 17.771 ], "simple_Rise": 3.035, "simple_Twist": 36.688, "simple_hRise": 2.990, "simple_hTwist": 37.191 }, { "index": 108, "nt1": "///I/108", "nt2": "///J/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.176, 0.482, -4.048, 7.006, 2.875 ], "step_params": [ 0.535, -0.623, 3.196, -2.515, 6.412, 30.929 ], "heli_params": [ -2.269, -1.422, 2.959, 11.840, 4.645, 31.669 ], "bp2_params": [ 0.243, -0.276, 0.878, 0.475, 5.629, 4.152 ], "groove_widths": [ 14.681, 14.388, 17.202, 16.354 ], "simple_Rise": 3.196, "simple_Twist": 28.228, "simple_hRise": 2.929, "simple_hTwist": 29.040 }, { "index": 109, "nt1": "///I/109", "nt2": "///J/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.276, 0.878, 0.475, 5.629, 4.152 ], "step_params": [ -0.641, -0.249, 2.989, -1.145, 3.296, 35.642 ], "heli_params": [ -0.838, 0.892, 2.974, 5.368, 1.865, 35.807 ], "bp2_params": [ -0.211, -0.232, 0.885, 3.118, 0.955, 2.094 ], "groove_widths": [ 13.944, 13.584, 17.682, 16.401 ], "simple_Rise": 2.989, "simple_Twist": 38.104, "simple_hRise": 2.976, "simple_hTwist": 38.258 }, { "index": 110, "nt1": "///I/110", "nt2": "///J/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.232, 0.885, 3.118, 0.955, 2.094 ], "step_params": [ -0.451, -1.061, 3.211, 3.399, 1.430, 32.726 ], "heli_params": [ -2.107, 1.356, 3.101, 2.529, -6.008, 32.927 ], "bp2_params": [ -0.119, -0.225, 0.377, 5.446, -6.708, -1.084 ], "groove_widths": [ 12.516, 12.268, 17.105, 16.685 ], "simple_Rise": 3.211, "simple_Twist": 32.414, "simple_hRise": 3.100, "simple_hTwist": 32.617 }, { "index": 111, "nt1": "///I/111", "nt2": "///J/87", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.119, -0.225, 0.377, 5.446, -6.708, -1.084 ], "step_params": [ -0.015, -0.430, 3.094, 5.636, -0.869, 37.419 ], "heli_params": [ -0.557, 0.710, 3.069, -1.345, -8.723, 37.836 ], "bp2_params": [ -0.077, -0.174, -0.318, 6.812, -12.218, 0.793 ], "groove_widths": [ 10.793, 10.716, 16.809, 16.703 ], "simple_Rise": 3.094, "simple_Twist": 37.299, "simple_hRise": 3.068, "simple_hTwist": 37.717 }, { "index": 112, "nt1": "///I/112", "nt2": "///J/86", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.174, -0.318, 6.812, -12.218, 0.793 ], "step_params": [ 0.185, 0.013, 3.447, 3.430, 0.364, 38.580 ], "heli_params": [ -0.028, 0.166, 3.450, 0.550, -5.179, 38.728 ], "bp2_params": [ -0.040, -0.261, -0.773, 1.363, -15.002, 3.034 ], "groove_widths": [ 9.706, 9.664, 17.575, 17.540 ], "simple_Rise": 3.447, "simple_Twist": 38.243, "simple_hRise": 3.450, "simple_hTwist": 38.392 }, { "index": 113, "nt1": "///I/113", "nt2": "///J/85", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.261, -0.773, 1.363, -15.002, 3.034 ], "step_params": [ -0.357, 0.456, 3.351, 1.176, 2.287, 32.626 ], "heli_params": [ 0.404, 0.841, 3.360, 4.064, -2.089, 32.724 ], "bp2_params": [ -0.006, -0.209, -0.772, -4.014, -14.652, 1.943 ], "groove_widths": [ 9.791, 9.579, 18.199, 17.693 ], "simple_Rise": 3.351, "simple_Twist": 32.332, "simple_hRise": 3.360, "simple_hTwist": 32.432 }, { "index": 114, "nt1": "///I/114", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.006, -0.209, -0.772, -4.014, -14.652, 1.943 ], "step_params": [ 0.159, 2.087, 3.798, -3.006, -1.782, 44.373 ], "heli_params": [ 2.944, -0.527, 3.698, -2.355, 3.973, 44.504 ], "bp2_params": [ 0.232, -0.246, -1.295, -9.065, -8.185, -0.551 ], "groove_widths": [ 10.177, 9.809, 18.393, 18.109 ], "simple_Rise": 3.798, "simple_Twist": 42.905, "simple_hRise": 3.694, "simple_hTwist": 43.041 }, { "index": 115, "nt1": "///I/115", "nt2": "///J/83", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.232, -0.246, -1.295, -9.065, -8.185, -0.551 ], "step_params": [ -1.571, 1.811, 3.216, -7.352, -4.326, 38.121 ], "heli_params": [ 3.233, 1.466, 3.236, -6.524, 11.087, 39.029 ], "bp2_params": [ 0.197, -0.321, -1.251, -16.003, -10.327, 2.122 ], "groove_widths": [ 11.260, 11.041, 17.806, 17.617 ], "simple_Rise": 3.216, "simple_Twist": 37.886, "simple_hRise": 3.236, "simple_hTwist": 38.800 }, { "index": 116, "nt1": "///I/116", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.321, -1.251, -16.003, -10.327, 2.122 ], "step_params": [ 0.080, 0.294, 3.197, -6.084, 3.492, 34.077 ], "heli_params": [ -0.031, -1.044, 3.150, 5.881, 10.248, 34.770 ], "bp2_params": [ 0.146, -0.283, -0.784, -9.336, -0.549, 1.077 ], "groove_widths": [ 13.149, 13.105, 17.376, 17.366 ], "simple_Rise": 3.197, "simple_Twist": 34.718, "simple_hRise": 3.152, "simple_hTwist": 35.399 }, { "index": 117, "nt1": "///I/117", "nt2": "///J/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.146, -0.283, -0.784, -9.336, -0.549, 1.077 ], "step_params": [ 0.253, -0.067, 3.358, -4.570, 6.103, 30.118 ], "heli_params": [ -1.321, -1.368, 3.211, 11.513, 8.621, 31.046 ], "bp2_params": [ 0.197, -0.160, -0.084, -5.574, 4.429, -0.302 ], "groove_widths": [ 14.273, 14.109, 16.463, 15.928 ], "simple_Rise": 3.358, "simple_Twist": 30.049, "simple_hRise": 3.210, "simple_hTwist": 30.979 }, { "index": 118, "nt1": "///I/118", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.160, -0.084, -5.574, 4.429, -0.302 ], "step_params": [ 0.273, -0.175, 2.997, -2.291, 6.775, 30.320 ], "heli_params": [ -1.501, -0.906, 2.864, 12.731, 4.305, 31.132 ], "bp2_params": [ -0.226, -0.168, 0.418, -1.599, 5.694, 1.034 ], "groove_widths": [ 14.972, 14.646, 18.131, 16.508 ], "simple_Rise": 2.997, "simple_Twist": 32.718, "simple_hRise": 2.879, "simple_hTwist": 33.470 }, { "index": 119, "nt1": "///I/119", "nt2": "///J/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.168, 0.418, -1.599, 5.694, 1.034 ], "step_params": [ 0.612, -1.012, 3.153, 0.289, 6.673, 32.799 ], "heli_params": [ -2.788, -1.019, 2.902, 11.667, -0.506, 33.454 ], "bp2_params": [ 0.215, -0.198, 0.531, 1.739, 3.906, 0.745 ], "groove_widths": [ 15.027, 14.540, 19.216, 17.697 ], "simple_Rise": 3.153, "simple_Twist": 30.315, "simple_hRise": 2.876, "simple_hTwist": 31.025 }, { "index": 120, "nt1": "///I/120", "nt2": "///J/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.215, -0.198, 0.531, 1.739, 3.906, 0.745 ], "step_params": [ 0.302, -1.429, 3.198, 2.104, 6.383, 29.363 ], "heli_params": [ -3.971, -0.178, 2.845, 12.389, -4.083, 30.106 ], "bp2_params": [ 0.179, -0.255, 0.892, 1.258, 1.558, 0.352 ], "groove_widths": [ 14.457, 14.005, 19.171, 17.690 ], "simple_Rise": 3.198, "simple_Twist": 29.548, "simple_hRise": 2.848, "simple_hTwist": 30.286 }, { "index": 121, "nt1": "///I/121", "nt2": "///J/77", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.255, 0.892, 1.258, 1.558, 0.352 ], "step_params": [ -0.165, -0.922, 2.844, 1.400, 5.817, 32.075 ], "heli_params": [ -2.495, 0.500, 2.631, 10.415, -2.507, 32.614 ], "bp2_params": [ 0.187, -0.209, 0.805, 2.309, -3.016, -2.902 ], "groove_widths": [ 13.896, 13.708, 19.721, 19.393 ], "simple_Rise": 2.844, "simple_Twist": 32.030, "simple_hRise": 2.631, "simple_hTwist": 32.569 }, { "index": 122, "nt1": "///I/122", "nt2": "///J/76", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.187, -0.209, 0.805, 2.309, -3.016, -2.902 ], "step_params": [ -0.479, -0.447, 3.229, 1.802, 1.509, 35.609 ], "heli_params": [ -0.944, 1.037, 3.181, 2.465, -2.943, 35.684 ], "bp2_params": [ 0.167, -0.151, 0.516, 4.536, -8.070, -2.379 ], "groove_widths": [ 12.910, 12.866, 19.593, 19.578 ], "simple_Rise": 3.229, "simple_Twist": 35.701, "simple_hRise": 3.181, "simple_hTwist": 35.776 }, { "index": 123, "nt1": "///I/123", "nt2": "///J/75", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.151, 0.516, 4.536, -8.070, -2.379 ], "step_params": [ 0.754, 0.240, 3.512, 3.537, -2.062, 31.096 ], "heli_params": [ 0.866, -0.672, 3.551, -3.826, -6.562, 31.358 ], "bp2_params": [ -0.171, -0.135, 0.331, 3.185, -9.438, 1.582 ], "groove_widths": [ 11.641, 11.535, 17.718, 17.604 ], "simple_Rise": 3.512, "simple_Twist": 33.106, "simple_hRise": 3.551, "simple_hTwist": 33.351 }, { "index": 124, "nt1": "///I/124", "nt2": "///J/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.135, 0.331, 3.185, -9.438, 1.582 ], "step_params": [ -1.027, 1.604, 3.621, -1.184, -2.619, 42.026 ], "heli_params": [ 2.528, 1.295, 3.545, -3.647, 1.649, 42.120 ], "bp2_params": [ -0.296, -0.156, -0.452, -8.177, -14.967, 3.960 ], "groove_widths": [ 10.686, 10.493, 17.218, 16.950 ], "simple_Rise": 3.621, "simple_Twist": 42.288, "simple_hRise": 3.546, "simple_hTwist": 42.381 }, { "index": 125, "nt1": "///I/125", "nt2": "///J/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.296, -0.156, -0.452, -8.177, -14.967, 3.960 ], "step_params": [ 0.309, 1.336, 3.479, 1.591, 0.786, 35.149 ], "heli_params": [ 2.085, -0.258, 3.517, 1.301, -2.633, 35.192 ], "bp2_params": [ -0.276, -0.255, -1.164, -13.003, -10.250, 5.007 ], "groove_widths": [ 10.096, 9.929, 17.400, 17.120 ], "simple_Rise": 3.479, "simple_Twist": 35.045, "simple_hRise": 3.517, "simple_hTwist": 35.089 }, { "index": 126, "nt1": "///I/126", "nt2": "///J/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, -0.255, -1.164, -13.003, -10.250, 5.007 ], "step_params": [ -1.502, 1.710, 3.334, -6.279, 0.651, 37.586 ], "heli_params": [ 2.532, 1.457, 3.558, 1.002, 9.662, 38.094 ], "bp2_params": [ -0.191, -0.393, -1.599, -15.333, -5.896, 3.214 ], "groove_widths": [ 11.253, 11.170, 16.413, 16.320 ], "simple_Rise": 3.334, "simple_Twist": 37.207, "simple_hRise": 3.560, "simple_hTwist": 37.720 }, { "index": 127, "nt1": "///I/127", "nt2": "///J/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.393, -1.599, -15.333, -5.896, 3.214 ], "step_params": [ 0.041, 0.640, 3.228, -5.365, 5.718, 35.323 ], "heli_params": [ 0.224, -0.824, 3.248, 9.282, 8.709, 36.156 ], "bp2_params": [ 0.224, -0.422, -1.441, -8.998, 1.297, -1.636 ], "groove_widths": [ 13.115, 13.090, 17.398, 17.336 ], "simple_Rise": 3.228, "simple_Twist": 33.120, "simple_hRise": 3.244, "simple_hTwist": 34.011 }, { "index": 128, "nt1": "///I/128", "nt2": "///J/70", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, -0.422, -1.441, -8.998, 1.297, -1.636 ], "step_params": [ 0.296, -0.304, 3.190, -5.078, 1.267, 29.850 ], "heli_params": [ -0.829, -1.557, 3.083, 2.435, 9.763, 30.295 ], "bp2_params": [ -0.232, -0.217, -0.665, -2.572, 4.045, -0.694 ], "groove_widths": [ 13.527, 13.421, 17.083, 16.763 ], "simple_Rise": 3.190, "simple_Twist": 32.505, "simple_hRise": 3.096, "simple_hTwist": 32.912 }, { "index": 129, "nt1": "///I/129", "nt2": "///J/69", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.232, -0.217, -0.665, -2.572, 4.045, -0.694 ], "step_params": [ 0.292, -0.658, 3.428, -0.777, 5.645, 32.992 ], "heli_params": [ -2.103, -0.640, 3.266, 9.848, 1.355, 33.467 ], "bp2_params": [ -0.087, -0.065, 0.010, -1.437, 6.824, -0.221 ], "groove_widths": [ 13.756, 13.495, 17.906, 17.075 ], "simple_Rise": 3.428, "simple_Twist": 32.238, "simple_hRise": 3.261, "simple_hTwist": 32.725 }, { "index": 130, "nt1": "///I/130", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.065, 0.010, -1.437, 6.824, -0.221 ], "step_params": [ 0.479, -0.072, 3.003, 0.542, 7.093, 39.576 ], "heli_params": [ -0.845, -0.640, 2.953, 10.374, -0.793, 40.185 ], "bp2_params": [ 0.109, -0.138, 0.301, 0.350, 4.274, 0.071 ], "groove_widths": [ 14.131, 13.806, 16.624, 15.927 ], "simple_Rise": 3.003, "simple_Twist": 38.251, "simple_hRise": 2.949, "simple_hTwist": 38.882 }, { "index": 131, "nt1": "///I/131", "nt2": "///J/67", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.138, 0.301, 0.350, 4.274, 0.071 ], "step_params": [ 0.313, -0.977, 3.091, 2.248, 1.254, 29.940 ], "heli_params": [ -2.128, -0.169, 3.063, 2.422, -4.340, 30.048 ], "bp2_params": [ 0.225, -0.140, 0.345, 9.917, 3.490, 0.999 ], "groove_widths": [ 13.553, 13.358, 16.678, 16.194 ], "simple_Rise": 3.091, "simple_Twist": 29.433, "simple_hRise": 3.062, "simple_hTwist": 29.542 }, { "index": 132, "nt1": "///I/132", "nt2": "///J/66", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.225, -0.140, 0.345, 9.917, 3.490, 0.999 ], "step_params": [ 0.816, -0.328, 3.379, 7.341, 0.886, 32.985 ], "heli_params": [ -0.716, -0.145, 3.466, 1.536, -12.730, 33.781 ], "bp2_params": [ -0.063, -0.145, 0.152, 8.882, -0.450, 1.128 ], "groove_widths": [ 12.261, 12.198, 17.201, 17.174 ], "simple_Rise": 3.379, "simple_Twist": 34.737, "simple_hRise": 3.465, "simple_hTwist": 35.492 }, { "index": 133, "nt1": "///I/133", "nt2": "///J/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.145, 0.152, 8.882, -0.450, 1.128 ], "step_params": [ -0.001, 0.552, 3.375, 1.480, -0.681, 38.085 ], "heli_params": [ 0.934, 0.195, 3.362, -1.043, -2.267, 38.118 ], "bp2_params": [ 0.191, -0.202, 0.599, 9.229, -9.322, -2.519 ], "groove_widths": [ 10.934, 10.786, 17.604, 17.225 ], "simple_Rise": 3.375, "simple_Twist": 36.797, "simple_hRise": 3.362, "simple_hTwist": 36.831 }, { "index": 134, "nt1": "///I/134", "nt2": "///J/64", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.191, -0.202, 0.599, 9.229, -9.322, -2.519 ], "step_params": [ 0.423, 1.583, 3.617, 4.740, -5.736, 42.015 ], "heli_params": [ 2.802, -0.065, 3.408, -7.925, -6.550, 42.639 ], "bp2_params": [ 0.207, -0.177, 0.248, -1.121, -15.595, 0.627 ], "groove_widths": [ 10.236, 9.927, 18.057, 17.321 ], "simple_Rise": 3.617, "simple_Twist": 41.625, "simple_hRise": 3.406, "simple_hTwist": 42.255 }, { "index": 135, "nt1": "///I/135", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.207, -0.177, 0.248, -1.121, -15.595, 0.627 ], "step_params": [ -0.495, 1.689, 3.592, -0.616, -4.352, 41.062 ], "heli_params": [ 2.898, 0.630, 3.410, -6.184, 0.875, 41.287 ], "bp2_params": [ 0.234, -0.163, -0.238, -10.350, -10.917, 3.037 ], "groove_widths": [ 11.038, 10.742, 17.732, 17.324 ], "simple_Rise": 3.592, "simple_Twist": 40.687, "simple_hRise": 3.408, "simple_hTwist": 40.913 }, { "index": 136, "nt1": "///I/136", "nt2": "///J/62", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.163, -0.238, -10.350, -10.917, 3.037 ], "step_params": [ -0.740, 0.899, 3.538, -5.915, 0.213, 28.693 ], "heli_params": [ 1.727, 0.050, 3.621, 0.424, 11.776, 29.285 ], "bp2_params": [ -0.153, -0.159, -0.403, -8.526, -6.457, 1.924 ], "groove_widths": [ 12.161, 12.046, 16.751, 16.518 ], "simple_Rise": 3.538, "simple_Twist": 31.133, "simple_hRise": 3.619, "simple_hTwist": 31.676 }, { "index": 137, "nt1": "///I/137", "nt2": "///J/61", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.159, -0.403, -8.526, -6.457, 1.924 ], "step_params": [ -0.617, 0.725, 3.648, -4.574, 7.076, 42.703 ], "heli_params": [ 0.197, 0.327, 3.759, 9.606, 6.208, 43.488 ], "bp2_params": [ 0.227, -0.302, -1.274, -13.472, 0.945, -0.782 ], "groove_widths": [ 12.858, 12.736, 17.589, 17.547 ], "simple_Rise": 3.648, "simple_Twist": 40.531, "simple_hRise": 3.762, "simple_hTwist": 41.361 }, { "index": 138, "nt1": "///I/138", "nt2": "///J/60", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, -0.302, -1.274, -13.472, 0.945, -0.782 ], "step_params": [ 0.064, -0.415, 3.136, -3.512, 3.425, 30.398 ], "heli_params": [ -1.418, -0.772, 3.045, 6.479, 6.642, 30.782 ], "bp2_params": [ -0.124, -0.272, -1.058, -8.483, 4.501, -2.471 ], "groove_widths": [ 13.809, 13.464, 17.638, 17.452 ], "simple_Rise": 3.136, "simple_Twist": 32.518, "simple_hRise": 3.054, "simple_hTwist": 32.876 }, { "index": 139, "nt1": "///I/139", "nt2": "///J/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.124, -0.272, -1.058, -8.483, 4.501, -2.471 ], "step_params": [ -0.006, -0.627, 3.119, -4.551, 5.291, 29.391 ], "heli_params": [ -2.212, -0.856, 2.932, 10.246, 8.814, 30.191 ], "bp2_params": [ -0.090, -0.203, -0.136, 2.820, 10.836, 0.541 ], "groove_widths": [ 15.042, 14.634, 16.254, 14.483 ], "simple_Rise": 3.119, "simple_Twist": 29.070, "simple_hRise": 2.929, "simple_hTwist": 29.878 }, { "index": 140, "nt1": "///I/140", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.203, -0.136, 2.820, 10.836, 0.541 ], "step_params": [ 0.295, -0.325, 3.305, 0.537, 9.227, 33.986 ], "heli_params": [ -1.913, -0.409, 3.118, 15.434, -0.898, 35.185 ], "bp2_params": [ 0.193, -0.191, 0.228, 4.425, 7.846, 0.593 ], "groove_widths": [ 14.953, 14.503, 16.703, 14.966 ], "simple_Rise": 3.305, "simple_Twist": 32.366, "simple_hRise": 3.102, "simple_hTwist": 33.626 }, { "index": 141, "nt1": "///I/141", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.191, 0.228, 4.425, 7.846, 0.593 ], "step_params": [ 0.534, -0.491, 3.181, 3.404, 3.985, 33.958 ], "heli_params": [ -1.437, -0.386, 3.142, 6.772, -5.785, 34.348 ], "bp2_params": [ -0.005, -0.232, 0.125, 7.759, 0.569, 2.103 ], "groove_widths": [ 13.497, 13.143, 16.570, 16.269 ], "simple_Rise": 3.181, "simple_Twist": 35.301, "simple_hRise": 3.145, "simple_hTwist": 35.676 }, { "index": 142, "nt1": "///I/142", "nt2": "///J/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.232, 0.125, 7.759, 0.569, 2.103 ], "step_params": [ 0.739, 0.009, 3.137, 8.002, 3.904, 35.343 ], "heli_params": [ -0.520, -0.087, 3.206, 6.307, -12.928, 36.412 ], "bp2_params": [ 0.227, -0.144, -0.110, 12.810, -1.355, 1.841 ], "groove_widths": [ 11.838, 11.738, 17.023, 17.021 ], "simple_Rise": 3.137, "simple_Twist": 33.955, "simple_hRise": 3.205, "simple_hTwist": 35.069 }, { "index": 143, "nt1": "///I/143", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, -0.144, -0.110, 12.810, -1.355, 1.841 ], "step_params": [ 0.289, 1.138, 3.465, 3.648, -2.815, 40.482 ], "heli_params": [ 1.963, 0.009, 3.394, -4.053, -5.252, 40.733 ], "bp2_params": [ 0.239, -0.141, 0.204, 8.137, -11.159, 1.274 ], "groove_widths": [ 10.581, 10.448, 17.180, 16.892 ], "simple_Rise": 3.465, "simple_Twist": 40.523, "simple_hRise": 3.394, "simple_hTwist": 40.773 }, { "index": 144, "nt1": "///I/144", "nt2": "///J/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.239, -0.141, 0.204, 8.137, -11.159, 1.274 ], "step_params": [ -0.000, 1.874, 3.899, 2.566, -3.287, 39.900 ], "heli_params": [ 3.170, 0.343, 3.732, -4.802, -3.748, 40.108 ], "bp2_params": [ 0.065, -0.130, -0.016, -3.128, -14.771, 2.490 ], "groove_widths": [ 10.004, 9.600, 18.638, 17.778 ], "simple_Rise": 3.899, "simple_Twist": 40.550, "simple_hRise": 3.735, "simple_hTwist": 40.755 }, { "index": 145, "nt1": "///I/145", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.065, -0.130, -0.016, -3.128, -14.771, 2.490 ], "step_params": [ -0.650, 2.088, 3.424, -0.344, -2.948, 40.562 ], "heli_params": [ 3.340, 0.896, 3.276, -4.245, 0.495, 40.666 ], "bp2_params": [ -0.306, -0.147, -0.571, -14.950, -13.250, 3.036 ], "groove_widths": [ 10.332, 9.872, 17.577, 16.548 ], "simple_Rise": 3.424, "simple_Twist": 42.290, "simple_hRise": 3.283, "simple_hTwist": 42.389 }, { "index": 146, "nt1": "///I/146", "nt2": "///J/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, -0.147, -0.571, -14.950, -13.250, 3.036 ], "step_params": [ -0.016, 1.723, 3.326, -2.363, 2.590, 35.777 ], "heli_params": [ 2.409, -0.323, 3.432, 4.204, 3.836, 35.943 ], "bp2_params": [ -0.262, -0.174, -0.926, -17.456, -6.910, 2.758 ], "groove_widths": [ 11.820, 11.629, 17.752, 17.353 ], "simple_Rise": 3.326, "simple_Twist": 35.786, "simple_hRise": 3.432, "simple_hTwist": 35.952 }, { "index": 147, "nt1": "///I/147", "nt2": "///J/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.262, -0.174, -0.926, -17.456, -6.910, 2.758 ], "step_params": [ -0.978, 0.509, 3.366, -12.461, 3.900, 33.122 ], "heli_params": [ 0.211, -0.389, 3.531, 6.533, 20.876, 35.536 ], "bp2_params": [ 0.178, -0.147, -0.377, -8.558, 3.654, 0.260 ], "groove_widths": [ 12.774, 12.719, 16.551, 16.551 ], "simple_Rise": 3.366, "simple_Twist": 30.963, "simple_hRise": 3.526, "simple_hTwist": 33.541 }, { "index": 148, "nt1": "///I/148", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.147, -0.377, -8.558, 3.654, 0.260 ], "step_params": [ -0.407, 0.333, 3.017, -5.143, 5.989, 39.451 ], "heli_params": [ -0.154, 0.045, 3.060, 8.765, 7.528, 40.202 ], "bp2_params": [ 0.087, -0.145, -0.103, -4.049, 3.731, 0.701 ], "groove_widths": [ 13.397, 13.223, 15.569, 15.405 ], "simple_Rise": 3.017, "simple_Twist": 39.759, "simple_hRise": 3.060, "simple_hTwist": 40.504 }, { "index": 149, "nt1": "///I/149", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.145, -0.103, -4.049, 3.731, 0.701 ], "step_params": [ 0.134, -0.684, 3.231, -1.342, 3.403, 34.362 ], "heli_params": [ -1.666, -0.429, 3.144, 5.739, 2.264, 34.551 ], "bp2_params": [ 0.197, -0.149, -0.109, 0.941, 0.552, 0.243 ], "groove_widths": [ 13.466, 13.145, 16.045, 15.818 ], "simple_Rise": 3.231, "simple_Twist": 33.801, "simple_hRise": 3.142, "simple_hTwist": 33.993 }, { "index": 150, "nt1": "///I/150", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.149, -0.109, 0.941, 0.552, 0.243 ], "step_params": [ 0.057, -0.414, 3.249, 0.261, 2.600, 34.773 ], "heli_params": [ -1.080, -0.056, 3.211, 4.342, -0.436, 34.868 ], "bp2_params": [ -0.193, -0.176, -0.220, 1.300, 0.872, 0.109 ], "groove_widths": [ 12.998, 12.744, 16.717, 16.163 ], "simple_Rise": 3.249, "simple_Twist": 37.037, "simple_hRise": 3.214, "simple_hTwist": 37.126 }, { "index": 151, "nt1": "///I/151", "nt2": "///J/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.176, -0.220, 1.300, 0.872, 0.109 ], "step_params": [ -0.063, -0.504, 3.291, 1.550, 2.633, 31.581 ], "heli_params": [ -1.405, 0.400, 3.233, 4.823, -2.839, 31.725 ], "bp2_params": [ -0.078, -0.156, -0.301, 4.904, -1.146, -0.270 ], "groove_widths": [ 13.052, 12.985, 17.214, 17.031 ], "simple_Rise": 3.291, "simple_Twist": 31.023, "simple_hRise": 3.231, "simple_hTwist": 31.169 }, { "index": 152, "nt1": "///I/152", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.078, -0.156, -0.301, 4.904, -1.146, -0.270 ], "step_params": [ 0.257, 0.703, 3.512, 1.661, 2.005, 36.917 ], "heli_params": [ 0.816, -0.163, 3.552, 3.161, -2.619, 37.005 ], "bp2_params": [ -0.200, -0.147, -0.203, 3.393, -5.525, 1.382 ], "groove_widths": [ 12.426, 12.418, 16.304, 16.281 ], "simple_Rise": 3.512, "simple_Twist": 37.602, "simple_hRise": 3.551, "simple_hTwist": 37.688 }, { "index": 153, "nt1": "///I/153", "nt2": "///J/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.147, -0.203, 3.393, -5.525, 1.382 ], "step_params": [ -0.093, 0.826, 3.409, 1.586, -0.541, 36.864 ], "heli_params": [ 1.381, 0.370, 3.390, -0.856, -2.507, 36.900 ], "bp2_params": [ -0.019, -0.161, 0.131, 6.751, -10.578, 0.512 ], "groove_widths": [ 11.120, 11.033, 16.787, 16.386 ], "simple_Rise": 3.409, "simple_Twist": 36.106, "simple_hRise": 3.389, "simple_hTwist": 36.144 }, { "index": 154, "nt1": "///I/154", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.019, -0.161, 0.131, 6.751, -10.578, 0.512 ], "step_params": [ 0.444, 1.900, 3.484, 2.345, -2.986, 46.057 ], "heli_params": [ 2.689, -0.356, 3.379, -3.809, -2.992, 46.205 ], "bp2_params": [ 0.213, -0.143, 0.043, 1.174, -10.062, 2.877 ], "groove_widths": [ 10.651, 10.336, 16.573, 15.786 ], "simple_Rise": 3.484, "simple_Twist": 44.298, "simple_hRise": 3.374, "simple_hTwist": 44.452 }, { "index": 155, "nt1": "///I/155", "nt2": "///J/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.213, -0.143, 0.043, 1.174, -10.062, 2.877 ], "step_params": [ -0.812, 2.427, 3.579, -1.438, -1.569, 41.688 ], "heli_params": [ 3.586, 0.975, 3.515, -2.204, 2.019, 41.740 ], "bp2_params": [ 0.081, -0.136, -0.493, -9.013, -11.115, 1.486 ], "groove_widths": [ 11.038, 10.679, 17.093, 16.638 ], "simple_Rise": 3.579, "simple_Twist": 42.195, "simple_hRise": 3.516, "simple_hTwist": 42.246 }, { "index": 156, "nt1": "///I/156", "nt2": "///J/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.136, -0.493, -9.013, -11.115, 1.486 ], "step_params": [ 0.458, 1.252, 3.469, -0.037, 0.850, 30.499 ], "heli_params": [ 2.200, -0.878, 3.502, 1.614, 0.071, 30.511 ], "bp2_params": [ -0.200, -0.248, -1.014, -10.948, -4.547, 2.959 ], "groove_widths": [ 11.454, 11.320, 16.780, 16.585 ], "simple_Rise": 3.469, "simple_Twist": 32.370, "simple_hRise": 3.500, "simple_hTwist": 32.380 }, { "index": 157, "nt1": "///I/157", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.248, -1.014, -10.948, -4.547, 2.959 ], "step_params": [ -0.883, 0.725, 3.240, -6.387, 4.960, 38.158 ], "heli_params": [ 0.471, 0.531, 3.402, 7.484, 9.637, 38.975 ], "bp2_params": [ 0.167, -0.234, -1.015, -11.250, -3.793, 2.164 ], "groove_widths": [ 11.771, 11.698, 16.735, 16.733 ], "simple_Rise": 3.240, "simple_Twist": 35.924, "simple_hRise": 3.408, "simple_hTwist": 36.794 }, { "index": 158, "nt1": "///I/158", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.234, -1.015, -11.250, -3.793, 2.164 ], "step_params": [ 0.553, -0.675, 3.172, -6.548, 1.934, 33.519 ], "heli_params": [ -1.438, -1.922, 2.972, 3.310, 11.208, 34.188 ], "bp2_params": [ -0.040, -0.149, -0.002, -3.833, 2.857, 5.376 ], "groove_widths": [ 12.481, 12.161, 16.919, 16.595 ], "simple_Rise": 3.172, "simple_Twist": 35.001, "simple_hRise": 2.983, "simple_hTwist": 35.640 }, { "index": 159, "nt1": "///I/159", "nt2": "///J/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.149, -0.002, -3.833, 2.857, 5.376 ], "step_params": [ 0.153, -0.326, 3.000, 1.309, 7.816, 36.279 ], "heli_params": [ -1.462, -0.082, 2.874, 12.371, -2.071, 37.106 ], "bp2_params": [ 0.040, -0.167, -0.067, -3.797, 2.811, 1.632 ], "groove_widths": [ 13.623, 13.136, 17.546, 16.781 ], "simple_Rise": 3.000, "simple_Twist": 35.658, "simple_hRise": 2.871, "simple_hTwist": 36.500 }, { "index": 160, "nt1": "///I/160", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, -0.167, -0.067, -3.797, 2.811, 1.632 ], "step_params": [ 0.256, -1.189, 3.379, 0.082, 3.307, 30.156 ], "heli_params": [ -2.948, -0.473, 3.234, 6.333, -0.157, 30.333 ], "bp2_params": [ -0.106, -0.136, 0.376, -0.478, 4.848, -0.235 ], "groove_widths": [ 14.002, 13.610, 19.069, 17.666 ], "simple_Rise": 3.379, "simple_Twist": 31.059, "simple_hRise": 3.239, "simple_hTwist": 31.231 }, { "index": 161, "nt1": "///I/161", "nt2": "///J/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.136, 0.376, -0.478, 4.848, -0.235 ], "step_params": [ 0.248, -0.437, 3.107, 3.538, 11.853, 33.415 ], "heli_params": [ -2.330, 0.075, 2.807, 19.791, -5.908, 35.570 ], "bp2_params": [ 0.034, -0.146, -0.006, -4.054, -7.714, 1.695 ], "groove_widths": [ 13.437, 13.164, 19.228, 18.353 ], "simple_Rise": 3.107, "simple_Twist": 32.474, "simple_hRise": 2.794, "simple_hTwist": 34.691 }, { "index": 162, "nt1": "///I/162", "nt2": "///J/36", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.034, -0.146, -0.006, -4.054, -7.714, 1.695 ], "step_params": [ -0.195, -0.949, 3.394, -1.421, -1.277, 30.341 ], "heli_params": [ -1.543, 0.075, 3.435, -2.438, 2.712, 30.400 ], "bp2_params": [ -0.046, -0.118, 0.040, -1.506, -6.746, 2.583 ], "groove_widths": [ 12.391, 12.218, 18.579, 18.317 ], "simple_Rise": 3.394, "simple_Twist": 30.986, "simple_hRise": 3.435, "simple_hTwist": 31.043 }, { "index": 163, "nt1": "///I/163", "nt2": "///J/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, -0.118, 0.040, -1.506, -6.746, 2.583 ], "step_params": [ 0.092, 0.332, 3.232, -1.644, 0.288, 41.680 ], "heli_params": [ 0.437, -0.300, 3.228, 0.405, 2.309, 41.712 ], "bp2_params": [ 0.094, -0.105, 0.169, -2.314, -8.696, 1.540 ], "groove_widths": [ 11.395, 11.300, 17.544, 17.498 ], "simple_Rise": 3.232, "simple_Twist": 40.730, "simple_hRise": 3.228, "simple_hTwist": 40.762 }, { "index": 164, "nt1": "///I/164", "nt2": "///J/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.094, -0.105, 0.169, -2.314, -8.696, 1.540 ], "step_params": [ -0.109, -0.440, 3.287, 0.136, -2.435, 33.934 ], "heli_params": [ -0.360, 0.208, 3.309, -4.165, -0.233, 34.019 ], "bp2_params": [ 0.195, -0.111, -0.086, -2.655, -7.593, 1.520 ], "groove_widths": [ 10.820, 10.778, 17.916, 17.916 ], "simple_Rise": 3.287, "simple_Twist": 33.449, "simple_hRise": 3.309, "simple_hTwist": 33.536 }, { "index": 165, "nt1": "///I/165", "nt2": "///J/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.111, -0.086, -2.655, -7.593, 1.520 ], "step_params": [ -0.364, -0.301, 3.762, 1.492, -1.308, 36.945 ], "heli_params": [ -0.272, 0.805, 3.753, -2.062, -2.352, 36.997 ], "bp2_params": [ 0.121, -0.118, -0.485, -7.322, -6.072, 0.827 ], "groove_widths": [ 11.203, 11.200, 18.967, 18.883 ], "simple_Rise": 3.762, "simple_Twist": 37.255, "simple_hRise": 3.753, "simple_hTwist": 37.306 }, { "index": 166, "nt1": "///I/166", "nt2": "///J/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.118, -0.485, -7.322, -6.072, 0.827 ], "step_params": [ -0.304, -0.036, 3.138, -1.607, -0.578, 31.029 ], "heli_params": [ 0.038, 0.271, 3.149, -1.080, 3.001, 31.075 ], "bp2_params": [ -0.120, -0.173, -0.422, -1.504, -6.079, -1.304 ], "groove_widths": [ 12.006, 11.997, 17.941, 17.830 ], "simple_Rise": 3.138, "simple_Twist": 32.653, "simple_hRise": 3.149, "simple_hTwist": 32.696 }, { "index": 167, "nt1": "///I/167", "nt2": "///J/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.173, -0.422, -1.504, -6.079, -1.304 ], "step_params": [ 0.091, -0.459, 3.253, -1.844, 3.365, 36.518 ], "heli_params": [ -1.182, -0.394, 3.191, 5.352, 2.932, 36.712 ], "bp2_params": [ 0.197, -0.134, -0.344, -1.623, -5.826, 1.335 ], "groove_widths": [ 12.643, 12.596, 17.146, 16.919 ], "simple_Rise": 3.253, "simple_Twist": 34.638, "simple_hRise": 3.187, "simple_hTwist": 34.844 }, { "index": 168, "nt1": "///I/168", "nt2": "///J/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.134, -0.344, -1.623, -5.826, 1.335 ], "step_params": [ 0.851, 0.349, 3.248, 3.189, 2.301, 37.235 ], "heli_params": [ 0.240, -0.904, 3.322, 3.591, -4.977, 37.435 ], "bp2_params": [ 0.226, -0.103, -0.197, -2.462, -2.753, 2.824 ], "groove_widths": [ 12.468, 12.375, 16.401, 16.158 ], "simple_Rise": 3.248, "simple_Twist": 36.946, "simple_hRise": 3.323, "simple_hTwist": 37.148 }, { "index": 169, "nt1": "///I/169", "nt2": "///J/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.103, -0.197, -2.462, -2.753, 2.824 ], "step_params": [ -0.066, 0.038, 3.462, -0.975, 2.070, 27.993 ], "heli_params": [ -0.437, -0.107, 3.455, 4.270, 2.011, 28.084 ], "bp2_params": [ 0.040, -0.078, 0.297, -1.131, -2.506, 2.747 ], "groove_widths": [ 12.611, 12.518, 16.636, 16.405 ], "simple_Rise": 3.462, "simple_Twist": 29.285, "simple_hRise": 3.456, "simple_hTwist": 29.372 }, { "index": 170, "nt1": "///I/170", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, -0.078, 0.297, -1.131, -2.506, 2.747 ], "step_params": [ 0.241, 0.587, 3.266, -1.069, 1.002, 40.647 ], "heli_params": [ 0.733, -0.465, 3.272, 1.442, 1.538, 40.672 ], "bp2_params": [ -0.185, -0.203, 0.632, -3.611, 0.133, -0.004 ], "groove_widths": [ 13.388, 13.292, 17.806, 17.666 ], "simple_Rise": 3.266, "simple_Twist": 41.674, "simple_hRise": 3.272, "simple_hTwist": 41.699 }, { "index": 171, "nt1": "///I/171", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.203, 0.632, -3.611, 0.133, -0.004 ], "step_params": [ -0.098, -0.909, 3.295, 0.217, 2.269, 29.186 ], "heli_params": [ -2.288, 0.240, 3.216, 4.493, -0.429, 29.273 ], "bp2_params": [ -0.067, -0.205, 0.659, -0.835, 3.610, -1.298 ], "groove_widths": [ 13.861, 13.730, 18.251, 17.756 ], "simple_Rise": 3.295, "simple_Twist": 28.698, "simple_hRise": 3.214, "simple_hTwist": 28.787 }, { "index": 172, "nt1": "///I/172", "nt2": "///J/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, -0.205, 0.659, -0.835, 3.610, -1.298 ], "step_params": [ 0.367, -0.387, 3.007, 1.842, 11.007, 33.367 ], "heli_params": [ -2.132, -0.358, 2.761, 18.537, -3.103, 35.134 ], "bp2_params": [ -0.182, -0.158, 0.411, -0.858, -4.654, -0.091 ], "groove_widths": [ 14.087, 13.897, 17.838, 17.037 ], "simple_Rise": 3.007, "simple_Twist": 33.981, "simple_hRise": 2.768, "simple_hTwist": 35.716 }, { "index": 173, "nt1": "///I/173", "nt2": "///J/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.158, 0.411, -0.858, -4.654, -0.091 ], "step_params": [ -0.279, -0.795, 3.345, 0.450, 1.294, 33.654 ], "heli_params": [ -1.587, 0.556, 3.309, 2.235, -0.776, 33.681 ], "bp2_params": [ 0.223, -0.132, 0.046, -0.521, -5.134, 0.718 ], "groove_widths": [ 13.334, 12.843, 17.538, 17.220 ], "simple_Rise": 3.345, "simple_Twist": 31.307, "simple_hRise": 3.306, "simple_hTwist": 31.337 }, { "index": 174, "nt1": "///I/174", "nt2": "///J/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.132, 0.046, -0.521, -5.134, 0.718 ], "step_params": [ 0.156, -0.369, 3.212, -1.902, 1.484, 40.200 ], "heli_params": [ -0.701, -0.437, 3.186, 2.157, 2.765, 40.269 ], "bp2_params": [ 0.083, -0.158, 0.593, -0.679, -3.857, 0.002 ], "groove_widths": [ 13.601, 12.779, 18.967, 18.637 ], "simple_Rise": 3.212, "simple_Twist": 40.902, "simple_hRise": 3.187, "simple_hTwist": 40.970 }, { "index": 175, "nt1": "///I/175", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.083, -0.158, 0.593, -0.679, -3.857, 0.002 ], "step_params": [ -0.323, -0.874, 3.725, 1.289, 0.188, 33.913 ], "heli_params": [ -1.531, 0.788, 3.706, 0.323, -2.209, 33.938 ], "bp2_params": [ -0.088, -0.149, -0.189, -1.654, -4.006, 0.566 ], "groove_widths": [ 14.904, 14.164, 18.695, 18.081 ], "simple_Rise": 3.725, "simple_Twist": 35.045, "simple_hRise": 3.707, "simple_hTwist": 35.069 }, { "index": 176, "nt1": "///I/176", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.149, -0.189, -1.654, -4.006, 0.566 ], "step_params": [ 0.522, -1.224, 3.050, -2.273, 7.487, 28.996 ], "heli_params": [ -3.721, -1.420, 2.612, 14.620, 4.438, 30.011 ], "bp2_params": [ -0.211, -0.184, 0.376, -1.397, 1.718, 2.326 ], "groove_widths": [ 15.493, 15.010, 19.990, 18.383 ], "simple_Rise": 3.050, "simple_Twist": 29.690, "simple_hRise": 2.624, "simple_hTwist": 30.681 }, { "index": 177, "nt1": "///I/177", "nt2": "///J/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.184, 0.376, -1.397, 1.718, 2.326 ], "step_params": [ 0.169, -1.599, 3.201, -0.086, 2.209, 32.410 ], "heli_params": [ -3.231, -0.317, 3.087, 3.951, 0.154, 32.483 ], "bp2_params": [ -0.103, -0.138, 0.579, 0.463, -1.693, 5.188 ], "groove_widths": [ 14.315, 13.945, 20.088, 18.514 ], "simple_Rise": 3.201, "simple_Twist": 31.794, "simple_hRise": 3.085, "simple_hTwist": 31.869 }, { "index": 178, "nt1": "///I/178", "nt2": "///J/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.138, 0.579, 0.463, -1.693, 5.188 ], "step_params": [ -0.684, -0.963, 2.786, 6.046, 8.689, 31.556 ], "heli_params": [ -2.841, 2.001, 2.282, 15.443, -10.746, 33.241 ], "bp2_params": [ 0.133, -0.127, 0.133, 7.457, -4.665, -1.610 ], "groove_widths": [ 12.146, 11.806, 17.074, 16.674 ], "simple_Rise": 2.786, "simple_Twist": 30.298, "simple_hRise": 2.256, "simple_hTwist": 32.053 }, { "index": 179, "nt1": "///I/179", "nt2": "///J/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.127, 0.133, 7.457, -4.665, -1.610 ], "step_params": [ -0.385, -1.431, 3.377, 1.888, -2.399, 35.267 ], "heli_params": [ -1.985, 0.923, 3.439, -3.950, -3.109, 35.394 ], "bp2_params": [ -0.082, -0.114, -0.208, -1.191, -8.483, -2.513 ], "groove_widths": [ 11.208, 11.003, 17.419, 17.335 ], "simple_Rise": 3.377, "simple_Twist": 36.434, "simple_hRise": 3.438, "simple_hTwist": 36.557 }, { "index": 180, "nt1": "///I/180", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.114, -0.208, -1.191, -8.483, -2.513 ], "step_params": [ 0.176, 0.123, 3.446, 0.003, 3.844, 31.421 ], "heli_params": [ -0.524, -0.322, 3.436, 7.065, -0.006, 31.649 ], "bp2_params": [ -0.016, -0.165, -0.372, 1.573, -6.633, 5.523 ], "groove_widths": [ 11.627, 11.555, 15.950, 15.950 ], "simple_Rise": 3.446, "simple_Twist": 31.156, "simple_hRise": 3.436, "simple_hTwist": 31.386 }, { "index": 181, "nt1": "///I/181", "nt2": "///J/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.016, -0.165, -0.372, 1.573, -6.633, 5.523 ], "step_params": [ -0.953, 1.608, 3.368, -1.399, -0.277, 43.649 ], "heli_params": [ 2.190, 1.142, 3.386, -0.372, 1.881, 43.671 ], "bp2_params": [ -0.226, -0.154, -0.670, -3.866, -7.464, 1.256 ], "groove_widths": [ 12.194, 12.116, 17.639, 17.614 ], "simple_Rise": 3.368, "simple_Twist": 44.470, "simple_hRise": 3.386, "simple_hTwist": 44.492 }, { "index": 182, "nt1": "///I/182", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.154, -0.670, -3.866, -7.464, 1.256 ], "step_params": [ 0.197, 0.948, 3.583, 1.521, -2.293, 37.252 ], "heli_params": [ 1.809, -0.089, 3.526, -3.584, -2.377, 37.350 ], "bp2_params": [ 0.150, -0.459, -1.534, -4.792, -2.884, 1.573 ], "groove_widths": [ 11.638, 11.588, 18.569, 18.484 ], "simple_Rise": 3.583, "simple_Twist": 35.091, "simple_hRise": 3.521, "simple_hTwist": 35.196 }, { "index": 183, "nt1": "///I/183", "nt2": "///J/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.459, -1.534, -4.792, -2.884, 1.573 ], "step_params": [ -1.720, 1.216, 3.601, -10.209, 0.748, 37.851 ], "heli_params": [ 1.709, 1.131, 3.939, 1.129, 15.397, 39.161 ], "bp2_params": [ 0.235, -0.575, -1.528, -7.732, -0.530, -2.921 ], "groove_widths": [ 11.798, 11.793, 15.750, 15.635 ], "simple_Rise": 3.601, "simple_Twist": 37.419, "simple_hRise": 3.942, "simple_hTwist": 38.746 }, { "index": 184, "nt1": "///I/184", "nt2": "///J/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.575, -1.528, -7.732, -0.530, -2.921 ], "step_params": [ 0.447, -0.481, 3.254, -4.391, 4.293, 31.558 ], "heli_params": [ -1.620, -1.576, 3.075, 7.801, 7.979, 32.135 ], "bp2_params": [ 0.129, -0.366, -0.988, -5.568, 2.644, -0.324 ], "groove_widths": [ 12.608, 12.542, 15.667, 15.662 ], "simple_Rise": 3.254, "simple_Twist": 32.290, "simple_hRise": 3.081, "simple_hTwist": 32.853 }, { "index": 185, "nt1": "///I/185", "nt2": "///J/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.366, -0.988, -5.568, 2.644, -0.324 ], "step_params": [ 0.748, 0.627, 3.506, -0.682, 6.486, 40.879 ], "heli_params": [ 0.134, -1.138, 3.548, 9.216, 0.969, 41.374 ], "bp2_params": [ 0.068, -0.154, -0.530, -8.089, -2.806, 3.869 ], "groove_widths": [ 12.380, 12.220, 16.431, 16.261 ], "simple_Rise": 3.506, "simple_Twist": 41.104, "simple_hRise": 3.548, "simple_hTwist": 41.596 }, { "index": 186, "nt1": "///I/186", "nt2": "///J/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.068, -0.154, -0.530, -8.089, -2.806, 3.869 ], "step_params": [ -1.256, -0.238, 3.356, -0.751, -0.076, 33.734 ], "heli_params": [ -0.398, 2.038, 3.383, -0.130, 1.294, 33.743 ], "bp2_params": [ -0.176, -0.186, -0.760, -4.883, -2.060, -0.233 ], "groove_widths": [ 12.404, 12.272, 17.273, 17.087 ], "simple_Rise": 3.356, "simple_Twist": 35.197, "simple_hRise": 3.382, "simple_hTwist": 35.205 }, { "index": 187, "nt1": "///I/187", "nt2": "///J/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, -0.186, -0.760, -4.883, -2.060, -0.233 ], "step_params": [ 0.391, 0.029, 3.166, -2.764, 1.835, 36.436 ], "heli_params": [ -0.197, -0.990, 3.127, 2.928, 4.409, 36.581 ], "bp2_params": [ 0.219, -0.136, -0.281, 0.176, -1.877, 1.068 ], "groove_widths": [ 12.369, 12.274, 15.436, 15.405 ], "simple_Rise": 3.166, "simple_Twist": 34.337, "simple_hRise": 3.123, "simple_hTwist": 34.492 }, { "index": 188, "nt1": "///I/188", "nt2": "///J/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.136, -0.281, 0.176, -1.877, 1.068 ], "step_params": [ -0.473, 0.203, 3.102, -3.010, 3.722, 39.977 ], "heli_params": [ -0.108, 0.361, 3.133, 5.421, 4.383, 40.251 ], "bp2_params": [ -0.185, -0.118, -0.023, -1.949, -1.082, -0.771 ], "groove_widths": [ 12.076, 11.956, 15.735, 15.592 ], "simple_Rise": 3.102, "simple_Twist": 42.127, "simple_hRise": 3.133, "simple_hTwist": 42.386 }, { "index": 189, "nt1": "///I/189", "nt2": "///J/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.118, -0.023, -1.949, -1.082, -0.771 ], "step_params": [ 0.607, -0.119, 3.145, 0.642, 2.277, 38.345 ], "heli_params": [ -0.454, -0.846, 3.142, 3.463, -0.976, 38.415 ], "bp2_params": [ 0.075, -0.113, 0.053, -1.945, -3.244, 2.600 ], "groove_widths": [ 11.835, 11.744, 14.880, 14.692 ], "simple_Rise": 3.145, "simple_Twist": 36.843, "simple_hRise": 3.142, "simple_hTwist": 36.916 }, { "index": 190, "nt1": "///I/190", "nt2": "///J/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.075, -0.113, 0.053, -1.945, -3.244, 2.600 ], "step_params": [ -1.125, 0.076, 3.128, -1.833, 0.368, 37.574 ], "heli_params": [ 0.071, 1.515, 3.178, 0.571, 2.844, 37.619 ], "bp2_params": [ 0.180, -0.116, 0.018, 0.747, -4.107, -0.697 ], "groove_widths": [ 11.662, 11.620, 14.470, 14.457 ], "simple_Rise": 3.128, "simple_Twist": 37.098, "simple_hRise": 3.178, "simple_hTwist": 37.144 }, { "index": 191, "nt1": "///I/191", "nt2": "///J/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.116, 0.018, 0.747, -4.107, -0.697 ], "step_params": [ 0.331, -0.211, 3.178, 0.624, -0.103, 38.663 ], "heli_params": [ -0.306, -0.425, 3.184, -0.155, -0.942, 38.668 ], "bp2_params": [ 0.189, -0.127, 0.064, -0.689, -4.069, 0.165 ], "groove_widths": [ 11.477, 11.458, 16.133, 16.085 ], "simple_Rise": 3.178, "simple_Twist": 38.642, "simple_hRise": 3.184, "simple_hTwist": 38.647 }, { "index": 192, "nt1": "///I/192", "nt2": "///J/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.127, 0.064, -0.689, -4.069, 0.165 ], "step_params": [ -0.635, 1.439, 3.581, 0.654, -0.831, 43.118 ], "heli_params": [ 2.047, 0.933, 3.544, -1.131, -0.890, 43.130 ], "bp2_params": [ 0.110, -0.138, -0.483, -2.756, -3.214, -0.041 ], "groove_widths": [ 12.060, 12.049, 16.462, 16.418 ], "simple_Rise": 3.581, "simple_Twist": 43.409, "simple_hRise": 3.545, "simple_hTwist": 43.422 }, { "index": 193, "nt1": "///I/193", "nt2": "///J/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.138, -0.483, -2.756, -3.214, -0.041 ], "step_params": [ 0.930, 0.136, 3.792, -0.438, 0.569, 33.032 ], "heli_params": [ 0.128, -1.722, 3.782, 1.001, 0.771, 33.040 ], "bp2_params": [ 0.189, -0.349, -1.111, -1.342, -1.108, 3.262 ], "groove_widths": [ 12.863, 12.822, 15.942, 15.922 ], "simple_Rise": 3.792, "simple_Twist": 32.622, "simple_hRise": 3.781, "simple_hTwist": 32.630 }, { "index": 194, "nt1": "///I/194", "nt2": "///J/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.349, -1.111, -1.342, -1.108, 3.262 ], "step_params": [ -1.261, 0.155, 3.494, -2.102, 3.372, 35.614 ], "heli_params": [ -0.271, 1.723, 3.559, 5.492, 3.424, 35.828 ], "bp2_params": [ 0.154, -0.291, -0.980, -0.979, 1.442, -0.934 ], "groove_widths": [ 12.833, null, 15.084, null ], "simple_Rise": 3.494, "simple_Twist": 35.921, "simple_hRise": 3.559, "simple_hTwist": 36.133 }, { "index": 195, "nt1": "///I/195", "nt2": "///J/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.291, -0.980, -0.979, 1.442, -0.934 ], "step_params": [ 0.535, 0.257, 3.272, 2.177, 0.982, 40.325 ], "heli_params": [ 0.261, -0.528, 3.300, 1.423, -3.155, 40.393 ], "bp2_params": [ 0.159, -0.242, -0.825, 2.860, 1.163, -0.869 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.272, "simple_Twist": 40.235, "simple_hRise": 3.300, "simple_hTwist": 40.303 }, { "index": 196, "nt1": "///I/196", "nt2": "///J/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.159, -0.242, -0.825, 2.860, 1.163, -0.869 ], "step_params": [ 1.097, 0.704, 3.535, 2.659, 0.259, 35.558 ], "heli_params": [ 1.108, -1.370, 3.610, 0.424, -4.346, 35.655 ], "bp2_params": [ 0.186, -0.178, -0.540, 3.567, 0.441, 1.573 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.535, "simple_Twist": 35.383, "simple_hRise": 3.610, "simple_hTwist": 35.481 }, { "index": 197, "nt1": "///I/197", "nt2": "///J/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 0, "stacks": [], "nonStack": { "num_nts": 1, "nts_short": "G", "nts_long": "///I/1" }, "dbn": { "all_chains": { "num_nts": 394, "num_chars": 395, "bseq": "GGGCTGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCACCCC&GGGGTGGTCGCTGTTCAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCGGCCGCGTATAGGGTCCAGCCC", "sstr": "(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((&)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))", "form": "..BBBBBBBBB...BBBBBBBBBBBBBBBBBBBBB.BB.BB...BBBBBBB..BBBBBBBBB.BBBBBBBBBBBBB..BBBB.BBBB.BBBB.BBBB..BBB.BBBBBB.BBB..BBB...BB.B.BBBB.BBBBBBBBBBBB..BBBBBBBB..BB.B.B.BBBBBBBB.BBB.AAA.B.B.BBBBBBBB.BBBB-&.BBB.BBBBBBBBBB.B.....B.B.BBBBBBBB.B.BBBB..BBBBBBB...BBBB.BBB..BB.BBBB...BB...BBB..BBB.BBBB..BB.B.BBBB..BB.BBBBBB.BBBB...BB.B.BBBBBBB.BBB.BBBB...BBBBBBB...BB..B.BBBBBBBBBBBB..BBBBBBB...BBBBBBBBB.B-" }, "chain_I": { "num_nts": 197, "num_chars": 197, "bseq": "GGGCTGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCACCCC", "sstr": "(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((", "form": "..BBBBBBBBB...BBBBBBBBBBBBBBBBBBBBB.BB.BB...BBBBBBB..BBBBBBBBB.BBBBBBBBBBBBB..BBBB.BBBB.BBBB.BBBB..BBB.BBBBBB.BBB..BBB...BB.B.BBBB.BBBBBBBBBBBB..BBBBBBBB..BB.B.B.BBBBBBBB.BBB.AAA.B.B.BBBBBBBB.BBBB-" }, "chain_J": { "num_nts": 197, "num_chars": 197, "bseq": "GGGGTGGTCGCTGTTCAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCGGCCGCGTATAGGGTCCAGCCC", "sstr": ")))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))", "form": ".BBB.BBBBBBBBBB.B.....B.B.BBBBBBBB.B.BBBB..BBBBBBB...BBBB.BBB..BB.BBBB...BB...BBB..BBB.BBBB..BB.B.BBBB..BB.BBBBBB.BBBB...BB.B.BBBBBBB.BBB.BBBB...BBBBBBB...BB..B.BBBBBBBBBBBB..BBBBBBB...BBBBBBBBB.B-" } }, "chains": { "chain_I": { "num_nts": 197, "bseq": "GGGCTGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCACCCC", "sstr": "(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((", "form": "..BBBBBBBBB...BBBBBBBBBBBBBBBBBBBBB.BB.BB...BBBBBBB..BBBBBBBBB.BBBBBBBBBBBBB..BBBB.BBBB.BBBB.BBBB..BBB.BBBBBB.BBB..BBB...BB.B.BBBB.BBBBBBBBBBBB..BBBBBBBB..BB.B.B.BBBBBBBB.BBB.AAA.B.B.BBBBBBBB.BBBB-", "helical_rise": 0.213, "helical_rise_std": 2.357, "helical_axis": [ -0.921, 0.383, -0.074 ], "point1": [ 192.119, 168.771, 195.174 ], "point2": [ 154.494, 184.439, 192.135 ], "num_chars": 589, "suite": "G!!G!!G!!C!!T!!G!!G!!A!!C!!C!!C!!T4bA!!T4bA!!C!!G!!C!!G!!G!!C!!C!!G!!C!!C!!C!!T4bG!!G!!A!!G!!A!!A!!T!!C!!C!!C!!G!!G!!T!!G!!C4bC4bG!!A!!G!!G!!C!!C!!G!!C!!T4bC4bA!!A!!T!!T!!G!!G!!T!!C4bG!!T4bA!!G!!A!!C!!A!!G!!C!!T!!C!!T4bA4bG!!C!!A!!C!!C!!G!!C!!T!!T4bA4bA!!A!!C!!G!!C!!A!!C!!G!!T4bA!!C!!G!!C!!G!!C!!T!!G!!T!!C!!C!!C!!C!!C!!G!!C!!G!!T!!T!!T!!T4bA4bA!!C!!C!!G!!C!!C!!A!!A!!G!!G!!G!!G!!A!!T!!T!!A!!C!!T!!C4bC!!C!!T!!A!!G!!T!!C!!T!!C4bC4bA4bG!!G4bC!!A!!C!!G!!T!!G!!T4bC!!A!!G4bA!!T!!A!!T!!A!!T!!A!!C!!A!!T!!C!!C!!T!!G!!T!!G!!C!!A!!T1aG1aT1bA!!T!!T4bG!!A4bA!!C!!A!!G!!C!!G!!A!!C!!C4bA!!C!!C!!C!!C" }, "chain_J": { "num_nts": 197, "bseq": "GGGGTGGTCGCTGTTCAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCGGCCGCGTATAGGGTCCAGCCC", "sstr": ")))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))", "form": ".BBB.BBBBBBBBBB.B.....B.B.BBBBBBBB.B.BBBB..BBBBBBB...BBBB.BBB..BB.BBBB...BB...BBB..BBB.BBBB..BB.B.BBBB..BB.BBBBBB.BBBB...BB.B.BBBBBBB.BBB.BBBB...BBBBBBB...BB..B.BBBBBBBBBBBB..BBBBBBB...BBBBBBBBB.B-", "helical_rise": 0.197, "helical_rise_std": 2.361, "helical_axis": [ 0.928, -0.371, -0.022 ], "point1": [ 152.612, 187.690, 191.862 ], "point2": [ 187.370, 173.803, 191.034 ], "num_chars": 589, "suite": "G4bG!!G!!G!!T!!G!!G!!T!!C!!G!!C!!T!!G!!T!!T4bC4aA1bA!!T!!A!!C!!A!!T!!G!!C!!A!!C4bA!!G4bG!!A!!T!!G!!T!!A!!T!!A!!T!!A!!T!!C4bT4bG4bA!!C!!A!!C!!G!!T!!G!!C!!C4bT4bG4bG!!A!!G!!A!!C!!T!!A!!G4bG4bG!!A!!G!!T!!A!!A!!T!!C!!C4bC4bC4aT!!T!!G!!G!!C!!G!!G!!T!!T!!A!!A!!A!!A!!C!!G!!C!!G!!G4bG4bG4bG!!A!!C4bA!!G!!C!!G!!C4bG4bT4bA!!C!!G!!T!!G!!C!!G!!T!!T!!T4bA4bA!!G!!C!!G!!G!!T!!G!!C!!T4bA!!G4bA!!G!!C!!T!!G!!T!!C!!T4bA!!C!!G!!A!!C!!C!!A!!A!!T!!T4bG4bA!!G!!C!!G!!G!!C!!C!!T!!C4bG4bG!!C4bA!!C!!C!!G!!G!!G!!A!!T!!T!!C!!T!!C!!C!!A!!G!!G!!G!!C!!G!!G!!C!!C!!G!!C!!G!!T!!A!!T!!A!!G!!G!!G!!T!!C!!C!!A!!G!!C!!C!!C" } }, "num_nts": 394, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "I", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/1", "linked_nts": [ null, "///I/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 172.520, "gamma": 59.775, "delta": 129.628, "epsilon": -151.152, "zeta": -121.181, "epsilon_zeta": -29.971, "bb_type": "--", "chi": -120.463, "glyco_bond": "anti", "C5prime_xyz": [ -2.486, 8.609, -1.446 ], "P_xyz": [ -0.149, 9.794, -1.463 ], "form": ".", "ssZp": 2.328, "Dp": 2.302, "splay_angle": 28.926, "splay_distance": 4.802, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": null, "theta": -152.407, "eta_prime": null, "theta_prime": -154.872, "eta_base": null, "theta_base": -120.529, "v0": -31.873, "v1": 37.054, "v2": -27.982, "v3": 10.498, "v4": 13.171, "amplitude": 36.390, "phase_angle": 140.260, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 195.065, 185.471, 292.377 ], "x_axis": [ 0.845, -0.438, 0.307 ], "y_axis": [ -0.531, -0.610, 0.588 ], "z_axis": [ -0.070, -0.660, -0.748 ], "quaternion": [ 0.349, 0.895, -0.271, 0.066 ] } }, { "index": 2, "index_chain": 2, "chain_name": "I", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/2", "linked_nts": [ "///I/1", "///I/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -71.965, "beta": 164.998, "gamma": 69.957, "delta": 141.180, "epsilon": -153.554, "zeta": -146.937, "epsilon_zeta": -6.616, "bb_type": "--", "chi": -105.281, "glyco_bond": "anti", "C5prime_xyz": [ -2.480, 8.287, -1.933 ], "P_xyz": [ -0.004, 8.929, -2.519 ], "form": ".", "ssZp": 2.070, "Dp": 2.084, "splay_angle": 24.788, "splay_distance": 4.143, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 175.779, "theta": -165.712, "eta_prime": -157.321, "theta_prime": -178.135, "eta_base": -122.813, "theta_base": -122.479, "v0": -27.072, "v1": 39.135, "v2": -35.590, "v3": 20.979, "v4": 3.545, "amplitude": 38.959, "phase_angle": 155.998, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 194.218, 182.113, 289.052 ], "x_axis": [ 0.365, -0.753, 0.548 ], "y_axis": [ -0.927, -0.240, 0.288 ], "z_axis": [ -0.085, -0.613, -0.786 ], "quaternion": [ 0.291, 0.773, -0.543, 0.150 ] } }, { "index": 3, "index_chain": 3, "chain_name": "I", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/3", "linked_nts": [ "///I/2", "///I/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.604, "beta": 145.154, "gamma": 74.171, "delta": 152.730, "epsilon": -172.099, "zeta": -118.253, "epsilon_zeta": -53.846, "bb_type": "BI", "chi": -114.908, "glyco_bond": "anti", "C5prime_xyz": [ -1.674, 8.423, -1.288 ], "P_xyz": [ 0.922, 8.084, -1.544 ], "form": "B", "ssZp": 1.866, "Dp": 1.921, "splay_angle": 21.505, "splay_distance": 3.478, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 155.553, "theta": -121.121, "eta_prime": -157.903, "theta_prime": -164.063, "eta_base": -103.947, "theta_base": -121.569, "v0": -14.689, "v1": 33.834, "v2": -39.020, "v3": 31.534, "v4": -10.801, "amplitude": 39.072, "phase_angle": 177.050, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 192.372, 179.799, 286.154 ], "x_axis": [ -0.398, -0.757, 0.518 ], "y_axis": [ -0.914, 0.380, -0.146 ], "z_axis": [ -0.086, -0.531, -0.843 ], "quaternion": [ -0.187, -0.516, 0.809, -0.209 ] } }, { "index": 4, "index_chain": 4, "chain_name": "I", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/4", "linked_nts": [ "///I/3", "///I/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.890, "beta": -176.610, "gamma": 44.121, "delta": 144.279, "epsilon": -172.898, "zeta": -101.298, "epsilon_zeta": -71.600, "bb_type": "BI", "chi": -109.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.307, -1.667 ], "P_xyz": [ 0.895, 9.111, -1.049 ], "form": "B", "ssZp": 1.890, "Dp": 2.004, "splay_angle": 22.120, "splay_distance": 3.769, "splay_ratio": 0.192, "d22": 4.350, "d64": 3.919, "eta": 170.992, "theta": -131.080, "eta_prime": -167.075, "theta_prime": -145.235, "eta_base": -117.457, "theta_base": -106.974, "v0": -12.442, "v1": 28.091, "v2": -32.250, "v3": 25.847, "v4": -8.656, "amplitude": 32.309, "phase_angle": 176.523, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 192.315, 178.206, 283.062 ], "x_axis": [ -0.904, -0.347, 0.249 ], "y_axis": [ -0.422, 0.816, -0.394 ], "z_axis": [ -0.066, -0.462, -0.885 ], "quaternion": [ -0.083, -0.203, 0.949, -0.225 ] } }, { "index": 5, "index_chain": 5, "chain_name": "I", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/5", "linked_nts": [ "///I/4", "///I/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.545, "beta": 173.485, "gamma": 45.926, "delta": 136.235, "epsilon": -166.371, "zeta": -123.234, "epsilon_zeta": -43.137, "bb_type": "BI", "chi": -110.475, "glyco_bond": "anti", "C5prime_xyz": [ -2.411, 8.391, -1.815 ], "P_xyz": [ -0.160, 9.715, -1.713 ], "form": "B", "ssZp": 2.166, "Dp": 2.205, "splay_angle": 18.901, "splay_distance": 3.184, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 168.558, "theta": -151.854, "eta_prime": -163.183, "theta_prime": -162.975, "eta_base": -117.600, "theta_base": -118.699, "v0": -28.871, "v1": 38.335, "v2": -32.849, "v3": 17.119, "v4": 7.101, "amplitude": 37.740, "phase_angle": 150.504, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 191.657, 176.456, 279.789 ], "x_axis": [ -0.986, 0.168, -0.012 ], "y_axis": [ 0.155, 0.878, -0.453 ], "z_axis": [ -0.066, -0.449, -0.891 ], "quaternion": [ -0.014, 0.083, 0.969, -0.233 ] } }, { "index": 6, "index_chain": 6, "chain_name": "I", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/6", "linked_nts": [ "///I/5", "///I/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.182, "beta": 160.089, "gamma": 41.225, "delta": 132.095, "epsilon": -162.497, "zeta": -112.404, "epsilon_zeta": -50.094, "bb_type": "BI", "chi": -121.138, "glyco_bond": "anti", "C5prime_xyz": [ -2.195, 8.651, -1.375 ], "P_xyz": [ 0.155, 9.719, -0.955 ], "form": "B", "ssZp": 2.249, "Dp": 2.277, "splay_angle": 18.332, "splay_distance": 3.141, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 169.454, "theta": -142.394, "eta_prime": -170.171, "theta_prime": -154.199, "eta_base": -119.854, "theta_base": -113.412, "v0": -28.406, "v1": 35.563, "v2": -29.045, "v3": 13.470, "v4": 9.171, "amplitude": 34.922, "phase_angle": 146.277, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 191.037, 174.957, 277.050 ], "x_axis": [ -0.690, 0.697, -0.194 ], "y_axis": [ 0.712, 0.606, -0.355 ], "z_axis": [ -0.130, -0.383, -0.915 ], "quaternion": [ 0.018, 0.393, 0.896, -0.206 ] } }, { "index": 7, "index_chain": 7, "chain_name": "I", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/7", "linked_nts": [ "///I/6", "///I/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.901, "beta": 159.655, "gamma": 49.305, "delta": 123.946, "epsilon": 179.808, "zeta": -100.126, "epsilon_zeta": -80.067, "bb_type": "BI", "chi": -123.966, "glyco_bond": "anti", "C5prime_xyz": [ -2.457, 8.691, -1.389 ], "P_xyz": [ -0.130, 9.870, -1.333 ], "form": "B", "ssZp": 2.530, "Dp": 2.517, "splay_angle": 20.410, "splay_distance": 3.390, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 162.489, "theta": -148.764, "eta_prime": -171.223, "theta_prime": -159.488, "eta_base": -121.173, "theta_base": -108.005, "v0": -33.407, "v1": 35.327, "v2": -24.008, "v3": 5.520, "v4": 17.353, "amplitude": 35.520, "phase_angle": 132.524, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 190.125, 173.843, 274.258 ], "x_axis": [ -0.157, 0.915, -0.372 ], "y_axis": [ 0.972, 0.076, -0.223 ], "z_axis": [ -0.176, -0.396, -0.901 ], "quaternion": [ 0.067, 0.646, 0.731, -0.212 ] } }, { "index": 8, "index_chain": 8, "chain_name": "I", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/8", "linked_nts": [ "///I/7", "///I/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.413, "beta": 173.309, "gamma": 54.603, "delta": 140.329, "epsilon": -161.302, "zeta": -124.685, "epsilon_zeta": -36.618, "bb_type": "BI", "chi": -122.114, "glyco_bond": "anti", "C5prime_xyz": [ -2.172, 8.609, -1.186 ], "P_xyz": [ 0.177, 9.653, -0.685 ], "form": "B", "ssZp": 2.122, "Dp": 2.158, "splay_angle": 19.752, "splay_distance": 3.244, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 172.144, "theta": -149.708, "eta_prime": -160.340, "theta_prime": -160.905, "eta_base": -101.616, "theta_base": -124.635, "v0": -27.125, "v1": 38.792, "v2": -35.024, "v3": 20.361, "v4": 3.981, "amplitude": 38.546, "phase_angle": 155.319, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 189.390, 173.454, 270.971 ], "x_axis": [ 0.524, 0.740, -0.421 ], "y_axis": [ 0.834, -0.545, 0.080 ], "z_axis": [ -0.170, -0.393, -0.904 ], "quaternion": [ 0.137, 0.862, 0.456, -0.171 ] } }, { "index": 9, "index_chain": 9, "chain_name": "I", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/9", "linked_nts": [ "///I/8", "///I/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.185, "beta": 168.487, "gamma": 52.223, "delta": 141.843, "epsilon": -172.902, "zeta": -108.383, "epsilon_zeta": -64.519, "bb_type": "BI", "chi": -117.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.973, 8.603, -1.372 ], "P_xyz": [ 0.496, 9.405, -1.001 ], "form": "B", "ssZp": 2.172, "Dp": 2.194, "splay_angle": 19.220, "splay_distance": 3.234, "splay_ratio": 0.168, "d22": 4.039, "d64": 3.616, "eta": 162.732, "theta": -135.227, "eta_prime": -171.555, "theta_prime": -153.283, "eta_base": -127.701, "theta_base": -104.283, "v0": -24.312, "v1": 37.226, "v2": -35.307, "v3": 22.190, "v4": 1.094, "amplitude": 37.673, "phase_angle": 159.586, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 188.102, 172.194, 268.274 ], "x_axis": [ 0.912, 0.253, -0.324 ], "y_axis": [ 0.357, -0.877, 0.320 ], "z_axis": [ -0.203, -0.408, -0.890 ], "quaternion": [ 0.190, 0.959, 0.159, -0.137 ] } }, { "index": 10, "index_chain": 10, "chain_name": "I", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/10", "linked_nts": [ "///I/9", "///I/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -62.960, "beta": 166.503, "gamma": 59.173, "delta": 139.844, "epsilon": -156.463, "zeta": -132.883, "epsilon_zeta": -23.580, "bb_type": "--", "chi": -121.346, "glyco_bond": "anti", "C5prime_xyz": [ -2.356, 8.698, -1.282 ], "P_xyz": [ 0.030, 9.757, -1.030 ], "form": "B", "ssZp": 2.030, "Dp": 2.132, "splay_angle": 20.299, "splay_distance": 3.315, "splay_ratio": 0.177, "d22": 5.099, "d64": 4.095, "eta": 169.315, "theta": -156.397, "eta_prime": -161.563, "theta_prime": -166.306, "eta_base": -104.145, "theta_base": -136.694, "v0": -31.381, "v1": 42.359, "v2": -36.626, "v3": 19.634, "v4": 7.025, "amplitude": 41.666, "phase_angle": 151.529, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 188.130, 171.237, 265.184 ], "x_axis": [ 0.923, -0.379, -0.073 ], "y_axis": [ -0.309, -0.839, 0.447 ], "z_axis": [ -0.231, -0.390, -0.891 ], "quaternion": [ 0.219, 0.956, -0.180, -0.080 ] } }, { "index": 11, "index_chain": 11, "chain_name": "I", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/11", "linked_nts": [ "///I/10", "///I/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.927, "beta": 178.134, "gamma": 40.806, "delta": 146.074, "epsilon": 178.304, "zeta": -91.907, "epsilon_zeta": -89.788, "bb_type": "BI", "chi": -110.138, "glyco_bond": "anti", "C5prime_xyz": [ -1.584, 8.322, -1.655 ], "P_xyz": [ 0.824, 9.156, -1.027 ], "form": "B", "ssZp": 1.901, "Dp": 1.977, "splay_angle": 19.404, "splay_distance": 3.364, "splay_ratio": 0.171, "d22": 3.767, "d64": 3.548, "eta": 163.288, "theta": -124.123, "eta_prime": -175.948, "theta_prime": -141.985, "eta_base": -140.444, "theta_base": -93.553, "v0": -13.734, "v1": 30.170, "v2": -34.318, "v3": 27.263, "v4": -8.740, "amplitude": 34.414, "phase_angle": 175.722, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 186.600, 171.007, 262.252 ], "x_axis": [ 0.586, -0.772, 0.246 ], "y_axis": [ -0.786, -0.468, 0.403 ], "z_axis": [ -0.197, -0.429, -0.881 ], "quaternion": [ 0.243, 0.857, -0.455, 0.014 ] } }, { "index": 12, "index_chain": 12, "chain_name": "I", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/12", "linked_nts": [ "///I/11", "///I/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.026, "beta": 176.938, "gamma": 41.377, "delta": 140.429, "epsilon": -127.801, "zeta": -155.975, "epsilon_zeta": 28.174, "bb_type": "--", "chi": -107.758, "glyco_bond": "anti", "C5prime_xyz": [ -2.689, 8.336, -1.838 ], "P_xyz": [ -0.645, 9.962, -1.698 ], "form": ".", "ssZp": 1.660, "Dp": 1.672, "splay_angle": 21.658, "splay_distance": 3.685, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -179.898, "theta": -171.332, "eta_prime": -154.181, "theta_prime": -171.189, "eta_base": -99.468, "theta_base": -134.255, "v0": -31.505, "v1": 42.806, "v2": -37.110, "v3": 20.106, "v4": 6.807, "amplitude": 42.073, "phase_angle": 151.889, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 186.691, 168.650, 259.854 ], "x_axis": [ -0.009, -0.907, 0.420 ], "y_axis": [ -0.989, 0.069, 0.130 ], "z_axis": [ -0.147, -0.415, -0.898 ], "quaternion": [ -0.202, -0.675, 0.703, -0.101 ] } }, { "index": 13, "index_chain": 13, "chain_name": "I", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/13", "linked_nts": [ "///I/12", "///I/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.507, "beta": 150.239, "gamma": 49.697, "delta": 143.790, "epsilon": -179.219, "zeta": -98.012, "epsilon_zeta": -81.207, "bb_type": "BI", "chi": -113.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.909, 8.400, -1.517 ], "P_xyz": [ 0.679, 8.748, -1.263 ], "form": ".", "ssZp": 2.065, "Dp": 2.110, "splay_angle": 19.594, "splay_distance": 3.485, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 151.897, "theta": -121.309, "eta_prime": -178.483, "theta_prime": -150.625, "eta_base": -137.515, "theta_base": -124.384, "v0": -19.724, "v1": 34.217, "v2": -34.948, "v3": 24.515, "v4": -3.270, "amplitude": 35.966, "phase_angle": 166.332, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.119, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 185.777, 168.486, 256.287 ], "x_axis": [ -0.546, -0.663, 0.513 ], "y_axis": [ -0.801, 0.592, -0.089 ], "z_axis": [ -0.244, -0.459, -0.854 ], "quaternion": [ -0.219, -0.423, 0.865, -0.158 ] } }, { "index": 14, "index_chain": 14, "chain_name": "I", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/14", "linked_nts": [ "///I/13", "///I/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -60.922, "beta": -173.513, "gamma": 39.846, "delta": 136.045, "epsilon": -145.159, "zeta": -149.875, "epsilon_zeta": 4.716, "bb_type": "--", "chi": -111.566, "glyco_bond": "anti", "C5prime_xyz": [ -2.597, 8.411, -1.752 ], "P_xyz": [ -0.706, 10.194, -1.443 ], "form": ".", "ssZp": 2.055, "Dp": 2.055, "splay_angle": 26.250, "splay_distance": 4.438, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 174.672, "theta": -175.372, "eta_prime": -168.083, "theta_prime": -168.126, "eta_base": -132.674, "theta_base": -112.773, "v0": -32.397, "v1": 41.254, "v2": -33.901, "v3": 16.282, "v4": 9.802, "amplitude": 40.319, "phase_angle": 147.227, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 185.864, 166.089, 253.758 ], "x_axis": [ -0.864, -0.279, 0.420 ], "y_axis": [ -0.437, 0.829, -0.349 ], "z_axis": [ -0.250, -0.485, -0.838 ], "quaternion": [ -0.178, -0.191, 0.939, -0.222 ] } }, { "index": 15, "index_chain": 15, "chain_name": "I", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/15", "linked_nts": [ "///I/14", "///I/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.612, "beta": 157.316, "gamma": 56.169, "delta": 149.885, "epsilon": 177.171, "zeta": -91.220, "epsilon_zeta": -91.609, "bb_type": "BI", "chi": -100.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.496, 7.861, -1.988 ], "P_xyz": [ 1.117, 7.610, -1.865 ], "form": "B", "ssZp": 1.741, "Dp": 1.891, "splay_angle": 23.677, "splay_distance": 4.106, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 163.209, "theta": -108.531, "eta_prime": -161.872, "theta_prime": -144.472, "eta_base": -109.666, "theta_base": -111.221, "v0": -5.017, "v1": 23.837, "v2": -32.478, "v3": 30.452, "v4": -16.222, "amplitude": 32.990, "phase_angle": 190.108, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 184.639, 165.931, 249.496 ], "x_axis": [ -0.907, 0.420, 0.022 ], "y_axis": [ 0.343, 0.768, -0.541 ], "z_axis": [ -0.244, -0.483, -0.841 ], "quaternion": [ -0.071, 0.204, 0.937, -0.273 ] } }, { "index": 16, "index_chain": 16, "chain_name": "I", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/16", "linked_nts": [ "///I/15", "///I/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -53.738, "beta": -176.606, "gamma": 40.458, "delta": 135.747, "epsilon": -154.645, "zeta": -145.394, "epsilon_zeta": -9.251, "bb_type": "--", "chi": -105.255, "glyco_bond": "anti", "C5prime_xyz": [ -2.580, 8.317, -2.024 ], "P_xyz": [ -0.562, 9.983, -2.044 ], "form": "B", "ssZp": 2.115, "Dp": 2.157, "splay_angle": 23.943, "splay_distance": 3.999, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 175.433, "theta": -170.955, "eta_prime": -160.868, "theta_prime": -171.437, "eta_base": -119.428, "theta_base": -132.457, "v0": -31.421, "v1": 40.319, "v2": -33.415, "v3": 16.334, "v4": 9.166, "amplitude": 39.456, "phase_angle": 147.876, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 182.919, 164.256, 246.164 ], "x_axis": [ -0.578, 0.768, -0.275 ], "y_axis": [ 0.784, 0.431, -0.446 ], "z_axis": [ -0.224, -0.474, -0.852 ], "quaternion": [ 0.015, 0.459, 0.846, -0.272 ] } }, { "index": 17, "index_chain": 17, "chain_name": "I", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/17", "linked_nts": [ "///I/16", "///I/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.353, "beta": 150.222, "gamma": 50.487, "delta": 141.808, "epsilon": -159.524, "zeta": -131.253, "epsilon_zeta": -28.271, "bb_type": "--", "chi": -111.845, "glyco_bond": "anti", "C5prime_xyz": [ -2.203, 8.476, -1.639 ], "P_xyz": [ 0.346, 9.045, -1.585 ], "form": "B", "ssZp": 2.071, "Dp": 2.094, "splay_angle": 20.403, "splay_distance": 3.399, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 172.872, "theta": -143.827, "eta_prime": -162.834, "theta_prime": -162.959, "eta_base": -124.049, "theta_base": -121.963, "v0": -25.344, "v1": 38.102, "v2": -35.705, "v3": 21.984, "v4": 1.884, "amplitude": 38.383, "phase_angle": 158.473, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 182.647, 162.100, 242.807 ], "x_axis": [ -0.054, 0.875, -0.482 ], "y_axis": [ 0.979, -0.049, -0.199 ], "z_axis": [ -0.197, -0.482, -0.853 ], "quaternion": [ 0.104, 0.680, 0.682, -0.250 ] } }, { "index": 18, "index_chain": 18, "chain_name": "I", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/18", "linked_nts": [ "///I/17", "///I/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.996, "beta": 157.491, "gamma": 46.731, "delta": 140.981, "epsilon": -161.924, "zeta": -119.816, "epsilon_zeta": -42.108, "bb_type": "BI", "chi": -118.373, "glyco_bond": "anti", "C5prime_xyz": [ -2.124, 8.642, -1.359 ], "P_xyz": [ 0.344, 9.443, -1.009 ], "form": "B", "ssZp": 2.185, "Dp": 2.184, "splay_angle": 18.735, "splay_distance": 3.080, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 166.297, "theta": -141.740, "eta_prime": -168.962, "theta_prime": -156.374, "eta_base": -121.138, "theta_base": -107.878, "v0": -27.690, "v1": 39.762, "v2": -35.959, "v3": 20.908, "v4": 4.038, "amplitude": 39.537, "phase_angle": 155.437, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 181.924, 160.339, 239.992 ], "x_axis": [ 0.540, 0.688, -0.486 ], "y_axis": [ 0.827, -0.541, 0.153 ], "z_axis": [ -0.158, -0.484, -0.861 ], "quaternion": [ 0.186, 0.858, 0.442, -0.188 ] } }, { "index": 19, "index_chain": 19, "chain_name": "I", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/19", "linked_nts": [ "///I/18", "///I/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.407, "beta": 164.047, "gamma": 60.642, "delta": 141.878, "epsilon": -176.232, "zeta": -107.376, "epsilon_zeta": -68.857, "bb_type": "BI", "chi": -119.460, "glyco_bond": "anti", "C5prime_xyz": [ -1.957, 8.597, -1.288 ], "P_xyz": [ 0.579, 9.207, -1.054 ], "form": "B", "ssZp": 2.066, "Dp": 2.149, "splay_angle": 19.323, "splay_distance": 3.177, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 156.185, "theta": -135.438, "eta_prime": -170.072, "theta_prime": -157.062, "eta_base": -112.535, "theta_base": -116.270, "v0": -23.283, "v1": 36.378, "v2": -35.020, "v3": 22.485, "v4": 0.219, "amplitude": 37.068, "phase_angle": 160.866, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 181.794, 158.882, 237.281 ], "x_axis": [ 0.960, 0.189, -0.206 ], "y_axis": [ 0.261, -0.872, 0.415 ], "z_axis": [ -0.101, -0.452, -0.886 ], "quaternion": [ 0.225, 0.964, 0.117, -0.080 ] } }, { "index": 20, "index_chain": 20, "chain_name": "I", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/20", "linked_nts": [ "///I/19", "///I/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.481, "beta": -169.854, "gamma": 37.107, "delta": 143.289, "epsilon": 176.284, "zeta": -95.863, "epsilon_zeta": -87.853, "bb_type": "BI", "chi": -106.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.734, 8.233, -1.818 ], "P_xyz": [ 0.487, 9.473, -1.207 ], "form": "B", "ssZp": 1.935, "Dp": 2.021, "splay_angle": 19.621, "splay_distance": 3.395, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 167.744, "theta": -137.063, "eta_prime": -168.784, "theta_prime": -151.079, "eta_base": -119.511, "theta_base": -106.877, "v0": -13.913, "v1": 29.016, "v2": -32.327, "v3": 25.124, "v4": -7.324, "amplitude": 32.505, "phase_angle": 173.987, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 181.468, 157.872, 234.287 ], "x_axis": [ 0.905, -0.415, 0.091 ], "y_axis": [ -0.410, -0.799, 0.440 ], "z_axis": [ -0.110, -0.436, -0.893 ], "quaternion": [ 0.231, 0.948, -0.217, -0.005 ] } }, { "index": 21, "index_chain": 21, "chain_name": "I", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/21", "linked_nts": [ "///I/20", "///I/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -50.594, "beta": -179.413, "gamma": 38.954, "delta": 134.542, "epsilon": -150.968, "zeta": -128.285, "epsilon_zeta": -22.683, "bb_type": "--", "chi": -111.923, "glyco_bond": "anti", "C5prime_xyz": [ -2.296, 8.481, -1.767 ], "P_xyz": [ -0.187, 9.998, -1.487 ], "form": "B", "ssZp": 2.065, "Dp": 2.127, "splay_angle": 23.320, "splay_distance": 3.973, "splay_ratio": 0.203, "d22": 4.666, "d64": 4.076, "eta": 176.827, "theta": -154.505, "eta_prime": -162.994, "theta_prime": -159.085, "eta_base": -112.630, "theta_base": -116.631, "v0": -28.953, "v1": 37.446, "v2": -31.316, "v3": 15.518, "v4": 8.214, "amplitude": 36.734, "phase_angle": 148.486, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 181.948, 156.325, 231.304 ], "x_axis": [ 0.491, -0.813, 0.313 ], "y_axis": [ -0.865, -0.410, 0.291 ], "z_axis": [ -0.108, -0.414, -0.904 ], "quaternion": [ 0.210, 0.837, -0.501, 0.061 ] } }, { "index": 22, "index_chain": 22, "chain_name": "I", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/22", "linked_nts": [ "///I/21", "///I/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.248, "beta": 147.655, "gamma": 55.806, "delta": 118.921, "epsilon": -176.448, "zeta": -102.505, "epsilon_zeta": -73.943, "bb_type": "BI", "chi": -127.056, "glyco_bond": "anti", "C5prime_xyz": [ -2.328, 8.771, -1.311 ], "P_xyz": [ 0.168, 9.509, -1.557 ], "form": "B", "ssZp": 2.687, "Dp": 2.649, "splay_angle": 20.195, "splay_distance": 3.420, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 165.351, "theta": -149.495, "eta_prime": -170.173, "theta_prime": -164.088, "eta_base": -122.001, "theta_base": -126.215, "v0": -33.516, "v1": 32.087, "v2": -18.982, "v3": 0.338, "v4": 20.761, "amplitude": 33.788, "phase_angle": 124.181, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 181.210, 154.431, 227.891 ], "x_axis": [ -0.108, -0.899, 0.424 ], "y_axis": [ -0.984, 0.157, 0.084 ], "z_axis": [ -0.142, -0.408, -0.902 ], "quaternion": [ -0.192, -0.640, 0.736, -0.110 ] } }, { "index": 23, "index_chain": 23, "chain_name": "I", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/23", "linked_nts": [ "///I/22", "///I/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.151, "beta": 164.053, "gamma": 64.429, "delta": 128.659, "epsilon": -163.558, "zeta": -128.445, "epsilon_zeta": -35.113, "bb_type": "BI", "chi": -137.046, "glyco_bond": "anti", "C5prime_xyz": [ -2.261, 8.879, -0.664 ], "P_xyz": [ 0.127, 9.854, -0.243 ], "form": "B", "ssZp": 2.240, "Dp": 2.330, "splay_angle": 19.148, "splay_distance": 3.271, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 174.402, "theta": -140.431, "eta_prime": -161.092, "theta_prime": -154.098, "eta_base": -114.983, "theta_base": -119.370, "v0": -31.972, "v1": 36.846, "v2": -27.688, "v3": 10.117, "v4": 13.486, "amplitude": 36.287, "phase_angle": 139.731, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 181.272, 152.728, 224.926 ], "x_axis": [ -0.627, -0.656, 0.421 ], "y_axis": [ -0.756, 0.643, -0.124 ], "z_axis": [ -0.190, -0.396, -0.898 ], "quaternion": [ -0.172, -0.397, 0.890, -0.146 ] } }, { "index": 24, "index_chain": 24, "chain_name": "I", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/24", "linked_nts": [ "///I/23", "///I/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 34.300, "beta": 167.256, "gamma": -42.876, "delta": 158.077, "epsilon": 176.025, "zeta": -93.634, "epsilon_zeta": -90.341, "bb_type": "BI", "chi": -107.375, "glyco_bond": "anti", "C5prime_xyz": [ -1.190, 7.998, -1.521 ], "P_xyz": [ 0.505, 9.910, -0.996 ], "form": "B", "ssZp": 1.801, "Dp": 1.801, "splay_angle": 18.121, "splay_distance": 3.115, "splay_ratio": 0.159, "d22": 3.938, "d64": 3.578, "eta": 168.687, "theta": -145.232, "eta_prime": -169.547, "theta_prime": -152.541, "eta_base": -126.375, "theta_base": -106.901, "v0": -1.210, "v1": 23.641, "v2": -35.662, "v3": 35.965, "v4": -22.072, "amplitude": 37.256, "phase_angle": 196.823, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 181.455, 150.893, 222.224 ], "x_axis": [ -0.960, -0.112, 0.255 ], "y_axis": [ -0.204, 0.906, -0.370 ], "z_axis": [ -0.190, -0.407, -0.893 ], "quaternion": [ -0.115, -0.082, 0.970, -0.200 ] } }, { "index": 25, "index_chain": 25, "chain_name": "I", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/25", "linked_nts": [ "///I/24", "///I/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.246, "beta": -179.443, "gamma": 47.830, "delta": 127.924, "epsilon": 168.057, "zeta": -90.964, "epsilon_zeta": -100.979, "bb_type": "BI", "chi": -116.595, "glyco_bond": "anti", "C5prime_xyz": [ -2.201, 8.569, -1.665 ], "P_xyz": [ 0.036, 9.906, -1.468 ], "form": "B", "ssZp": 2.367, "Dp": 2.389, "splay_angle": 19.211, "splay_distance": 3.169, "splay_ratio": 0.167, "d22": 4.476, "d64": 3.877, "eta": 158.848, "theta": -155.126, "eta_prime": -171.708, "theta_prime": -166.048, "eta_base": -117.868, "theta_base": -126.738, "v0": -29.425, "v1": 34.297, "v2": -26.155, "v3": 9.950, "v4": 12.016, "amplitude": 33.779, "phase_angle": 140.742, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 180.377, 149.341, 219.748 ], "x_axis": [ -0.902, 0.432, -0.003 ], "y_axis": [ 0.383, 0.796, -0.469 ], "z_axis": [ -0.200, -0.424, -0.883 ], "quaternion": [ -0.052, 0.216, 0.946, -0.236 ] } }, { "index": 26, "index_chain": 26, "chain_name": "I", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/26", "linked_nts": [ "///I/25", "///I/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.750, "beta": -147.367, "gamma": 18.683, "delta": 143.368, "epsilon": 176.865, "zeta": -92.171, "epsilon_zeta": -90.964, "bb_type": "BI", "chi": -104.963, "glyco_bond": "anti", "C5prime_xyz": [ -1.253, 7.952, -1.845 ], "P_xyz": [ 0.680, 9.515, -1.059 ], "form": "B", "ssZp": 1.851, "Dp": 2.104, "splay_angle": 20.058, "splay_distance": 3.497, "splay_ratio": 0.175, "d22": 4.114, "d64": 4.004, "eta": -178.179, "theta": -143.735, "eta_prime": -165.035, "theta_prime": -148.703, "eta_base": -122.264, "theta_base": -120.442, "v0": -0.231, "v1": 16.270, "v2": -25.125, "v3": 25.681, "v4": -16.274, "amplitude": 26.451, "phase_angle": 198.221, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 179.443, 147.581, 217.284 ], "x_axis": [ -0.492, 0.824, -0.280 ], "y_axis": [ 0.839, 0.365, -0.403 ], "z_axis": [ -0.230, -0.433, -0.871 ], "quaternion": [ 0.015, 0.504, 0.826, -0.253 ] } }, { "index": 27, "index_chain": 27, "chain_name": "I", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/27", "linked_nts": [ "///I/26", "///I/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -41.779, "beta": 176.652, "gamma": 33.276, "delta": 142.734, "epsilon": -144.673, "zeta": -159.907, "epsilon_zeta": 15.234, "bb_type": "--", "chi": -105.698, "glyco_bond": "anti", "C5prime_xyz": [ -2.588, 8.299, -1.906 ], "P_xyz": [ -0.610, 9.979, -1.703 ], "form": "B", "ssZp": 1.912, "Dp": 1.932, "splay_angle": 20.209, "splay_distance": 3.413, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 177.179, "theta": -172.306, "eta_prime": -157.752, "theta_prime": -172.990, "eta_base": -126.177, "theta_base": -115.558, "v0": -30.841, "v1": 43.350, "v2": -38.612, "v3": 21.877, "v4": 5.343, "amplitude": 42.917, "phase_angle": 154.118, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 178.360, 145.851, 214.444 ], "x_axis": [ -0.108, 0.894, -0.434 ], "y_axis": [ 0.965, -0.010, -0.261 ], "z_axis": [ -0.237, -0.447, -0.862 ], "quaternion": [ 0.070, 0.664, 0.700, -0.253 ] } }, { "index": 28, "index_chain": 28, "chain_name": "I", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/28", "linked_nts": [ "///I/27", "///I/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.061, "beta": 145.220, "gamma": 42.271, "delta": 145.525, "epsilon": -161.533, "zeta": -121.575, "epsilon_zeta": -39.957, "bb_type": "BI", "chi": -108.168, "glyco_bond": "anti", "C5prime_xyz": [ -1.758, 8.295, -1.732 ], "P_xyz": [ 0.819, 8.454, -1.363 ], "form": "B", "ssZp": 1.821, "Dp": 1.929, "splay_angle": 18.634, "splay_distance": 3.187, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 168.326, "theta": -129.197, "eta_prime": -165.652, "theta_prime": -153.485, "eta_base": -108.436, "theta_base": -121.208, "v0": -15.761, "v1": 31.416, "v2": -34.338, "v3": 26.044, "v4": -6.702, "amplitude": 34.657, "phase_angle": 172.225, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.072, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 178.659, 144.088, 211.537 ], "x_axis": [ 0.582, 0.629, -0.516 ], "y_axis": [ 0.772, -0.626, 0.108 ], "z_axis": [ -0.255, -0.461, -0.850 ], "quaternion": [ 0.163, 0.874, 0.401, -0.221 ] } }, { "index": 29, "index_chain": 29, "chain_name": "I", "nt_resnum": 29, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/29", "linked_nts": [ "///I/28", "///I/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.994, "beta": 156.584, "gamma": 40.730, "delta": 138.093, "epsilon": -148.671, "zeta": -145.108, "epsilon_zeta": -3.562, "bb_type": "--", "chi": -116.363, "glyco_bond": "anti", "C5prime_xyz": [ -2.507, 8.562, -1.518 ], "P_xyz": [ -0.223, 9.769, -1.198 ], "form": "B", "ssZp": 2.039, "Dp": 2.055, "splay_angle": 19.796, "splay_distance": 3.277, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 167.165, "theta": -158.161, "eta_prime": -168.832, "theta_prime": -165.745, "eta_base": -128.641, "theta_base": -121.463, "v0": -32.189, "v1": 42.078, "v2": -35.445, "v3": 17.897, "v4": 8.673, "amplitude": 41.267, "phase_angle": 149.195, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 177.556, 142.636, 208.924 ], "x_axis": [ 0.904, 0.279, -0.323 ], "y_axis": [ 0.391, -0.846, 0.363 ], "z_axis": [ -0.172, -0.455, -0.874 ], "quaternion": [ 0.215, 0.952, 0.176, -0.130 ] } }, { "index": 30, "index_chain": 30, "chain_name": "I", "nt_resnum": 30, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/30", "linked_nts": [ "///I/29", "///I/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.996, "beta": 155.414, "gamma": 33.463, "delta": 139.439, "epsilon": -163.404, "zeta": -114.901, "epsilon_zeta": -48.503, "bb_type": "BI", "chi": -116.277, "glyco_bond": "anti", "C5prime_xyz": [ -1.747, 8.428, -1.439 ], "P_xyz": [ 0.693, 9.071, -0.763 ], "form": "B", "ssZp": 2.039, "Dp": 2.115, "splay_angle": 18.490, "splay_distance": 3.276, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 167.666, "theta": -124.716, "eta_prime": -172.748, "theta_prime": -138.791, "eta_base": -123.846, "theta_base": -106.329, "v0": -18.406, "v1": 30.599, "v2": -30.636, "v3": 20.792, "v4": -1.737, "amplitude": 31.821, "phase_angle": 164.315, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 176.657, 140.888, 206.302 ], "x_axis": [ 0.960, -0.275, 0.051 ], "y_axis": [ -0.260, -0.812, 0.522 ], "z_axis": [ -0.102, -0.515, -0.851 ], "quaternion": [ 0.272, 0.952, -0.140, -0.013 ] } }, { "index": 31, "index_chain": 31, "chain_name": "I", "nt_resnum": 31, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/31", "linked_nts": [ "///I/30", "///I/32" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -18.779, "beta": 148.742, "gamma": 17.772, "delta": 137.664, "epsilon": -105.820, "zeta": -175.576, "epsilon_zeta": 69.756, "bb_type": "BII", "chi": -107.425, "glyco_bond": "anti", "C5prime_xyz": [ -3.156, 8.296, -1.817 ], "P_xyz": [ -1.317, 10.119, -1.588 ], "form": "B", "ssZp": 1.504, "Dp": 1.426, "splay_angle": 19.737, "splay_distance": 3.336, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -177.486, "theta": -166.673, "eta_prime": -152.477, "theta_prime": -168.776, "eta_base": -114.204, "theta_base": -115.434, "v0": -38.605, "v1": 47.444, "v2": -37.361, "v3": 16.458, "v4": 13.427, "amplitude": 46.081, "phase_angle": 144.171, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 177.084, 139.419, 203.406 ], "x_axis": [ 0.729, -0.614, 0.303 ], "y_axis": [ -0.682, -0.611, 0.402 ], "z_axis": [ -0.062, -0.499, -0.864 ], "quaternion": [ 0.252, 0.895, -0.362, 0.067 ] } }, { "index": 32, "index_chain": 32, "chain_name": "I", "nt_resnum": 32, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/32", "linked_nts": [ "///I/31", "///I/33" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.432, "beta": 126.160, "gamma": 38.526, "delta": 117.497, "epsilon": 166.380, "zeta": -95.660, "epsilon_zeta": -97.960, "bb_type": "BI", "chi": -119.604, "glyco_bond": "anti", "C5prime_xyz": [ -2.551, 8.522, -1.717 ], "P_xyz": [ -0.048, 9.248, -1.668 ], "form": "B", "ssZp": 2.457, "Dp": 2.513, "splay_angle": 19.716, "splay_distance": 3.191, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 154.962, "theta": -150.548, "eta_prime": -178.483, "theta_prime": -167.222, "eta_base": -120.184, "theta_base": -123.299, "v0": -35.029, "v1": 33.265, "v2": -19.538, "v3": 0.031, "v4": 21.882, "amplitude": 35.208, "phase_angle": 123.706, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 176.387, 137.550, 200.732 ], "x_axis": [ 0.124, -0.883, 0.452 ], "y_axis": [ -0.989, -0.074, 0.127 ], "z_axis": [ -0.079, -0.463, -0.883 ], "quaternion": [ 0.205, 0.721, -0.649, 0.129 ] } }, { "index": 33, "index_chain": 33, "chain_name": "I", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/33", "linked_nts": [ "///I/32", "///I/34" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.918, "beta": -168.374, "gamma": 44.719, "delta": 147.965, "epsilon": -173.815, "zeta": -105.462, "epsilon_zeta": -68.353, "bb_type": "BI", "chi": -109.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.685, 8.224, -1.632 ], "P_xyz": [ 0.567, 9.280, -0.863 ], "form": "B", "ssZp": 1.805, "Dp": 1.900, "splay_angle": 20.605, "splay_distance": 3.491, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 177.418, "theta": -133.155, "eta_prime": -159.595, "theta_prime": -147.129, "eta_base": -111.018, "theta_base": -107.234, "v0": -13.017, "v1": 30.296, "v2": -35.163, "v3": 28.580, "v4": -10.027, "amplitude": 35.196, "phase_angle": 177.510, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 176.398, 135.871, 198.018 ], "x_axis": [ -0.523, -0.739, 0.424 ], "y_axis": [ -0.850, 0.488, -0.197 ], "z_axis": [ -0.061, -0.464, -0.884 ], "quaternion": [ -0.143, -0.467, 0.851, -0.194 ] } }, { "index": 34, "index_chain": 34, "chain_name": "I", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/34", "linked_nts": [ "///I/33", "///I/35" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.249, "beta": 177.575, "gamma": 34.707, "delta": 143.059, "epsilon": -163.073, "zeta": -134.960, "epsilon_zeta": -28.113, "bb_type": "--", "chi": -103.267, "glyco_bond": "anti", "C5prime_xyz": [ -2.360, 8.189, -2.035 ], "P_xyz": [ -0.267, 9.721, -1.796 ], "form": "B", "ssZp": 1.875, "Dp": 1.990, "splay_angle": 20.675, "splay_distance": 3.469, "splay_ratio": 0.180, "d22": 4.283, "d64": 3.676, "eta": 170.595, "theta": -153.002, "eta_prime": -163.159, "theta_prime": -162.059, "eta_base": -117.051, "theta_base": -115.877, "v0": -25.290, "v1": 38.728, "v2": -36.877, "v3": 23.326, "v4": 0.870, "amplitude": 39.272, "phase_angle": 159.887, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 176.138, 133.869, 195.171 ], "x_axis": [ -0.919, -0.332, 0.214 ], "y_axis": [ -0.393, 0.818, -0.419 ], "z_axis": [ -0.036, -0.469, -0.882 ], "quaternion": [ -0.066, -0.191, 0.951, -0.233 ] } }, { "index": 35, "index_chain": 35, "chain_name": "I", "nt_resnum": 35, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/35", "linked_nts": [ "///I/34", "///I/36" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -27.603, "beta": 156.040, "gamma": 26.516, "delta": 140.470, "epsilon": -160.934, "zeta": -135.916, "epsilon_zeta": -25.019, "bb_type": "--", "chi": -109.045, "glyco_bond": "anti", "C5prime_xyz": [ -2.184, 8.435, -1.796 ], "P_xyz": [ 0.108, 9.614, -1.385 ], "form": "B", "ssZp": 2.042, "Dp": 2.076, "splay_angle": 20.911, "splay_distance": 3.504, "splay_ratio": 0.182, "d22": 4.443, "d64": 3.762, "eta": 171.653, "theta": -152.382, "eta_prime": -167.336, "theta_prime": -162.148, "eta_base": -117.274, "theta_base": -121.299, "v0": -26.198, "v1": 38.384, "v2": -35.412, "v3": 21.160, "v4": 2.891, "amplitude": 38.476, "phase_angle": 156.977, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 175.643, 132.188, 192.177 ], "x_axis": [ -0.965, 0.260, -0.043 ], "y_axis": [ 0.251, 0.859, -0.445 ], "z_axis": [ -0.079, -0.441, -0.894 ], "quaternion": [ -0.009, 0.132, 0.964, -0.230 ] } }, { "index": 36, "index_chain": 36, "chain_name": "I", "nt_resnum": 36, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/36", "linked_nts": [ "///I/35", "///I/37" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.400, "beta": 157.607, "gamma": 30.408, "delta": 136.171, "epsilon": -167.138, "zeta": -105.637, "epsilon_zeta": -61.502, "bb_type": "BI", "chi": -114.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.945, 8.520, -1.577 ], "P_xyz": [ 0.408, 9.481, -1.030 ], "form": ".", "ssZp": 2.117, "Dp": 2.178, "splay_angle": 19.757, "splay_distance": 3.584, "splay_ratio": 0.176, "d22": 4.015, "d64": 4.130, "eta": 171.472, "theta": -132.794, "eta_prime": -168.674, "theta_prime": -149.194, "eta_base": -122.810, "theta_base": -120.422, "v0": -23.031, "v1": 33.001, "v2": -30.106, "v3": 17.663, "v4": 3.125, "amplitude": 32.987, "phase_angle": 155.876, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 175.523, 130.598, 189.057 ], "x_axis": [ -0.640, 0.727, -0.248 ], "y_axis": [ 0.764, 0.571, -0.300 ], "z_axis": [ -0.077, -0.382, -0.921 ], "quaternion": [ 0.048, 0.421, 0.885, -0.193 ] } }, { "index": 37, "index_chain": 37, "chain_name": "I", "nt_resnum": 37, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/37", "linked_nts": [ "///I/36", "///I/38" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.137, "beta": 167.402, "gamma": 26.029, "delta": 112.392, "epsilon": -174.193, "zeta": -102.589, "epsilon_zeta": -71.604, "bb_type": "BI", "chi": -126.233, "glyco_bond": "anti", "C5prime_xyz": [ -2.493, 8.725, -1.460 ], "P_xyz": [ -0.629, 10.505, -1.116 ], "form": "B", "ssZp": 2.655, "Dp": 2.696, "splay_angle": 18.096, "splay_distance": 3.113, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 166.756, "theta": -164.274, "eta_prime": -176.758, "theta_prime": -165.549, "eta_base": -137.907, "theta_base": -127.597, "v0": -36.127, "v1": 30.378, "v2": -13.995, "v3": -6.245, "v4": 26.633, "amplitude": 35.194, "phase_angle": 113.432, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 174.323, 128.942, 186.114 ], "x_axis": [ -0.205, 0.939, -0.275 ], "y_axis": [ 0.976, 0.176, -0.127 ], "z_axis": [ -0.071, -0.295, -0.953 ], "quaternion": [ 0.067, 0.627, 0.764, -0.138 ] } }, { "index": 38, "index_chain": 38, "chain_name": "I", "nt_resnum": 38, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/38", "linked_nts": [ "///I/37", "///I/39" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.018, "beta": 161.188, "gamma": 54.544, "delta": 123.998, "epsilon": -168.360, "zeta": -103.831, "epsilon_zeta": -64.529, "bb_type": "BI", "chi": -135.150, "glyco_bond": "anti", "C5prime_xyz": [ -2.335, 8.859, -0.867 ], "P_xyz": [ -0.004, 9.976, -0.497 ], "form": "B", "ssZp": 2.495, "Dp": 2.500, "splay_angle": 19.158, "splay_distance": 3.209, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 169.917, "theta": -147.666, "eta_prime": -167.674, "theta_prime": -156.224, "eta_base": -123.586, "theta_base": -117.901, "v0": -34.069, "v1": 35.720, "v2": -24.013, "v3": 5.147, "v4": 17.998, "amplitude": 36.022, "phase_angle": 131.806, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 173.511, 128.150, 183.215 ], "x_axis": [ 0.333, 0.915, -0.228 ], "y_axis": [ 0.941, -0.337, 0.024 ], "z_axis": [ -0.055, -0.223, -0.973 ], "quaternion": [ 0.076, 0.813, 0.571, -0.087 ] } }, { "index": 39, "index_chain": 39, "chain_name": "I", "nt_resnum": 39, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/39", "linked_nts": [ "///I/38", "///I/40" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.956, "beta": 176.702, "gamma": 53.295, "delta": 136.476, "epsilon": -171.470, "zeta": -102.008, "epsilon_zeta": -69.463, "bb_type": "BI", "chi": -123.922, "glyco_bond": "anti", "C5prime_xyz": [ -2.047, 8.683, -1.159 ], "P_xyz": [ 0.279, 9.730, -0.591 ], "form": ".", "ssZp": 2.215, "Dp": 2.244, "splay_angle": 18.758, "splay_distance": 3.234, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 163.155, "theta": -137.402, "eta_prime": -170.869, "theta_prime": -149.964, "eta_base": -123.379, "theta_base": -119.196, "v0": -25.745, "v1": 35.677, "v2": -31.621, "v3": 17.626, "v4": 4.890, "amplitude": 35.357, "phase_angle": 153.423, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 172.772, 127.820, 180.110 ], "x_axis": [ 0.837, 0.538, -0.102 ], "y_axis": [ 0.548, -0.821, 0.161 ], "z_axis": [ 0.003, -0.190, -0.982 ], "quaternion": [ 0.092, 0.954, 0.285, -0.026 ] } }, { "index": 40, "index_chain": 40, "chain_name": "I", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/40", "linked_nts": [ "///I/39", "///I/41" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -59.024, "beta": -177.331, "gamma": 40.078, "delta": 143.820, "epsilon": -143.088, "zeta": -143.273, "epsilon_zeta": 0.186, "bb_type": "--", "chi": -107.196, "glyco_bond": "anti", "C5prime_xyz": [ -2.463, 8.336, -1.835 ], "P_xyz": [ -0.417, 9.927, -1.526 ], "form": "B", "ssZp": 1.825, "Dp": 1.852, "splay_angle": 18.907, "splay_distance": 3.182, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 173.683, "theta": -149.497, "eta_prime": -164.686, "theta_prime": -154.512, "eta_base": -127.368, "theta_base": -101.862, "v0": -29.059, "v1": 42.356, "v2": -38.687, "v3": 22.964, "v4": 3.553, "amplitude": 42.216, "phase_angle": 156.406, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 172.390, 128.092, 176.910 ], "x_axis": [ 1.000, 0.021, 0.001 ], "y_axis": [ 0.021, -0.992, 0.126 ], "z_axis": [ 0.003, -0.126, -0.992 ], "quaternion": [ 0.063, 0.998, 0.010, 0.001 ] } }, { "index": 41, "index_chain": 41, "chain_name": "I", "nt_resnum": 41, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/41", "linked_nts": [ "///I/40", "///I/42" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -37.360, "beta": 136.890, "gamma": 36.316, "delta": 139.238, "epsilon": -105.933, "zeta": 173.605, "epsilon_zeta": 80.462, "bb_type": "BII", "chi": -105.320, "glyco_bond": "anti", "C5prime_xyz": [ -2.920, 8.277, -1.941 ], "P_xyz": [ -0.530, 9.319, -2.042 ], "form": "B", "ssZp": 1.349, "Dp": 1.306, "splay_angle": 21.170, "splay_distance": 3.611, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -178.521, "theta": -159.484, "eta_prime": -155.179, "theta_prime": -165.220, "eta_base": -102.820, "theta_base": -125.544, "v0": -35.138, "v1": 45.188, "v2": -37.257, "v3": 18.117, "v4": 10.303, "amplitude": 44.081, "phase_angle": 147.691, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 173.054, 127.053, 173.977 ], "x_axis": [ 0.799, -0.595, 0.091 ], "y_axis": [ -0.598, -0.801, 0.012 ], "z_axis": [ 0.065, -0.064, -0.996 ], "quaternion": [ 0.020, 0.948, -0.315, 0.041 ] } }, { "index": 42, "index_chain": 42, "chain_name": "I", "nt_resnum": 42, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/42", "linked_nts": [ "///I/41", "///I/43" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -28.414, "beta": 126.756, "gamma": 10.879, "delta": 146.174, "epsilon": -97.412, "zeta": 169.239, "epsilon_zeta": 93.349, "bb_type": "BII", "chi": -88.360, "glyco_bond": "anti", "C5prime_xyz": [ -2.883, 7.853, -2.462 ], "P_xyz": [ -0.571, 9.071, -2.357 ], "form": ".", "ssZp": 0.944, "Dp": 0.942, "splay_angle": 24.912, "splay_distance": 4.287, "splay_ratio": 0.227, "d22": 5.226, "d64": 4.027, "eta": -176.248, "theta": -158.079, "eta_prime": -157.833, "theta_prime": -162.157, "eta_base": -121.750, "theta_base": -103.634, "v0": -29.796, "v1": 44.105, "v2": -40.716, "v3": 24.558, "v4": 2.974, "amplitude": 44.122, "phase_angle": 157.340, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 172.465, 126.876, 170.419 ], "x_axis": [ 0.360, -0.933, 0.025 ], "y_axis": [ -0.931, -0.361, -0.062 ], "z_axis": [ 0.067, -0.001, -0.998 ], "quaternion": [ -0.019, 0.824, -0.565, 0.028 ] } }, { "index": 43, "index_chain": 43, "chain_name": "I", "nt_resnum": 43, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/43", "linked_nts": [ "///I/42", "///I/44" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -47.722, "beta": 128.088, "gamma": 30.998, "delta": 149.132, "epsilon": -89.532, "zeta": 172.621, "epsilon_zeta": 97.847, "bb_type": "BII", "chi": -83.340, "glyco_bond": "anti", "C5prime_xyz": [ -2.891, 7.652, -2.612 ], "P_xyz": [ -0.358, 8.256, -2.875 ], "form": ".", "ssZp": 0.607, "Dp": 0.639, "splay_angle": 21.344, "splay_distance": 3.731, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -170.618, "theta": -162.416, "eta_prime": -144.608, "theta_prime": -176.326, "eta_base": -96.275, "theta_base": -114.360, "v0": -27.299, "v1": 43.157, "v2": -41.712, "v3": 27.150, "v4": -0.246, "amplitude": 43.996, "phase_angle": 161.458, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.165, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 170.622, 126.125, 166.622 ], "x_axis": [ -0.352, -0.932, -0.088 ], "y_axis": [ -0.930, 0.359, -0.083 ], "z_axis": [ 0.109, 0.052, -0.993 ], "quaternion": [ 0.060, -0.566, 0.822, -0.009 ] } }, { "index": 44, "index_chain": 44, "chain_name": "I", "nt_resnum": 44, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/44", "linked_nts": [ "///I/43", "///I/45" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -80.653, "beta": 134.626, "gamma": 47.955, "delta": 153.433, "epsilon": -85.457, "zeta": 171.064, "epsilon_zeta": 103.480, "bb_type": "BII", "chi": -90.589, "glyco_bond": "anti", "C5prime_xyz": [ -2.631, 7.849, -2.376 ], "P_xyz": [ -0.041, 8.168, -2.661 ], "form": ".", "ssZp": 0.366, "Dp": 0.518, "splay_angle": 21.670, "splay_distance": 3.663, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": -175.448, "theta": -158.947, "eta_prime": -148.453, "theta_prime": -177.121, "eta_base": -100.209, "theta_base": -118.024, "v0": -24.756, "v1": 42.810, "v2": -43.554, "v3": 30.589, "v4": -3.940, "amplitude": 44.858, "phase_angle": 166.155, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.265, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 169.470, 127.521, 163.360 ], "x_axis": [ -0.871, -0.467, -0.155 ], "y_axis": [ -0.470, 0.882, -0.015 ], "z_axis": [ 0.144, 0.060, -0.988 ], "quaternion": [ 0.078, -0.242, 0.967, 0.011 ] } }, { "index": 45, "index_chain": 45, "chain_name": "I", "nt_resnum": 45, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/45", "linked_nts": [ "///I/44", "///I/46" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.016, "beta": 152.274, "gamma": 18.746, "delta": 155.568, "epsilon": -160.747, "zeta": -148.505, "epsilon_zeta": -12.242, "bb_type": "--", "chi": -82.237, "glyco_bond": "anti", "C5prime_xyz": [ -2.003, 7.331, -2.678 ], "P_xyz": [ 0.458, 8.180, -2.560 ], "form": "B", "ssZp": 1.150, "Dp": 1.539, "splay_angle": 20.401, "splay_distance": 3.449, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.125, "theta": -141.349, "eta_prime": -172.437, "theta_prime": -161.404, "eta_base": -119.616, "theta_base": -120.489, "v0": -9.910, "v1": 31.004, "v2": -39.377, "v3": 34.605, "v4": -15.820, "amplitude": 39.498, "phase_angle": 184.487, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 170.165, 129.412, 160.301 ], "x_axis": [ -0.957, 0.259, -0.128 ], "y_axis": [ 0.242, 0.961, 0.132 ], "z_axis": [ 0.157, 0.095, -0.983 ], "quaternion": [ 0.072, 0.127, 0.988, 0.058 ] } }, { "index": 46, "index_chain": 46, "chain_name": "I", "nt_resnum": 46, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/46", "linked_nts": [ "///I/45", "///I/47" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -19.541, "beta": 137.900, "gamma": 24.777, "delta": 132.376, "epsilon": -160.880, "zeta": -134.329, "epsilon_zeta": -26.551, "bb_type": "--", "chi": -102.418, "glyco_bond": "anti", "C5prime_xyz": [ -2.684, 8.169, -2.190 ], "P_xyz": [ -0.340, 9.309, -2.157 ], "form": "B", "ssZp": 2.087, "Dp": 2.221, "splay_angle": 19.702, "splay_distance": 3.380, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 168.032, "theta": -151.096, "eta_prime": -172.043, "theta_prime": -164.799, "eta_base": -128.783, "theta_base": -128.406, "v0": -31.230, "v1": 38.219, "v2": -30.561, "v3": 13.456, "v4": 10.865, "amplitude": 37.495, "phase_angle": 144.594, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 170.869, 130.265, 157.034 ], "x_axis": [ -0.711, 0.703, 0.030 ], "y_axis": [ 0.694, 0.694, 0.192 ], "z_axis": [ 0.114, 0.158, -0.981 ], "quaternion": [ 0.023, 0.380, 0.920, 0.095 ] } }, { "index": 47, "index_chain": 47, "chain_name": "I", "nt_resnum": 47, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/47", "linked_nts": [ "///I/46", "///I/48" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -34.824, "beta": 145.263, "gamma": 39.424, "delta": 116.365, "epsilon": -175.958, "zeta": -104.441, "epsilon_zeta": -71.517, "bb_type": "BI", "chi": -124.690, "glyco_bond": "anti", "C5prime_xyz": [ -2.610, 8.662, -1.462 ], "P_xyz": [ -0.279, 9.819, -1.414 ], "form": "B", "ssZp": 2.666, "Dp": 2.667, "splay_angle": 21.890, "splay_distance": 3.638, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 168.553, "theta": -154.386, "eta_prime": -174.045, "theta_prime": -161.186, "eta_base": -131.194, "theta_base": -119.172, "v0": -36.192, "v1": 32.927, "v2": -17.801, "v3": -2.420, "v4": 24.164, "amplitude": 35.830, "phase_angle": 119.789, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 171.008, 130.794, 153.699 ], "x_axis": [ -0.271, 0.942, 0.196 ], "y_axis": [ 0.959, 0.247, 0.140 ], "z_axis": [ 0.084, 0.226, -0.971 ], "quaternion": [ -0.035, 0.603, 0.789, 0.116 ] } }, { "index": 48, "index_chain": 48, "chain_name": "I", "nt_resnum": 48, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/48", "linked_nts": [ "///I/47", "///I/49" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.657, "beta": 176.933, "gamma": 45.550, "delta": 139.227, "epsilon": -167.117, "zeta": -105.401, "epsilon_zeta": -61.716, "bb_type": "BI", "chi": -117.195, "glyco_bond": "anti", "C5prime_xyz": [ -1.847, 8.552, -1.434 ], "P_xyz": [ 0.528, 9.528, -0.926 ], "form": "B", "ssZp": 2.184, "Dp": 2.186, "splay_angle": 20.307, "splay_distance": 3.436, "splay_ratio": 0.176, "d22": 4.353, "d64": 3.768, "eta": 173.822, "theta": -136.661, "eta_prime": -163.388, "theta_prime": -147.736, "eta_base": -115.957, "theta_base": -111.117, "v0": -21.964, "v1": 33.744, "v2": -32.073, "v3": 20.258, "v4": 0.874, "amplitude": 34.176, "phase_angle": 159.797, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 171.105, 132.074, 150.295 ], "x_axis": [ 0.375, 0.869, 0.323 ], "y_axis": [ 0.920, -0.392, -0.015 ], "z_axis": [ 0.113, 0.303, -0.946 ], "quaternion": [ -0.096, 0.824, 0.543, 0.132 ] } }, { "index": 49, "index_chain": 49, "chain_name": "I", "nt_resnum": 49, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/49", "linked_nts": [ "///I/48", "///I/50" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.413, "beta": 175.917, "gamma": 45.131, "delta": 137.875, "epsilon": -164.938, "zeta": -115.180, "epsilon_zeta": -49.757, "bb_type": "BI", "chi": -109.998, "glyco_bond": "anti", "C5prime_xyz": [ -2.252, 8.429, -1.797 ], "P_xyz": [ 0.042, 9.671, -1.634 ], "form": "B", "ssZp": 2.170, "Dp": 2.192, "splay_angle": 20.955, "splay_distance": 3.537, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 165.376, "theta": -145.070, "eta_prime": -168.718, "theta_prime": -155.943, "eta_base": -124.313, "theta_base": -113.882, "v0": -26.909, "v1": 37.299, "v2": -33.012, "v3": 18.436, "v4": 5.080, "amplitude": 36.916, "phase_angle": 153.412, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 171.488, 133.460, 147.174 ], "x_axis": [ 0.821, 0.466, 0.329 ], "y_axis": [ 0.549, -0.802, -0.234 ], "z_axis": [ 0.155, 0.373, -0.915 ], "quaternion": [ -0.161, 0.941, 0.270, 0.129 ] } }, { "index": 50, "index_chain": 50, "chain_name": "I", "nt_resnum": 50, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/50", "linked_nts": [ "///I/49", "///I/51" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.308, "beta": 165.723, "gamma": 50.515, "delta": 124.218, "epsilon": -174.194, "zeta": -99.379, "epsilon_zeta": -74.814, "bb_type": "BI", "chi": -117.141, "glyco_bond": "anti", "C5prime_xyz": [ -2.312, 8.532, -1.690 ], "P_xyz": [ 0.077, 9.590, -1.779 ], "form": "B", "ssZp": 2.420, "Dp": 2.482, "splay_angle": 19.904, "splay_distance": 3.374, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 167.655, "theta": -144.084, "eta_prime": -170.263, "theta_prime": -152.722, "eta_base": -121.634, "theta_base": -108.399, "v0": -29.567, "v1": 31.753, "v2": -22.179, "v3": 5.813, "v4": 14.771, "amplitude": 31.833, "phase_angle": 134.165, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 172.524, 134.926, 144.126 ], "x_axis": [ 0.978, -0.124, 0.167 ], "y_axis": [ -0.041, -0.903, -0.427 ], "z_axis": [ 0.204, 0.411, -0.889 ], "quaternion": [ -0.216, 0.971, -0.043, 0.096 ] } }, { "index": 51, "index_chain": 51, "chain_name": "I", "nt_resnum": 51, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/51", "linked_nts": [ "///I/50", "///I/52" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -50.299, "beta": 169.490, "gamma": 48.705, "delta": 146.584, "epsilon": -105.714, "zeta": -168.804, "epsilon_zeta": 63.089, "bb_type": "BII", "chi": -104.380, "glyco_bond": "anti", "C5prime_xyz": [ -2.614, 8.322, -1.907 ], "P_xyz": [ -0.343, 9.607, -1.969 ], "form": "B", "ssZp": 1.098, "Dp": 1.136, "splay_angle": 20.526, "splay_distance": 3.485, "splay_ratio": 0.180, "d22": 4.990, "d64": 4.062, "eta": -168.023, "theta": -154.354, "eta_prime": -143.300, "theta_prime": -159.291, "eta_base": -99.063, "theta_base": -123.714, "v0": -30.954, "v1": 45.033, "v2": -41.007, "v3": 24.336, "v4": 3.780, "amplitude": 44.788, "phase_angle": 156.289, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 174.170, 135.893, 141.345 ], "x_axis": [ 0.763, -0.639, -0.100 ], "y_axis": [ -0.578, -0.604, -0.548 ], "z_axis": [ 0.290, 0.476, -0.830 ], "quaternion": [ -0.287, 0.894, -0.340, 0.053 ] } }, { "index": 52, "index_chain": 52, "chain_name": "I", "nt_resnum": 52, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/52", "linked_nts": [ "///I/51", "///I/53" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -44.588, "beta": 138.720, "gamma": 16.763, "delta": 150.185, "epsilon": -88.830, "zeta": 155.900, "epsilon_zeta": 115.271, "bb_type": "BII", "chi": -80.662, "glyco_bond": "anti", "C5prime_xyz": [ -3.194, 7.529, -2.595 ], "P_xyz": [ -0.972, 8.858, -2.989 ], "form": ".", "ssZp": 0.873, "Dp": 0.859, "splay_angle": 23.416, "splay_distance": 3.927, "splay_ratio": 0.210, "d22": 4.961, "d64": 3.745, "eta": -179.753, "theta": -167.512, "eta_prime": -157.434, "theta_prime": -175.048, "eta_base": -126.015, "theta_base": -101.979, "v0": -30.269, "v1": 46.353, "v2": -43.646, "v3": 27.424, "v4": 1.434, "amplitude": 46.643, "phase_angle": 159.348, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 174.342, 137.777, 138.418 ], "x_axis": [ 0.393, -0.814, -0.428 ], "y_axis": [ -0.856, -0.155, -0.492 ], "z_axis": [ 0.334, 0.560, -0.758 ], "quaternion": [ -0.347, 0.759, -0.550, -0.031 ] } }, { "index": 53, "index_chain": 53, "chain_name": "I", "nt_resnum": 53, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/53", "linked_nts": [ "///I/52", "///I/54" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.699, "beta": 132.267, "gamma": 27.963, "delta": 150.157, "epsilon": -88.878, "zeta": 174.415, "epsilon_zeta": 96.707, "bb_type": "BII", "chi": -85.113, "glyco_bond": "anti", "C5prime_xyz": [ -2.706, 7.713, -2.577 ], "P_xyz": [ -0.183, 8.395, -2.708 ], "form": ".", "ssZp": 0.494, "Dp": 0.548, "splay_angle": 21.673, "splay_distance": 3.773, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -169.026, "theta": -159.284, "eta_prime": -145.760, "theta_prime": -172.443, "eta_base": -84.166, "theta_base": -110.774, "v0": -25.522, "v1": 42.284, "v2": -42.096, "v3": 28.481, "v4": -2.147, "amplitude": 43.795, "phase_angle": 163.989, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.147, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 173.752, 139.030, 134.743 ], "x_axis": [ -0.346, -0.592, -0.728 ], "y_axis": [ -0.847, 0.530, -0.028 ], "z_axis": [ 0.403, 0.607, -0.685 ], "quaternion": [ 0.353, -0.450, 0.800, 0.181 ] } }, { "index": 54, "index_chain": 54, "chain_name": "I", "nt_resnum": 54, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/54", "linked_nts": [ "///I/53", "///I/55" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -76.797, "beta": 129.408, "gamma": 46.637, "delta": 148.989, "epsilon": -96.561, "zeta": 166.514, "epsilon_zeta": 96.925, "bb_type": "BII", "chi": -92.741, "glyco_bond": "anti", "C5prime_xyz": [ -2.806, 7.907, -2.308 ], "P_xyz": [ -0.238, 8.292, -2.663 ], "form": "B", "ssZp": 0.825, "Dp": 0.904, "splay_angle": 20.341, "splay_distance": 3.451, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 178.879, "theta": -162.896, "eta_prime": -153.639, "theta_prime": 178.794, "eta_base": -102.613, "theta_base": -125.879, "v0": -29.204, "v1": 44.652, "v2": -42.116, "v3": 26.592, "v4": 1.294, "amplitude": 44.974, "phase_angle": 159.463, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.216, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 173.678, 142.299, 132.860 ], "x_axis": [ -0.783, -0.072, -0.618 ], "y_axis": [ -0.430, 0.781, 0.453 ], "z_axis": [ 0.450, 0.620, -0.643 ], "quaternion": [ 0.298, -0.140, 0.895, 0.300 ] } }, { "index": 55, "index_chain": 55, "chain_name": "I", "nt_resnum": 55, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/55", "linked_nts": [ "///I/54", "///I/56" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.545, "beta": 144.540, "gamma": 14.979, "delta": 148.711, "epsilon": -173.713, "zeta": -130.005, "epsilon_zeta": -43.708, "bb_type": "BI", "chi": -94.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.912, 7.851, -2.271 ], "P_xyz": [ 0.491, 8.718, -1.760 ], "form": "B", "ssZp": 1.675, "Dp": 1.841, "splay_angle": 20.075, "splay_distance": 3.411, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 160.801, "theta": -141.829, "eta_prime": -176.681, "theta_prime": -161.123, "eta_base": -123.512, "theta_base": -130.681, "v0": -13.451, "v1": 31.200, "v2": -36.113, "v3": 29.147, "v4": -10.122, "amplitude": 36.155, "phase_angle": 177.228, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 175.434, 145.057, 131.759 ], "x_axis": [ -0.886, 0.432, -0.168 ], "y_axis": [ 0.143, 0.599, 0.788 ], "z_axis": [ 0.441, 0.674, -0.592 ], "quaternion": [ 0.173, 0.164, 0.877, 0.417 ] } }, { "index": 56, "index_chain": 56, "chain_name": "I", "nt_resnum": 56, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/56", "linked_nts": [ "///I/55", "///I/57" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,phosphate", "alpha": -20.851, "beta": 163.605, "gamma": 18.363, "delta": 143.234, "epsilon": -156.986, "zeta": -134.953, "epsilon_zeta": -22.033, "bb_type": "--", "chi": -105.928, "glyco_bond": "anti", "C5prime_xyz": [ -2.223, 8.276, -1.886 ], "P_xyz": [ -0.141, 9.765, -1.415 ], "form": "B", "ssZp": 1.843, "Dp": 1.907, "splay_angle": 22.550, "splay_distance": 3.871, "splay_ratio": 0.196, "d22": 4.403, "d64": 3.832, "eta": 175.995, "theta": -140.206, "eta_prime": -166.959, "theta_prime": -147.959, "eta_base": -132.175, "theta_base": -117.326, "v0": -23.006, "v1": 36.905, "v2": -36.053, "v3": 23.675, "v4": -0.691, "amplitude": 37.857, "phase_angle": 162.237, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 177.225, 146.837, 129.464 ], "x_axis": [ -0.737, 0.631, 0.244 ], "y_axis": [ 0.527, 0.310, 0.791 ], "z_axis": [ 0.423, 0.712, -0.561 ], "quaternion": [ 0.055, 0.359, 0.807, 0.465 ] } }, { "index": 57, "index_chain": 57, "chain_name": "I", "nt_resnum": 57, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/57", "linked_nts": [ "///I/56", "///I/58" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 10.899, "beta": 161.549, "gamma": -23.421, "delta": 158.936, "epsilon": -149.845, "zeta": -142.831, "epsilon_zeta": -7.015, "bb_type": "--", "chi": -91.577, "glyco_bond": "anti", "C5prime_xyz": [ -2.053, 7.795, -2.226 ], "P_xyz": [ -0.396, 9.781, -2.034 ], "form": "B", "ssZp": 1.546, "Dp": 1.605, "splay_angle": 21.283, "splay_distance": 3.584, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 171.614, "theta": -153.891, "eta_prime": -167.721, "theta_prime": -157.543, "eta_base": -133.370, "theta_base": -110.411, "v0": -13.379, "v1": 35.223, "v2": -42.357, "v3": 35.881, "v4": -14.253, "amplitude": 42.360, "phase_angle": 180.673, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 178.677, 149.645, 127.230 ], "x_axis": [ -0.445, 0.547, 0.709 ], "y_axis": [ 0.824, -0.061, 0.564 ], "z_axis": [ 0.352, 0.835, -0.423 ], "quaternion": [ -0.133, 0.510, 0.672, 0.520 ] } }, { "index": 58, "index_chain": 58, "chain_name": "I", "nt_resnum": 58, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/58", "linked_nts": [ "///I/57", "///I/59" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -36.471, "beta": 147.095, "gamma": 29.393, "delta": 133.814, "epsilon": -168.261, "zeta": -113.311, "epsilon_zeta": -54.950, "bb_type": "BI", "chi": -106.890, "glyco_bond": "anti", "C5prime_xyz": [ -2.390, 8.300, -1.975 ], "P_xyz": [ 0.025, 9.301, -1.855 ], "form": "B", "ssZp": 2.253, "Dp": 2.312, "splay_angle": 19.761, "splay_distance": 3.464, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 161.742, "theta": -138.837, "eta_prime": -174.585, "theta_prime": -154.928, "eta_base": -123.529, "theta_base": -119.788, "v0": -26.758, "v1": 35.069, "v2": -29.621, "v3": 15.047, "v4": 7.157, "amplitude": 34.417, "phase_angle": 149.389, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 180.389, 152.706, 126.491 ], "x_axis": [ 0.070, 0.261, 0.963 ], "y_axis": [ 0.923, -0.382, 0.036 ], "z_axis": [ 0.378, 0.886, -0.267 ], "quaternion": [ -0.324, 0.656, 0.451, 0.511 ] } }, { "index": 59, "index_chain": 59, "chain_name": "I", "nt_resnum": 59, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/59", "linked_nts": [ "///I/58", "///I/60" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.231, "beta": 159.308, "gamma": 39.021, "delta": 115.044, "epsilon": 179.594, "zeta": -96.531, "epsilon_zeta": -83.875, "bb_type": "BI", "chi": -126.157, "glyco_bond": "anti", "C5prime_xyz": [ -2.657, 8.672, -1.399 ], "P_xyz": [ -0.514, 10.148, -1.282 ], "form": "B", "ssZp": 2.745, "Dp": 2.715, "splay_angle": 21.338, "splay_distance": 3.601, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 166.509, "theta": -156.653, "eta_prime": -173.932, "theta_prime": -160.871, "eta_base": -129.473, "theta_base": -126.472, "v0": -35.992, "v1": 31.955, "v2": -16.420, "v3": -3.616, "v4": 24.740, "amplitude": 35.337, "phase_angle": 117.689, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 181.338, 156.029, 126.258 ], "x_axis": [ 0.476, -0.085, 0.875 ], "y_axis": [ 0.764, -0.454, -0.459 ], "z_axis": [ 0.436, 0.887, -0.151 ], "quaternion": [ -0.467, 0.721, 0.235, 0.455 ] } }, { "index": 60, "index_chain": 60, "chain_name": "I", "nt_resnum": 60, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/60", "linked_nts": [ "///I/59", "///I/61" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.882, "beta": -175.289, "gamma": 46.298, "delta": 138.261, "epsilon": -165.914, "zeta": -108.780, "epsilon_zeta": -57.134, "bb_type": "BI", "chi": -112.473, "glyco_bond": "anti", "C5prime_xyz": [ -2.202, 8.434, -1.683 ], "P_xyz": [ 0.005, 9.784, -1.305 ], "form": "B", "ssZp": 2.173, "Dp": 2.184, "splay_angle": 20.073, "splay_distance": 3.433, "splay_ratio": 0.175, "d22": 4.214, "d64": 3.773, "eta": 176.395, "theta": -139.007, "eta_prime": -162.705, "theta_prime": -147.971, "eta_base": -123.953, "theta_base": -103.786, "v0": -26.070, "v1": 36.949, "v2": -33.242, "v3": 19.099, "v4": 4.126, "amplitude": 36.726, "phase_angle": 154.845, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 182.533, 159.424, 126.386 ], "x_axis": [ 0.801, -0.355, 0.481 ], "y_axis": [ 0.399, -0.283, -0.872 ], "z_axis": [ 0.446, 0.891, -0.085 ], "quaternion": [ 0.599, -0.736, -0.015, -0.315 ] } }, { "index": 61, "index_chain": 61, "chain_name": "I", "nt_resnum": 61, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/61", "linked_nts": [ "///I/60", "///I/62" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -49.088, "beta": 167.158, "gamma": 40.572, "delta": 139.044, "epsilon": -127.926, "zeta": -165.656, "epsilon_zeta": 37.729, "bb_type": "BII", "chi": -104.690, "glyco_bond": "anti", "C5prime_xyz": [ -2.698, 8.320, -1.958 ], "P_xyz": [ -0.518, 9.743, -2.108 ], "form": "B", "ssZp": 1.754, "Dp": 1.734, "splay_angle": 22.708, "splay_distance": 3.871, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 179.884, "theta": -163.045, "eta_prime": -157.479, "theta_prime": -164.821, "eta_base": -109.852, "theta_base": -116.817, "v0": -32.618, "v1": 42.973, "v2": -36.172, "v3": 18.471, "v4": 8.548, "amplitude": 41.996, "phase_angle": 149.465, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 184.860, 161.943, 126.547 ], "x_axis": [ 0.874, -0.467, -0.135 ], "y_axis": [ -0.112, 0.076, -0.991 ], "z_axis": [ 0.473, 0.881, 0.014 ], "quaternion": [ 0.701, -0.668, 0.217, -0.127 ] } }, { "index": 62, "index_chain": 62, "chain_name": "I", "nt_resnum": 62, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/62", "linked_nts": [ "///I/61", "///I/63" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -37.137, "beta": 124.651, "gamma": 42.107, "delta": 136.495, "epsilon": -142.940, "zeta": -160.250, "epsilon_zeta": 17.309, "bb_type": "--", "chi": -108.289, "glyco_bond": "anti", "C5prime_xyz": [ -2.851, 8.352, -1.886 ], "P_xyz": [ -0.336, 9.039, -1.916 ], "form": "B", "ssZp": 1.970, "Dp": 2.000, "splay_angle": 22.493, "splay_distance": 3.754, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 172.222, "theta": -148.966, "eta_prime": -160.456, "theta_prime": -163.246, "eta_base": -113.063, "theta_base": -122.340, "v0": -35.020, "v1": 43.739, "v2": -35.349, "v3": 16.157, "v4": 11.463, "amplitude": 42.763, "phase_angle": 145.754, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.023, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 186.460, 165.345, 125.625 ], "x_axis": [ 0.662, -0.296, -0.689 ], "y_axis": [ -0.606, 0.329, -0.724 ], "z_axis": [ 0.441, 0.896, 0.038 ], "quaternion": [ 0.712, -0.569, 0.397, 0.109 ] } }, { "index": 63, "index_chain": 63, "chain_name": "I", "nt_resnum": 63, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/63", "linked_nts": [ "///I/62", "///I/64" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -22.220, "beta": 134.305, "gamma": 29.594, "delta": 143.582, "epsilon": -89.620, "zeta": 154.093, "epsilon_zeta": 116.287, "bb_type": "BII", "chi": -100.374, "glyco_bond": "anti", "C5prime_xyz": [ -2.844, 8.148, -2.070 ], "P_xyz": [ -0.449, 9.180, -1.937 ], "form": ".", "ssZp": 0.796, "Dp": 0.831, "splay_angle": 20.415, "splay_distance": 3.639, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -163.916, "theta": -177.545, "eta_prime": -145.347, "theta_prime": 176.302, "eta_base": -108.071, "theta_base": -118.255, "v0": -31.994, "v1": 44.693, "v2": -39.600, "v3": 22.366, "v4": 5.625, "amplitude": 44.131, "phase_angle": 153.809, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 187.827, 168.842, 125.617 ], "x_axis": [ 0.227, -0.005, -0.974 ], "y_axis": [ -0.865, 0.458, -0.203 ], "z_axis": [ 0.447, 0.889, 0.100 ], "quaternion": [ 0.668, -0.409, 0.532, 0.322 ] } }, { "index": 64, "index_chain": 64, "chain_name": "I", "nt_resnum": 64, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/64", "linked_nts": [ "///I/63", "///I/65" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.295, "beta": 150.168, "gamma": 20.979, "delta": 154.228, "epsilon": -171.586, "zeta": -120.639, "epsilon_zeta": -50.947, "bb_type": "BI", "chi": -87.020, "glyco_bond": "--", "C5prime_xyz": [ -1.587, 7.427, -2.496 ], "P_xyz": [ 0.939, 7.911, -2.041 ], "form": "B", "ssZp": 1.174, "Dp": 1.631, "splay_angle": 18.961, "splay_distance": 3.216, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 169.992, "theta": -129.681, "eta_prime": -164.910, "theta_prime": -152.804, "eta_base": -105.034, "theta_base": -106.150, "v0": -3.907, "v1": 25.260, "v2": -35.914, "v3": 34.416, "v4": -19.511, "amplitude": 36.804, "phase_angle": 192.626, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.095, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 187.595, 172.224, 126.937 ], "x_axis": [ -0.372, 0.547, -0.750 ], "y_axis": [ -0.778, 0.257, 0.574 ], "z_axis": [ 0.506, 0.797, 0.330 ], "quaternion": [ 0.551, -0.101, 0.570, 0.601 ] } }, { "index": 65, "index_chain": 65, "chain_name": "I", "nt_resnum": 65, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/65", "linked_nts": [ "///I/64", "///I/66" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.981, "beta": 150.287, "gamma": 45.510, "delta": 145.438, "epsilon": -120.040, "zeta": 178.846, "epsilon_zeta": 61.114, "bb_type": "BII", "chi": -104.642, "glyco_bond": "anti", "C5prime_xyz": [ -2.780, 8.291, -1.904 ], "P_xyz": [ -0.412, 9.342, -2.082 ], "form": "B", "ssZp": 1.514, "Dp": 1.535, "splay_angle": 20.252, "splay_distance": 3.399, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 177.388, "theta": -168.828, "eta_prime": -155.129, "theta_prime": -178.370, "eta_base": -108.063, "theta_base": -131.912, "v0": -32.883, "v1": 46.102, "v2": -40.916, "v3": 23.240, "v4": 5.630, "amplitude": 45.517, "phase_angle": 154.016, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 188.427, 175.108, 128.093 ], "x_axis": [ -0.748, 0.572, -0.337 ], "y_axis": [ -0.450, -0.064, 0.891 ], "z_axis": [ 0.488, 0.818, 0.305 ], "quaternion": [ 0.351, 0.052, 0.587, 0.728 ] } }, { "index": 66, "index_chain": 66, "chain_name": "I", "nt_resnum": 66, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/66", "linked_nts": [ "///I/65", "///I/67" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -39.737, "beta": 143.881, "gamma": 19.340, "delta": 147.162, "epsilon": -168.810, "zeta": -109.770, "epsilon_zeta": -59.040, "bb_type": "BI", "chi": -108.418, "glyco_bond": "anti", "C5prime_xyz": [ -1.758, 8.254, -1.690 ], "P_xyz": [ 0.593, 8.948, -0.801 ], "form": "B", "ssZp": 1.832, "Dp": 1.921, "splay_angle": 19.981, "splay_distance": 3.468, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 164.553, "theta": -124.435, "eta_prime": -175.165, "theta_prime": -143.068, "eta_base": -127.075, "theta_base": -104.025, "v0": -16.145, "v1": 32.630, "v2": -35.919, "v3": 27.442, "v4": -7.334, "amplitude": 36.206, "phase_angle": 172.783, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 190.600, 177.163, 129.709 ], "x_axis": [ -0.897, 0.367, 0.247 ], "y_axis": [ 0.047, -0.477, 0.878 ], "z_axis": [ 0.440, 0.799, 0.410 ], "quaternion": [ 0.096, 0.206, 0.502, 0.834 ] } }, { "index": 67, "index_chain": 67, "chain_name": "I", "nt_resnum": 67, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/67", "linked_nts": [ "///I/66", "///I/68" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -32.326, "beta": 174.300, "gamma": 16.099, "delta": 142.955, "epsilon": -161.716, "zeta": -136.699, "epsilon_zeta": -25.017, "bb_type": "--", "chi": -108.491, "glyco_bond": "anti", "C5prime_xyz": [ -2.097, 8.382, -1.785 ], "P_xyz": [ -0.189, 10.069, -1.254 ], "form": "B", "ssZp": 1.908, "Dp": 1.965, "splay_angle": 19.359, "splay_distance": 3.248, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 168.040, "theta": -155.002, "eta_prime": -168.013, "theta_prime": -162.060, "eta_base": -120.080, "theta_base": -124.750, "v0": -22.536, "v1": 36.268, "v2": -35.482, "v3": 23.493, "v4": -0.928, "amplitude": 37.200, "phase_angle": 162.523, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 191.470, 180.245, 131.042 ], "x_axis": [ -0.766, -0.084, 0.637 ], "y_axis": [ 0.537, -0.628, 0.563 ], "z_axis": [ 0.353, 0.774, 0.526 ], "quaternion": [ -0.182, 0.290, 0.391, 0.855 ] } }, { "index": 68, "index_chain": 68, "chain_name": "I", "nt_resnum": 68, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/68", "linked_nts": [ "///I/67", "///I/69" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 12.146, "beta": 177.423, "gamma": -30.663, "delta": 155.635, "epsilon": 177.292, "zeta": -93.763, "epsilon_zeta": -88.945, "bb_type": "BI", "chi": -105.979, "glyco_bond": "anti", "C5prime_xyz": [ -1.094, 7.768, -1.604 ], "P_xyz": [ 0.786, 9.488, -1.129 ], "form": "B", "ssZp": 1.711, "Dp": 1.859, "splay_angle": 18.290, "splay_distance": 3.176, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 171.299, "theta": -143.949, "eta_prime": -172.293, "theta_prime": -151.747, "eta_base": -130.817, "theta_base": -117.078, "v0": 4.587, "v1": 17.101, "v2": -30.871, "v3": 34.379, "v4": -24.816, "amplitude": 34.396, "phase_angle": 206.166, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 192.776, 182.896, 132.390 ], "x_axis": [ -0.356, -0.547, 0.758 ], "y_axis": [ 0.881, -0.466, 0.078 ], "z_axis": [ 0.310, 0.696, 0.648 ], "quaternion": [ -0.454, 0.340, 0.246, 0.786 ] } }, { "index": 69, "index_chain": 69, "chain_name": "I", "nt_resnum": 69, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/69", "linked_nts": [ "///I/68", "///I/70" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.638, "beta": 179.775, "gamma": 32.370, "delta": 133.477, "epsilon": -177.144, "zeta": -111.166, "epsilon_zeta": -65.978, "bb_type": "BI", "chi": -109.604, "glyco_bond": "anti", "C5prime_xyz": [ -2.245, 8.378, -1.889 ], "P_xyz": [ -0.212, 9.987, -1.609 ], "form": "B", "ssZp": 2.146, "Dp": 2.230, "splay_angle": 18.449, "splay_distance": 3.103, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 165.361, "theta": -156.905, "eta_prime": -168.478, "theta_prime": -163.470, "eta_base": -127.634, "theta_base": -123.988, "v0": -26.165, "v1": 34.766, "v2": -29.908, "v3": 15.643, "v4": 6.348, "amplitude": 34.292, "phase_angle": 150.708, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 193.266, 185.266, 134.448 ], "x_axis": [ 0.117, -0.710, 0.695 ], "y_axis": [ 0.949, -0.127, -0.290 ], "z_axis": [ 0.294, 0.693, 0.658 ], "quaternion": [ 0.642, -0.383, -0.156, -0.646 ] } }, { "index": 70, "index_chain": 70, "chain_name": "I", "nt_resnum": 70, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/70", "linked_nts": [ "///I/69", "///I/71" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.324, "beta": 177.358, "gamma": 35.639, "delta": 140.623, "epsilon": -168.423, "zeta": -120.507, "epsilon_zeta": -47.917, "bb_type": "BI", "chi": -107.603, "glyco_bond": "anti", "C5prime_xyz": [ -2.106, 8.347, -1.835 ], "P_xyz": [ 0.130, 9.636, -1.511 ], "form": "B", "ssZp": 2.152, "Dp": 2.187, "splay_angle": 19.202, "splay_distance": 3.215, "splay_ratio": 0.167, "d22": 4.352, "d64": 3.693, "eta": 170.906, "theta": -149.918, "eta_prime": -169.077, "theta_prime": -157.982, "eta_base": -125.081, "theta_base": -122.093, "v0": -23.223, "v1": 35.462, "v2": -33.496, "v3": 20.925, "v4": 1.196, "amplitude": 35.808, "phase_angle": 159.299, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 193.846, 187.334, 136.687 ], "x_axis": [ 0.623, -0.672, 0.399 ], "y_axis": [ 0.737, 0.333, -0.588 ], "z_axis": [ 0.262, 0.661, 0.703 ], "quaternion": [ 0.815, -0.383, -0.042, -0.432 ] } }, { "index": 71, "index_chain": 71, "chain_name": "I", "nt_resnum": 71, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/71", "linked_nts": [ "///I/70", "///I/72" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.894, "beta": 163.889, "gamma": 46.128, "delta": 147.889, "epsilon": -124.937, "zeta": -150.926, "epsilon_zeta": 25.990, "bb_type": "--", "chi": -105.797, "glyco_bond": "anti", "C5prime_xyz": [ -2.521, 8.300, -1.824 ], "P_xyz": [ -0.171, 9.432, -1.761 ], "form": "B", "ssZp": 1.489, "Dp": 1.514, "splay_angle": 24.035, "splay_distance": 4.010, "splay_ratio": 0.211, "d22": 4.820, "d64": 3.726, "eta": -177.873, "theta": -135.569, "eta_prime": -155.396, "theta_prime": -142.895, "eta_base": -118.542, "theta_base": -87.011, "v0": -28.820, "v1": 43.802, "v2": -41.169, "v3": 25.633, "v4": 1.675, "amplitude": 44.101, "phase_angle": 158.990, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 194.622, 189.403, 139.022 ], "x_axis": [ 0.911, -0.411, 0.020 ], "y_axis": [ 0.322, 0.682, -0.657 ], "z_axis": [ 0.257, 0.605, 0.754 ], "quaternion": [ 0.915, -0.345, 0.065, -0.200 ] } }, { "index": 72, "index_chain": 72, "chain_name": "I", "nt_resnum": 72, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/72", "linked_nts": [ "///I/71", "///I/73" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -30.198, "beta": 132.071, "gamma": 26.036, "delta": 146.547, "epsilon": -90.616, "zeta": 157.431, "epsilon_zeta": 111.953, "bb_type": "BII", "chi": -80.067, "glyco_bond": "anti", "C5prime_xyz": [ -3.324, 7.546, -2.600 ], "P_xyz": [ -0.981, 8.570, -3.154 ], "form": "B", "ssZp": 0.944, "Dp": 0.913, "splay_angle": 21.683, "splay_distance": 3.682, "splay_ratio": 0.191, "d22": 4.999, "d64": 3.989, "eta": -178.113, "theta": -170.193, "eta_prime": -146.543, "theta_prime": 179.073, "eta_base": -94.915, "theta_base": -138.179, "v0": -31.996, "v1": 46.183, "v2": -41.782, "v3": 24.645, "v4": 4.166, "amplitude": 45.795, "phase_angle": 155.834, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 196.963, 192.369, 140.363 ], "x_axis": [ 0.887, 0.175, -0.427 ], "y_axis": [ -0.352, 0.856, -0.379 ], "z_axis": [ 0.299, 0.487, 0.821 ], "quaternion": [ 0.944, -0.229, 0.192, 0.139 ] } }, { "index": 73, "index_chain": 73, "chain_name": "I", "nt_resnum": 73, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/73", "linked_nts": [ "///I/72", "///I/74" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -53.100, "beta": 144.155, "gamma": 13.377, "delta": 153.994, "epsilon": -86.221, "zeta": 172.395, "epsilon_zeta": 101.383, "bb_type": "BII", "chi": -82.990, "glyco_bond": "anti", "C5prime_xyz": [ -2.747, 7.587, -2.569 ], "P_xyz": [ -0.462, 8.878, -2.648 ], "form": "B", "ssZp": 0.517, "Dp": 0.522, "splay_angle": 25.190, "splay_distance": 4.225, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": -169.644, "theta": -150.220, "eta_prime": -154.829, "theta_prime": -159.216, "eta_base": -121.525, "theta_base": -96.716, "v0": -23.904, "v1": 42.206, "v2": -43.300, "v3": 30.686, "v4": -4.515, "amplitude": 44.450, "phase_angle": 166.942, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 196.986, 194.405, 143.431 ], "x_axis": [ 0.578, 0.621, -0.529 ], "y_axis": [ -0.765, 0.638, -0.087 ], "z_axis": [ 0.284, 0.455, 0.844 ], "quaternion": [ 0.875, -0.155, 0.232, 0.396 ] } }, { "index": 74, "index_chain": 74, "chain_name": "I", "nt_resnum": 74, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/74", "linked_nts": [ "///I/73", "///I/75" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -57.261, "beta": 120.229, "gamma": 35.833, "delta": 135.924, "epsilon": -98.402, "zeta": 161.664, "epsilon_zeta": 99.934, "bb_type": "BII", "chi": -93.212, "glyco_bond": "anti", "C5prime_xyz": [ -3.363, 7.823, -2.353 ], "P_xyz": [ -0.951, 8.673, -2.888 ], "form": "B", "ssZp": 1.219, "Dp": 1.188, "splay_angle": 20.856, "splay_distance": 3.564, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": -177.626, "theta": -172.619, "eta_prime": -153.539, "theta_prime": 175.436, "eta_base": -98.591, "theta_base": -136.715, "v0": -37.860, "v1": 46.150, "v2": -36.134, "v3": 15.567, "v4": 13.549, "amplitude": 44.893, "phase_angle": 143.600, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.053, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 196.663, 197.675, 146.088 ], "x_axis": [ -0.080, 0.912, -0.403 ], "y_axis": [ -0.960, 0.038, 0.277 ], "z_axis": [ 0.268, 0.409, 0.872 ], "quaternion": [ 0.676, -0.049, 0.248, 0.692 ] } }, { "index": 75, "index_chain": 75, "chain_name": "I", "nt_resnum": 75, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/75", "linked_nts": [ "///I/74", "///I/76" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -49.689, "beta": 129.388, "gamma": 23.641, "delta": 128.526, "epsilon": -172.359, "zeta": -111.298, "epsilon_zeta": -61.061, "bb_type": "BI", "chi": -111.628, "glyco_bond": "anti", "C5prime_xyz": [ -2.401, 8.407, -1.904 ], "P_xyz": [ 0.010, 9.329, -1.488 ], "form": "B", "ssZp": 2.255, "Dp": 2.349, "splay_angle": 20.648, "splay_distance": 3.564, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.082, "theta": -142.836, "eta_prime": -179.271, "theta_prime": -158.170, "eta_base": -130.954, "theta_base": -120.914, "v0": -30.713, "v1": 35.657, "v2": -27.196, "v3": 10.217, "v4": 12.651, "amplitude": 35.205, "phase_angle": 140.579, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.012, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 197.256, 198.441, 149.517 ], "x_axis": [ -0.609, 0.771, -0.187 ], "y_axis": [ -0.768, -0.513, 0.383 ], "z_axis": [ 0.199, 0.377, 0.905 ], "quaternion": [ 0.442, 0.003, 0.218, 0.870 ] } }, { "index": 76, "index_chain": 76, "chain_name": "I", "nt_resnum": 76, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/76", "linked_nts": [ "///I/75", "///I/77" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.484, "beta": 158.810, "gamma": 57.944, "delta": 123.632, "epsilon": -150.665, "zeta": -116.943, "epsilon_zeta": -33.722, "bb_type": "BI", "chi": -133.140, "glyco_bond": "anti", "C5prime_xyz": [ -2.465, 8.852, -1.029 ], "P_xyz": [ -0.183, 10.054, -0.828 ], "form": "B", "ssZp": 2.209, "Dp": 2.260, "splay_angle": 18.547, "splay_distance": 3.253, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": -179.635, "theta": -147.402, "eta_prime": -161.992, "theta_prime": -157.474, "eta_base": -118.384, "theta_base": -125.851, "v0": -38.060, "v1": 39.121, "v2": -25.607, "v3": 4.612, "v4": 20.754, "amplitude": 39.689, "phase_angle": 130.181, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 198.036, 200.345, 152.427 ], "x_axis": [ -0.933, 0.359, -0.009 ], "y_axis": [ -0.334, -0.861, 0.384 ], "z_axis": [ 0.131, 0.361, 0.923 ], "quaternion": [ 0.180, 0.032, 0.193, 0.964 ] } }, { "index": 77, "index_chain": 77, "chain_name": "I", "nt_resnum": 77, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/77", "linked_nts": [ "///I/76", "///I/78" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.156, "beta": 156.005, "gamma": 34.899, "delta": 113.913, "epsilon": -177.327, "zeta": -90.474, "epsilon_zeta": -86.853, "bb_type": "BI", "chi": -130.785, "glyco_bond": "anti", "C5prime_xyz": [ -2.487, 8.732, -1.241 ], "P_xyz": [ -0.358, 10.182, -0.854 ], "form": ".", "ssZp": 2.640, "Dp": 2.660, "splay_angle": 20.333, "splay_distance": 3.659, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 159.374, "theta": -148.445, "eta_prime": 179.176, "theta_prime": -155.029, "eta_base": -139.692, "theta_base": -120.910, "v0": -36.015, "v1": 31.316, "v2": -15.576, "v3": -4.532, "v4": 25.433, "amplitude": 35.242, "phase_angle": 116.229, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 198.871, 202.215, 154.955 ], "x_axis": [ -0.981, -0.161, 0.111 ], "y_axis": [ 0.189, -0.926, 0.326 ], "z_axis": [ 0.050, 0.341, 0.939 ], "quaternion": [ -0.089, 0.041, 0.170, 0.980 ] } }, { "index": 78, "index_chain": 78, "chain_name": "I", "nt_resnum": 78, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/78", "linked_nts": [ "///I/77", "///I/79" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.279, "beta": 178.023, "gamma": 36.925, "delta": 124.962, "epsilon": -161.800, "zeta": -107.903, "epsilon_zeta": -53.897, "bb_type": "BI", "chi": -127.089, "glyco_bond": "anti", "C5prime_xyz": [ -2.364, 8.777, -1.239 ], "P_xyz": [ -0.484, 10.460, -0.574 ], "form": ".", "ssZp": 2.339, "Dp": 2.356, "splay_angle": 19.102, "splay_distance": 3.380, "splay_ratio": 0.169, "d22": 4.206, "d64": 3.981, "eta": 175.961, "theta": -150.305, "eta_prime": -165.188, "theta_prime": -154.661, "eta_base": -123.749, "theta_base": -123.070, "v0": -34.652, "v1": 37.076, "v2": -25.582, "v3": 6.499, "v4": 17.456, "amplitude": 37.097, "phase_angle": 133.598, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 198.122, 204.302, 157.866 ], "x_axis": [ -0.738, -0.647, 0.191 ], "y_axis": [ 0.674, -0.711, 0.199 ], "z_axis": [ 0.008, 0.276, 0.961 ], "quaternion": [ -0.358, 0.054, 0.128, 0.923 ] } }, { "index": 79, "index_chain": 79, "chain_name": "I", "nt_resnum": 79, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/79", "linked_nts": [ "///I/78", "///I/80" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.075, "beta": 169.494, "gamma": 31.061, "delta": 121.125, "epsilon": -168.362, "zeta": -110.091, "epsilon_zeta": -58.272, "bb_type": "BI", "chi": -123.385, "glyco_bond": "anti", "C5prime_xyz": [ -2.323, 8.691, -1.449 ], "P_xyz": [ -0.289, 10.270, -1.033 ], "form": "B", "ssZp": 2.515, "Dp": 2.529, "splay_angle": 17.641, "splay_distance": 3.008, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 164.760, "theta": -159.333, "eta_prime": -177.760, "theta_prime": -163.032, "eta_base": -138.617, "theta_base": -129.076, "v0": -33.055, "v1": 33.104, "v2": -20.996, "v3": 2.650, "v4": 18.988, "amplitude": 34.049, "phase_angle": 128.071, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 197.392, 205.804, 160.804 ], "x_axis": [ -0.288, -0.945, 0.153 ], "y_axis": [ 0.957, -0.278, 0.082 ], "z_axis": [ -0.035, 0.171, 0.985 ], "quaternion": [ 0.595, -0.037, -0.079, -0.799 ] } }, { "index": 80, "index_chain": 80, "chain_name": "I", "nt_resnum": 80, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/80", "linked_nts": [ "///I/79", "///I/81" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.071, "beta": 164.414, "gamma": 47.734, "delta": 123.788, "epsilon": -169.282, "zeta": -98.356, "epsilon_zeta": -70.926, "bb_type": "BI", "chi": -127.925, "glyco_bond": "anti", "C5prime_xyz": [ -2.146, 8.752, -1.182 ], "P_xyz": [ 0.218, 9.814, -0.879 ], "form": "B", "ssZp": 2.534, "Dp": 2.527, "splay_angle": 21.313, "splay_distance": 3.671, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 167.214, "theta": -141.529, "eta_prime": -173.355, "theta_prime": -149.183, "eta_base": -132.863, "theta_base": -117.808, "v0": -29.709, "v1": 31.696, "v2": -21.891, "v3": 5.457, "v4": 15.118, "amplitude": 31.818, "phase_angle": 133.473, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 196.784, 206.554, 163.653 ], "x_axis": [ 0.255, -0.963, 0.090 ], "y_axis": [ 0.965, 0.259, 0.037 ], "z_axis": [ -0.058, 0.077, 0.995 ], "quaternion": [ 0.792, -0.013, -0.047, -0.609 ] } }, { "index": 81, "index_chain": 81, "chain_name": "I", "nt_resnum": 81, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/81", "linked_nts": [ "///I/80", "///I/82" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.474, "beta": -176.984, "gamma": 26.005, "delta": 139.640, "epsilon": -167.302, "zeta": -128.862, "epsilon_zeta": -38.439, "bb_type": "BI", "chi": -103.461, "glyco_bond": "anti", "C5prime_xyz": [ -2.221, 8.252, -2.040 ], "P_xyz": [ -0.232, 9.917, -1.772 ], "form": "B", "ssZp": 2.081, "Dp": 2.168, "splay_angle": 16.724, "splay_distance": 2.810, "splay_ratio": 0.146, "d22": 4.363, "d64": 3.566, "eta": 172.497, "theta": -160.752, "eta_prime": -164.498, "theta_prime": -166.055, "eta_base": -126.456, "theta_base": -128.134, "v0": -24.857, "v1": 36.520, "v2": -33.735, "v3": 20.197, "v4": 2.662, "amplitude": 36.619, "phase_angle": 157.107, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 196.088, 206.297, 167.249 ], "x_axis": [ 0.733, -0.675, 0.083 ], "y_axis": [ 0.673, 0.738, 0.053 ], "z_axis": [ -0.097, 0.017, 0.995 ], "quaternion": [ 0.931, 0.010, -0.048, -0.362 ] } }, { "index": 82, "index_chain": 82, "chain_name": "I", "nt_resnum": 82, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/82", "linked_nts": [ "///I/81", "///I/83" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -44.460, "beta": 154.139, "gamma": 49.042, "delta": 137.199, "epsilon": -150.771, "zeta": -131.815, "epsilon_zeta": -18.956, "bb_type": "--", "chi": -109.069, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.363, -1.888 ], "P_xyz": [ -0.068, 9.313, -2.017 ], "form": "B", "ssZp": 1.894, "Dp": 1.997, "splay_angle": 21.659, "splay_distance": 3.636, "splay_ratio": 0.189, "d22": 4.418, "d64": 3.548, "eta": 175.841, "theta": -137.137, "eta_prime": -162.595, "theta_prime": -147.728, "eta_base": -123.419, "theta_base": -92.810, "v0": -30.858, "v1": 40.735, "v2": -34.768, "v3": 17.902, "v4": 7.839, "amplitude": 40.106, "phase_angle": 150.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 195.672, 206.385, 170.026 ], "x_axis": [ 0.970, -0.198, 0.139 ], "y_axis": [ 0.179, 0.974, 0.138 ], "z_axis": [ -0.163, -0.109, 0.981 ], "quaternion": [ 0.991, 0.063, -0.076, -0.095 ] } }, { "index": 83, "index_chain": 83, "chain_name": "I", "nt_resnum": 83, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/83", "linked_nts": [ "///I/82", "///I/84" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -25.097, "beta": 143.530, "gamma": 26.915, "delta": 141.353, "epsilon": -104.673, "zeta": 163.828, "epsilon_zeta": 91.499, "bb_type": "BII", "chi": -89.990, "glyco_bond": "anti", "C5prime_xyz": [ -3.123, 7.801, -2.400 ], "P_xyz": [ -0.865, 9.034, -2.793 ], "form": ".", "ssZp": 1.164, "Dp": 1.179, "splay_angle": 21.415, "splay_distance": 3.796, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": -174.851, "theta": 179.850, "eta_prime": -148.779, "theta_prime": 176.268, "eta_base": -94.780, "theta_base": -127.056, "v0": -32.591, "v1": 44.062, "v2": -38.094, "v3": 20.454, "v4": 7.213, "amplitude": 43.309, "phase_angle": 151.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 196.593, 207.077, 173.475 ], "x_axis": [ 0.849, 0.485, 0.209 ], "y_axis": [ -0.520, 0.836, 0.176 ], "z_axis": [ -0.090, -0.259, 0.962 ], "quaternion": [ 0.955, 0.114, -0.078, 0.263 ] } }, { "index": 84, "index_chain": 84, "chain_name": "I", "nt_resnum": 84, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/84", "linked_nts": [ "///I/83", "///I/85" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -56.427, "beta": 132.711, "gamma": 36.670, "delta": 150.239, "epsilon": -147.835, "zeta": -157.672, "epsilon_zeta": 9.837, "bb_type": "--", "chi": -97.586, "glyco_bond": "anti", "C5prime_xyz": [ -2.208, 8.006, -2.157 ], "P_xyz": [ 0.381, 8.296, -1.930 ], "form": "B", "ssZp": 1.580, "Dp": 1.684, "splay_angle": 20.083, "splay_distance": 3.368, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 167.868, "theta": -143.407, "eta_prime": -164.375, "theta_prime": -167.782, "eta_base": -112.547, "theta_base": -120.729, "v0": -20.562, "v1": 37.812, "v2": -39.797, "v3": 28.928, "v4": -5.507, "amplitude": 40.550, "phase_angle": 168.941, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.355, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 194.696, 207.048, 176.763 ], "x_axis": [ 0.312, 0.885, 0.345 ], "y_axis": [ -0.939, 0.342, -0.031 ], "z_axis": [ -0.145, -0.315, 0.938 ], "quaternion": [ 0.805, 0.088, -0.152, 0.567 ] } }, { "index": 85, "index_chain": 85, "chain_name": "I", "nt_resnum": 85, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/85", "linked_nts": [ "///I/84", "///I/86" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -36.229, "beta": 135.797, "gamma": 41.116, "delta": 138.671, "epsilon": -163.013, "zeta": -128.541, "epsilon_zeta": -34.473, "bb_type": "BI", "chi": -113.216, "glyco_bond": "anti", "C5prime_xyz": [ -2.273, 8.456, -1.677 ], "P_xyz": [ 0.224, 9.083, -1.356 ], "form": "B", "ssZp": 1.894, "Dp": 2.033, "splay_angle": 19.921, "splay_distance": 3.273, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 166.684, "theta": -140.464, "eta_prime": -166.027, "theta_prime": -159.547, "eta_base": -115.560, "theta_base": -113.099, "v0": -29.238, "v1": 40.103, "v2": -35.628, "v3": 19.686, "v4": 5.643, "amplitude": 39.902, "phase_angle": 153.238, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 193.592, 205.865, 179.717 ], "x_axis": [ -0.306, 0.908, 0.287 ], "y_axis": [ -0.936, -0.231, -0.267 ], "z_axis": [ -0.176, -0.350, 0.920 ], "quaternion": [ 0.588, 0.035, -0.197, 0.784 ] } }, { "index": 86, "index_chain": 86, "chain_name": "I", "nt_resnum": 86, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/86", "linked_nts": [ "///I/85", "///I/87" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -33.150, "beta": 167.544, "gamma": 26.059, "delta": 146.587, "epsilon": -175.313, "zeta": -118.768, "epsilon_zeta": -56.545, "bb_type": "BI", "chi": -105.263, "glyco_bond": "anti", "C5prime_xyz": [ -1.913, 8.163, -1.848 ], "P_xyz": [ 0.355, 9.324, -1.344 ], "form": "B", "ssZp": 1.895, "Dp": 1.957, "splay_angle": 21.532, "splay_distance": 3.645, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 167.813, "theta": -139.604, "eta_prime": -166.835, "theta_prime": -154.727, "eta_base": -114.248, "theta_base": -111.255, "v0": -16.937, "v1": 33.276, "v2": -36.088, "v3": 27.289, "v4": -6.819, "amplitude": 36.465, "phase_angle": 171.750, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 192.892, 204.840, 182.745 ], "x_axis": [ -0.836, 0.546, 0.051 ], "y_axis": [ -0.520, -0.759, -0.392 ], "z_axis": [ -0.175, -0.354, 0.919 ], "quaternion": [ 0.284, -0.033, -0.199, 0.937 ] } }, { "index": 87, "index_chain": 87, "chain_name": "I", "nt_resnum": 87, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/87", "linked_nts": [ "///I/86", "///I/88" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -12.383, "beta": 173.774, "gamma": 6.954, "delta": 150.305, "epsilon": -154.684, "zeta": -130.131, "epsilon_zeta": -24.554, "bb_type": "--", "chi": -102.388, "glyco_bond": "anti", "C5prime_xyz": [ -1.901, 8.170, -1.908 ], "P_xyz": [ 0.051, 9.814, -1.362 ], "form": "B", "ssZp": 1.710, "Dp": 1.785, "splay_angle": 22.725, "splay_distance": 3.875, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 179.842, "theta": -146.110, "eta_prime": -159.971, "theta_prime": -151.291, "eta_base": -112.088, "theta_base": -113.368, "v0": -16.616, "v1": 34.357, "v2": -38.051, "v3": 29.445, "v4": -8.333, "amplitude": 38.291, "phase_angle": 173.572, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 191.919, 204.015, 186.160 ], "x_axis": [ -0.981, -0.030, -0.190 ], "y_axis": [ 0.101, -0.922, -0.374 ], "z_axis": [ -0.164, -0.387, 0.908 ], "quaternion": [ -0.034, -0.091, -0.195, 0.976 ] } }, { "index": 88, "index_chain": 88, "chain_name": "I", "nt_resnum": 88, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/88", "linked_nts": [ "///I/87", "///I/89" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.094, "beta": 156.042, "gamma": 28.820, "delta": 134.858, "epsilon": -173.160, "zeta": -104.981, "epsilon_zeta": -68.179, "bb_type": "BI", "chi": -107.153, "glyco_bond": "anti", "C5prime_xyz": [ -2.500, 8.309, -1.945 ], "P_xyz": [ -0.273, 9.641, -1.769 ], "form": ".", "ssZp": 2.209, "Dp": 2.254, "splay_angle": 20.848, "splay_distance": 3.703, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.322, "theta": -138.950, "eta_prime": -170.047, "theta_prime": -154.448, "eta_base": -127.162, "theta_base": -111.205, "v0": -28.395, "v1": 37.166, "v2": -31.488, "v3": 16.081, "v4": 7.465, "amplitude": 36.522, "phase_angle": 149.562, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 191.195, 202.285, 189.551 ], "x_axis": [ -0.762, -0.477, -0.438 ], "y_axis": [ 0.614, -0.747, -0.255 ], "z_axis": [ -0.206, -0.463, 0.862 ], "quaternion": [ -0.297, -0.175, -0.196, 0.918 ] } }, { "index": 89, "index_chain": 89, "chain_name": "I", "nt_resnum": 89, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/89", "linked_nts": [ "///I/88", "///I/90" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.124, "beta": 167.689, "gamma": 42.601, "delta": 113.936, "epsilon": 179.339, "zeta": -99.727, "epsilon_zeta": -80.934, "bb_type": "BI", "chi": -128.258, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.751, -1.361 ], "P_xyz": [ -0.458, 10.316, -1.172 ], "form": "B", "ssZp": 2.632, "Dp": 2.638, "splay_angle": 17.849, "splay_distance": 3.004, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 169.565, "theta": -163.135, "eta_prime": -171.613, "theta_prime": -166.813, "eta_base": -119.549, "theta_base": -132.017, "v0": -37.030, "v1": 32.363, "v2": -16.231, "v3": -4.426, "v4": 25.930, "amplitude": 36.248, "phase_angle": 116.602, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 189.305, 200.330, 192.063 ], "x_axis": [ -0.234, -0.765, -0.600 ], "y_axis": [ 0.947, -0.320, 0.038 ], "z_axis": [ -0.221, -0.559, 0.799 ], "quaternion": [ 0.558, 0.268, 0.170, -0.767 ] } }, { "index": 90, "index_chain": 90, "chain_name": "I", "nt_resnum": 90, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/90", "linked_nts": [ "///I/89", "///I/91" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -54.748, "beta": -179.831, "gamma": 44.773, "delta": 134.505, "epsilon": -171.473, "zeta": -99.761, "epsilon_zeta": -71.712, "bb_type": "BI", "chi": -121.223, "glyco_bond": "anti", "C5prime_xyz": [ -1.966, 8.566, -1.314 ], "P_xyz": [ 0.269, 9.747, -0.674 ], "form": "B", "ssZp": 2.247, "Dp": 2.275, "splay_angle": 17.241, "splay_distance": 3.008, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 170.487, "theta": -136.490, "eta_prime": -169.485, "theta_prime": -145.582, "eta_base": -129.115, "theta_base": -107.709, "v0": -24.790, "v1": 33.592, "v2": -29.368, "v3": 15.857, "v4": 5.389, "amplitude": 33.239, "phase_angle": 152.071, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 187.952, 198.976, 194.378 ], "x_axis": [ 0.334, -0.773, -0.539 ], "y_axis": [ 0.912, 0.122, 0.391 ], "z_axis": [ -0.237, -0.622, 0.746 ], "quaternion": [ 0.742, 0.342, 0.102, -0.568 ] } }, { "index": 91, "index_chain": 91, "chain_name": "I", "nt_resnum": 91, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/91", "linked_nts": [ "///I/90", "///I/92" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.574, "beta": 178.491, "gamma": 25.011, "delta": 145.413, "epsilon": -143.665, "zeta": -160.559, "epsilon_zeta": 16.894, "bb_type": "--", "chi": -101.344, "glyco_bond": "anti", "C5prime_xyz": [ -2.497, 8.250, -1.996 ], "P_xyz": [ -0.543, 9.963, -1.757 ], "form": "B", "ssZp": 1.951, "Dp": 1.936, "splay_angle": 18.676, "splay_distance": 3.160, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 170.570, "theta": -162.176, "eta_prime": -165.434, "theta_prime": -164.895, "eta_base": -120.753, "theta_base": -113.294, "v0": -28.457, "v1": 42.349, "v2": -39.156, "v3": 23.772, "v4": 2.680, "amplitude": 42.357, "phase_angle": 157.582, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 187.019, 196.554, 195.899 ], "x_axis": [ 0.791, -0.555, -0.257 ], "y_axis": [ 0.548, 0.454, 0.703 ], "z_axis": [ -0.273, -0.697, 0.663 ], "quaternion": [ 0.853, 0.410, -0.005, -0.323 ] } }, { "index": 92, "index_chain": 92, "chain_name": "I", "nt_resnum": 92, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/92", "linked_nts": [ "///I/91", "///I/93" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -31.831, "beta": 122.806, "gamma": 45.383, "delta": 134.437, "epsilon": -124.242, "zeta": -168.724, "epsilon_zeta": 44.482, "bb_type": "BII", "chi": -114.954, "glyco_bond": "anti", "C5prime_xyz": [ -2.876, 8.493, -1.652 ], "P_xyz": [ -0.383, 9.189, -1.594 ], "form": "B", "ssZp": 1.647, "Dp": 1.703, "splay_angle": 23.378, "splay_distance": 3.925, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": -179.214, "theta": -151.558, "eta_prime": -155.443, "theta_prime": -160.228, "eta_base": -104.590, "theta_base": -122.325, "v0": -37.135, "v1": 44.638, "v2": -34.706, "v3": 14.276, "v4": 13.926, "amplitude": 43.640, "phase_angle": 142.682, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 186.726, 194.581, 198.351 ], "x_axis": [ 0.950, -0.223, 0.218 ], "y_axis": [ -0.020, 0.654, 0.756 ], "z_axis": [ -0.311, -0.723, 0.617 ], "quaternion": [ 0.897, 0.412, -0.147, -0.057 ] } }, { "index": 93, "index_chain": 93, "chain_name": "I", "nt_resnum": 93, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/93", "linked_nts": [ "///I/92", "///I/94" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -20.651, "beta": 137.672, "gamma": 15.574, "delta": 153.535, "epsilon": -82.074, "zeta": 169.642, "epsilon_zeta": 108.285, "bb_type": "BII", "chi": -83.803, "glyco_bond": "anti", "C5prime_xyz": [ -2.734, 7.599, -2.573 ], "P_xyz": [ -0.387, 8.758, -2.497 ], "form": ".", "ssZp": 0.305, "Dp": 0.399, "splay_angle": 21.086, "splay_distance": 3.599, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": -166.126, "theta": -158.000, "eta_prime": -144.500, "theta_prime": -168.444, "eta_base": -112.855, "theta_base": -102.682, "v0": -22.944, "v1": 41.260, "v2": -42.917, "v3": 30.858, "v4": -5.298, "amplitude": 43.874, "phase_angle": 168.011, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 184.790, 192.353, 200.938 ], "x_axis": [ 0.741, 0.128, 0.659 ], "y_axis": [ -0.572, 0.634, 0.521 ], "z_axis": [ -0.351, -0.763, 0.543 ], "quaternion": [ 0.854, 0.376, -0.296, 0.205 ] } }, { "index": 94, "index_chain": 94, "chain_name": "I", "nt_resnum": 94, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/94", "linked_nts": [ "///I/93", "///I/95" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -73.338, "beta": 136.590, "gamma": 33.924, "delta": 152.521, "epsilon": -88.269, "zeta": 150.146, "epsilon_zeta": 121.585, "bb_type": "BII", "chi": -81.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.798, 7.514, -2.677 ], "P_xyz": [ -0.267, 8.098, -3.113 ], "form": "B", "ssZp": 0.559, "Dp": 0.612, "splay_angle": 22.600, "splay_distance": 3.818, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -178.886, "theta": -166.555, "eta_prime": -153.479, "theta_prime": 176.682, "eta_base": -98.643, "theta_base": -120.559, "v0": -25.168, "v1": 42.768, "v2": -42.931, "v3": 29.549, "v4": -2.963, "amplitude": 44.447, "phase_angle": 164.991, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.175, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 182.359, 191.129, 203.293 ], "x_axis": [ 0.094, 0.449, 0.889 ], "y_axis": [ -0.942, 0.329, -0.066 ], "z_axis": [ -0.322, -0.831, 0.453 ], "quaternion": [ 0.685, 0.279, -0.442, 0.508 ] } }, { "index": 95, "index_chain": 95, "chain_name": "I", "nt_resnum": 95, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/95", "linked_nts": [ "///I/94", "///I/96" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -45.985, "beta": 140.318, "gamma": 12.354, "delta": 150.699, "epsilon": -151.712, "zeta": -160.780, "epsilon_zeta": 9.068, "bb_type": "--", "chi": -86.724, "glyco_bond": "anti", "C5prime_xyz": [ -2.287, 7.705, -2.582 ], "P_xyz": [ 0.107, 8.733, -2.415 ], "form": "B", "ssZp": 1.442, "Dp": 1.692, "splay_angle": 22.593, "splay_distance": 3.847, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 172.609, "theta": -155.825, "eta_prime": -166.830, "theta_prime": -166.938, "eta_base": -110.820, "theta_base": -121.827, "v0": -19.322, "v1": 37.044, "v2": -39.858, "v3": 29.656, "v4": -6.730, "amplitude": 40.383, "phase_angle": 170.749, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 179.917, 188.396, 204.363 ], "x_axis": [ -0.597, 0.456, 0.660 ], "y_axis": [ -0.741, 0.003, -0.672 ], "z_axis": [ -0.309, -0.890, 0.336 ], "quaternion": [ 0.431, 0.126, -0.562, 0.695 ] } }, { "index": 96, "index_chain": 96, "chain_name": "I", "nt_resnum": 96, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/96", "linked_nts": [ "///I/95", "///I/97" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -28.504, "beta": 142.265, "gamma": 32.749, "delta": 142.925, "epsilon": -169.295, "zeta": -126.271, "epsilon_zeta": -43.024, "bb_type": "BI", "chi": -99.370, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.080, -2.169 ], "P_xyz": [ 0.375, 8.659, -1.935 ], "form": "B", "ssZp": 1.828, "Dp": 1.981, "splay_angle": 17.922, "splay_distance": 3.079, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 168.463, "theta": -133.791, "eta_prime": -166.523, "theta_prime": -156.283, "eta_base": -121.150, "theta_base": -115.781, "v0": -19.307, "v1": 33.531, "v2": -34.508, "v3": 24.196, "v4": -3.387, "amplitude": 35.470, "phase_angle": 166.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 178.140, 184.987, 204.478 ], "x_axis": [ -0.890, 0.437, 0.133 ], "y_axis": [ -0.256, -0.236, -0.937 ], "z_axis": [ -0.378, -0.868, 0.322 ], "quaternion": [ 0.221, -0.078, -0.577, 0.782 ] } }, { "index": 97, "index_chain": 97, "chain_name": "I", "nt_resnum": 97, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/97", "linked_nts": [ "///I/96", "///I/98" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -23.709, "beta": 154.097, "gamma": 23.301, "delta": 137.063, "epsilon": -160.881, "zeta": -136.898, "epsilon_zeta": -23.983, "bb_type": "--", "chi": -106.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.644, 8.351, -1.903 ], "P_xyz": [ -0.504, 9.818, -1.728 ], "form": "B", "ssZp": 2.268, "Dp": 2.236, "splay_angle": 21.466, "splay_distance": 3.584, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 169.333, "theta": -157.502, "eta_prime": -168.917, "theta_prime": -165.278, "eta_base": -121.689, "theta_base": -119.984, "v0": -31.495, "v1": 40.982, "v2": -34.240, "v3": 17.188, "v4": 8.650, "amplitude": 40.049, "phase_angle": 148.753, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 176.572, 182.596, 205.621 ], "x_axis": [ -0.878, 0.270, -0.395 ], "y_axis": [ 0.235, -0.475, -0.848 ], "z_axis": [ -0.417, -0.837, 0.354 ], "quaternion": [ 0.011, -0.247, -0.512, 0.823 ] } }, { "index": 98, "index_chain": 98, "chain_name": "I", "nt_resnum": 98, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/98", "linked_nts": [ "///I/97", "///I/99" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.203, "beta": 151.957, "gamma": 40.771, "delta": 133.697, "epsilon": -162.945, "zeta": -104.152, "epsilon_zeta": -58.794, "bb_type": "BI", "chi": -122.403, "glyco_bond": "anti", "C5prime_xyz": [ -2.142, 8.684, -1.277 ], "P_xyz": [ 0.266, 9.552, -0.798 ], "form": ".", "ssZp": 2.208, "Dp": 2.232, "splay_angle": 19.156, "splay_distance": 3.417, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 172.190, "theta": -130.332, "eta_prime": -166.941, "theta_prime": -148.042, "eta_base": -116.976, "theta_base": -110.587, "v0": -28.118, "v1": 36.310, "v2": -30.514, "v3": 15.125, "v4": 7.948, "amplitude": 35.737, "phase_angle": 148.632, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 174.797, 179.657, 206.651 ], "x_axis": [ -0.512, 0.024, -0.858 ], "y_axis": [ 0.738, -0.500, -0.454 ], "z_axis": [ -0.440, -0.866, 0.239 ], "quaternion": [ -0.238, -0.433, -0.440, 0.750 ] } }, { "index": 99, "index_chain": 99, "chain_name": "I", "nt_resnum": 99, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/99", "linked_nts": [ "///I/98", "///I/100" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.865, "beta": 166.676, "gamma": 36.164, "delta": 109.239, "epsilon": 177.010, "zeta": -91.669, "epsilon_zeta": -91.322, "bb_type": "BI", "chi": -129.507, "glyco_bond": "anti", "C5prime_xyz": [ -2.443, 8.763, -1.334 ], "P_xyz": [ -0.381, 10.333, -1.078 ], "form": ".", "ssZp": 2.747, "Dp": 2.767, "splay_angle": 18.478, "splay_distance": 3.189, "splay_ratio": 0.162, "d22": 4.222, "d64": 3.978, "eta": 161.791, "theta": -161.263, "eta_prime": -178.306, "theta_prime": -163.815, "eta_base": -128.940, "theta_base": -134.393, "v0": -34.712, "v1": 26.925, "v2": -10.000, "v3": -9.509, "v4": 27.765, "amplitude": 33.658, "phase_angle": 107.284, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 172.490, 177.184, 207.136 ], "x_axis": [ 0.024, -0.193, -0.981 ], "y_axis": [ 0.899, -0.425, 0.105 ], "z_axis": [ -0.438, -0.884, 0.163 ], "quaternion": [ -0.436, -0.567, -0.311, 0.625 ] } }, { "index": 100, "index_chain": 100, "chain_name": "I", "nt_resnum": 100, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/100", "linked_nts": [ "///I/99", "///I/101" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.962, "beta": 179.454, "gamma": 44.142, "delta": 133.514, "epsilon": -169.842, "zeta": -113.235, "epsilon_zeta": -56.607, "bb_type": "BI", "chi": -119.923, "glyco_bond": "anti", "C5prime_xyz": [ -2.317, 8.592, -1.413 ], "P_xyz": [ -0.186, 10.018, -0.923 ], "form": "B", "ssZp": 2.345, "Dp": 2.331, "splay_angle": 17.912, "splay_distance": 2.979, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 173.188, "theta": -150.362, "eta_prime": -165.425, "theta_prime": -157.207, "eta_base": -130.639, "theta_base": -109.683, "v0": -30.177, "v1": 37.798, "v2": -30.746, "v3": 14.220, "v4": 9.785, "amplitude": 37.034, "phase_angle": 146.119, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 170.258, 174.941, 207.537 ], "x_axis": [ 0.455, -0.354, -0.817 ], "y_axis": [ 0.751, -0.339, 0.566 ], "z_axis": [ -0.478, -0.871, 0.112 ], "quaternion": [ 0.554, 0.649, 0.153, -0.499 ] } }, { "index": 101, "index_chain": 101, "chain_name": "I", "nt_resnum": 101, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/101", "linked_nts": [ "///I/100", "///I/102" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.509, "beta": 170.752, "gamma": 41.324, "delta": 138.648, "epsilon": -165.266, "zeta": -120.035, "epsilon_zeta": -45.231, "bb_type": "BI", "chi": -114.744, "glyco_bond": "anti", "C5prime_xyz": [ -2.112, 8.486, -1.541 ], "P_xyz": [ 0.202, 9.575, -1.090 ], "form": "B", "ssZp": 2.173, "Dp": 2.199, "splay_angle": 17.892, "splay_distance": 3.029, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 167.559, "theta": -147.484, "eta_prime": -168.859, "theta_prime": -158.535, "eta_base": -114.590, "theta_base": -133.751, "v0": -24.006, "v1": 34.975, "v2": -32.032, "v3": 19.019, "v4": 2.930, "amplitude": 34.932, "phase_angle": 156.487, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 169.021, 172.240, 207.320 ], "x_axis": [ 0.851, -0.444, -0.280 ], "y_axis": [ 0.270, -0.087, 0.959 ], "z_axis": [ -0.451, -0.892, 0.045 ], "quaternion": [ 0.672, 0.688, -0.063, -0.265 ] } }, { "index": 102, "index_chain": 102, "chain_name": "I", "nt_resnum": 102, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/102", "linked_nts": [ "///I/101", "///I/103" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -51.832, "beta": 166.510, "gamma": 43.437, "delta": 139.672, "epsilon": -144.377, "zeta": -144.605, "epsilon_zeta": 0.228, "bb_type": "--", "chi": -109.724, "glyco_bond": "anti", "C5prime_xyz": [ -2.517, 8.373, -1.779 ], "P_xyz": [ -0.265, 9.664, -1.648 ], "form": "B", "ssZp": 1.886, "Dp": 1.922, "splay_angle": 20.542, "splay_distance": 3.453, "splay_ratio": 0.180, "d22": 4.510, "d64": 3.517, "eta": 174.744, "theta": -144.081, "eta_prime": -166.365, "theta_prime": -149.503, "eta_base": -137.151, "theta_base": -99.864, "v0": -30.092, "v1": 41.120, "v2": -35.845, "v3": 19.522, "v4": 6.307, "amplitude": 40.496, "phase_angle": 152.269, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 167.061, 169.981, 206.843 ], "x_axis": [ 0.880, -0.432, 0.200 ], "y_axis": [ -0.201, 0.043, 0.979 ], "z_axis": [ -0.431, -0.901, -0.049 ], "quaternion": [ 0.684, 0.687, -0.231, -0.084 ] } }, { "index": 103, "index_chain": 103, "chain_name": "I", "nt_resnum": 103, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/103", "linked_nts": [ "///I/102", "///I/104" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -17.566, "beta": 139.134, "gamma": 17.779, "delta": 149.591, "epsilon": -87.110, "zeta": 148.301, "epsilon_zeta": 124.590, "bb_type": "BII", "chi": -86.766, "glyco_bond": "anti", "C5prime_xyz": [ -2.909, 7.803, -2.453 ], "P_xyz": [ -0.602, 9.035, -2.586 ], "form": ".", "ssZp": 0.764, "Dp": 0.743, "splay_angle": 23.264, "splay_distance": 3.949, "splay_ratio": 0.211, "d22": 5.226, "d64": 4.001, "eta": -173.156, "theta": -165.197, "eta_prime": -146.773, "theta_prime": -170.961, "eta_base": -99.983, "theta_base": -109.284, "v0": -28.758, "v1": 44.531, "v2": -42.133, "v3": 26.842, "v4": 0.847, "amplitude": 44.848, "phase_angle": 159.962, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 166.080, 166.806, 207.785 ], "x_axis": [ 0.567, -0.287, 0.772 ], "y_axis": [ -0.759, 0.182, 0.625 ], "z_axis": [ -0.320, -0.940, -0.115 ], "quaternion": [ 0.639, 0.612, -0.427, 0.185 ] } }, { "index": 104, "index_chain": 104, "chain_name": "I", "nt_resnum": 104, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/104", "linked_nts": [ "///I/103", "///I/105" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -29.973, "beta": 136.454, "gamma": 1.877, "delta": 159.015, "epsilon": -80.563, "zeta": 146.971, "epsilon_zeta": 132.466, "bb_type": "BII", "chi": -73.112, "glyco_bond": "anti", "C5prime_xyz": [ -2.459, 7.172, -2.850 ], "P_xyz": [ -0.108, 8.333, -2.803 ], "form": "B", "ssZp": -0.097, "Dp": 0.120, "splay_angle": 23.858, "splay_distance": 4.068, "splay_ratio": 0.213, "d22": 4.958, "d64": 3.855, "eta": -163.372, "theta": -152.900, "eta_prime": -142.442, "theta_prime": -163.473, "eta_base": -92.980, "theta_base": -106.262, "v0": -13.402, "v1": 35.446, "v2": -42.767, "v3": 36.221, "v4": -14.570, "amplitude": 42.771, "phase_angle": 180.846, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 163.425, 163.919, 208.236 ], "x_axis": [ -0.149, -0.185, 0.971 ], "y_axis": [ -0.942, 0.324, -0.083 ], "z_axis": [ -0.300, -0.928, -0.222 ], "quaternion": [ -0.488, -0.433, 0.651, -0.388 ] } }, { "index": 105, "index_chain": 105, "chain_name": "I", "nt_resnum": 105, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/105", "linked_nts": [ "///I/104", "///I/106" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -32.348, "beta": 125.475, "gamma": -1.511, "delta": 149.398, "epsilon": -72.386, "zeta": 120.625, "epsilon_zeta": 166.989, "bb_type": "--", "chi": -66.535, "glyco_bond": "--", "C5prime_xyz": [ -3.165, 6.973, -2.969 ], "P_xyz": [ -0.979, 8.366, -3.367 ], "form": "B", "ssZp": 0.192, "Dp": 0.220, "splay_angle": 24.681, "splay_distance": 4.186, "splay_ratio": 0.218, "d22": 4.916, "d64": 3.836, "eta": -170.278, "theta": -163.796, "eta_prime": -149.928, "theta_prime": -176.854, "eta_base": -105.128, "theta_base": -117.279, "v0": -23.946, "v1": 40.138, "v2": -40.040, "v3": 27.358, "v4": -2.406, "amplitude": 41.564, "phase_angle": 164.437, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 160.575, 161.323, 206.938 ], "x_axis": [ -0.712, -0.032, 0.702 ], "y_axis": [ -0.654, 0.393, -0.646 ], "z_axis": [ -0.255, -0.919, -0.301 ], "quaternion": [ -0.308, -0.221, 0.776, -0.504 ] } }, { "index": 106, "index_chain": 106, "chain_name": "I", "nt_resnum": 106, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/106", "linked_nts": [ "///I/105", "///I/107" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 102.207, "beta": -123.441, "gamma": 156.657, "delta": 130.352, "epsilon": -152.573, "zeta": -141.727, "epsilon_zeta": -10.846, "bb_type": "--", "chi": -118.257, "glyco_bond": "anti", "C5prime_xyz": [ -2.569, 8.635, -1.554 ], "P_xyz": [ -0.373, 8.643, -2.939 ], "form": "B", "ssZp": 2.202, "Dp": 2.223, "splay_angle": 22.089, "splay_distance": 3.689, "splay_ratio": 0.192, "d22": 4.705, "d64": 3.927, "eta": 164.091, "theta": -160.528, "eta_prime": -170.363, "theta_prime": 179.830, "eta_base": -116.527, "theta_base": -139.882, "v0": -36.212, "v1": 41.813, "v2": -31.411, "v3": 11.448, "v4": 15.212, "amplitude": 41.144, "phase_angle": 139.768, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 158.589, 158.617, 204.436 ], "x_axis": [ -0.972, 0.205, 0.118 ], "y_axis": [ -0.030, 0.388, -0.921 ], "z_axis": [ -0.234, -0.899, -0.370 ], "quaternion": [ -0.107, 0.053, 0.826, -0.551 ] } }, { "index": 107, "index_chain": 107, "chain_name": "I", "nt_resnum": 107, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/107", "linked_nts": [ "///I/106", "///I/108" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -32.078, "beta": 154.423, "gamma": 29.353, "delta": 141.724, "epsilon": -161.837, "zeta": -113.658, "epsilon_zeta": -48.180, "bb_type": "BI", "chi": -112.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.971, 8.470, -1.632 ], "P_xyz": [ 0.411, 9.370, -1.045 ], "form": "B", "ssZp": 2.016, "Dp": 2.059, "splay_angle": 19.402, "splay_distance": 3.286, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 170.740, "theta": -135.427, "eta_prime": -168.649, "theta_prime": -150.237, "eta_base": -127.217, "theta_base": -108.901, "v0": -23.370, "v1": 36.206, "v2": -34.672, "v3": 22.078, "v4": 0.527, "amplitude": 36.808, "phase_angle": 160.387, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 158.124, 155.217, 203.083 ], "x_axis": [ -0.794, 0.462, -0.395 ], "y_axis": [ 0.540, 0.238, -0.807 ], "z_axis": [ -0.279, -0.854, -0.439 ], "quaternion": [ 0.037, 0.319, 0.786, -0.529 ] } }, { "index": 108, "index_chain": 108, "chain_name": "I", "nt_resnum": 108, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/108", "linked_nts": [ "///I/107", "///I/109" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.098, "beta": 165.233, "gamma": 46.994, "delta": 123.909, "epsilon": -170.834, "zeta": -98.989, "epsilon_zeta": -71.845, "bb_type": "BI", "chi": -121.234, "glyco_bond": "anti", "C5prime_xyz": [ -2.206, 8.612, -1.476 ], "P_xyz": [ 0.161, 9.671, -1.338 ], "form": "B", "ssZp": 2.454, "Dp": 2.514, "splay_angle": 20.188, "splay_distance": 3.565, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 162.395, "theta": -139.813, "eta_prime": -175.551, "theta_prime": -149.618, "eta_base": -124.870, "theta_base": -112.724, "v0": -28.525, "v1": 30.467, "v2": -21.107, "v3": 5.336, "v4": 14.467, "amplitude": 30.585, "phase_angle": 133.639, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 156.956, 152.610, 201.458 ], "x_axis": [ -0.290, 0.609, -0.739 ], "y_axis": [ 0.901, -0.088, -0.426 ], "z_axis": [ -0.324, -0.789, -0.523 ], "quaternion": [ 0.158, 0.575, 0.657, -0.462 ] } }, { "index": 109, "index_chain": 109, "chain_name": "I", "nt_resnum": 109, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/109", "linked_nts": [ "///I/108", "///I/110" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -41.748, "beta": 164.718, "gamma": 38.466, "delta": 128.694, "epsilon": -153.163, "zeta": -139.718, "epsilon_zeta": -13.445, "bb_type": "--", "chi": -123.059, "glyco_bond": "anti", "C5prime_xyz": [ -2.684, 8.692, -1.348 ], "P_xyz": [ -0.658, 10.264, -0.965 ], "form": "B", "ssZp": 2.376, "Dp": 2.324, "splay_angle": 18.657, "splay_distance": 3.096, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 173.172, "theta": -169.903, "eta_prime": -163.178, "theta_prime": -172.126, "eta_base": -118.303, "theta_base": -134.636, "v0": -37.420, "v1": 41.582, "v2": -29.805, "v3": 9.262, "v4": 17.337, "amplitude": 41.095, "phase_angle": 136.490, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 155.195, 150.538, 199.153 ], "x_axis": [ 0.254, 0.548, -0.797 ], "y_axis": [ 0.921, -0.388, 0.027 ], "z_axis": [ -0.295, -0.741, -0.604 ], "quaternion": [ 0.256, 0.749, 0.490, -0.364 ] } }, { "index": 110, "index_chain": 110, "chain_name": "I", "nt_resnum": 110, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/110", "linked_nts": [ "///I/109", "///I/111" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.539, "beta": 152.171, "gamma": 50.030, "delta": 132.883, "epsilon": -176.174, "zeta": -96.522, "epsilon_zeta": -79.652, "bb_type": "BI", "chi": -128.261, "glyco_bond": "anti", "C5prime_xyz": [ -1.966, 8.723, -0.975 ], "P_xyz": [ 0.554, 9.239, -0.542 ], "form": ".", "ssZp": 2.362, "Dp": 2.370, "splay_angle": 18.376, "splay_distance": 3.176, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 161.243, "theta": -130.849, "eta_prime": -175.628, "theta_prime": -149.660, "eta_base": -132.283, "theta_base": -123.701, "v0": -24.609, "v1": 32.211, "v2": -27.379, "v3": 13.897, "v4": 6.523, "amplitude": 31.745, "phase_angle": 149.596, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 153.812, 148.052, 197.928 ], "x_axis": [ 0.740, 0.255, -0.622 ], "y_axis": [ 0.616, -0.627, 0.477 ], "z_axis": [ -0.268, -0.736, -0.621 ], "quaternion": [ 0.351, 0.864, 0.252, -0.257 ] } }, { "index": 111, "index_chain": 111, "chain_name": "I", "nt_resnum": 111, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/111", "linked_nts": [ "///I/110", "///I/112" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.578, "beta": -173.654, "gamma": 41.478, "delta": 137.370, "epsilon": 178.872, "zeta": -112.579, "epsilon_zeta": -68.548, "bb_type": "BI", "chi": -110.099, "glyco_bond": "anti", "C5prime_xyz": [ -2.373, 8.376, -1.805 ], "P_xyz": [ -0.333, 9.955, -1.425 ], "form": "B", "ssZp": 2.245, "Dp": 2.296, "splay_angle": 16.859, "splay_distance": 2.773, "splay_ratio": 0.147, "d22": 4.446, "d64": 3.715, "eta": 164.546, "theta": -155.535, "eta_prime": -170.171, "theta_prime": -164.296, "eta_base": -132.825, "theta_base": -119.664, "v0": -28.911, "v1": 39.080, "v2": -33.955, "v3": 18.145, "v4": 6.432, "amplitude": 38.565, "phase_angle": 151.696, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 152.310, 146.609, 195.531 ], "x_axis": [ 0.940, -0.134, -0.314 ], "y_axis": [ 0.122, -0.728, 0.675 ], "z_axis": [ -0.320, -0.672, -0.668 ], "quaternion": [ 0.369, 0.913, -0.004, -0.174 ] } }, { "index": 112, "index_chain": 112, "chain_name": "I", "nt_resnum": 112, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/112", "linked_nts": [ "///I/111", "///I/113" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.374, "beta": 179.145, "gamma": 46.421, "delta": 140.539, "epsilon": -178.988, "zeta": -113.052, "epsilon_zeta": -65.936, "bb_type": "BI", "chi": -104.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.212, -1.996 ], "P_xyz": [ 0.188, 9.367, -1.864 ], "form": "B", "ssZp": 2.037, "Dp": 2.128, "splay_angle": 19.486, "splay_distance": 3.225, "splay_ratio": 0.169, "d22": 4.371, "d64": 3.646, "eta": 171.243, "theta": -144.880, "eta_prime": -165.785, "theta_prime": -159.115, "eta_base": -116.880, "theta_base": -111.262, "v0": -22.513, "v1": 35.333, "v2": -34.059, "v3": 21.927, "v4": 0.078, "amplitude": 36.012, "phase_angle": 161.047, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 151.761, 145.016, 193.328 ], "x_axis": [ 0.792, -0.601, 0.110 ], "y_axis": [ -0.526, -0.581, 0.621 ], "z_axis": [ -0.309, -0.549, -0.776 ], "quaternion": [ 0.330, 0.887, -0.317, -0.056 ] } }, { "index": 113, "index_chain": 113, "chain_name": "I", "nt_resnum": 113, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/113", "linked_nts": [ "///I/112", "///I/114" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -25.399, "beta": 179.570, "gamma": 20.857, "delta": 150.584, "epsilon": -162.512, "zeta": -137.644, "epsilon_zeta": -24.868, "bb_type": "--", "chi": -95.463, "glyco_bond": "anti", "C5prime_xyz": [ -1.967, 7.889, -2.239 ], "P_xyz": [ 0.154, 9.367, -1.967 ], "form": "B", "ssZp": 1.579, "Dp": 1.778, "splay_angle": 20.186, "splay_distance": 3.397, "splay_ratio": 0.176, "d22": 4.373, "d64": 3.639, "eta": 179.189, "theta": -147.848, "eta_prime": -158.572, "theta_prime": -155.614, "eta_base": -108.024, "theta_base": -115.867, "v0": -15.084, "v1": 33.301, "v2": -37.941, "v3": 30.167, "v4": -9.746, "amplitude": 38.041, "phase_angle": 175.850, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 151.217, 142.802, 191.048 ], "x_axis": [ 0.275, -0.847, 0.456 ], "y_axis": [ -0.933, -0.119, 0.341 ], "z_axis": [ -0.234, -0.519, -0.822 ], "quaternion": [ 0.289, 0.744, -0.598, 0.075 ] } }, { "index": 114, "index_chain": 114, "chain_name": "I", "nt_resnum": 114, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/114", "linked_nts": [ "///I/113", "///I/115" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -16.825, "beta": 151.072, "gamma": 17.397, "delta": 152.409, "epsilon": -84.169, "zeta": 173.748, "epsilon_zeta": 102.083, "bb_type": "BII", "chi": -90.109, "glyco_bond": "anti", "C5prime_xyz": [ -2.680, 7.853, -2.358 ], "P_xyz": [ -0.475, 9.253, -2.329 ], "form": ".", "ssZp": 0.496, "Dp": 0.567, "splay_angle": 24.772, "splay_distance": 4.128, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": -165.708, "theta": -153.824, "eta_prime": -143.981, "theta_prime": -157.904, "eta_base": -108.788, "theta_base": -97.875, "v0": -26.134, "v1": 43.892, "v2": -43.891, "v3": 29.969, "v4": -2.731, "amplitude": 45.536, "phase_angle": 164.554, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 150.082, 140.909, 188.465 ], "x_axis": [ -0.254, -0.771, 0.584 ], "y_axis": [ -0.949, 0.315, 0.003 ], "z_axis": [ -0.186, -0.553, -0.812 ], "quaternion": [ -0.249, -0.557, 0.772, -0.179 ] } }, { "index": 115, "index_chain": 115, "chain_name": "I", "nt_resnum": 115, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/115", "linked_nts": [ "///I/114", "///I/116" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -56.062, "beta": 131.553, "gamma": 23.659, "delta": 148.087, "epsilon": -88.944, "zeta": 146.117, "epsilon_zeta": 124.940, "bb_type": "BII", "chi": -81.774, "glyco_bond": "anti", "C5prime_xyz": [ -2.969, 7.489, -2.642 ], "P_xyz": [ -0.519, 8.379, -2.894 ], "form": ".", "ssZp": 0.606, "Dp": 0.645, "splay_angle": 23.040, "splay_distance": 3.983, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": -178.061, "theta": 174.976, "eta_prime": -152.262, "theta_prime": 163.200, "eta_base": -100.309, "theta_base": -141.447, "v0": -26.486, "v1": 41.762, "v2": -40.128, "v3": 26.054, "v4": -0.067, "amplitude": 42.398, "phase_angle": 161.165, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.053, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 147.512, 139.581, 185.521 ], "x_axis": [ -0.838, -0.353, 0.416 ], "y_axis": [ -0.512, 0.771, -0.378 ], "z_axis": [ -0.187, -0.530, -0.827 ], "quaternion": [ -0.163, -0.234, 0.927, -0.245 ] } }, { "index": 116, "index_chain": 116, "chain_name": "I", "nt_resnum": 116, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/116", "linked_nts": [ "///I/115", "///I/117" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.847, "beta": 157.063, "gamma": 26.957, "delta": 151.470, "epsilon": -173.814, "zeta": -108.539, "epsilon_zeta": -65.275, "bb_type": "BI", "chi": -99.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 7.834, -2.009 ], "P_xyz": [ 1.072, 8.303, -1.374 ], "form": "B", "ssZp": 1.451, "Dp": 1.703, "splay_angle": 20.118, "splay_distance": 3.456, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.874, "theta": -122.160, "eta_prime": -170.900, "theta_prime": -146.237, "eta_base": -121.415, "theta_base": -107.637, "v0": -5.069, "v1": 25.001, "v2": -34.373, "v3": 32.315, "v4": -17.449, "amplitude": 34.964, "phase_angle": 190.546, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.256, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 147.924, 139.326, 181.568 ], "x_axis": [ -0.986, 0.166, -0.014 ], "y_axis": [ 0.158, 0.904, -0.397 ], "z_axis": [ -0.054, -0.394, -0.918 ], "quaternion": [ -0.010, 0.083, 0.976, -0.203 ] } }, { "index": 117, "index_chain": 117, "chain_name": "I", "nt_resnum": 117, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/117", "linked_nts": [ "///I/116", "///I/118" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -17.895, "beta": 179.483, "gamma": -0.447, "delta": 141.604, "epsilon": -176.641, "zeta": -106.561, "epsilon_zeta": -70.080, "bb_type": "BI", "chi": -98.787, "glyco_bond": "anti", "C5prime_xyz": [ -1.787, 7.991, -2.194 ], "P_xyz": [ 0.089, 9.792, -2.004 ], "form": "B", "ssZp": 1.845, "Dp": 2.078, "splay_angle": 21.484, "splay_distance": 3.721, "splay_ratio": 0.187, "d22": 4.025, "d64": 3.760, "eta": 167.783, "theta": -150.879, "eta_prime": -170.291, "theta_prime": -155.590, "eta_base": -124.444, "theta_base": -119.492, "v0": -13.824, "v1": 27.695, "v2": -30.399, "v3": 23.149, "v4": -6.114, "amplitude": 30.658, "phase_angle": 172.537, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 147.379, 138.077, 178.392 ], "x_axis": [ -0.720, 0.675, -0.160 ], "y_axis": [ 0.684, 0.654, -0.323 ], "z_axis": [ -0.113, -0.342, -0.933 ], "quaternion": [ 0.013, 0.374, 0.909, -0.183 ] } }, { "index": 118, "index_chain": 118, "chain_name": "I", "nt_resnum": 118, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/118", "linked_nts": [ "///I/117", "///I/119" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -27.551, "beta": 174.568, "gamma": 18.718, "delta": 138.729, "epsilon": -161.993, "zeta": -125.588, "epsilon_zeta": -36.405, "bb_type": "BI", "chi": -105.870, "glyco_bond": "anti", "C5prime_xyz": [ -2.177, 8.305, -1.936 ], "P_xyz": [ -0.188, 9.949, -1.634 ], "form": "B", "ssZp": 2.088, "Dp": 2.150, "splay_angle": 18.994, "splay_distance": 3.260, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 173.911, "theta": -153.990, "eta_prime": -165.518, "theta_prime": -160.690, "eta_base": -125.854, "theta_base": -122.484, "v0": -24.938, "v1": 35.993, "v2": -32.836, "v3": 19.282, "v4": 3.297, "amplitude": 35.937, "phase_angle": 156.023, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 146.617, 137.121, 174.877 ], "x_axis": [ -0.271, 0.946, -0.180 ], "y_axis": [ 0.955, 0.240, -0.177 ], "z_axis": [ -0.124, -0.220, -0.968 ], "quaternion": [ 0.018, 0.604, 0.787, -0.126 ] } }, { "index": 119, "index_chain": 119, "chain_name": "I", "nt_resnum": 119, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/119", "linked_nts": [ "///I/118", "///I/120" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.373, "beta": 152.744, "gamma": 38.238, "delta": 119.826, "epsilon": -175.339, "zeta": -89.881, "epsilon_zeta": -85.458, "bb_type": "BI", "chi": -124.511, "glyco_bond": "anti", "C5prime_xyz": [ -2.382, 8.695, -1.413 ], "P_xyz": [ -0.065, 9.857, -1.195 ], "form": ".", "ssZp": 2.560, "Dp": 2.579, "splay_angle": 19.198, "splay_distance": 3.489, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 165.720, "theta": -138.261, "eta_prime": -174.565, "theta_prime": -149.735, "eta_base": -129.778, "theta_base": -112.464, "v0": -32.745, "v1": 32.075, "v2": -19.741, "v3": 1.561, "v4": 19.496, "amplitude": 33.357, "phase_angle": 126.285, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 145.982, 136.559, 171.730 ], "x_axis": [ 0.274, 0.953, -0.132 ], "y_axis": [ 0.957, -0.284, -0.060 ], "z_axis": [ -0.095, -0.109, -0.989 ], "quaternion": [ 0.015, 0.798, 0.598, -0.071 ] } }, { "index": 120, "index_chain": 120, "chain_name": "I", "nt_resnum": 120, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/120", "linked_nts": [ "///I/119", "///I/121" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.249, "beta": 175.407, "gamma": 34.452, "delta": 119.606, "epsilon": -178.182, "zeta": -89.448, "epsilon_zeta": -88.733, "bb_type": "BI", "chi": -123.872, "glyco_bond": "anti", "C5prime_xyz": [ -2.528, 8.696, -1.461 ], "P_xyz": [ -0.650, 10.473, -1.109 ], "form": ".", "ssZp": 2.597, "Dp": 2.575, "splay_angle": 19.950, "splay_distance": 3.670, "splay_ratio": 0.182, "d22": 4.152, "d64": 4.354, "eta": 168.407, "theta": -149.388, "eta_prime": -169.780, "theta_prime": -154.983, "eta_base": -122.522, "theta_base": -124.068, "v0": -36.213, "v1": 35.164, "v2": -21.213, "v3": 1.128, "v4": 21.863, "amplitude": 36.684, "phase_angle": 125.328, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 145.289, 137.536, 168.452 ], "x_axis": [ 0.754, 0.655, -0.049 ], "y_axis": [ 0.655, -0.755, -0.018 ], "z_axis": [ -0.049, -0.019, -0.999 ], "quaternion": [ 0.000, 0.936, 0.350, -0.026 ] } }, { "index": 121, "index_chain": 121, "chain_name": "I", "nt_resnum": 121, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/121", "linked_nts": [ "///I/120", "///I/122" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.728, "beta": -175.647, "gamma": 33.298, "delta": 120.203, "epsilon": -171.632, "zeta": -107.080, "epsilon_zeta": -64.552, "bb_type": "BI", "chi": -120.127, "glyco_bond": "anti", "C5prime_xyz": [ -2.522, 8.620, -1.638 ], "P_xyz": [ -0.795, 10.542, -1.313 ], "form": ".", "ssZp": 2.453, "Dp": 2.490, "splay_angle": 16.570, "splay_distance": 2.919, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 173.148, "theta": -161.201, "eta_prime": -170.235, "theta_prime": -165.915, "eta_base": -132.754, "theta_base": -129.212, "v0": -35.534, "v1": 34.952, "v2": -21.567, "v3": 1.900, "v4": 20.951, "amplitude": 36.214, "phase_angle": 126.550, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 144.917, 138.938, 165.082 ], "x_axis": [ 0.978, 0.204, 0.038 ], "y_axis": [ 0.205, -0.978, -0.037 ], "z_axis": [ 0.030, 0.044, -0.999 ], "quaternion": [ -0.020, 0.994, 0.103, 0.017 ] } }, { "index": 122, "index_chain": 122, "chain_name": "I", "nt_resnum": 122, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/122", "linked_nts": [ "///I/121", "///I/123" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.441, "beta": 161.247, "gamma": 43.405, "delta": 107.064, "epsilon": 175.744, "zeta": -91.380, "epsilon_zeta": -92.876, "bb_type": "BI", "chi": -134.910, "glyco_bond": "anti", "C5prime_xyz": [ -2.444, 8.777, -1.128 ], "P_xyz": [ -0.260, 10.186, -0.901 ], "form": "B", "ssZp": 2.761, "Dp": 2.786, "splay_angle": 19.099, "splay_distance": 3.132, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 168.013, "theta": -163.993, "eta_prime": -175.575, "theta_prime": -165.157, "eta_base": -131.862, "theta_base": -128.288, "v0": -34.636, "v1": 25.627, "v2": -8.100, "v3": -11.428, "v4": 28.994, "amplitude": 33.703, "phase_angle": 103.907, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 145.119, 139.907, 162.336 ], "x_axis": [ 0.944, -0.322, 0.074 ], "y_axis": [ -0.314, -0.944, -0.104 ], "z_axis": [ 0.104, 0.075, -0.992 ], "quaternion": [ -0.046, 0.985, -0.161, 0.045 ] } }, { "index": 123, "index_chain": 123, "chain_name": "I", "nt_resnum": 123, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/123", "linked_nts": [ "///I/122", "///I/124" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.215, "beta": -168.710, "gamma": 39.643, "delta": 144.543, "epsilon": -163.108, "zeta": -111.284, "epsilon_zeta": -51.824, "bb_type": "BI", "chi": -107.466, "glyco_bond": "anti", "C5prime_xyz": [ -1.651, 8.167, -1.766 ], "P_xyz": [ 0.581, 9.307, -1.064 ], "form": "B", "ssZp": 1.719, "Dp": 1.908, "splay_angle": 20.280, "splay_distance": 3.478, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": -179.312, "theta": -132.227, "eta_prime": -158.659, "theta_prime": -140.810, "eta_base": -120.211, "theta_base": -98.807, "v0": -13.159, "v1": 28.591, "v2": -32.408, "v3": 25.613, "v4": -8.101, "amplitude": 32.513, "phase_angle": 175.394, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 145.450, 140.623, 159.305 ], "x_axis": [ 0.586, -0.810, -0.020 ], "y_axis": [ -0.796, -0.570, -0.204 ], "z_axis": [ 0.154, 0.136, -0.979 ], "quaternion": [ -0.096, 0.885, -0.453, 0.038 ] } }, { "index": 124, "index_chain": 124, "chain_name": "I", "nt_resnum": 124, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/124", "linked_nts": [ "///I/123", "///I/125" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -38.110, "beta": 155.054, "gamma": 36.956, "delta": 140.722, "epsilon": -98.587, "zeta": 158.598, "epsilon_zeta": 102.816, "bb_type": "BII", "chi": -100.479, "glyco_bond": "anti", "C5prime_xyz": [ -3.088, 8.124, -2.074 ], "P_xyz": [ -0.951, 9.575, -2.372 ], "form": ".", "ssZp": 1.170, "Dp": 1.137, "splay_angle": 21.337, "splay_distance": 3.708, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": -171.408, "theta": 173.863, "eta_prime": -144.930, "theta_prime": 174.457, "eta_base": -102.824, "theta_base": -128.686, "v0": -35.289, "v1": 45.995, "v2": -38.300, "v3": 19.275, "v4": 9.639, "amplitude": 44.820, "phase_angle": 148.708, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 146.062, 140.242, 155.902 ], "x_axis": [ 0.072, -0.981, -0.180 ], "y_axis": [ -0.971, -0.027, -0.237 ], "z_axis": [ 0.228, 0.192, -0.955 ], "quaternion": [ -0.150, 0.717, -0.681, 0.017 ] } }, { "index": 125, "index_chain": 125, "chain_name": "I", "nt_resnum": 125, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/125", "linked_nts": [ "///I/124", "///I/126" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.727, "beta": 149.596, "gamma": 18.144, "delta": 159.153, "epsilon": -160.289, "zeta": -128.893, "epsilon_zeta": -31.395, "bb_type": "--", "chi": -91.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.536, 7.653, -2.268 ], "P_xyz": [ 0.920, 8.231, -1.571 ], "form": "B", "ssZp": 1.076, "Dp": 1.412, "splay_angle": 19.823, "splay_distance": 3.370, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 172.996, "theta": -124.763, "eta_prime": -163.224, "theta_prime": -146.704, "eta_base": -112.397, "theta_base": -96.565, "v0": -4.506, "v1": 27.657, "v2": -39.149, "v3": 37.476, "v4": -20.993, "amplitude": 40.071, "phase_angle": 192.316, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 145.596, 142.117, 152.736 ], "x_axis": [ -0.596, -0.712, -0.372 ], "y_axis": [ -0.772, 0.635, 0.022 ], "z_axis": [ 0.221, 0.301, -0.928 ], "quaternion": [ 0.167, -0.417, 0.889, 0.091 ] } }, { "index": 126, "index_chain": 126, "chain_name": "I", "nt_resnum": 126, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/126", "linked_nts": [ "///I/125", "///I/127" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -36.858, "beta": 145.601, "gamma": 37.736, "delta": 140.943, "epsilon": -92.051, "zeta": 157.379, "epsilon_zeta": 110.569, "bb_type": "BII", "chi": -97.831, "glyco_bond": "anti", "C5prime_xyz": [ -2.889, 8.060, -2.263 ], "P_xyz": [ -0.558, 9.195, -2.559 ], "form": ".", "ssZp": 0.723, "Dp": 0.810, "splay_angle": 21.718, "splay_distance": 3.731, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": -170.060, "theta": -177.994, "eta_prime": -146.580, "theta_prime": 179.776, "eta_base": -99.140, "theta_base": -133.075, "v0": -33.376, "v1": 44.645, "v2": -38.364, "v3": 20.242, "v4": 7.847, "amplitude": 43.892, "phase_angle": 150.934, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 145.249, 143.369, 149.627 ], "x_axis": [ -0.928, -0.206, -0.310 ], "y_axis": [ -0.272, 0.944, 0.188 ], "z_axis": [ 0.254, 0.258, -0.932 ], "quaternion": [ 0.145, -0.122, 0.975, 0.114 ] } }, { "index": 127, "index_chain": 127, "chain_name": "I", "nt_resnum": 127, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/127", "linked_nts": [ "///I/126", "///I/128" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,phosphate", "alpha": -34.063, "beta": 148.436, "gamma": -2.509, "delta": 157.414, "epsilon": -179.012, "zeta": -114.070, "epsilon_zeta": -64.942, "bb_type": "BI", "chi": -86.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 7.472, -2.431 ], "P_xyz": [ 0.620, 8.600, -1.832 ], "form": "B", "ssZp": 1.328, "Dp": 1.606, "splay_angle": 20.005, "splay_distance": 3.380, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 164.916, "theta": -133.453, "eta_prime": -173.694, "theta_prime": -152.080, "eta_base": -129.089, "theta_base": -109.406, "v0": -2.911, "v1": 25.523, "v2": -37.276, "v3": 36.443, "v4": -21.404, "amplitude": 38.481, "phase_angle": 194.380, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 147.245, 145.329, 147.158 ], "x_axis": [ -0.905, 0.404, -0.136 ], "y_axis": [ 0.318, 0.851, 0.418 ], "z_axis": [ 0.285, 0.335, -0.898 ], "quaternion": [ 0.110, 0.189, 0.956, 0.197 ] } }, { "index": 128, "index_chain": 128, "chain_name": "I", "nt_resnum": 128, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/128", "linked_nts": [ "///I/127", "///I/129" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.391, "beta": 173.536, "gamma": 21.336, "delta": 144.056, "epsilon": -164.939, "zeta": -130.078, "epsilon_zeta": -34.861, "bb_type": "BI", "chi": -98.693, "glyco_bond": "anti", "C5prime_xyz": [ -2.204, 8.015, -2.171 ], "P_xyz": [ -0.083, 9.533, -2.032 ], "form": "B", "ssZp": 1.927, "Dp": 2.038, "splay_angle": 20.961, "splay_distance": 3.606, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 169.209, "theta": -151.417, "eta_prime": -169.135, "theta_prime": -163.130, "eta_base": -121.887, "theta_base": -125.979, "v0": -20.439, "v1": 34.903, "v2": -35.274, "v3": 24.381, "v4": -2.744, "amplitude": 36.446, "phase_angle": 165.430, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 147.954, 146.916, 144.259 ], "x_axis": [ -0.604, 0.770, 0.206 ], "y_axis": [ 0.765, 0.486, 0.423 ], "z_axis": [ 0.226, 0.413, -0.882 ], "quaternion": [ 0.006, 0.445, 0.862, 0.243 ] } }, { "index": 129, "index_chain": 129, "chain_name": "I", "nt_resnum": 129, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/129", "linked_nts": [ "///I/128", "///I/130" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -34.546, "beta": 149.211, "gamma": 38.323, "delta": 115.246, "epsilon": -174.213, "zeta": -99.529, "epsilon_zeta": -74.684, "bb_type": "BI", "chi": -126.987, "glyco_bond": "anti", "C5prime_xyz": [ -2.583, 8.689, -1.378 ], "P_xyz": [ -0.299, 9.945, -1.273 ], "form": "B", "ssZp": 2.716, "Dp": 2.695, "splay_angle": 22.535, "splay_distance": 3.846, "splay_ratio": 0.196, "d22": 4.366, "d64": 4.043, "eta": 170.186, "theta": -149.961, "eta_prime": -173.179, "theta_prime": -155.331, "eta_base": -129.685, "theta_base": -121.450, "v0": -36.100, "v1": 32.281, "v2": -16.887, "v3": -3.270, "v4": 24.651, "amplitude": 35.557, "phase_angle": 118.355, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 148.417, 148.370, 140.992 ], "x_axis": [ -0.143, 0.897, 0.418 ], "y_axis": [ 0.955, 0.014, 0.297 ], "z_axis": [ 0.260, 0.441, -0.859 ], "quaternion": [ -0.055, 0.652, 0.710, 0.260 ] } }, { "index": 130, "index_chain": 130, "chain_name": "I", "nt_resnum": 130, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/130", "linked_nts": [ "///I/129", "///I/131" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -31.466, "beta": -176.607, "gamma": 22.477, "delta": 149.087, "epsilon": -163.688, "zeta": -121.842, "epsilon_zeta": -41.846, "bb_type": "BI", "chi": -107.413, "glyco_bond": "anti", "C5prime_xyz": [ -2.059, 8.305, -1.724 ], "P_xyz": [ -0.114, 9.933, -1.091 ], "form": "B", "ssZp": 1.986, "Dp": 1.974, "splay_angle": 19.231, "splay_distance": 3.208, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 175.792, "theta": -145.756, "eta_prime": -160.527, "theta_prime": -153.993, "eta_base": -121.347, "theta_base": -105.618, "v0": -20.438, "v1": 37.371, "v2": -39.176, "v3": 28.422, "v4": -5.266, "amplitude": 39.952, "phase_angle": 168.687, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 148.835, 150.555, 137.854 ], "x_axis": [ 0.372, 0.702, 0.608 ], "y_axis": [ 0.877, -0.480, 0.017 ], "z_axis": [ 0.304, 0.527, -0.794 ], "quaternion": [ -0.157, 0.813, 0.485, 0.280 ] } }, { "index": 131, "index_chain": 131, "chain_name": "I", "nt_resnum": 131, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/131", "linked_nts": [ "///I/130", "///I/132" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.242, "beta": 166.509, "gamma": 31.909, "delta": 131.626, "epsilon": 176.892, "zeta": -94.244, "epsilon_zeta": -88.865, "bb_type": "BI", "chi": -113.905, "glyco_bond": "anti", "C5prime_xyz": [ -2.087, 8.401, -1.697 ], "P_xyz": [ 0.254, 9.557, -1.387 ], "form": ".", "ssZp": 2.459, "Dp": 2.457, "splay_angle": 18.759, "splay_distance": 3.273, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 159.278, "theta": -141.754, "eta_prime": -177.278, "theta_prime": -153.432, "eta_base": -120.220, "theta_base": -122.124, "v0": -24.210, "v1": 31.122, "v2": -26.012, "v3": 12.707, "v4": 7.057, "amplitude": 30.613, "phase_angle": 148.177, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 150.127, 152.584, 135.732 ], "x_axis": [ 0.814, 0.180, 0.552 ], "y_axis": [ 0.446, -0.803, -0.395 ], "z_axis": [ 0.373, 0.568, -0.734 ], "quaternion": [ -0.263, 0.915, 0.171, 0.253 ] } }, { "index": 132, "index_chain": 132, "chain_name": "I", "nt_resnum": 132, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/132", "linked_nts": [ "///I/131", "///I/133" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.383, "beta": -175.115, "gamma": 38.823, "delta": 133.138, "epsilon": -171.696, "zeta": -112.140, "epsilon_zeta": -59.556, "bb_type": "BI", "chi": -108.700, "glyco_bond": "anti", "C5prime_xyz": [ -2.377, 8.396, -1.904 ], "P_xyz": [ -0.325, 10.007, -1.753 ], "form": "B", "ssZp": 2.300, "Dp": 2.319, "splay_angle": 19.818, "splay_distance": 3.365, "splay_ratio": 0.172, "d22": 4.270, "d64": 3.811, "eta": 173.870, "theta": -151.174, "eta_prime": -165.580, "theta_prime": -156.259, "eta_base": -127.145, "theta_base": -115.347, "v0": -28.750, "v1": 36.578, "v2": -30.155, "v3": 14.488, "v4": 8.679, "amplitude": 35.824, "phase_angle": 147.327, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 151.373, 155.132, 134.097 ], "x_axis": [ 0.924, -0.258, 0.282 ], "y_axis": [ 0.012, -0.717, -0.697 ], "z_axis": [ 0.382, 0.647, -0.660 ], "quaternion": [ -0.370, 0.908, -0.068, 0.183 ] } }, { "index": 133, "index_chain": 133, "chain_name": "I", "nt_resnum": 133, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/133", "linked_nts": [ "///I/132", "///I/134" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -42.084, "beta": 166.215, "gamma": 40.567, "delta": 144.280, "epsilon": -123.466, "zeta": -177.457, "epsilon_zeta": 53.990, "bb_type": "BII", "chi": -103.004, "glyco_bond": "anti", "C5prime_xyz": [ -2.766, 8.221, -1.964 ], "P_xyz": [ -0.571, 9.626, -2.098 ], "form": "B", "ssZp": 1.650, "Dp": 1.600, "splay_angle": 21.635, "splay_distance": 3.642, "splay_ratio": 0.190, "d22": 4.762, "d64": 3.896, "eta": -174.365, "theta": -159.235, "eta_prime": -152.591, "theta_prime": -162.236, "eta_base": -111.122, "theta_base": -115.321, "v0": -32.090, "v1": 44.860, "v2": -39.686, "v3": 22.377, "v4": 5.764, "amplitude": 44.264, "phase_angle": 153.711, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 153.334, 157.071, 132.168 ], "x_axis": [ 0.783, -0.604, -0.146 ], "y_axis": [ -0.446, -0.383, -0.809 ], "z_axis": [ 0.433, 0.699, -0.569 ], "quaternion": [ -0.456, 0.827, -0.317, 0.087 ] } }, { "index": 134, "index_chain": 134, "chain_name": "I", "nt_resnum": 134, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/134", "linked_nts": [ "///I/133", "///I/135" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -19.399, "beta": 124.093, "gamma": 17.327, "delta": 146.893, "epsilon": -91.336, "zeta": 154.991, "epsilon_zeta": 113.673, "bb_type": "BII", "chi": -89.911, "glyco_bond": "anti", "C5prime_xyz": [ -2.952, 7.943, -2.361 ], "P_xyz": [ -0.561, 9.003, -2.273 ], "form": "B", "ssZp": 0.971, "Dp": 0.934, "splay_angle": 22.538, "splay_distance": 3.848, "splay_ratio": 0.204, "d22": 5.002, "d64": 3.888, "eta": -173.035, "theta": -159.619, "eta_prime": -150.655, "theta_prime": -167.826, "eta_base": -108.045, "theta_base": -103.702, "v0": -31.888, "v1": 46.351, "v2": -42.064, "v3": 24.760, "v4": 4.178, "amplitude": 46.047, "phase_angle": 155.993, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 154.520, 159.248, 129.501 ], "x_axis": [ 0.389, -0.678, -0.623 ], "y_axis": [ -0.804, 0.080, -0.589 ], "z_axis": [ 0.450, 0.730, -0.514 ], "quaternion": [ -0.489, 0.675, -0.549, -0.064 ] } }, { "index": 135, "index_chain": 135, "chain_name": "I", "nt_resnum": 135, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/135", "linked_nts": [ "///I/134", "///I/136" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -40.616, "beta": 126.002, "gamma": 20.329, "delta": 151.893, "epsilon": -84.494, "zeta": 147.474, "epsilon_zeta": 128.032, "bb_type": "BII", "chi": -82.763, "glyco_bond": "anti", "C5prime_xyz": [ -2.839, 7.630, -2.622 ], "P_xyz": [ -0.365, 8.501, -2.625 ], "form": "B", "ssZp": 0.508, "Dp": 0.570, "splay_angle": 22.539, "splay_distance": 3.821, "splay_ratio": 0.203, "d22": 5.200, "d64": 3.904, "eta": -169.993, "theta": -160.842, "eta_prime": -143.852, "theta_prime": -174.868, "eta_base": -89.752, "theta_base": -115.643, "v0": -26.477, "v1": 43.640, "v2": -43.182, "v3": 29.178, "v4": -2.007, "amplitude": 44.997, "phase_angle": 163.672, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 154.605, 161.888, 126.703 ], "x_axis": [ -0.199, -0.329, -0.923 ], "y_axis": [ -0.840, 0.543, -0.013 ], "z_axis": [ 0.505, 0.772, -0.385 ], "quaternion": [ 0.490, -0.401, 0.729, 0.261 ] } }, { "index": 136, "index_chain": 136, "chain_name": "I", "nt_resnum": 136, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/136", "linked_nts": [ "///I/135", "///I/137" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -31.159, "beta": 148.035, "gamma": -7.922, "delta": 164.989, "epsilon": -162.337, "zeta": -152.631, "epsilon_zeta": -9.707, "bb_type": "--", "chi": -74.029, "glyco_bond": "anti", "C5prime_xyz": [ -2.088, 7.119, -2.775 ], "P_xyz": [ 0.167, 8.450, -2.708 ], "form": "B", "ssZp": 1.201, "Dp": 1.494, "splay_angle": 21.930, "splay_distance": 3.688, "splay_ratio": 0.193, "d22": 4.524, "d64": 3.722, "eta": 170.021, "theta": -156.360, "eta_prime": -168.313, "theta_prime": -172.320, "eta_base": -114.906, "theta_base": -134.806, "v0": -6.475, "v1": 31.644, "v2": -43.504, "v3": 40.710, "v4": -21.704, "amplitude": 44.214, "phase_angle": 190.284, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 155.269, 165.578, 125.970 ], "x_axis": [ -0.677, 0.170, -0.716 ], "y_axis": [ -0.506, 0.599, 0.621 ], "z_axis": [ 0.535, 0.783, -0.319 ], "quaternion": [ 0.388, -0.104, 0.805, 0.436 ] } }, { "index": 137, "index_chain": 137, "chain_name": "I", "nt_resnum": 137, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/137", "linked_nts": [ "///I/136", "///I/138" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -47.863, "beta": 143.802, "gamma": 51.114, "delta": 137.585, "epsilon": -168.200, "zeta": -135.505, "epsilon_zeta": -32.695, "bb_type": "--", "chi": -111.139, "glyco_bond": "anti", "C5prime_xyz": [ -2.513, 8.424, -1.743 ], "P_xyz": [ 0.013, 9.060, -1.933 ], "form": "B", "ssZp": 2.277, "Dp": 2.273, "splay_angle": 20.391, "splay_distance": 3.304, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 164.158, "theta": -154.220, "eta_prime": -172.000, "theta_prime": -172.015, "eta_base": -132.595, "theta_base": -124.461, "v0": -30.107, "v1": 40.097, "v2": -34.307, "v3": 17.857, "v4": 7.389, "amplitude": 39.417, "phase_angle": 150.501, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 157.434, 168.552, 125.712 ], "x_axis": [ -0.843, 0.424, -0.330 ], "y_axis": [ -0.148, 0.407, 0.901 ], "z_axis": [ 0.517, 0.809, -0.280 ], "quaternion": [ 0.266, 0.087, 0.795, 0.538 ] } }, { "index": 138, "index_chain": 138, "chain_name": "I", "nt_resnum": 138, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/138", "linked_nts": [ "///I/137", "///I/139" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -41.947, "beta": 170.420, "gamma": 37.297, "delta": 148.062, "epsilon": -172.411, "zeta": -100.336, "epsilon_zeta": -72.076, "bb_type": "BI", "chi": -115.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.241, -1.294 ], "P_xyz": [ 1.079, 8.687, -0.374 ], "form": "B", "ssZp": 1.812, "Dp": 1.913, "splay_angle": 18.766, "splay_distance": 3.280, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 171.189, "theta": -121.815, "eta_prime": -167.874, "theta_prime": -141.262, "eta_base": -116.412, "theta_base": -110.870, "v0": -7.187, "v1": 24.926, "v2": -32.195, "v3": 28.904, "v4": -13.901, "amplitude": 32.381, "phase_angle": 186.159, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 159.304, 171.237, 125.252 ], "x_axis": [ -0.792, 0.467, 0.394 ], "y_axis": [ 0.431, -0.029, 0.902 ], "z_axis": [ 0.432, 0.884, -0.178 ], "quaternion": [ 0.014, 0.322, 0.697, 0.641 ] } }, { "index": 139, "index_chain": 139, "chain_name": "I", "nt_resnum": 139, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/139", "linked_nts": [ "///I/138", "///I/140" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.608, "beta": 174.580, "gamma": 26.902, "delta": 135.348, "epsilon": -168.566, "zeta": -109.360, "epsilon_zeta": -59.206, "bb_type": "BI", "chi": -112.502, "glyco_bond": "anti", "C5prime_xyz": [ -2.360, 8.454, -1.714 ], "P_xyz": [ -0.415, 10.116, -1.200 ], "form": "B", "ssZp": 2.214, "Dp": 2.265, "splay_angle": 21.204, "splay_distance": 3.651, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 162.218, "theta": -148.397, "eta_prime": -171.858, "theta_prime": -154.617, "eta_base": -130.072, "theta_base": -123.700, "v0": -28.835, "v1": 37.600, "v2": -31.841, "v3": 16.123, "v4": 7.676, "amplitude": 36.997, "phase_angle": 149.386, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 160.322, 174.136, 124.102 ], "x_axis": [ -0.493, 0.350, 0.796 ], "y_axis": [ 0.758, -0.276, 0.591 ], "z_axis": [ 0.427, 0.895, -0.129 ], "quaternion": [ -0.159, 0.477, 0.580, 0.640 ] } }, { "index": 140, "index_chain": 140, "chain_name": "I", "nt_resnum": 140, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/140", "linked_nts": [ "///I/139", "///I/141" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.957, "beta": -178.290, "gamma": 28.854, "delta": 135.336, "epsilon": -164.513, "zeta": -114.052, "epsilon_zeta": -50.460, "bb_type": "BI", "chi": -109.055, "glyco_bond": "anti", "C5prime_xyz": [ -2.261, 8.324, -1.854 ], "P_xyz": [ -0.251, 9.955, -1.581 ], "form": "B", "ssZp": 2.217, "Dp": 2.254, "splay_angle": 20.723, "splay_distance": 3.530, "splay_ratio": 0.180, "d22": 4.180, "d64": 3.631, "eta": 170.129, "theta": -151.043, "eta_prime": -173.282, "theta_prime": -155.625, "eta_base": -136.526, "theta_base": -117.163, "v0": -25.408, "v1": 34.661, "v2": -30.217, "v3": 16.464, "v4": 5.414, "amplitude": 34.157, "phase_angle": 152.206, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 161.222, 177.602, 123.392 ], "x_axis": [ -0.090, 0.038, 0.995 ], "y_axis": [ 0.911, -0.401, 0.097 ], "z_axis": [ 0.403, 0.915, 0.002 ], "quaternion": [ -0.357, 0.572, 0.414, 0.611 ] } }, { "index": 141, "index_chain": 141, "chain_name": "I", "nt_resnum": 141, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/141", "linked_nts": [ "///I/140", "///I/142" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.980, "beta": 165.698, "gamma": 42.058, "delta": 131.282, "epsilon": -175.153, "zeta": -107.584, "epsilon_zeta": -67.569, "bb_type": "BI", "chi": -115.184, "glyco_bond": "anti", "C5prime_xyz": [ -2.311, 8.555, -1.641 ], "P_xyz": [ 0.000, 9.746, -1.508 ], "form": "B", "ssZp": 2.421, "Dp": 2.408, "splay_angle": 19.006, "splay_distance": 3.198, "splay_ratio": 0.166, "d22": 4.181, "d64": 3.660, "eta": 163.840, "theta": -148.100, "eta_prime": -171.783, "theta_prime": -158.451, "eta_base": -126.994, "theta_base": -117.512, "v0": -29.628, "v1": 36.279, "v2": -28.816, "v3": 12.568, "v4": 10.525, "amplitude": 35.510, "phase_angle": 144.242, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 162.585, 180.818, 123.898 ], "x_axis": [ 0.364, -0.330, 0.871 ], "y_axis": [ 0.817, -0.335, -0.469 ], "z_axis": [ 0.447, 0.882, 0.148 ], "quaternion": [ 0.543, -0.623, -0.195, -0.529 ] } }, { "index": 142, "index_chain": 142, "chain_name": "I", "nt_resnum": 142, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/142", "linked_nts": [ "///I/141", "///I/143" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.435, "beta": 169.427, "gamma": 55.462, "delta": 138.236, "epsilon": -149.197, "zeta": -113.033, "epsilon_zeta": -36.164, "bb_type": "BI", "chi": -114.992, "glyco_bond": "anti", "C5prime_xyz": [ -2.430, 8.485, -1.595 ], "P_xyz": [ -0.116, 9.667, -1.449 ], "form": "B", "ssZp": 1.872, "Dp": 1.968, "splay_angle": 18.362, "splay_distance": 3.142, "splay_ratio": 0.160, "d22": 4.274, "d64": 3.537, "eta": 178.217, "theta": -129.695, "eta_prime": -158.473, "theta_prime": -141.229, "eta_base": -113.439, "theta_base": -98.113, "v0": -29.983, "v1": 40.439, "v2": -35.126, "v3": 18.952, "v4": 6.556, "amplitude": 39.866, "phase_angle": 151.775, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 163.974, 183.497, 124.957 ], "x_axis": [ 0.757, -0.478, 0.446 ], "y_axis": [ 0.497, -0.021, -0.867 ], "z_axis": [ 0.424, 0.878, 0.221 ], "quaternion": [ 0.699, -0.624, -0.008, -0.349 ] } }, { "index": 143, "index_chain": 143, "chain_name": "I", "nt_resnum": 143, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/143", "linked_nts": [ "///I/142", "///I/144" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -47.411, "beta": 159.724, "gamma": 29.240, "delta": 142.059, "epsilon": -93.993, "zeta": 162.038, "epsilon_zeta": 103.969, "bb_type": "BII", "chi": -87.138, "glyco_bond": "anti", "C5prime_xyz": [ -3.291, 7.779, -2.428 ], "P_xyz": [ -1.310, 9.335, -3.139 ], "form": "B", "ssZp": 1.127, "Dp": 1.050, "splay_angle": 22.454, "splay_distance": 3.837, "splay_ratio": 0.201, "d22": 4.985, "d64": 3.881, "eta": 179.505, "theta": -176.238, "eta_prime": -155.437, "theta_prime": -176.101, "eta_base": -111.370, "theta_base": -118.291, "v0": -34.315, "v1": 45.916, "v2": -39.031, "v3": 20.589, "v4": 8.160, "amplitude": 44.819, "phase_angle": 150.559, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 166.162, 185.613, 125.732 ], "x_axis": [ 0.886, -0.440, -0.142 ], "y_axis": [ 0.068, 0.429, -0.901 ], "z_axis": [ 0.458, 0.789, 0.410 ], "quaternion": [ 0.825, -0.512, 0.182, -0.154 ] } }, { "index": 144, "index_chain": 144, "chain_name": "I", "nt_resnum": 144, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/144", "linked_nts": [ "///I/143", "///I/145" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -49.648, "beta": 129.891, "gamma": 26.492, "delta": 145.971, "epsilon": -82.540, "zeta": 171.218, "epsilon_zeta": 106.242, "bb_type": "BII", "chi": -87.610, "glyco_bond": "anti", "C5prime_xyz": [ -2.894, 7.805, -2.487 ], "P_xyz": [ -0.420, 8.638, -2.676 ], "form": ".", "ssZp": 0.606, "Dp": 0.588, "splay_angle": 25.019, "splay_distance": 4.252, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": -167.078, "theta": -156.427, "eta_prime": -146.976, "theta_prime": -165.380, "eta_base": -98.983, "theta_base": -109.409, "v0": -28.380, "v1": 42.829, "v2": -40.025, "v3": 24.865, "v4": 1.857, "amplitude": 42.980, "phase_angle": 158.630, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.121, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 167.810, 189.078, 125.814 ], "x_axis": [ 0.757, 0.007, -0.654 ], "y_axis": [ -0.506, 0.640, -0.579 ], "z_axis": [ 0.414, 0.769, 0.488 ], "quaternion": [ 0.849, -0.397, 0.314, 0.151 ] } }, { "index": 145, "index_chain": 145, "chain_name": "I", "nt_resnum": 145, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/145", "linked_nts": [ "///I/144", "///I/146" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.304, "beta": 133.667, "gamma": 32.903, "delta": 144.560, "epsilon": -95.734, "zeta": 150.360, "epsilon_zeta": 113.906, "bb_type": "BII", "chi": -83.446, "glyco_bond": "anti", "C5prime_xyz": [ -3.045, 7.536, -2.618 ], "P_xyz": [ -0.579, 8.259, -3.127 ], "form": ".", "ssZp": 0.782, "Dp": 0.853, "splay_angle": 21.737, "splay_distance": 3.825, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -174.779, "theta": -178.223, "eta_prime": -152.885, "theta_prime": 171.903, "eta_base": -106.449, "theta_base": -129.325, "v0": -28.135, "v1": 41.821, "v2": -38.703, "v3": 23.616, "v4": 2.499, "amplitude": 41.830, "phase_angle": 157.706, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.177, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 168.090, 193.214, 126.761 ], "x_axis": [ 0.281, 0.478, -0.832 ], "y_axis": [ -0.875, 0.484, -0.017 ], "z_axis": [ 0.394, 0.733, 0.554 ], "quaternion": [ 0.761, -0.246, 0.403, 0.444 ] } }, { "index": 146, "index_chain": 146, "chain_name": "I", "nt_resnum": 146, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/146", "linked_nts": [ "///I/145", "///I/147" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.515, "beta": 139.785, "gamma": 20.037, "delta": 155.945, "epsilon": -147.662, "zeta": -149.821, "epsilon_zeta": 2.159, "bb_type": "--", "chi": -86.460, "glyco_bond": "anti", "C5prime_xyz": [ -2.031, 7.622, -2.534 ], "P_xyz": [ 0.479, 8.273, -2.168 ], "form": "B", "ssZp": 1.128, "Dp": 1.425, "splay_angle": 20.766, "splay_distance": 3.543, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 173.328, "theta": -140.274, "eta_prime": -162.837, "theta_prime": -160.349, "eta_base": -112.221, "theta_base": -109.402, "v0": -13.107, "v1": 34.025, "v2": -41.111, "v3": 34.440, "v4": -13.683, "amplitude": 41.112, "phase_angle": 180.448, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.046, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 167.739, 195.903, 129.458 ], "x_axis": [ -0.325, 0.735, -0.595 ], "y_axis": [ -0.867, 0.020, 0.498 ], "z_axis": [ 0.377, 0.678, 0.631 ], "quaternion": [ 0.575, -0.078, 0.423, 0.696 ] } }, { "index": 147, "index_chain": 147, "chain_name": "I", "nt_resnum": 147, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/147", "linked_nts": [ "///I/146", "///I/148" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.207, "beta": 138.835, "gamma": 43.356, "delta": 142.452, "epsilon": -140.497, "zeta": -152.613, "epsilon_zeta": 12.116, "bb_type": "--", "chi": -103.148, "glyco_bond": "anti", "C5prime_xyz": [ -2.613, 8.224, -2.038 ], "P_xyz": [ -0.113, 8.939, -2.173 ], "form": "B", "ssZp": 1.746, "Dp": 1.831, "splay_angle": 22.287, "splay_distance": 3.750, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 170.770, "theta": -153.036, "eta_prime": -162.529, "theta_prime": -169.313, "eta_base": -112.003, "theta_base": -131.271, "v0": -30.562, "v1": 42.911, "v2": -38.260, "v3": 21.729, "v4": 5.219, "amplitude": 42.502, "phase_angle": 154.185, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 167.956, 198.184, 132.161 ], "x_axis": [ -0.777, 0.597, -0.197 ], "y_axis": [ -0.512, -0.418, 0.750 ], "z_axis": [ 0.366, 0.684, 0.631 ], "quaternion": [ 0.330, 0.050, 0.427, 0.841 ] } }, { "index": 148, "index_chain": 148, "chain_name": "I", "nt_resnum": 148, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/148", "linked_nts": [ "///I/147", "///I/149" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -51.508, "beta": 145.312, "gamma": 41.266, "delta": 140.636, "epsilon": -154.725, "zeta": -137.406, "epsilon_zeta": -17.320, "bb_type": "--", "chi": -118.238, "glyco_bond": "anti", "C5prime_xyz": [ -2.307, 8.655, -1.367 ], "P_xyz": [ 0.155, 9.428, -0.985 ], "form": "B", "ssZp": 2.158, "Dp": 2.140, "splay_angle": 19.466, "splay_distance": 3.202, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 164.682, "theta": -150.850, "eta_prime": -173.622, "theta_prime": -163.890, "eta_base": -131.639, "theta_base": -120.632, "v0": -30.205, "v1": 41.732, "v2": -36.611, "v3": 20.141, "v4": 6.063, "amplitude": 41.155, "phase_angle": 152.820, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.033, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 169.743, 200.318, 134.675 ], "x_axis": [ -0.969, 0.196, 0.150 ], "y_axis": [ -0.046, -0.742, 0.669 ], "z_axis": [ 0.242, 0.641, 0.728 ], "quaternion": [ 0.065, 0.106, 0.353, 0.927 ] } }, { "index": 149, "index_chain": 149, "chain_name": "I", "nt_resnum": 149, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/149", "linked_nts": [ "///I/148", "///I/150" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.522, "beta": 163.288, "gamma": 43.348, "delta": 144.267, "epsilon": -168.553, "zeta": -102.266, "epsilon_zeta": -66.287, "bb_type": "BI", "chi": -119.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.603, 8.458, -1.192 ], "P_xyz": [ 0.872, 8.934, -0.509 ], "form": "B", "ssZp": 2.061, "Dp": 2.078, "splay_angle": 19.046, "splay_distance": 3.297, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 163.703, "theta": -123.975, "eta_prime": -173.123, "theta_prime": -143.914, "eta_base": -122.703, "theta_base": -109.182, "v0": -16.078, "v1": 30.869, "v2": -33.162, "v3": 24.722, "v4": -5.646, "amplitude": 33.597, "phase_angle": 170.773, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 170.992, 202.125, 137.005 ], "x_axis": [ -0.794, -0.379, 0.475 ], "y_axis": [ 0.574, -0.724, 0.383 ], "z_axis": [ 0.199, 0.577, 0.792 ], "quaternion": [ -0.262, 0.185, 0.264, 0.910 ] } }, { "index": 150, "index_chain": 150, "chain_name": "I", "nt_resnum": 150, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/150", "linked_nts": [ "///I/149", "///I/151" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.627, "beta": 174.063, "gamma": 38.639, "delta": 130.530, "epsilon": -174.199, "zeta": -113.023, "epsilon_zeta": -61.176, "bb_type": "BI", "chi": -116.881, "glyco_bond": "anti", "C5prime_xyz": [ -2.262, 8.577, -1.611 ], "P_xyz": [ -0.112, 10.019, -1.303 ], "form": "B", "ssZp": 2.349, "Dp": 2.357, "splay_angle": 19.282, "splay_distance": 3.222, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 162.554, "theta": -156.240, "eta_prime": -171.622, "theta_prime": -162.603, "eta_base": -124.988, "theta_base": -123.454, "v0": -30.290, "v1": 36.430, "v2": -28.542, "v3": 11.946, "v4": 11.284, "amplitude": 35.712, "phase_angle": 143.057, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 170.987, 204.274, 139.505 ], "x_axis": [ -0.339, -0.732, 0.591 ], "y_axis": [ 0.924, -0.378, 0.061 ], "z_axis": [ 0.179, 0.567, 0.804 ], "quaternion": [ 0.521, -0.242, -0.198, -0.794 ] } }, { "index": 151, "index_chain": 151, "chain_name": "I", "nt_resnum": 151, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/151", "linked_nts": [ "///I/150", "///I/152" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.406, "beta": 175.280, "gamma": 38.466, "delta": 138.060, "epsilon": -168.082, "zeta": -107.927, "epsilon_zeta": -60.155, "bb_type": "BI", "chi": -114.837, "glyco_bond": "anti", "C5prime_xyz": [ -1.987, 8.465, -1.554 ], "P_xyz": [ 0.290, 9.615, -1.025 ], "form": "B", "ssZp": 2.160, "Dp": 2.199, "splay_angle": 19.173, "splay_distance": 3.294, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 171.840, "theta": -139.533, "eta_prime": -167.902, "theta_prime": -150.433, "eta_base": -123.555, "theta_base": -117.429, "v0": -21.813, "v1": 32.755, "v2": -30.776, "v3": 19.027, "v4": 1.518, "amplitude": 33.047, "phase_angle": 158.632, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 171.163, 206.159, 142.112 ], "x_axis": [ 0.238, -0.845, 0.480 ], "y_axis": [ 0.956, 0.116, -0.270 ], "z_axis": [ 0.172, 0.523, 0.835 ], "quaternion": [ 0.740, -0.268, -0.104, -0.608 ] } }, { "index": 152, "index_chain": 152, "chain_name": "I", "nt_resnum": 152, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/152", "linked_nts": [ "///I/151", "///I/153" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.045, "beta": 172.938, "gamma": 34.386, "delta": 134.817, "epsilon": -152.050, "zeta": -137.323, "epsilon_zeta": -14.726, "bb_type": "--", "chi": -108.733, "glyco_bond": "anti", "C5prime_xyz": [ -2.458, 8.338, -1.879 ], "P_xyz": [ -0.343, 9.846, -1.769 ], "form": "B", "ssZp": 2.120, "Dp": 2.169, "splay_angle": 21.555, "splay_distance": 3.631, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 172.399, "theta": -161.307, "eta_prime": -167.717, "theta_prime": -162.943, "eta_base": -128.420, "theta_base": -115.516, "v0": -29.691, "v1": 38.113, "v2": -31.562, "v3": 15.345, "v4": 8.790, "amplitude": 37.312, "phase_angle": 147.767, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 171.315, 207.605, 145.068 ], "x_axis": [ 0.696, -0.674, 0.247 ], "y_axis": [ 0.704, 0.572, -0.422 ], "z_axis": [ 0.143, 0.468, 0.872 ], "quaternion": [ 0.886, -0.251, -0.029, -0.389 ] } }, { "index": 153, "index_chain": 153, "chain_name": "I", "nt_resnum": 153, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/153", "linked_nts": [ "///I/152", "///I/154" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.996, "beta": 143.576, "gamma": 55.697, "delta": 143.980, "epsilon": -133.047, "zeta": -146.594, "epsilon_zeta": 13.548, "bb_type": "--", "chi": -111.239, "glyco_bond": "anti", "C5prime_xyz": [ -2.343, 8.469, -1.665 ], "P_xyz": [ 0.216, 8.973, -1.771 ], "form": "B", "ssZp": 1.576, "Dp": 1.642, "splay_angle": 21.721, "splay_distance": 3.659, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 178.145, "theta": -137.668, "eta_prime": -153.842, "theta_prime": -153.041, "eta_base": -107.962, "theta_base": -109.813, "v0": -27.991, "v1": 41.427, "v2": -38.417, "v3": 23.206, "v4": 2.728, "amplitude": 41.578, "phase_angle": 157.515, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 172.495, 209.646, 147.829 ], "x_axis": [ 0.979, -0.189, -0.070 ], "y_axis": [ 0.138, 0.882, -0.450 ], "z_axis": [ 0.147, 0.431, 0.890 ], "quaternion": [ 0.969, -0.227, 0.056, -0.084 ] } }, { "index": 154, "index_chain": 154, "chain_name": "I", "nt_resnum": 154, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/154", "linked_nts": [ "///I/153", "///I/155" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -34.239, "beta": 144.108, "gamma": 25.637, "delta": 151.236, "epsilon": -87.983, "zeta": 169.995, "epsilon_zeta": 102.022, "bb_type": "BII", "chi": -85.662, "glyco_bond": "anti", "C5prime_xyz": [ -2.976, 7.710, -2.474 ], "P_xyz": [ -0.643, 8.877, -2.744 ], "form": ".", "ssZp": 0.738, "Dp": 0.767, "splay_angle": 23.878, "splay_distance": 3.999, "splay_ratio": 0.215, "d22": 5.177, "d64": 3.817, "eta": -174.133, "theta": -158.777, "eta_prime": -147.433, "theta_prime": -166.434, "eta_base": -108.056, "theta_base": -100.460, "v0": -28.372, "v1": 45.145, "v2": -43.645, "v3": 28.483, "v4": -0.411, "amplitude": 45.990, "phase_angle": 161.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 173.105, 211.905, 150.642 ], "x_axis": [ 0.879, 0.390, -0.273 ], "y_axis": [ -0.455, 0.857, -0.242 ], "z_axis": [ 0.140, 0.337, 0.931 ], "quaternion": [ 0.958, -0.151, 0.108, 0.221 ] } }, { "index": 155, "index_chain": 155, "chain_name": "I", "nt_resnum": 155, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/155", "linked_nts": [ "///I/154", "///I/156" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -58.800, "beta": 137.242, "gamma": 26.921, "delta": 149.339, "epsilon": -92.052, "zeta": 154.928, "epsilon_zeta": 113.020, "bb_type": "BII", "chi": -79.800, "glyco_bond": "anti", "C5prime_xyz": [ -2.752, 7.480, -2.732 ], "P_xyz": [ -0.244, 8.163, -3.065 ], "form": ".", "ssZp": 0.447, "Dp": 0.593, "splay_angle": 23.509, "splay_distance": 4.221, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": -172.689, "theta": -174.320, "eta_prime": -150.729, "theta_prime": 176.076, "eta_base": -94.915, "theta_base": -125.878, "v0": -22.595, "v1": 39.084, "v2": -39.777, "v3": 27.880, "v4": -3.625, "amplitude": 40.967, "phase_angle": 166.154, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.169, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 172.671, 214.898, 153.258 ], "x_axis": [ 0.274, 0.907, -0.320 ], "y_axis": [ -0.945, 0.315, 0.084 ], "z_axis": [ 0.177, 0.279, 0.944 ], "quaternion": [ 0.796, -0.061, 0.156, 0.582 ] } }, { "index": 156, "index_chain": 156, "chain_name": "I", "nt_resnum": 156, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/156", "linked_nts": [ "///I/155", "///I/157" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.852, "beta": 149.374, "gamma": 19.164, "delta": 152.286, "epsilon": -169.684, "zeta": -126.830, "epsilon_zeta": -42.854, "bb_type": "BI", "chi": -82.076, "glyco_bond": "--", "C5prime_xyz": [ -1.844, 7.218, -2.703 ], "P_xyz": [ 0.693, 7.792, -2.496 ], "form": "B", "ssZp": 1.142, "Dp": 1.702, "splay_angle": 20.218, "splay_distance": 3.440, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 169.424, "theta": -134.846, "eta_prime": -168.148, "theta_prime": -156.027, "eta_base": -117.776, "theta_base": -110.928, "v0": -4.475, "v1": 24.672, "v2": -34.402, "v3": 32.621, "v4": -18.025, "amplitude": 35.104, "phase_angle": 191.479, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 170.895, 215.276, 157.068 ], "x_axis": [ -0.409, 0.901, -0.147 ], "y_axis": [ -0.902, -0.375, 0.214 ], "z_axis": [ 0.138, 0.220, 0.966 ], "quaternion": [ 0.544, -0.003, 0.131, 0.829 ] } }, { "index": 157, "index_chain": 157, "chain_name": "I", "nt_resnum": 157, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/157", "linked_nts": [ "///I/156", "///I/158" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -38.716, "beta": 143.391, "gamma": 48.625, "delta": 144.692, "epsilon": -114.565, "zeta": -172.518, "epsilon_zeta": 57.953, "bb_type": "BII", "chi": -102.401, "glyco_bond": "anti", "C5prime_xyz": [ -2.954, 8.211, -1.996 ], "P_xyz": [ -0.572, 9.180, -2.373 ], "form": "B", "ssZp": 1.401, "Dp": 1.449, "splay_angle": 20.272, "splay_distance": 3.385, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": -176.636, "theta": -165.008, "eta_prime": -149.339, "theta_prime": -177.405, "eta_base": -106.913, "theta_base": -128.278, "v0": -34.597, "v1": 47.346, "v2": -41.180, "v3": 22.622, "v4": 7.041, "amplitude": 46.484, "phase_angle": 152.363, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 170.297, 215.983, 160.382 ], "x_axis": [ -0.821, 0.571, -0.031 ], "y_axis": [ -0.555, -0.782, 0.284 ], "z_axis": [ 0.137, 0.250, 0.958 ], "quaternion": [ 0.298, 0.028, 0.142, 0.944 ] } }, { "index": 158, "index_chain": 158, "chain_name": "I", "nt_resnum": 158, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/158", "linked_nts": [ "///I/157", "///I/159" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -58.873, "beta": 143.088, "gamma": 33.081, "delta": 139.682, "epsilon": 179.174, "zeta": -98.652, "epsilon_zeta": -82.174, "bb_type": "BI", "chi": -112.004, "glyco_bond": "anti", "C5prime_xyz": [ -2.138, 8.392, -1.677 ], "P_xyz": [ 0.327, 9.124, -1.216 ], "form": ".", "ssZp": 2.151, "Dp": 2.205, "splay_angle": 21.965, "splay_distance": 3.778, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 154.573, "theta": -128.960, "eta_prime": 179.842, "theta_prime": -149.555, "eta_base": -127.523, "theta_base": -112.938, "v0": -24.295, "v1": 36.222, "v2": -33.885, "v3": 20.738, "v4": 1.963, "amplitude": 36.499, "phase_angle": 158.186, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.340, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 171.096, 216.182, 163.665 ], "x_axis": [ -0.994, -0.049, 0.094 ], "y_axis": [ 0.064, -0.983, 0.170 ], "z_axis": [ 0.084, 0.175, 0.981 ], "quaternion": [ -0.028, 0.045, 0.087, 0.995 ] } }, { "index": 159, "index_chain": 159, "chain_name": "I", "nt_resnum": 159, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/159", "linked_nts": [ "///I/158", "///I/160" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.067, "beta": -169.795, "gamma": 33.322, "delta": 141.978, "epsilon": -164.768, "zeta": -118.184, "epsilon_zeta": -46.584, "bb_type": "BI", "chi": -108.920, "glyco_bond": "anti", "C5prime_xyz": [ -2.224, 8.340, -1.773 ], "P_xyz": [ -0.305, 10.020, -1.216 ], "form": "B", "ssZp": 2.035, "Dp": 2.082, "splay_angle": 17.525, "splay_distance": 2.994, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 174.008, "theta": -148.144, "eta_prime": -165.106, "theta_prime": -156.333, "eta_base": -119.726, "theta_base": -114.849, "v0": -24.248, "v1": 37.167, "v2": -35.351, "v3": 22.366, "v4": 0.878, "amplitude": 37.657, "phase_angle": 159.848, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 170.593, 217.402, 167.206 ], "x_axis": [ -0.779, -0.617, 0.111 ], "y_axis": [ 0.625, -0.779, 0.055 ], "z_axis": [ 0.053, 0.112, 0.992 ], "quaternion": [ -0.330, 0.043, 0.044, 0.942 ] } }, { "index": 160, "index_chain": 160, "chain_name": "I", "nt_resnum": 160, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/160", "linked_nts": [ "///I/159", "///I/161" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.373, "beta": 162.877, "gamma": 37.310, "delta": 128.164, "epsilon": -174.668, "zeta": -97.661, "epsilon_zeta": -77.007, "bb_type": "BI", "chi": -117.887, "glyco_bond": "anti", "C5prime_xyz": [ -2.397, 8.501, -1.613 ], "P_xyz": [ -0.167, 9.839, -1.375 ], "form": ".", "ssZp": 2.408, "Dp": 2.430, "splay_angle": 21.124, "splay_distance": 3.798, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 161.849, "theta": -141.613, "eta_prime": -176.273, "theta_prime": -154.393, "eta_base": -127.190, "theta_base": -125.795, "v0": -31.508, "v1": 35.851, "v2": -26.642, "v3": 9.280, "v4": 13.735, "amplitude": 35.416, "phase_angle": 138.787, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 170.195, 217.717, 170.156 ], "x_axis": [ -0.287, -0.958, 0.017 ], "y_axis": [ 0.958, -0.287, 0.027 ], "z_axis": [ -0.021, 0.024, 1.000 ], "quaternion": [ 0.597, 0.001, -0.016, -0.802 ] } }, { "index": 161, "index_chain": 161, "chain_name": "I", "nt_resnum": 161, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/161", "linked_nts": [ "///I/160", "///I/162" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.697, "beta": -178.992, "gamma": 35.942, "delta": 114.016, "epsilon": 177.999, "zeta": -94.651, "epsilon_zeta": -87.350, "bb_type": "BI", "chi": -121.505, "glyco_bond": "anti", "C5prime_xyz": [ -2.493, 8.567, -1.666 ], "P_xyz": [ -0.615, 10.375, -1.497 ], "form": "B", "ssZp": 2.559, "Dp": 2.638, "splay_angle": 17.392, "splay_distance": 2.976, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 171.392, "theta": -161.651, "eta_prime": -173.172, "theta_prime": -163.837, "eta_base": -136.383, "theta_base": -120.027, "v0": -34.078, "v1": 29.678, "v2": -14.868, "v3": -4.174, "v4": 24.001, "amplitude": 33.366, "phase_angle": 116.462, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 168.834, 217.638, 173.701 ], "x_axis": [ 0.220, -0.975, -0.032 ], "y_axis": [ 0.975, 0.219, 0.044 ], "z_axis": [ -0.036, -0.041, 0.999 ], "quaternion": [ 0.781, 0.027, -0.001, -0.624 ] } }, { "index": 162, "index_chain": 162, "chain_name": "I", "nt_resnum": 162, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/162", "linked_nts": [ "///I/161", "///I/163" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.671, "beta": 171.696, "gamma": 46.469, "delta": 126.880, "epsilon": -177.488, "zeta": -98.244, "epsilon_zeta": -79.244, "bb_type": "BI", "chi": -123.375, "glyco_bond": "anti", "C5prime_xyz": [ -2.211, 8.627, -1.357 ], "P_xyz": [ 0.031, 9.901, -0.958 ], "form": ".", "ssZp": 2.338, "Dp": 2.393, "splay_angle": 20.404, "splay_distance": 3.550, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 170.154, "theta": -146.047, "eta_prime": -166.035, "theta_prime": -155.318, "eta_base": -116.405, "theta_base": -123.665, "v0": -29.386, "v1": 33.613, "v2": -25.173, "v3": 9.018, "v4": 12.597, "amplitude": 33.191, "phase_angle": 139.325, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 168.550, 216.781, 176.538 ], "x_axis": [ 0.734, -0.675, -0.076 ], "y_axis": [ 0.679, 0.725, 0.118 ], "z_axis": [ -0.025, -0.139, 0.990 ], "quaternion": [ 0.929, 0.069, 0.014, -0.364 ] } }, { "index": 163, "index_chain": 163, "chain_name": "I", "nt_resnum": 163, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/163", "linked_nts": [ "///I/162", "///I/164" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -45.322, "beta": -177.645, "gamma": 34.740, "delta": 142.775, "epsilon": -166.489, "zeta": -160.532, "epsilon_zeta": -5.957, "bb_type": "--", "chi": -110.503, "glyco_bond": "anti", "C5prime_xyz": [ -2.421, 8.401, -1.724 ], "P_xyz": [ -0.502, 10.090, -1.241 ], "form": "B", "ssZp": 2.088, "Dp": 2.151, "splay_angle": 20.693, "splay_distance": 3.322, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 172.919, "theta": -160.738, "eta_prime": -163.148, "theta_prime": -163.097, "eta_base": -125.041, "theta_base": -110.412, "v0": -29.353, "v1": 42.075, "v2": -38.127, "v3": 22.242, "v4": 4.101, "amplitude": 41.874, "phase_angle": 155.576, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 167.914, 215.404, 179.748 ], "x_axis": [ 0.976, -0.214, 0.029 ], "y_axis": [ 0.207, 0.965, 0.161 ], "z_axis": [ -0.062, -0.151, 0.986 ], "quaternion": [ 0.991, 0.079, -0.023, -0.106 ] } }, { "index": 164, "index_chain": 164, "chain_name": "I", "nt_resnum": 164, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/164", "linked_nts": [ "///I/163", "///I/165" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 11.564, "beta": 128.823, "gamma": 13.754, "delta": 145.991, "epsilon": -167.419, "zeta": -125.967, "epsilon_zeta": -41.452, "bb_type": "BI", "chi": -101.525, "glyco_bond": "anti", "C5prime_xyz": [ -2.177, 8.117, -2.038 ], "P_xyz": [ 0.155, 8.972, -1.236 ], "form": "B", "ssZp": 1.897, "Dp": 1.984, "splay_angle": 18.592, "splay_distance": 3.187, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 171.919, "theta": -137.179, "eta_prime": -164.261, "theta_prime": -157.624, "eta_base": -108.841, "theta_base": -118.058, "v0": -21.433, "v1": 36.688, "v2": -37.263, "v3": 25.821, "v4": -3.058, "amplitude": 38.455, "phase_angle": 165.696, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 168.038, 215.231, 183.063 ], "x_axis": [ 0.869, 0.470, 0.153 ], "y_axis": [ -0.487, 0.867, 0.106 ], "z_axis": [ -0.083, -0.167, 0.983 ], "quaternion": [ 0.964, 0.071, -0.061, 0.248 ] } }, { "index": 165, "index_chain": 165, "chain_name": "I", "nt_resnum": 165, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/165", "linked_nts": [ "///I/164", "///I/166" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.046, "beta": 153.233, "gamma": 51.984, "delta": 120.887, "epsilon": -178.674, "zeta": -103.782, "epsilon_zeta": -74.891, "bb_type": "BI", "chi": -124.986, "glyco_bond": "anti", "C5prime_xyz": [ -2.505, 8.728, -1.454 ], "P_xyz": [ -0.166, 9.881, -1.485 ], "form": "B", "ssZp": 2.359, "Dp": 2.443, "splay_angle": 21.680, "splay_distance": 3.590, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 170.302, "theta": -155.065, "eta_prime": -168.439, "theta_prime": -164.769, "eta_base": -120.965, "theta_base": -126.627, "v0": -36.440, "v1": 36.609, "v2": -23.332, "v3": 3.173, "v4": 20.648, "amplitude": 37.544, "phase_angle": 128.424, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 168.236, 214.411, 186.137 ], "x_axis": [ 0.447, 0.862, 0.241 ], "y_axis": [ -0.890, 0.454, 0.027 ], "z_axis": [ -0.086, -0.227, 0.970 ], "quaternion": [ 0.847, 0.075, -0.097, 0.517 ] } }, { "index": 166, "index_chain": 166, "chain_name": "I", "nt_resnum": 166, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/166", "linked_nts": [ "///I/165", "///I/167" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.622, "beta": -168.329, "gamma": 29.231, "delta": 147.203, "epsilon": -166.281, "zeta": -120.024, "epsilon_zeta": -46.257, "bb_type": "BI", "chi": -102.969, "glyco_bond": "anti", "C5prime_xyz": [ -1.766, 8.067, -1.932 ], "P_xyz": [ 0.327, 9.511, -1.323 ], "form": "B", "ssZp": 1.736, "Dp": 1.910, "splay_angle": 18.729, "splay_distance": 3.195, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": -179.102, "theta": -146.947, "eta_prime": -160.495, "theta_prime": -157.471, "eta_base": -119.722, "theta_base": -122.636, "v0": -13.375, "v1": 30.151, "v2": -34.585, "v3": 27.721, "v4": -9.277, "amplitude": 34.650, "phase_angle": 176.491, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 168.341, 213.333, 189.559 ], "x_axis": [ -0.173, 0.952, 0.252 ], "y_axis": [ -0.983, -0.149, -0.110 ], "z_axis": [ -0.067, -0.267, 0.961 ], "quaternion": [ 0.640, 0.061, -0.125, 0.755 ] } }, { "index": 167, "index_chain": 167, "chain_name": "I", "nt_resnum": 167, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/167", "linked_nts": [ "///I/166", "///I/168" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.552, "beta": 156.740, "gamma": 48.926, "delta": 124.643, "epsilon": -176.790, "zeta": -109.864, "epsilon_zeta": -66.926, "bb_type": "BI", "chi": -117.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.570, 8.521, -1.701 ], "P_xyz": [ -0.254, 9.700, -1.813 ], "form": "B", "ssZp": 2.326, "Dp": 2.390, "splay_angle": 19.691, "splay_distance": 3.333, "splay_ratio": 0.172, "d22": 4.175, "d64": 3.705, "eta": 166.243, "theta": -151.588, "eta_prime": -170.038, "theta_prime": -163.131, "eta_base": -129.579, "theta_base": -118.186, "v0": -34.169, "v1": 36.816, "v2": -25.690, "v3": 6.847, "v4": 16.930, "amplitude": 36.794, "phase_angle": 134.283, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 168.488, 212.337, 192.591 ], "x_axis": [ -0.641, 0.740, 0.205 ], "y_axis": [ -0.767, -0.614, -0.183 ], "z_axis": [ -0.010, -0.274, 0.962 ], "quaternion": [ 0.420, 0.054, -0.128, 0.897 ] } }, { "index": 168, "index_chain": 168, "chain_name": "I", "nt_resnum": 168, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/168", "linked_nts": [ "///I/167", "///I/169" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -31.735, "beta": 175.617, "gamma": 25.877, "delta": 146.152, "epsilon": -157.771, "zeta": -117.599, "epsilon_zeta": -40.172, "bb_type": "BI", "chi": -108.657, "glyco_bond": "anti", "C5prime_xyz": [ -1.989, 8.399, -1.720 ], "P_xyz": [ 0.115, 9.811, -1.088 ], "form": "B", "ssZp": 1.844, "Dp": 1.904, "splay_angle": 20.350, "splay_distance": 3.462, "splay_ratio": 0.177, "d22": 4.169, "d64": 3.531, "eta": 176.791, "theta": -136.281, "eta_prime": -161.859, "theta_prime": -143.949, "eta_base": -112.648, "theta_base": -95.195, "v0": -21.607, "v1": 37.042, "v2": -37.705, "v3": 26.105, "v4": -3.100, "amplitude": 38.900, "phase_angle": 165.763, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 168.253, 212.099, 195.907 ], "x_axis": [ -0.976, 0.219, 0.001 ], "y_axis": [ -0.212, -0.944, -0.254 ], "z_axis": [ -0.055, -0.248, 0.967 ], "quaternion": [ 0.109, -0.014, -0.128, 0.986 ] } }, { "index": 169, "index_chain": 169, "chain_name": "I", "nt_resnum": 169, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/169", "linked_nts": [ "///I/168", "///I/170" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -42.721, "beta": 158.896, "gamma": 34.762, "delta": 138.528, "epsilon": -150.715, "zeta": -154.196, "epsilon_zeta": 3.481, "bb_type": "--", "chi": -101.416, "glyco_bond": "anti", "C5prime_xyz": [ -2.726, 8.202, -2.117 ], "P_xyz": [ -0.515, 9.551, -2.276 ], "form": "B", "ssZp": 2.002, "Dp": 2.046, "splay_angle": 21.856, "splay_distance": 3.711, "splay_ratio": 0.190, "d22": 4.386, "d64": 3.957, "eta": 168.081, "theta": -155.188, "eta_prime": -163.802, "theta_prime": -162.544, "eta_base": -110.383, "theta_base": -128.689, "v0": -32.047, "v1": 42.081, "v2": -35.690, "v3": 18.291, "v4": 8.234, "amplitude": 41.318, "phase_angle": 149.745, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 166.999, 210.954, 198.924 ], "x_axis": [ -0.898, -0.401, -0.181 ], "y_axis": [ 0.425, -0.898, -0.117 ], "z_axis": [ -0.115, -0.182, 0.977 ], "quaternion": [ -0.213, -0.076, -0.077, 0.971 ] } }, { "index": 170, "index_chain": 170, "chain_name": "I", "nt_resnum": 170, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/170", "linked_nts": [ "///I/169", "///I/171" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -16.461, "beta": 132.940, "gamma": 25.227, "delta": 141.045, "epsilon": -101.305, "zeta": -177.439, "epsilon_zeta": 76.135, "bb_type": "BII", "chi": -102.903, "glyco_bond": "anti", "C5prime_xyz": [ -3.140, 8.196, -1.941 ], "P_xyz": [ -0.902, 9.528, -1.862 ], "form": "B", "ssZp": 1.382, "Dp": 1.317, "splay_angle": 20.577, "splay_distance": 3.478, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": -170.651, "theta": -154.823, "eta_prime": -152.538, "theta_prime": -164.482, "eta_base": -120.230, "theta_base": -112.486, "v0": -37.157, "v1": 47.935, "v2": -39.488, "v3": 19.370, "v4": 10.688, "amplitude": 46.644, "phase_angle": 147.842, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 166.579, 210.267, 202.546 ], "x_axis": [ -0.590, -0.770, -0.242 ], "y_axis": [ 0.795, -0.607, -0.005 ], "z_axis": [ -0.143, -0.196, 0.970 ], "quaternion": [ -0.440, -0.108, -0.056, 0.890 ] } }, { "index": 171, "index_chain": 171, "chain_name": "I", "nt_resnum": 171, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/171", "linked_nts": [ "///I/170", "///I/172" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.477, "beta": 127.019, "gamma": 27.120, "delta": 115.252, "epsilon": 165.155, "zeta": -86.949, "epsilon_zeta": -107.896, "bb_type": "BI", "chi": -114.507, "glyco_bond": "anti", "C5prime_xyz": [ -2.634, 8.444, -1.939 ], "P_xyz": [ -0.212, 9.419, -1.861 ], "form": ".", "ssZp": 2.507, "Dp": 2.566, "splay_angle": 19.748, "splay_distance": 3.442, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 154.148, "theta": -147.864, "eta_prime": 177.289, "theta_prime": -163.066, "eta_base": -125.179, "theta_base": -133.538, "v0": -34.446, "v1": 31.167, "v2": -16.859, "v3": -2.408, "v4": 23.120, "amplitude": 34.076, "phase_angle": 119.653, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 166.461, 209.184, 205.849 ], "x_axis": [ 0.052, -0.973, -0.224 ], "y_axis": [ 0.991, 0.023, 0.129 ], "z_axis": [ -0.120, -0.228, 0.966 ], "quaternion": [ 0.714, 0.125, 0.036, -0.688 ] } }, { "index": 172, "index_chain": 172, "chain_name": "I", "nt_resnum": 172, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/172", "linked_nts": [ "///I/171", "///I/173" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.838, "beta": -168.463, "gamma": 38.331, "delta": 135.257, "epsilon": -163.908, "zeta": -114.651, "epsilon_zeta": -49.257, "bb_type": "BI", "chi": -113.977, "glyco_bond": "anti", "C5prime_xyz": [ -2.246, 8.457, -1.665 ], "P_xyz": [ -0.305, 10.115, -1.120 ], "form": "B", "ssZp": 2.194, "Dp": 2.226, "splay_angle": 17.074, "splay_distance": 2.951, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": -179.309, "theta": -147.937, "eta_prime": -163.682, "theta_prime": -153.900, "eta_base": -128.335, "theta_base": -110.559, "v0": -28.159, "v1": 36.974, "v2": -31.413, "v3": 16.055, "v4": 7.357, "amplitude": 36.373, "phase_angle": 149.726, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 165.093, 208.098, 208.815 ], "x_axis": [ 0.527, -0.830, -0.185 ], "y_axis": [ 0.842, 0.478, 0.251 ], "z_axis": [ -0.120, -0.288, 0.950 ], "quaternion": [ 0.859, 0.157, 0.019, -0.486 ] } }, { "index": 173, "index_chain": 173, "chain_name": "I", "nt_resnum": 173, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/173", "linked_nts": [ "///I/172", "///I/174" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.391, "beta": 156.933, "gamma": 41.720, "delta": 126.656, "epsilon": -170.456, "zeta": -112.001, "epsilon_zeta": -58.454, "bb_type": "BI", "chi": -120.336, "glyco_bond": "anti", "C5prime_xyz": [ -2.604, 8.605, -1.531 ], "P_xyz": [ -0.372, 9.947, -1.375 ], "form": "B", "ssZp": 2.410, "Dp": 2.421, "splay_angle": 18.922, "splay_distance": 3.257, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 163.158, "theta": -152.049, "eta_prime": -171.868, "theta_prime": -162.684, "eta_base": -121.363, "theta_base": -124.873, "v0": -34.891, "v1": 38.284, "v2": -27.231, "v3": 8.041, "v4": 16.571, "amplitude": 38.030, "phase_angle": 135.729, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 164.911, 206.570, 211.333 ], "x_axis": [ 0.916, -0.386, -0.111 ], "y_axis": [ 0.398, 0.837, 0.375 ], "z_axis": [ -0.052, -0.387, 0.920 ], "quaternion": [ 0.958, 0.199, 0.015, -0.205 ] } }, { "index": 174, "index_chain": 174, "chain_name": "I", "nt_resnum": 174, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/174", "linked_nts": [ "///I/173", "///I/175" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.989, "beta": 165.269, "gamma": 54.347, "delta": 130.392, "epsilon": -167.888, "zeta": -111.114, "epsilon_zeta": -56.774, "bb_type": "BI", "chi": -124.397, "glyco_bond": "anti", "C5prime_xyz": [ -2.429, 8.730, -1.311 ], "P_xyz": [ -0.148, 9.980, -1.115 ], "form": "B", "ssZp": 2.289, "Dp": 2.355, "splay_angle": 21.124, "splay_distance": 3.504, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 170.907, "theta": -148.117, "eta_prime": -166.921, "theta_prime": -157.487, "eta_base": -122.750, "theta_base": -113.534, "v0": -34.830, "v1": 40.506, "v2": -30.589, "v3": 11.571, "v4": 14.273, "amplitude": 39.732, "phase_angle": 140.343, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 164.759, 204.563, 213.893 ], "x_axis": [ 0.982, 0.150, 0.114 ], "y_axis": [ -0.184, 0.894, 0.408 ], "z_axis": [ -0.041, -0.421, 0.906 ], "quaternion": [ 0.972, 0.213, -0.040, 0.086 ] } }, { "index": 175, "index_chain": 175, "chain_name": "I", "nt_resnum": 175, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/175", "linked_nts": [ "///I/174", "///I/176" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.588, "beta": 177.121, "gamma": 44.503, "delta": 137.779, "epsilon": 177.878, "zeta": -92.961, "epsilon_zeta": -89.161, "bb_type": "BI", "chi": -113.137, "glyco_bond": "anti", "C5prime_xyz": [ -2.050, 8.412, -1.639 ], "P_xyz": [ 0.260, 9.565, -1.216 ], "form": ".", "ssZp": 2.175, "Dp": 2.226, "splay_angle": 20.278, "splay_distance": 3.463, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 164.214, "theta": -124.497, "eta_prime": -169.461, "theta_prime": -158.841, "eta_base": -117.851, "theta_base": -126.291, "v0": -23.079, "v1": 34.157, "v2": -31.862, "v3": 19.394, "v4": 2.066, "amplitude": 34.399, "phase_angle": 157.855, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 165.069, 202.982, 217.004 ], "x_axis": [ 0.637, 0.702, 0.319 ], "y_axis": [ -0.771, 0.588, 0.243 ], "z_axis": [ -0.017, -0.401, 0.916 ], "quaternion": [ 0.886, 0.182, -0.095, 0.416 ] } }, { "index": 176, "index_chain": 176, "chain_name": "I", "nt_resnum": 176, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/176", "linked_nts": [ "///I/175", "///I/177" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 179.016, "beta": 155.296, "gamma": 145.642, "delta": 90.983, "epsilon": -148.868, "zeta": -66.366, "epsilon_zeta": -82.502, "bb_type": "BI", "chi": -155.953, "glyco_bond": "anti", "C5prime_xyz": [ -1.054, 8.607, 0.370 ], "P_xyz": [ 0.307, 9.881, -1.460 ], "form": "A", "ssZp": 4.252, "Dp": 4.538, "splay_angle": 21.960, "splay_distance": 3.616, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 147.388, "theta": -163.244, "eta_prime": 153.167, "theta_prime": -161.143, "eta_base": -156.964, "theta_base": -134.188, "v0": 8.140, "v1": -26.681, "v2": 33.954, "v3": -30.120, "v4": 14.024, "amplitude": 34.089, "phase_angle": 5.098, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 165.805, 201.095, 219.814 ], "x_axis": [ 0.094, 0.906, 0.413 ], "y_axis": [ -0.995, 0.080, 0.051 ], "z_axis": [ 0.014, -0.416, 0.909 ], "quaternion": [ 0.722, 0.162, -0.138, 0.659 ] } }, { "index": 177, "index_chain": 177, "chain_name": "I", "nt_resnum": 177, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/177", "linked_nts": [ "///I/176", "///I/178" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.803, "beta": 161.326, "gamma": 68.434, "delta": 84.291, "epsilon": -152.649, "zeta": -74.752, "epsilon_zeta": -77.897, "bb_type": "BI", "chi": -169.772, "glyco_bond": "anti", "C5prime_xyz": [ -1.874, 8.813, 0.960 ], "P_xyz": [ 0.637, 9.571, 0.953 ], "form": "A", "ssZp": 4.367, "Dp": 4.374, "splay_angle": 22.518, "splay_distance": 3.691, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 164.894, "theta": -147.012, "eta_prime": -173.801, "theta_prime": -149.495, "eta_base": -130.859, "theta_base": -122.034, "v0": -7.575, "v1": -16.251, "v2": 32.299, "v3": -37.613, "v4": 28.652, "amplitude": 37.327, "phase_angle": 30.085, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.487, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 166.993, 200.661, 223.202 ], "x_axis": [ -0.414, 0.883, 0.219 ], "y_axis": [ -0.909, -0.390, -0.148 ], "z_axis": [ -0.045, -0.261, 0.964 ], "quaternion": [ 0.539, 0.052, -0.123, 0.832 ] } }, { "index": 178, "index_chain": 178, "chain_name": "I", "nt_resnum": 178, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/178", "linked_nts": [ "///I/177", "///I/179" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.729, "beta": 169.155, "gamma": 55.061, "delta": 82.704, "epsilon": -156.536, "zeta": -83.156, "epsilon_zeta": -73.381, "bb_type": "BI", "chi": -163.499, "glyco_bond": "anti", "C5prime_xyz": [ -1.670, 8.857, 0.629 ], "P_xyz": [ 0.833, 9.551, 0.925 ], "form": "A", "ssZp": 4.335, "Dp": 4.424, "splay_angle": 17.469, "splay_distance": 2.784, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 168.749, "theta": -158.879, "eta_prime": -176.730, "theta_prime": -152.323, "eta_base": -133.802, "theta_base": -132.870, "v0": -5.734, "v1": -18.719, "v2": 34.429, "v3": -38.753, "v4": 28.216, "amplitude": 38.639, "phase_angle": 26.997, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.956, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 167.931, 201.008, 226.755 ], "x_axis": [ -0.850, 0.517, 0.097 ], "y_axis": [ -0.525, -0.820, -0.230 ], "z_axis": [ -0.039, -0.246, 0.968 ], "quaternion": [ 0.273, 0.015, -0.125, 0.954 ] } }, { "index": 179, "index_chain": 179, "chain_name": "I", "nt_resnum": 179, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/179", "linked_nts": [ "///I/178", "///I/180" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.623, "beta": 161.743, "gamma": 71.578, "delta": 137.854, "epsilon": -176.075, "zeta": -91.851, "epsilon_zeta": -84.224, "bb_type": "BI", "chi": -137.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.862, 8.762, -0.386 ], "P_xyz": [ 0.698, 9.188, -0.054 ], "form": ".", "ssZp": 2.206, "Dp": 2.322, "splay_angle": 20.534, "splay_distance": 3.532, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 167.160, "theta": -123.492, "eta_prime": -153.048, "theta_prime": -146.649, "eta_base": -125.863, "theta_base": -117.190, "v0": -23.806, "v1": 34.469, "v2": -31.401, "v3": 18.443, "v4": 3.202, "amplitude": 34.373, "phase_angle": 155.997, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.559, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 168.445, 201.310, 229.474 ], "x_axis": [ -0.989, 0.090, -0.114 ], "y_axis": [ -0.086, -0.995, -0.041 ], "z_axis": [ -0.118, -0.031, 0.993 ], "quaternion": [ 0.044, -0.058, -0.018, 0.997 ] } }, { "index": 180, "index_chain": 180, "chain_name": "I", "nt_resnum": 180, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/180", "linked_nts": [ "///I/179", "///I/181" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.658, "beta": -166.306, "gamma": 46.544, "delta": 145.041, "epsilon": -151.758, "zeta": -112.543, "epsilon_zeta": -39.215, "bb_type": "BI", "chi": -112.883, "glyco_bond": "anti", "C5prime_xyz": [ -2.187, 8.464, -1.603 ], "P_xyz": [ -0.202, 10.003, -0.847 ], "form": "B", "ssZp": 1.642, "Dp": 1.808, "splay_angle": 19.839, "splay_distance": 3.375, "splay_ratio": 0.173, "d22": 4.330, "d64": 3.619, "eta": 173.360, "theta": -133.663, "eta_prime": -161.391, "theta_prime": -142.141, "eta_base": -121.457, "theta_base": -101.043, "v0": -25.213, "v1": 39.869, "v2": -38.652, "v3": 25.162, "v4": -0.300, "amplitude": 40.739, "phase_angle": 161.579, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 168.075, 202.557, 232.758 ], "x_axis": [ -0.866, -0.496, -0.064 ], "y_axis": [ 0.496, -0.868, 0.011 ], "z_axis": [ -0.061, -0.022, 0.998 ], "quaternion": [ -0.257, -0.033, -0.003, 0.966 ] } }, { "index": 181, "index_chain": 181, "chain_name": "I", "nt_resnum": 181, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/181", "linked_nts": [ "///I/180", "///I/182" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -63.181, "beta": 164.557, "gamma": 41.526, "delta": 141.395, "epsilon": -124.160, "zeta": 176.947, "epsilon_zeta": 58.894, "bb_type": "BII", "chi": -98.590, "glyco_bond": "anti", "C5prime_xyz": [ -2.976, 8.077, -2.157 ], "P_xyz": [ -0.833, 9.525, -2.529 ], "form": ".", "ssZp": 1.616, "Dp": 1.614, "splay_angle": 21.016, "splay_distance": 3.715, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 169.477, "theta": 174.412, "eta_prime": -164.820, "theta_prime": 174.055, "eta_base": -120.203, "theta_base": -133.892, "v0": -33.110, "v1": 44.735, "v2": -38.519, "v3": 20.643, "v4": 7.435, "amplitude": 43.872, "phase_angle": 151.399, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 167.466, 202.073, 236.042 ], "x_axis": [ -0.412, -0.905, -0.106 ], "y_axis": [ 0.897, -0.424, 0.128 ], "z_axis": [ -0.161, -0.042, 0.986 ], "quaternion": [ 0.536, 0.079, -0.026, -0.840 ] } }, { "index": 182, "index_chain": 182, "chain_name": "I", "nt_resnum": 182, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/182", "linked_nts": [ "///I/181", "///I/183" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.808, "beta": 148.189, "gamma": 35.400, "delta": 150.459, "epsilon": -174.485, "zeta": -111.466, "epsilon_zeta": -63.019, "bb_type": "BI", "chi": -100.456, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 7.972, -1.984 ], "P_xyz": [ 1.080, 8.048, -1.433 ], "form": "B", "ssZp": 1.579, "Dp": 1.785, "splay_angle": 19.569, "splay_distance": 3.287, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 165.857, "theta": -123.661, "eta_prime": -168.723, "theta_prime": -149.685, "eta_base": -119.985, "theta_base": -101.610, "v0": -6.064, "v1": 25.544, "v2": -34.240, "v3": 31.555, "v4": -16.334, "amplitude": 34.646, "phase_angle": 188.782, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.513, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 168.563, 202.572, 239.556 ], "x_axis": [ 0.286, -0.958, 0.015 ], "y_axis": [ 0.949, 0.285, 0.138 ], "z_axis": [ -0.137, -0.026, 0.990 ], "quaternion": [ 0.800, 0.051, -0.047, -0.596 ] } }, { "index": 183, "index_chain": 183, "chain_name": "I", "nt_resnum": 183, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/183", "linked_nts": [ "///I/182", "///I/184" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -51.151, "beta": 163.055, "gamma": 48.104, "delta": 148.863, "epsilon": -101.048, "zeta": -179.258, "epsilon_zeta": 78.210, "bb_type": "BII", "chi": -103.327, "glyco_bond": "anti", "C5prime_xyz": [ -2.426, 8.224, -1.918 ], "P_xyz": [ 0.002, 9.206, -1.935 ], "form": ".", "ssZp": 0.895, "Dp": 0.923, "splay_angle": 24.199, "splay_distance": 4.097, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -171.695, "theta": -168.687, "eta_prime": -146.073, "theta_prime": -174.483, "eta_base": -97.003, "theta_base": -130.730, "v0": -26.577, "v1": 42.360, "v2": -41.024, "v3": 26.885, "v4": -0.485, "amplitude": 43.190, "phase_angle": 161.777, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 168.950, 202.340, 242.812 ], "x_axis": [ 0.795, -0.592, 0.135 ], "y_axis": [ 0.577, 0.806, 0.137 ], "z_axis": [ -0.190, -0.031, 0.981 ], "quaternion": [ 0.946, 0.044, -0.086, -0.309 ] } }, { "index": 184, "index_chain": 184, "chain_name": "I", "nt_resnum": 184, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/184", "linked_nts": [ "///I/183", "///I/185" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.699, "beta": 153.491, "gamma": 23.534, "delta": 149.414, "epsilon": -174.880, "zeta": -101.934, "epsilon_zeta": -72.946, "bb_type": "BI", "chi": -105.049, "glyco_bond": "anti", "C5prime_xyz": [ -1.563, 8.068, -1.810 ], "P_xyz": [ 0.888, 8.654, -1.110 ], "form": "B", "ssZp": 1.787, "Dp": 1.887, "splay_angle": 20.560, "splay_distance": 3.589, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 159.474, "theta": -122.464, "eta_prime": -177.825, "theta_prime": -144.016, "eta_base": -133.031, "theta_base": -106.553, "v0": -9.655, "v1": 27.935, "v2": -34.569, "v3": 29.923, "v4": -12.962, "amplitude": 34.612, "phase_angle": 182.849, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.216, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 167.266, 203.857, 246.224 ], "x_axis": [ 0.991, -0.012, 0.135 ], "y_axis": [ 0.032, 0.988, -0.150 ], "z_axis": [ -0.132, 0.153, 0.979 ], "quaternion": [ 0.995, -0.076, -0.067, -0.011 ] } }, { "index": 185, "index_chain": 185, "chain_name": "I", "nt_resnum": 185, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/185", "linked_nts": [ "///I/184", "///I/186" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.243, "beta": 172.941, "gamma": 34.573, "delta": 134.619, "epsilon": -161.206, "zeta": -123.090, "epsilon_zeta": -38.117, "bb_type": "BI", "chi": -114.395, "glyco_bond": "anti", "C5prime_xyz": [ -2.406, 8.552, -1.656 ], "P_xyz": [ -0.339, 10.124, -1.334 ], "form": "B", "ssZp": 2.268, "Dp": 2.260, "splay_angle": 23.620, "splay_distance": 3.885, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 167.161, "theta": -156.527, "eta_prime": -168.595, "theta_prime": -158.845, "eta_base": -121.496, "theta_base": -105.946, "v0": -31.585, "v1": 39.953, "v2": -32.635, "v3": 15.347, "v4": 9.917, "amplitude": 39.069, "phase_angle": 146.647, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 167.463, 204.099, 249.799 ], "x_axis": [ 0.857, 0.513, -0.050 ], "y_axis": [ -0.509, 0.827, -0.240 ], "z_axis": [ -0.082, 0.232, 0.969 ], "quaternion": [ 0.956, -0.123, -0.008, 0.267 ] } }, { "index": 186, "index_chain": 186, "chain_name": "I", "nt_resnum": 186, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/186", "linked_nts": [ "///I/185", "///I/187" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -60.572, "beta": 156.976, "gamma": 62.217, "delta": 143.833, "epsilon": -156.378, "zeta": -131.669, "epsilon_zeta": -24.709, "bb_type": "--", "chi": -117.717, "glyco_bond": "anti", "C5prime_xyz": [ -2.107, 8.513, -1.344 ], "P_xyz": [ 0.455, 9.048, -1.282 ], "form": "B", "ssZp": 1.957, "Dp": 2.006, "splay_angle": 21.279, "splay_distance": 3.513, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 169.058, "theta": -145.422, "eta_prime": -158.663, "theta_prime": -164.464, "eta_base": -103.044, "theta_base": -138.619, "v0": -24.768, "v1": 38.316, "v2": -36.600, "v3": 23.326, "v4": 0.612, "amplitude": 38.880, "phase_angle": 160.283, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 167.180, 205.987, 253.183 ], "x_axis": [ 0.280, 0.930, -0.237 ], "y_axis": [ -0.956, 0.247, -0.159 ], "z_axis": [ -0.090, 0.271, 0.958 ], "quaternion": [ 0.788, -0.137, 0.047, 0.598 ] } }, { "index": 187, "index_chain": 187, "chain_name": "I", "nt_resnum": 187, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/187", "linked_nts": [ "///I/186", "///I/188" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.946, "beta": 171.840, "gamma": 39.765, "delta": 142.429, "epsilon": -168.369, "zeta": -113.044, "epsilon_zeta": -55.324, "bb_type": "BI", "chi": -108.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.966, 8.340, -1.799 ], "P_xyz": [ 0.419, 9.364, -1.436 ], "form": "B", "ssZp": 2.013, "Dp": 2.081, "splay_angle": 20.474, "splay_distance": 3.464, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 168.072, "theta": -139.192, "eta_prime": -172.840, "theta_prime": -152.981, "eta_base": -141.202, "theta_base": -107.228, "v0": -20.058, "v1": 33.851, "v2": -34.089, "v3": 23.363, "v4": -2.309, "amplitude": 35.302, "phase_angle": 164.936, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 167.351, 205.594, 256.670 ], "x_axis": [ -0.265, 0.930, -0.252 ], "y_axis": [ -0.962, -0.273, 0.005 ], "z_axis": [ -0.064, 0.244, 0.968 ], "quaternion": [ 0.598, -0.100, 0.079, 0.792 ] } }, { "index": 188, "index_chain": 188, "chain_name": "I", "nt_resnum": 188, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/188", "linked_nts": [ "///I/187", "///I/189" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -55.403, "beta": 160.912, "gamma": 53.975, "delta": 135.825, "epsilon": -158.892, "zeta": -133.849, "epsilon_zeta": -25.043, "bb_type": "--", "chi": -117.528, "glyco_bond": "anti", "C5prime_xyz": [ -2.430, 8.622, -1.517 ], "P_xyz": [ -0.040, 9.684, -1.487 ], "form": "B", "ssZp": 2.187, "Dp": 2.212, "splay_angle": 20.117, "splay_distance": 3.302, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 169.088, "theta": -160.201, "eta_prime": -163.308, "theta_prime": -169.391, "eta_base": -111.182, "theta_base": -126.319, "v0": -32.539, "v1": 41.377, "v2": -34.011, "v3": 16.267, "v4": 9.891, "amplitude": 40.476, "phase_angle": 147.168, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 166.773, 206.987, 259.788 ], "x_axis": [ -0.791, 0.572, -0.216 ], "y_axis": [ -0.607, -0.777, 0.167 ], "z_axis": [ -0.072, 0.263, 0.962 ], "quaternion": [ 0.314, -0.077, 0.114, 0.939 ] } }, { "index": 189, "index_chain": 189, "chain_name": "I", "nt_resnum": 189, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/189", "linked_nts": [ "///I/188", "///I/190" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.248, "beta": 164.735, "gamma": 53.007, "delta": 146.056, "epsilon": -173.460, "zeta": -98.030, "epsilon_zeta": -75.430, "bb_type": "BI", "chi": -118.519, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 8.527, -1.220 ], "P_xyz": [ 0.884, 8.941, -0.684 ], "form": "B", "ssZp": 1.946, "Dp": 2.012, "splay_angle": 19.460, "splay_distance": 3.278, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 162.012, "theta": -119.988, "eta_prime": -170.896, "theta_prime": -142.822, "eta_base": -122.807, "theta_base": -95.576, "v0": -16.620, "v1": 32.527, "v2": -35.261, "v3": 26.581, "v4": -6.476, "amplitude": 35.646, "phase_angle": 171.567, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 166.892, 207.449, 263.055 ], "x_axis": [ -0.988, -0.066, -0.142 ], "y_axis": [ 0.032, -0.972, 0.232 ], "z_axis": [ -0.153, 0.224, 0.962 ], "quaternion": [ -0.025, -0.075, 0.115, 0.990 ] } }, { "index": 190, "index_chain": 190, "chain_name": "I", "nt_resnum": 190, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/190", "linked_nts": [ "///I/189", "///I/191" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -62.255, "beta": 177.654, "gamma": 45.235, "delta": 142.992, "epsilon": -159.695, "zeta": -139.932, "epsilon_zeta": -19.763, "bb_type": "--", "chi": -109.300, "glyco_bond": "anti", "C5prime_xyz": [ -2.355, 8.354, -1.749 ], "P_xyz": [ -0.128, 9.707, -1.467 ], "form": "B", "ssZp": 2.059, "Dp": 2.084, "splay_angle": 20.118, "splay_distance": 3.282, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 163.752, "theta": -164.930, "eta_prime": -165.451, "theta_prime": -171.940, "eta_base": -107.552, "theta_base": -135.681, "v0": -26.983, "v1": 40.156, "v2": -37.301, "v3": 22.761, "v4": 2.362, "amplitude": 40.275, "phase_angle": 157.847, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 165.556, 208.021, 265.993 ], "x_axis": [ -0.735, -0.677, 0.038 ], "y_axis": [ 0.656, -0.696, 0.294 ], "z_axis": [ -0.172, 0.241, 0.955 ], "quaternion": [ -0.362, -0.036, 0.145, 0.920 ] } }, { "index": 191, "index_chain": 191, "chain_name": "I", "nt_resnum": 191, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/191", "linked_nts": [ "///I/190", "///I/192" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.076, "beta": 163.277, "gamma": 56.418, "delta": 144.072, "epsilon": -174.355, "zeta": -106.684, "epsilon_zeta": -67.671, "bb_type": "BI", "chi": -116.095, "glyco_bond": "anti", "C5prime_xyz": [ -1.745, 8.525, -1.403 ], "P_xyz": [ 0.839, 8.917, -1.165 ], "form": "B", "ssZp": 2.119, "Dp": 2.132, "splay_angle": 19.389, "splay_distance": 3.226, "splay_ratio": 0.169, "d22": 4.215, "d64": 3.601, "eta": 162.813, "theta": -129.653, "eta_prime": -172.886, "theta_prime": -152.123, "eta_base": -132.535, "theta_base": -107.089, "v0": -19.701, "v1": 34.268, "v2": -34.995, "v3": 24.487, "v4": -3.213, "amplitude": 36.021, "phase_angle": 166.294, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 165.575, 209.559, 268.892 ], "x_axis": [ -0.212, -0.954, 0.210 ], "y_axis": [ 0.961, -0.164, 0.224 ], "z_axis": [ -0.179, 0.250, 0.952 ], "quaternion": [ 0.628, -0.010, -0.155, -0.763 ] } }, { "index": 192, "index_chain": 192, "chain_name": "I", "nt_resnum": 192, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/192", "linked_nts": [ "///I/191", "///I/193" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -62.603, "beta": 173.862, "gamma": 53.388, "delta": 144.328, "epsilon": -148.172, "zeta": -146.009, "epsilon_zeta": -2.162, "bb_type": "--", "chi": -113.365, "glyco_bond": "anti", "C5prime_xyz": [ -2.146, 8.538, -1.561 ], "P_xyz": [ 0.254, 9.554, -1.267 ], "form": ".", "ssZp": 1.876, "Dp": 1.909, "splay_angle": 21.448, "splay_distance": 3.681, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 171.999, "theta": -161.155, "eta_prime": -161.194, "theta_prime": -166.354, "eta_base": -108.362, "theta_base": -118.433, "v0": -26.354, "v1": 40.298, "v2": -38.093, "v3": 23.884, "v4": 1.279, "amplitude": 40.693, "phase_angle": 159.409, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 164.880, 209.857, 272.028 ], "x_axis": [ 0.439, -0.842, 0.313 ], "y_axis": [ 0.875, 0.479, 0.061 ], "z_axis": [ -0.201, 0.247, 0.948 ], "quaternion": [ 0.847, -0.055, -0.152, -0.507 ] } }, { "index": 193, "index_chain": 193, "chain_name": "I", "nt_resnum": 193, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/193", "linked_nts": [ "///I/192", "///I/194" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.517, "beta": 165.556, "gamma": 46.229, "delta": 148.633, "epsilon": 178.975, "zeta": -92.503, "epsilon_zeta": -88.522, "bb_type": "BI", "chi": -101.422, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 7.877, -1.960 ], "P_xyz": [ 1.162, 7.999, -1.588 ], "form": "B", "ssZp": 1.712, "Dp": 1.905, "splay_angle": 21.056, "splay_distance": 3.629, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 164.639, "theta": -114.917, "eta_prime": -168.078, "theta_prime": -141.502, "eta_base": -118.831, "theta_base": -99.782, "v0": -4.061, "v1": 22.411, "v2": -31.129, "v3": 29.600, "v4": -16.300, "amplitude": 31.763, "phase_angle": 191.463, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 164.730, 212.079, 274.959 ], "x_axis": [ 0.913, -0.284, 0.293 ], "y_axis": [ 0.339, 0.927, -0.159 ], "z_axis": [ -0.227, 0.245, 0.943 ], "quaternion": [ 0.973, -0.104, -0.134, -0.160 ] } }, { "index": 194, "index_chain": 194, "chain_name": "I", "nt_resnum": 194, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/194", "linked_nts": [ "///I/193", "///I/195" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.606, "beta": 171.967, "gamma": 46.692, "delta": 136.716, "epsilon": -156.401, "zeta": -144.492, "epsilon_zeta": -11.909, "bb_type": "--", "chi": -108.359, "glyco_bond": "anti", "C5prime_xyz": [ -2.706, 8.396, -1.859 ], "P_xyz": [ -0.543, 9.862, -1.940 ], "form": "B", "ssZp": 2.219, "Dp": 2.209, "splay_angle": 22.930, "splay_distance": 3.767, "splay_ratio": 0.202, "d22": 5.186, "d64": 4.170, "eta": 169.804, "theta": -172.666, "eta_prime": -160.200, "theta_prime": -175.398, "eta_base": -110.169, "theta_base": -141.968, "v0": -33.668, "v1": 42.599, "v2": -34.765, "v3": 16.488, "v4": 10.397, "amplitude": 41.575, "phase_angle": 146.740, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 165.035, 212.895, 278.482 ], "x_axis": [ 0.946, 0.292, 0.139 ], "y_axis": [ -0.245, 0.928, -0.279 ], "z_axis": [ -0.211, 0.230, 0.950 ], "quaternion": [ 0.978, -0.130, -0.089, 0.137 ] } }, { "index": 195, "index_chain": 195, "chain_name": "I", "nt_resnum": 195, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/195", "linked_nts": [ "///I/194", "///I/196" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.158, "beta": 164.162, "gamma": 54.502, "delta": 146.114, "epsilon": -167.116, "zeta": -108.727, "epsilon_zeta": -58.389, "bb_type": "BI", "chi": -113.084, "glyco_bond": "anti", "C5prime_xyz": [ -1.734, 8.446, -1.523 ], "P_xyz": [ 0.837, 8.874, -1.221 ], "form": "B", "ssZp": 1.902, "Dp": 1.970, "splay_angle": 20.560, "splay_distance": 3.418, "splay_ratio": 0.179, "d22": 4.546, "d64": 3.669, "eta": 169.341, "theta": -127.322, "eta_prime": -169.315, "theta_prime": -148.121, "eta_base": -135.233, "theta_base": -102.534, "v0": -18.007, "v1": 33.779, "v2": -35.878, "v3": 26.414, "v4": -5.514, "amplitude": 36.453, "phase_angle": 169.805, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 163.250, 213.326, 281.771 ], "x_axis": [ 0.668, 0.735, -0.115 ], "y_axis": [ -0.726, 0.609, -0.320 ], "z_axis": [ -0.165, 0.297, 0.941 ], "quaternion": [ 0.897, -0.172, -0.014, 0.407 ] } }, { "index": 196, "index_chain": 196, "chain_name": "I", "nt_resnum": 196, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/196", "linked_nts": [ "///I/195", "///I/197" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -60.157, "beta": 176.427, "gamma": 44.781, "delta": 141.380, "epsilon": -145.660, "zeta": -124.964, "epsilon_zeta": -20.697, "bb_type": "--", "chi": -102.308, "glyco_bond": "anti", "C5prime_xyz": [ -2.148, 8.201, -2.074 ], "P_xyz": [ 0.254, 9.249, -2.057 ], "form": "B", "ssZp": 1.748, "Dp": 1.928, "splay_angle": 22.782, "splay_distance": 3.938, "splay_ratio": 0.198, "d22": 4.436, "d64": 3.792, "eta": 172.690, "theta": -138.458, "eta_prime": -163.580, "theta_prime": -150.772, "eta_base": -112.055, "theta_base": -103.337, "v0": -22.362, "v1": 35.079, "v2": -33.769, "v3": 21.731, "v4": 0.176, "amplitude": 35.726, "phase_angle": 160.951, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 162.666, 214.949, 284.722 ], "x_axis": [ 0.038, 0.955, -0.293 ], "y_axis": [ -0.994, 0.007, -0.108 ], "z_axis": [ -0.101, 0.296, 0.950 ], "quaternion": [ 0.706, -0.143, 0.068, 0.690 ] } }, { "index": 197, "index_chain": 197, "chain_name": "I", "nt_resnum": 197, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/197", "linked_nts": [ "///I/196", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": -53.272, "beta": 137.825, "gamma": 58.487, "delta": 101.619, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -126.754, "glyco_bond": "anti", "C5prime_xyz": [ -2.757, 8.680, -1.548 ], "P_xyz": [ -0.395, 9.410, -2.399 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -36.475, "v1": 23.389, "v2": -2.833, "v3": -17.861, "v4": 34.244, "amplitude": 36.491, "phase_angle": 94.452, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 161.194, 216.863, 287.832 ], "x_axis": [ -0.565, 0.769, -0.299 ], "y_axis": [ -0.823, -0.551, 0.137 ], "z_axis": [ -0.059, 0.324, 0.944 ], "quaternion": [ 0.455, -0.102, 0.132, 0.875 ] } }, { "index": 198, "index_chain": 1, "chain_name": "J", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/1", "linked_nts": [ null, "///J/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -166.878, "gamma": 38.674, "delta": 133.641, "epsilon": -156.024, "zeta": -160.202, "epsilon_zeta": 4.177, "bb_type": "--", "chi": -103.432, "glyco_bond": "anti", "C5prime_xyz": [ -3.031, 8.181, -2.075 ], "P_xyz": [ -1.430, 10.250, -2.134 ], "form": ".", "ssZp": 2.260, "Dp": 2.267, "splay_angle": 21.695, "splay_distance": 3.599, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": null, "theta": 166.761, "eta_prime": null, "theta_prime": 170.407, "eta_base": null, "theta_base": -147.877, "v0": -35.565, "v1": 42.720, "v2": -33.139, "v3": 13.770, "v4": 13.288, "amplitude": 41.681, "phase_angle": 142.662, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 161.104, 216.784, 288.419 ], "x_axis": [ -0.542, 0.787, -0.295 ], "y_axis": [ 0.833, 0.548, -0.070 ], "z_axis": [ 0.107, -0.283, -0.953 ], "quaternion": [ 0.115, 0.464, 0.872, -0.101 ] } }, { "index": 199, "index_chain": 2, "chain_name": "J", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/2", "linked_nts": [ "///J/1", "///J/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.161, "beta": 144.007, "gamma": 59.123, "delta": 145.463, "epsilon": -165.601, "zeta": -115.718, "epsilon_zeta": -49.883, "bb_type": "BI", "chi": -123.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.760, 8.627, -0.968 ], "P_xyz": [ 0.852, 8.591, -0.740 ], "form": "B", "ssZp": 2.045, "Dp": 2.062, "splay_angle": 19.909, "splay_distance": 3.236, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 164.170, "theta": -128.155, "eta_prime": -167.879, "theta_prime": -154.793, "eta_base": -127.478, "theta_base": -117.161, "v0": -19.078, "v1": 34.236, "v2": -35.560, "v3": 25.490, "v4": -4.235, "amplitude": 36.377, "phase_angle": 167.837, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.011, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 162.318, 215.030, 285.520 ], "x_axis": [ 0.021, 0.961, -0.276 ], "y_axis": [ 0.988, 0.022, 0.151 ], "z_axis": [ 0.151, -0.276, -0.949 ], "quaternion": [ 0.153, 0.698, 0.698, -0.045 ] } }, { "index": 200, "index_chain": 3, "chain_name": "J", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/3", "linked_nts": [ "///J/2", "///J/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.702, "beta": -176.982, "gamma": 50.240, "delta": 145.966, "epsilon": -173.686, "zeta": -93.105, "epsilon_zeta": -80.580, "bb_type": "BI", "chi": -110.007, "glyco_bond": "anti", "C5prime_xyz": [ -1.576, 8.279, -1.626 ], "P_xyz": [ 0.892, 8.956, -1.056 ], "form": "B", "ssZp": 1.892, "Dp": 1.977, "splay_angle": 21.438, "splay_distance": 3.671, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 163.687, "theta": -119.950, "eta_prime": -170.302, "theta_prime": -137.000, "eta_base": -123.013, "theta_base": -91.122, "v0": -11.637, "v1": 28.031, "v2": -32.859, "v3": 27.016, "v4": -9.892, "amplitude": 32.871, "phase_angle": 178.436, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 162.771, 213.664, 282.622 ], "x_axis": [ 0.652, 0.752, -0.096 ], "y_axis": [ 0.739, -0.602, 0.302 ], "z_axis": [ 0.169, -0.268, -0.948 ], "quaternion": [ 0.159, 0.895, 0.417, 0.020 ] } }, { "index": 201, "index_chain": 4, "chain_name": "J", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/4", "linked_nts": [ "///J/3", "///J/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -58.113, "beta": 172.532, "gamma": 46.285, "delta": 136.808, "epsilon": -149.122, "zeta": -139.722, "epsilon_zeta": -9.400, "bb_type": "--", "chi": -106.435, "glyco_bond": "anti", "C5prime_xyz": [ -2.746, 8.283, -1.939 ], "P_xyz": [ -0.598, 9.763, -2.029 ], "form": "B", "ssZp": 2.036, "Dp": 2.073, "splay_angle": 25.175, "splay_distance": 4.193, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 169.985, "theta": -162.492, "eta_prime": -159.293, "theta_prime": -165.824, "eta_base": -105.923, "theta_base": -135.041, "v0": -31.852, "v1": 41.103, "v2": -34.207, "v3": 16.953, "v4": 8.989, "amplitude": 40.200, "phase_angle": 148.312, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 164.557, 213.419, 279.425 ], "x_axis": [ 0.963, 0.234, 0.136 ], "y_axis": [ 0.196, -0.949, 0.249 ], "z_axis": [ 0.187, -0.213, -0.959 ], "quaternion": [ 0.117, 0.984, 0.109, 0.082 ] } }, { "index": 202, "index_chain": 5, "chain_name": "J", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/5", "linked_nts": [ "///J/4", "///J/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -55.616, "beta": 163.106, "gamma": 45.948, "delta": 139.725, "epsilon": -152.749, "zeta": -138.727, "epsilon_zeta": -14.022, "bb_type": "--", "chi": -101.355, "glyco_bond": "anti", "C5prime_xyz": [ -2.429, 8.154, -2.108 ], "P_xyz": [ 0.011, 9.062, -2.353 ], "form": ".", "ssZp": 1.994, "Dp": 2.094, "splay_angle": 24.597, "splay_distance": 4.148, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 175.894, "theta": -157.896, "eta_prime": -167.912, "theta_prime": -167.074, "eta_base": -136.607, "theta_base": -112.529, "v0": -25.675, "v1": 37.224, "v2": -34.005, "v3": 20.091, "v4": 3.280, "amplitude": 37.156, "phase_angle": 156.233, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 164.574, 212.342, 275.372 ], "x_axis": [ 0.925, -0.295, 0.239 ], "y_axis": [ -0.328, -0.938, 0.113 ], "z_axis": [ 0.191, -0.184, -0.964 ], "quaternion": [ 0.076, 0.978, -0.159, 0.110 ] } }, { "index": 203, "index_chain": 6, "chain_name": "J", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/6", "linked_nts": [ "///J/5", "///J/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.307, "beta": 141.764, "gamma": 70.494, "delta": 141.634, "epsilon": -173.781, "zeta": -114.331, "epsilon_zeta": -59.450, "bb_type": "BI", "chi": -118.099, "glyco_bond": "anti", "C5prime_xyz": [ -1.936, 8.559, -1.343 ], "P_xyz": [ 0.649, 8.479, -1.750 ], "form": "B", "ssZp": 2.197, "Dp": 2.188, "splay_angle": 19.403, "splay_distance": 3.180, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 157.710, "theta": -130.576, "eta_prime": -160.634, "theta_prime": -164.544, "eta_base": -104.251, "theta_base": -124.747, "v0": -21.799, "v1": 34.664, "v2": -33.675, "v3": 21.944, "v4": -0.319, "amplitude": 35.461, "phase_angle": 161.737, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 164.919, 210.064, 271.923 ], "x_axis": [ 0.450, -0.859, 0.244 ], "y_axis": [ -0.874, -0.480, -0.073 ], "z_axis": [ 0.180, -0.181, -0.967 ], "quaternion": [ 0.032, 0.851, -0.509, 0.125 ] } }, { "index": 204, "index_chain": 7, "chain_name": "J", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/7", "linked_nts": [ "///J/6", "///J/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.384, "beta": -179.440, "gamma": 39.803, "delta": 143.834, "epsilon": -175.275, "zeta": -97.182, "epsilon_zeta": -78.093, "bb_type": "BI", "chi": -111.237, "glyco_bond": "anti", "C5prime_xyz": [ -1.721, 8.363, -1.612 ], "P_xyz": [ 0.611, 9.365, -0.970 ], "form": "B", "ssZp": 1.986, "Dp": 2.051, "splay_angle": 19.756, "splay_distance": 3.370, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 169.266, "theta": -128.685, "eta_prime": -167.523, "theta_prime": -142.430, "eta_base": -119.698, "theta_base": -91.339, "v0": -15.693, "v1": 30.594, "v2": -33.076, "v3": 24.802, "v4": -5.944, "amplitude": 33.459, "phase_angle": 171.320, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 165.726, 209.710, 268.868 ], "x_axis": [ -0.187, -0.972, 0.144 ], "y_axis": [ -0.966, 0.155, -0.209 ], "z_axis": [ 0.181, -0.178, -0.967 ], "quaternion": [ 0.012, -0.637, 0.760, -0.127 ] } }, { "index": 205, "index_chain": 8, "chain_name": "J", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/8", "linked_nts": [ "///J/7", "///J/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.191, "beta": 171.228, "gamma": 45.136, "delta": 137.382, "epsilon": -162.445, "zeta": -136.191, "epsilon_zeta": -26.254, "bb_type": "--", "chi": -108.627, "glyco_bond": "anti", "C5prime_xyz": [ -2.607, 8.355, -1.856 ], "P_xyz": [ -0.407, 9.761, -1.858 ], "form": "B", "ssZp": 2.210, "Dp": 2.218, "splay_angle": 19.052, "splay_distance": 3.139, "splay_ratio": 0.166, "d22": 4.569, "d64": 3.667, "eta": 166.629, "theta": -162.962, "eta_prime": -162.385, "theta_prime": -171.091, "eta_base": -103.207, "theta_base": -130.262, "v0": -31.187, "v1": 41.022, "v2": -34.665, "v3": 17.728, "v4": 8.151, "amplitude": 40.197, "phase_angle": 149.585, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 165.694, 207.979, 265.977 ], "x_axis": [ -0.753, -0.658, -0.029 ], "y_axis": [ -0.615, 0.718, -0.326 ], "z_axis": [ 0.236, -0.227, -0.945 ], "quaternion": [ 0.072, -0.344, 0.924, -0.150 ] } }, { "index": 206, "index_chain": 9, "chain_name": "J", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/9", "linked_nts": [ "///J/8", "///J/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.950, "beta": 159.612, "gamma": 47.099, "delta": 142.549, "epsilon": -165.684, "zeta": -115.125, "epsilon_zeta": -50.559, "bb_type": "BI", "chi": -115.761, "glyco_bond": "anti", "C5prime_xyz": [ -1.945, 8.565, -1.463 ], "P_xyz": [ 0.555, 9.261, -1.098 ], "form": "B", "ssZp": 2.053, "Dp": 2.092, "splay_angle": 18.092, "splay_distance": 2.992, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 167.392, "theta": -136.608, "eta_prime": -169.918, "theta_prime": -153.363, "eta_base": -125.373, "theta_base": -104.658, "v0": -23.841, "v1": 37.302, "v2": -35.891, "v3": 23.025, "v4": 0.280, "amplitude": 37.998, "phase_angle": 160.832, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 166.710, 207.326, 263.079 ], "x_axis": [ -0.984, -0.084, -0.157 ], "y_axis": [ -0.040, 0.963, -0.266 ], "z_axis": [ 0.173, -0.256, -0.951 ], "quaternion": [ 0.084, -0.031, 0.987, -0.132 ] } }, { "index": 207, "index_chain": 10, "chain_name": "J", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/10", "linked_nts": [ "///J/9", "///J/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.601, "beta": 170.387, "gamma": 48.114, "delta": 141.547, "epsilon": -168.061, "zeta": -116.630, "epsilon_zeta": -51.432, "bb_type": "BI", "chi": -110.125, "glyco_bond": "anti", "C5prime_xyz": [ -2.002, 8.387, -1.727 ], "P_xyz": [ 0.450, 9.271, -1.471 ], "form": "B", "ssZp": 2.022, "Dp": 2.086, "splay_angle": 17.561, "splay_distance": 2.929, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 162.617, "theta": -142.946, "eta_prime": -169.238, "theta_prime": -158.147, "eta_base": -112.497, "theta_base": -119.905, "v0": -21.259, "v1": 34.364, "v2": -33.812, "v3": 22.414, "v4": -0.981, "amplitude": 35.396, "phase_angle": 162.792, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 166.837, 206.832, 260.131 ], "x_axis": [ -0.777, 0.578, -0.250 ], "y_axis": [ 0.622, 0.767, -0.159 ], "z_axis": [ 0.100, -0.280, -0.955 ], "quaternion": [ 0.094, 0.321, 0.935, -0.117 ] } }, { "index": 208, "index_chain": 11, "chain_name": "J", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/11", "linked_nts": [ "///J/10", "///J/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.287, "beta": 173.145, "gamma": 42.698, "delta": 136.934, "epsilon": -175.862, "zeta": -100.611, "epsilon_zeta": -75.251, "bb_type": "BI", "chi": -105.798, "glyco_bond": "anti", "C5prime_xyz": [ -2.064, 8.290, -1.996 ], "P_xyz": [ 0.333, 9.326, -1.931 ], "form": "B", "ssZp": 2.117, "Dp": 2.211, "splay_angle": 21.343, "splay_distance": 3.673, "splay_ratio": 0.186, "d22": 4.027, "d64": 3.753, "eta": 164.498, "theta": -135.992, "eta_prime": -172.476, "theta_prime": -149.922, "eta_base": -127.375, "theta_base": -105.062, "v0": -22.281, "v1": 32.925, "v2": -30.646, "v3": 18.622, "v4": 2.075, "amplitude": 33.120, "phase_angle": 157.713, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 167.103, 205.915, 257.362 ], "x_axis": [ -0.268, 0.920, -0.287 ], "y_axis": [ 0.963, 0.254, -0.088 ], "z_axis": [ -0.008, -0.300, -0.954 ], "quaternion": [ 0.089, 0.598, 0.787, -0.123 ] } }, { "index": 209, "index_chain": 12, "chain_name": "J", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/12", "linked_nts": [ "///J/11", "///J/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -49.807, "beta": 167.526, "gamma": 48.800, "delta": 129.571, "epsilon": -161.253, "zeta": -130.297, "epsilon_zeta": -30.957, "bb_type": "--", "chi": -113.829, "glyco_bond": "anti", "C5prime_xyz": [ -2.723, 8.449, -1.743 ], "P_xyz": [ -0.531, 9.857, -1.895 ], "form": "B", "ssZp": 2.379, "Dp": 2.361, "splay_angle": 20.444, "splay_distance": 3.395, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 173.892, "theta": -168.886, "eta_prime": -160.443, "theta_prime": -169.847, "eta_base": -109.258, "theta_base": -130.689, "v0": -34.791, "v1": 39.897, "v2": -29.606, "v3": 10.512, "v4": 14.951, "amplitude": 39.211, "phase_angle": 139.028, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 167.005, 206.116, 253.695 ], "x_axis": [ 0.345, 0.897, -0.277 ], "y_axis": [ 0.937, -0.347, 0.041 ], "z_axis": [ -0.060, -0.274, -0.960 ], "quaternion": [ 0.097, 0.814, 0.563, -0.103 ] } }, { "index": 210, "index_chain": 13, "chain_name": "J", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/13", "linked_nts": [ "///J/12", "///J/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.394, "beta": 171.107, "gamma": 62.134, "delta": 148.638, "epsilon": -173.208, "zeta": -103.601, "epsilon_zeta": -69.607, "bb_type": "BI", "chi": -110.535, "glyco_bond": "anti", "C5prime_xyz": [ -1.631, 8.281, -1.544 ], "P_xyz": [ 0.966, 8.513, -1.284 ], "form": "B", "ssZp": 1.914, "Dp": 1.969, "splay_angle": 18.003, "splay_distance": 3.058, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 161.113, "theta": -122.352, "eta_prime": -171.753, "theta_prime": -149.010, "eta_base": -130.096, "theta_base": -123.503, "v0": -11.414, "v1": 28.981, "v2": -34.446, "v3": 28.807, "v4": -11.122, "amplitude": 34.446, "phase_angle": 179.748, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 167.089, 204.515, 250.702 ], "x_axis": [ 0.851, 0.526, -0.006 ], "y_axis": [ 0.521, -0.841, 0.145 ], "z_axis": [ 0.071, -0.127, -0.989 ], "quaternion": [ 0.071, 0.959, 0.273, 0.017 ] } }, { "index": 211, "index_chain": 14, "chain_name": "J", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/14", "linked_nts": [ "///J/13", "///J/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.687, "beta": -173.896, "gamma": 30.109, "delta": 141.172, "epsilon": -154.958, "zeta": -116.418, "epsilon_zeta": -38.540, "bb_type": "BI", "chi": -98.037, "glyco_bond": "anti", "C5prime_xyz": [ -2.254, 7.999, -2.270 ], "P_xyz": [ -0.219, 9.636, -2.130 ], "form": "B", "ssZp": 1.647, "Dp": 1.906, "splay_angle": 25.143, "splay_distance": 4.259, "splay_ratio": 0.219, "d22": 4.736, "d64": 3.988, "eta": 170.550, "theta": -139.593, "eta_prime": -169.697, "theta_prime": -142.283, "eta_base": -136.285, "theta_base": -91.087, "v0": -21.772, "v1": 34.617, "v2": -33.894, "v3": 22.213, "v4": -0.587, "amplitude": 35.608, "phase_angle": 162.152, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 166.837, 204.558, 247.655 ], "x_axis": [ 0.992, 0.038, 0.122 ], "y_axis": [ 0.035, -0.999, 0.023 ], "z_axis": [ 0.123, -0.018, -0.992 ], "quaternion": [ 0.010, 0.998, 0.018, 0.061 ] } }, { "index": 212, "index_chain": 15, "chain_name": "J", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/15", "linked_nts": [ "///J/14", "///J/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -45.594, "beta": 149.849, "gamma": 51.002, "delta": 137.815, "epsilon": -103.177, "zeta": 171.009, "epsilon_zeta": 85.813, "bb_type": "BII", "chi": -92.431, "glyco_bond": "anti", "C5prime_xyz": [ -3.313, 7.860, -2.328 ], "P_xyz": [ -1.104, 8.814, -3.332 ], "form": "B", "ssZp": 1.317, "Dp": 1.267, "splay_angle": 24.398, "splay_distance": 4.165, "splay_ratio": 0.216, "d22": 5.055, "d64": 4.156, "eta": -168.676, "theta": -173.669, "eta_prime": -141.929, "theta_prime": -177.498, "eta_base": -95.106, "theta_base": -127.145, "v0": -35.888, "v1": 45.146, "v2": -36.456, "v3": 16.993, "v4": 11.451, "amplitude": 43.940, "phase_angle": 146.066, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 168.798, 202.673, 244.378 ], "x_axis": [ 0.789, -0.610, 0.081 ], "y_axis": [ -0.582, -0.782, -0.222 ], "z_axis": [ 0.199, 0.128, -0.972 ], "quaternion": [ -0.093, 0.941, -0.317, 0.074 ] } }, { "index": 213, "index_chain": 16, "chain_name": "J", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/16", "linked_nts": [ "///J/15", "///J/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -44.663, "beta": 125.928, "gamma": 30.420, "delta": 138.840, "epsilon": -124.064, "zeta": -156.667, "epsilon_zeta": 32.603, "bb_type": "--", "chi": -96.103, "glyco_bond": "anti", "C5prime_xyz": [ -2.927, 8.100, -2.268 ], "P_xyz": [ -0.446, 8.909, -2.425 ], "form": ".", "ssZp": 1.625, "Dp": 1.664, "splay_angle": 23.073, "splay_distance": 3.991, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 179.755, "theta": -150.431, "eta_prime": -160.586, "theta_prime": -167.580, "eta_base": -115.732, "theta_base": -103.982, "v0": -33.750, "v1": 44.270, "v2": -37.256, "v3": 18.767, "v4": 9.072, "amplitude": 43.369, "phase_angle": 149.210, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.108, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 168.673, 202.332, 240.229 ], "x_axis": [ 0.284, -0.952, -0.117 ], "y_axis": [ -0.945, -0.257, -0.204 ], "z_axis": [ 0.163, 0.169, -0.972 ], "quaternion": [ -0.117, 0.793, -0.598, 0.015 ] } }, { "index": 214, "index_chain": 17, "chain_name": "J", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/17", "linked_nts": [ "///J/16", "///J/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.271, "beta": 125.936, "gamma": 48.014, "delta": 91.461, "epsilon": 179.930, "zeta": -84.742, "epsilon_zeta": -95.328, "bb_type": "BI", "chi": -129.378, "glyco_bond": "anti", "C5prime_xyz": [ -2.109, 8.690, -1.365 ], "P_xyz": [ 0.425, 8.713, -2.067 ], "form": "B", "ssZp": 3.146, "Dp": 3.705, "splay_angle": 21.114, "splay_distance": 3.532, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 158.110, "theta": -154.180, "eta_prime": 173.814, "theta_prime": -162.479, "eta_base": -116.036, "theta_base": -136.573, "v0": -17.647, "v1": -1.779, "v2": 18.917, "v3": -29.505, "v4": 29.986, "amplitude": 30.941, "phase_angle": 52.311, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.071, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 167.538, 201.946, 236.422 ], "x_axis": [ -0.477, -0.848, -0.230 ], "y_axis": [ -0.859, 0.506, -0.085 ], "z_axis": [ 0.188, 0.157, -0.970 ], "quaternion": [ 0.122, -0.497, 0.859, 0.021 ] } }, { "index": 215, "index_chain": 18, "chain_name": "J", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/18", "linked_nts": [ "///J/17", "///J/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.738, "beta": 161.399, "gamma": 66.925, "delta": 136.571, "epsilon": 177.348, "zeta": -88.686, "epsilon_zeta": -93.966, "bb_type": "BI", "chi": -125.675, "glyco_bond": "anti", "C5prime_xyz": [ -2.015, 8.662, -1.028 ], "P_xyz": [ 0.548, 9.193, -1.004 ], "form": ".", "ssZp": 2.368, "Dp": 2.353, "splay_angle": 21.442, "splay_distance": 3.846, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 168.118, "theta": -123.649, "eta_prime": -152.465, "theta_prime": -150.907, "eta_base": -116.916, "theta_base": -114.257, "v0": -24.954, "v1": 35.022, "v2": -31.261, "v3": 17.726, "v4": 4.326, "amplitude": 34.731, "phase_angle": 154.168, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.259, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 168.037, 202.406, 232.956 ], "x_axis": [ -0.824, -0.526, -0.210 ], "y_axis": [ -0.531, 0.847, -0.038 ], "z_axis": [ 0.197, 0.080, -0.977 ], "quaternion": [ 0.107, -0.277, 0.955, 0.011 ] } }, { "index": 216, "index_chain": 19, "chain_name": "J", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/19", "linked_nts": [ "///J/18", "///J/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.344, "beta": -168.940, "gamma": 35.137, "delta": 128.408, "epsilon": -174.246, "zeta": -88.190, "epsilon_zeta": -86.056, "bb_type": "BI", "chi": -125.353, "glyco_bond": "anti", "C5prime_xyz": [ -2.168, 8.693, -1.237 ], "P_xyz": [ -0.370, 10.399, -0.388 ], "form": ".", "ssZp": 2.429, "Dp": 2.428, "splay_angle": 17.912, "splay_distance": 3.277, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 171.876, "theta": -139.714, "eta_prime": -167.555, "theta_prime": -145.567, "eta_base": -117.838, "theta_base": -100.766, "v0": -30.264, "v1": 35.093, "v2": -26.541, "v3": 9.890, "v4": 12.601, "amplitude": 34.548, "phase_angle": 140.195, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 168.590, 201.185, 229.351 ], "x_axis": [ -0.978, 0.070, -0.197 ], "y_axis": [ 0.037, 0.986, 0.165 ], "z_axis": [ 0.206, 0.154, -0.966 ], "quaternion": [ 0.102, 0.027, 0.991, 0.080 ] } }, { "index": 217, "index_chain": 20, "chain_name": "J", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/20", "linked_nts": [ "///J/19", "///J/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.780, "beta": 173.857, "gamma": 40.711, "delta": 119.021, "epsilon": 176.112, "zeta": -89.977, "epsilon_zeta": -93.911, "bb_type": "BI", "chi": -129.331, "glyco_bond": "anti", "C5prime_xyz": [ -2.596, 8.704, -1.258 ], "P_xyz": [ -0.705, 10.452, -0.797 ], "form": ".", "ssZp": 2.543, "Dp": 2.584, "splay_angle": 19.325, "splay_distance": 3.476, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 159.911, "theta": -154.566, "eta_prime": -173.755, "theta_prime": -159.202, "eta_base": -118.300, "theta_base": -129.101, "v0": -37.008, "v1": 35.699, "v2": -21.275, "v3": 0.703, "v4": 22.585, "amplitude": 37.379, "phase_angle": 124.693, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 167.800, 201.095, 226.172 ], "x_axis": [ -0.798, 0.596, 0.089 ], "y_axis": [ 0.599, 0.767, 0.229 ], "z_axis": [ 0.068, 0.236, -0.969 ], "quaternion": [ -0.006, 0.318, 0.940, 0.124 ] } }, { "index": 218, "index_chain": 21, "chain_name": "J", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/21", "linked_nts": [ "///J/20", "///J/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.704, "beta": -166.010, "gamma": 36.899, "delta": 139.754, "epsilon": -163.410, "zeta": -115.029, "epsilon_zeta": -48.381, "bb_type": "BI", "chi": -113.676, "glyco_bond": "anti", "C5prime_xyz": [ -2.294, 8.522, -1.620 ], "P_xyz": [ -0.496, 10.303, -0.953 ], "form": ".", "ssZp": 2.090, "Dp": 2.137, "splay_angle": 17.086, "splay_distance": 3.042, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 173.891, "theta": -149.471, "eta_prime": -167.569, "theta_prime": -158.815, "eta_base": -131.878, "theta_base": -131.946, "v0": -28.923, "v1": 40.286, "v2": -35.681, "v3": 20.119, "v4": 5.204, "amplitude": 39.804, "phase_angle": 153.692, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 166.751, 200.880, 222.865 ], "x_axis": [ -0.378, 0.890, 0.253 ], "y_axis": [ 0.926, 0.360, 0.115 ], "z_axis": [ 0.011, 0.278, -0.961 ], "quaternion": [ -0.074, 0.553, 0.821, 0.120 ] } }, { "index": 219, "index_chain": 22, "chain_name": "J", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/22", "linked_nts": [ "///J/21", "///J/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.384, "beta": 165.168, "gamma": 45.024, "delta": 117.379, "epsilon": -173.396, "zeta": -96.817, "epsilon_zeta": -76.578, "bb_type": "BI", "chi": -125.454, "glyco_bond": "anti", "C5prime_xyz": [ -2.693, 8.617, -1.447 ], "P_xyz": [ -0.590, 10.183, -1.426 ], "form": ".", "ssZp": 2.671, "Dp": 2.647, "splay_angle": 24.573, "splay_distance": 4.220, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 161.314, "theta": -152.669, "eta_prime": 177.523, "theta_prime": -158.144, "eta_base": -147.629, "theta_base": -123.515, "v0": -37.356, "v1": 34.810, "v2": -19.560, "v3": -1.209, "v4": 24.021, "amplitude": 37.203, "phase_angle": 121.720, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 165.671, 201.114, 220.031 ], "x_axis": [ 0.102, 0.932, 0.348 ], "y_axis": [ 0.994, -0.078, -0.082 ], "z_axis": [ -0.049, 0.354, -0.934 ], "quaternion": [ -0.150, 0.727, 0.662, 0.103 ] } }, { "index": 220, "index_chain": 23, "chain_name": "J", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/23", "linked_nts": [ "///J/22", "///J/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -78.357, "beta": 170.974, "gamma": 79.984, "delta": 122.679, "epsilon": -173.698, "zeta": -108.458, "epsilon_zeta": -65.240, "bb_type": "BI", "chi": -131.619, "glyco_bond": "anti", "C5prime_xyz": [ -2.599, 8.784, -1.110 ], "P_xyz": [ -0.300, 10.025, -1.378 ], "form": "B", "ssZp": 2.444, "Dp": 2.506, "splay_angle": 18.236, "splay_distance": 2.972, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 174.858, "theta": -158.235, "eta_prime": -160.582, "theta_prime": -166.758, "eta_base": -120.652, "theta_base": -123.245, "v0": -37.590, "v1": 38.837, "v2": -25.501, "v3": 4.740, "v4": 20.337, "amplitude": 39.298, "phase_angle": 130.460, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 164.890, 203.240, 216.471 ], "x_axis": [ 0.636, 0.728, 0.256 ], "y_axis": [ 0.771, -0.584, -0.254 ], "z_axis": [ -0.035, 0.360, -0.932 ], "quaternion": [ -0.173, 0.888, 0.422, 0.062 ] } }, { "index": 221, "index_chain": 24, "chain_name": "J", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/24", "linked_nts": [ "///J/23", "///J/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.056, "beta": -177.541, "gamma": 50.724, "delta": 143.799, "epsilon": -168.346, "zeta": -99.937, "epsilon_zeta": -68.409, "bb_type": "BI", "chi": -112.195, "glyco_bond": "anti", "C5prime_xyz": [ -1.906, 8.407, -1.579 ], "P_xyz": [ 0.479, 9.361, -1.069 ], "form": ".", "ssZp": 2.014, "Dp": 2.053, "splay_angle": 20.315, "splay_distance": 3.657, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 168.085, "theta": -124.745, "eta_prime": -168.209, "theta_prime": -144.173, "eta_base": -119.651, "theta_base": -107.775, "v0": -18.957, "v1": 33.261, "v2": -34.198, "v3": 24.200, "v4": -3.525, "amplitude": 35.112, "phase_angle": 166.900, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 164.516, 204.664, 213.890 ], "x_axis": [ 0.984, 0.176, 0.028 ], "y_axis": [ 0.171, -0.893, -0.417 ], "z_axis": [ -0.049, 0.415, -0.909 ], "quaternion": [ -0.214, 0.973, 0.089, -0.005 ] } }, { "index": 222, "index_chain": 25, "chain_name": "J", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/25", "linked_nts": [ "///J/24", "///J/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -51.251, "beta": 171.936, "gamma": 34.869, "delta": 111.800, "epsilon": 178.514, "zeta": -96.789, "epsilon_zeta": -84.697, "bb_type": "BI", "chi": -120.370, "glyco_bond": "anti", "C5prime_xyz": [ -2.632, 8.581, -1.727 ], "P_xyz": [ -0.697, 10.333, -1.778 ], "form": "B", "ssZp": 2.652, "Dp": 2.708, "splay_angle": 18.796, "splay_distance": 3.158, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 164.099, "theta": -165.965, "eta_prime": -175.484, "theta_prime": -166.439, "eta_base": -128.317, "theta_base": -131.460, "v0": -36.614, "v1": 30.438, "v2": -13.663, "v3": -6.864, "v4": 27.235, "amplitude": 35.593, "phase_angle": 112.574, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 165.148, 206.803, 210.991 ], "x_axis": [ 0.918, -0.352, -0.184 ], "y_axis": [ -0.397, -0.832, -0.389 ], "z_axis": [ -0.017, 0.430, -0.903 ], "quaternion": [ -0.214, 0.956, -0.196, -0.053 ] } }, { "index": 223, "index_chain": 26, "chain_name": "J", "nt_resnum": 26, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/26", "linked_nts": [ "///J/25", "///J/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.652, "beta": -174.168, "gamma": 38.844, "delta": 134.597, "epsilon": -176.019, "zeta": -99.002, "epsilon_zeta": -77.017, "bb_type": "BI", "chi": -117.164, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.441, -1.471 ], "P_xyz": [ 0.465, 9.619, -0.821 ], "form": ".", "ssZp": 2.290, "Dp": 2.320, "splay_angle": 19.447, "splay_distance": 3.401, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 168.245, "theta": -140.436, "eta_prime": -172.928, "theta_prime": -149.230, "eta_base": -133.027, "theta_base": -116.534, "v0": -18.787, "v1": 28.267, "v2": -26.593, "v3": 16.461, "v4": 1.285, "amplitude": 28.539, "phase_angle": 158.719, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 165.393, 208.317, 208.231 ], "x_axis": [ 0.537, -0.835, -0.119 ], "y_axis": [ -0.827, -0.493, -0.269 ], "z_axis": [ 0.166, 0.243, -0.956 ], "quaternion": [ -0.148, 0.864, -0.481, 0.013 ] } }, { "index": 224, "index_chain": 27, "chain_name": "J", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/27", "linked_nts": [ "///J/26", "///J/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.378, "beta": 173.014, "gamma": 36.332, "delta": 139.962, "epsilon": -149.943, "zeta": -152.754, "epsilon_zeta": 2.811, "bb_type": "--", "chi": -113.991, "glyco_bond": "anti", "C5prime_xyz": [ -2.490, 8.559, -1.592 ], "P_xyz": [ -0.457, 10.138, -1.177 ], "form": "B", "ssZp": 2.081, "Dp": 2.094, "splay_angle": 19.065, "splay_distance": 3.181, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 174.694, "theta": -168.196, "eta_prime": -160.893, "theta_prime": -169.420, "eta_base": -121.558, "theta_base": -118.271, "v0": -32.832, "v1": 43.697, "v2": -37.241, "v3": 19.408, "v4": 8.114, "amplitude": 42.851, "phase_angle": 150.353, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 166.766, 209.150, 205.232 ], "x_axis": [ 0.052, -0.974, -0.221 ], "y_axis": [ -0.982, -0.009, -0.189 ], "z_axis": [ 0.182, 0.227, -0.957 ], "quaternion": [ -0.147, 0.710, -0.688, -0.014 ] } }, { "index": 225, "index_chain": 28, "chain_name": "J", "nt_resnum": 28, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/28", "linked_nts": [ "///J/27", "///J/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.696, "beta": 154.109, "gamma": 33.006, "delta": 146.185, "epsilon": -157.748, "zeta": -116.313, "epsilon_zeta": -41.435, "bb_type": "BI", "chi": -108.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.617, 8.196, -1.694 ], "P_xyz": [ 0.889, 8.612, -1.077 ], "form": "B", "ssZp": 1.770, "Dp": 1.932, "splay_angle": 18.640, "splay_distance": 3.216, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 172.489, "theta": -125.376, "eta_prime": -167.201, "theta_prime": -142.984, "eta_base": -115.131, "theta_base": -110.901, "v0": -12.306, "v1": 28.538, "v2": -33.013, "v3": 26.709, "v4": -9.277, "amplitude": 33.051, "phase_angle": 177.262, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 166.713, 210.309, 202.270 ], "x_axis": [ -0.620, -0.731, -0.284 ], "y_axis": [ -0.763, 0.647, -0.001 ], "z_axis": [ 0.184, 0.216, -0.959 ], "quaternion": [ 0.130, -0.416, 0.898, 0.060 ] } }, { "index": 226, "index_chain": 29, "chain_name": "J", "nt_resnum": 29, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/29", "linked_nts": [ "///J/28", "///J/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -46.906, "beta": 150.244, "gamma": 44.019, "delta": 136.121, "epsilon": -124.798, "zeta": -163.994, "epsilon_zeta": 39.197, "bb_type": "BII", "chi": -110.150, "glyco_bond": "anti", "C5prime_xyz": [ -3.032, 8.370, -1.776 ], "P_xyz": [ -0.803, 9.709, -1.946 ], "form": "B", "ssZp": 1.795, "Dp": 1.767, "splay_angle": 19.506, "splay_distance": 3.292, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 174.684, "theta": -169.877, "eta_prime": -159.073, "theta_prime": -175.650, "eta_base": -121.887, "theta_base": -131.542, "v0": -37.128, "v1": 45.439, "v2": -35.719, "v3": 15.569, "v4": 13.084, "amplitude": 44.192, "phase_angle": 143.928, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 167.216, 210.911, 199.151 ], "x_axis": [ -0.911, -0.348, -0.223 ], "y_axis": [ -0.374, 0.924, 0.085 ], "z_axis": [ 0.176, 0.161, -0.971 ], "quaternion": [ 0.102, -0.185, 0.975, 0.063 ] } }, { "index": 227, "index_chain": 30, "chain_name": "J", "nt_resnum": 30, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/30", "linked_nts": [ "///J/29", "///J/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.992, "beta": 138.027, "gamma": 45.978, "delta": 135.621, "epsilon": -160.045, "zeta": -109.219, "epsilon_zeta": -50.826, "bb_type": "BI", "chi": -118.865, "glyco_bond": "anti", "C5prime_xyz": [ -2.187, 8.619, -1.455 ], "P_xyz": [ 0.351, 9.146, -1.143 ], "form": "B", "ssZp": 1.978, "Dp": 2.078, "splay_angle": 18.645, "splay_distance": 3.251, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 163.856, "theta": -125.483, "eta_prime": -172.956, "theta_prime": -148.493, "eta_base": -126.909, "theta_base": -111.488, "v0": -28.330, "v1": 37.568, "v2": -32.384, "v3": 16.943, "v4": 6.892, "amplitude": 37.121, "phase_angle": 150.736, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.148, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 168.379, 211.848, 196.217 ], "x_axis": [ -0.960, 0.263, -0.092 ], "y_axis": [ 0.237, 0.944, 0.228 ], "z_axis": [ 0.147, 0.197, -0.969 ], "quaternion": [ 0.061, 0.127, 0.984, 0.108 ] } }, { "index": 228, "index_chain": 31, "chain_name": "J", "nt_resnum": 31, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/31", "linked_nts": [ "///J/30", "///J/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.309, "beta": 170.533, "gamma": 23.662, "delta": 116.981, "epsilon": -179.354, "zeta": -101.097, "epsilon_zeta": -78.257, "bb_type": "BI", "chi": -111.181, "glyco_bond": "anti", "C5prime_xyz": [ -2.332, 8.301, -2.035 ], "P_xyz": [ -0.319, 9.958, -2.028 ], "form": "B", "ssZp": 2.272, "Dp": 2.575, "splay_angle": 18.277, "splay_distance": 3.112, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 163.305, "theta": -162.152, "eta_prime": -177.758, "theta_prime": -165.100, "eta_base": -130.762, "theta_base": -124.092, "v0": -27.934, "v1": 26.154, "v2": -15.043, "v3": -0.518, "v4": 17.881, "amplitude": 27.946, "phase_angle": 122.566, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 168.264, 212.223, 192.990 ], "x_axis": [ -0.655, 0.750, 0.097 ], "y_axis": [ 0.754, 0.637, 0.161 ], "z_axis": [ 0.059, 0.179, -0.982 ], "quaternion": [ -0.011, 0.415, 0.905, 0.094 ] } }, { "index": 229, "index_chain": 32, "chain_name": "J", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/32", "linked_nts": [ "///J/31", "///J/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.128, "beta": 164.802, "gamma": 48.903, "delta": 125.493, "epsilon": -177.535, "zeta": -104.584, "epsilon_zeta": -72.950, "bb_type": "BI", "chi": -116.027, "glyco_bond": "anti", "C5prime_xyz": [ -2.342, 8.482, -1.731 ], "P_xyz": [ 0.015, 9.579, -1.823 ], "form": "B", "ssZp": 2.366, "Dp": 2.422, "splay_angle": 23.820, "splay_distance": 3.994, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 172.231, "theta": -149.337, "eta_prime": -163.682, "theta_prime": -159.155, "eta_base": -118.809, "theta_base": -117.374, "v0": -29.812, "v1": 33.172, "v2": -24.084, "v3": 7.670, "v4": 13.763, "amplitude": 32.921, "phase_angle": 137.018, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 168.237, 213.098, 190.004 ], "x_axis": [ -0.157, 0.976, 0.150 ], "y_axis": [ 0.987, 0.161, -0.018 ], "z_axis": [ -0.041, 0.145, -0.989 ], "quaternion": [ -0.063, 0.646, 0.759, 0.042 ] } }, { "index": 230, "index_chain": 33, "chain_name": "J", "nt_resnum": 33, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/33", "linked_nts": [ "///J/32", "///J/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.433, "beta": 178.686, "gamma": 32.875, "delta": 139.948, "epsilon": -176.315, "zeta": -107.543, "epsilon_zeta": -68.772, "bb_type": "BI", "chi": -109.048, "glyco_bond": "anti", "C5prime_xyz": [ -2.041, 8.338, -1.762 ], "P_xyz": [ 0.159, 9.645, -1.312 ], "form": "B", "ssZp": 2.188, "Dp": 2.210, "splay_angle": 20.285, "splay_distance": 3.450, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 175.366, "theta": -145.058, "eta_prime": -160.447, "theta_prime": -156.405, "eta_base": -113.436, "theta_base": -116.204, "v0": -20.134, "v1": 32.455, "v2": -31.820, "v3": 21.014, "v4": -0.800, "amplitude": 33.354, "phase_angle": 162.555, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 168.045, 214.277, 186.193 ], "x_axis": [ 0.475, 0.873, 0.110 ], "y_axis": [ 0.880, -0.469, -0.077 ], "z_axis": [ -0.016, 0.133, -0.991 ], "quaternion": [ -0.061, 0.857, 0.512, 0.027 ] } }, { "index": 231, "index_chain": 34, "chain_name": "J", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/34", "linked_nts": [ "///J/33", "///J/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.468, "beta": 166.193, "gamma": 58.385, "delta": 133.099, "epsilon": -157.491, "zeta": -122.728, "epsilon_zeta": -34.763, "bb_type": "BI", "chi": -120.190, "glyco_bond": "anti", "C5prime_xyz": [ -2.509, 8.601, -1.462 ], "P_xyz": [ -0.203, 9.822, -1.427 ], "form": "B", "ssZp": 2.121, "Dp": 2.199, "splay_angle": 19.352, "splay_distance": 3.182, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 177.210, "theta": -152.271, "eta_prime": -159.223, "theta_prime": -160.814, "eta_base": -113.920, "theta_base": -112.322, "v0": -33.628, "v1": 40.878, "v2": -32.357, "v3": 14.052, "v4": 11.983, "amplitude": 40.011, "phase_angle": 143.968, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 167.907, 215.304, 182.902 ], "x_axis": [ 0.883, 0.469, -0.000 ], "y_axis": [ 0.464, -0.873, -0.148 ], "z_axis": [ -0.069, 0.130, -0.989 ], "quaternion": [ -0.072, 0.968, 0.241, -0.018 ] } }, { "index": 232, "index_chain": 35, "chain_name": "J", "nt_resnum": 35, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/35", "linked_nts": [ "///J/34", "///J/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.718, "beta": 165.405, "gamma": 50.251, "delta": 138.470, "epsilon": -177.037, "zeta": -98.706, "epsilon_zeta": -78.331, "bb_type": "BI", "chi": -108.929, "glyco_bond": "anti", "C5prime_xyz": [ -2.075, 8.297, -1.815 ], "P_xyz": [ 0.421, 9.078, -1.744 ], "form": ".", "ssZp": 2.111, "Dp": 2.175, "splay_angle": 19.644, "splay_distance": 3.509, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 161.009, "theta": -130.697, "eta_prime": -170.404, "theta_prime": -152.910, "eta_base": -116.333, "theta_base": -121.581, "v0": -21.785, "v1": 33.382, "v2": -31.796, "v3": 20.110, "v4": 0.796, "amplitude": 33.863, "phase_angle": 159.878, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 167.986, 215.513, 179.728 ], "x_axis": [ 0.967, -0.237, -0.095 ], "y_axis": [ -0.251, -0.950, -0.186 ], "z_axis": [ -0.046, 0.203, -0.978 ], "quaternion": [ -0.099, 0.987, -0.123, -0.036 ] } }, { "index": 233, "index_chain": 36, "chain_name": "J", "nt_resnum": 36, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/36", "linked_nts": [ "///J/35", "///J/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.887, "beta": 176.894, "gamma": 41.704, "delta": 120.153, "epsilon": -164.594, "zeta": -109.299, "epsilon_zeta": -55.296, "bb_type": "BI", "chi": -115.455, "glyco_bond": "anti", "C5prime_xyz": [ -2.784, 8.430, -1.815 ], "P_xyz": [ -0.858, 10.183, -1.929 ], "form": "B", "ssZp": 2.467, "Dp": 2.520, "splay_angle": 19.453, "splay_distance": 3.326, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 173.554, "theta": -158.170, "eta_prime": -169.568, "theta_prime": -161.134, "eta_base": -130.230, "theta_base": -125.031, "v0": -36.811, "v1": 36.082, "v2": -22.023, "v3": 1.639, "v4": 21.925, "amplitude": 37.438, "phase_angle": 126.032, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 168.626, 216.906, 176.571 ], "x_axis": [ 0.714, -0.668, -0.212 ], "y_axis": [ -0.700, -0.690, -0.183 ], "z_axis": [ -0.024, 0.279, -0.960 ], "quaternion": [ -0.126, 0.917, -0.373, -0.064 ] } }, { "index": 234, "index_chain": 37, "chain_name": "J", "nt_resnum": 37, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/37", "linked_nts": [ "///J/36", "///J/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.387, "beta": 163.945, "gamma": 49.428, "delta": 127.275, "epsilon": -176.279, "zeta": -100.984, "epsilon_zeta": -75.295, "bb_type": "BI", "chi": -125.364, "glyco_bond": "anti", "C5prime_xyz": [ -2.325, 8.661, -1.270 ], "P_xyz": [ -0.016, 9.844, -0.985 ], "form": ".", "ssZp": 2.400, "Dp": 2.427, "splay_angle": 19.701, "splay_distance": 3.388, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 160.362, "theta": -147.028, "eta_prime": -175.695, "theta_prime": -157.975, "eta_base": -132.837, "theta_base": -129.074, "v0": -31.816, "v1": 35.896, "v2": -26.286, "v3": 8.784, "v4": 14.291, "amplitude": 35.453, "phase_angle": 137.853, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 169.009, 217.564, 173.333 ], "x_axis": [ 0.220, -0.974, 0.053 ], "y_axis": [ -0.974, -0.223, -0.052 ], "z_axis": [ 0.062, -0.040, -0.997 ], "quaternion": [ -0.004, 0.781, -0.623, 0.037 ] } }, { "index": 235, "index_chain": 38, "chain_name": "J", "nt_resnum": 38, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/38", "linked_nts": [ "///J/37", "///J/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.184, "beta": -175.720, "gamma": 44.759, "delta": 140.576, "epsilon": -161.823, "zeta": -121.184, "epsilon_zeta": -40.639, "bb_type": "BI", "chi": -115.210, "glyco_bond": "anti", "C5prime_xyz": [ -2.332, 8.506, -1.517 ], "P_xyz": [ -0.245, 9.991, -1.010 ], "form": "B", "ssZp": 2.161, "Dp": 2.160, "splay_angle": 18.528, "splay_distance": 3.051, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 170.098, "theta": -150.499, "eta_prime": -169.016, "theta_prime": -157.322, "eta_base": -132.958, "theta_base": -115.407, "v0": -28.568, "v1": 40.228, "v2": -35.835, "v3": 20.425, "v4": 4.813, "amplitude": 39.784, "phase_angle": 154.256, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 170.362, 217.709, 170.231 ], "x_axis": [ -0.317, -0.946, 0.064 ], "y_axis": [ -0.946, 0.310, -0.094 ], "z_axis": [ 0.069, -0.090, -0.994 ], "quaternion": [ 0.002, -0.585, 0.809, -0.057 ] } }, { "index": 236, "index_chain": 39, "chain_name": "J", "nt_resnum": 39, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/39", "linked_nts": [ "///J/38", "///J/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.423, "beta": 169.721, "gamma": 46.533, "delta": 143.049, "epsilon": -170.373, "zeta": -117.203, "epsilon_zeta": -53.170, "bb_type": "BI", "chi": -114.568, "glyco_bond": "anti", "C5prime_xyz": [ -2.104, 8.436, -1.492 ], "P_xyz": [ 0.289, 9.405, -1.041 ], "form": "B", "ssZp": 2.137, "Dp": 2.173, "splay_angle": 16.932, "splay_distance": 2.813, "splay_ratio": 0.148, "d22": null, "d64": null, "eta": 158.506, "theta": -142.820, "eta_prime": -175.311, "theta_prime": -157.507, "eta_base": -125.757, "theta_base": -132.190, "v0": -23.389, "v1": 36.823, "v2": -35.528, "v3": 22.950, "v4": -0.016, "amplitude": 37.533, "phase_angle": 161.189, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 170.649, 217.260, 167.227 ], "x_axis": [ -0.832, -0.534, 0.152 ], "y_axis": [ -0.553, 0.823, -0.133 ], "z_axis": [ -0.053, -0.195, -0.979 ], "quaternion": [ -0.054, -0.285, 0.953, -0.086 ] } }, { "index": 237, "index_chain": 40, "chain_name": "J", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/40", "linked_nts": [ "///J/39", "///J/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.165, "beta": -177.034, "gamma": 31.615, "delta": 146.236, "epsilon": -159.651, "zeta": -116.774, "epsilon_zeta": -42.877, "bb_type": "BI", "chi": -95.475, "glyco_bond": "anti", "C5prime_xyz": [ -2.161, 7.922, -2.308 ], "P_xyz": [ -0.012, 9.395, -2.175 ], "form": "B", "ssZp": 1.560, "Dp": 1.774, "splay_angle": 20.688, "splay_distance": 3.498, "splay_ratio": 0.180, "d22": 4.285, "d64": 3.285, "eta": 175.387, "theta": -137.352, "eta_prime": -166.642, "theta_prime": -145.262, "eta_base": -136.823, "theta_base": -94.828, "v0": -17.854, "v1": 33.954, "v2": -36.466, "v3": 27.109, "v4": -6.116, "amplitude": 36.963, "phase_angle": 170.598, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 171.322, 216.237, 164.695 ], "x_axis": [ -0.999, -0.031, 0.021 ], "y_axis": [ -0.036, 0.932, -0.361 ], "z_axis": [ -0.008, -0.361, -0.932 ], "quaternion": [ -0.007, -0.017, 0.983, -0.184 ] } }, { "index": 238, "index_chain": 41, "chain_name": "J", "nt_resnum": 41, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/41", "linked_nts": [ "///J/40", "///J/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -40.198, "beta": 163.211, "gamma": 27.862, "delta": 143.901, "epsilon": -90.999, "zeta": 172.346, "epsilon_zeta": 96.655, "bb_type": "BII", "chi": -84.060, "glyco_bond": "anti", "C5prime_xyz": [ -2.883, 7.670, -2.593 ], "P_xyz": [ -0.699, 8.971, -3.184 ], "form": "B", "ssZp": 0.653, "Dp": 0.787, "splay_angle": 22.848, "splay_distance": 3.995, "splay_ratio": 0.206, "d22": 4.958, "d64": 3.838, "eta": -170.949, "theta": -165.297, "eta_prime": -148.805, "theta_prime": -166.532, "eta_base": -101.434, "theta_base": -125.149, "v0": -27.277, "v1": 40.613, "v2": -37.584, "v3": 22.833, "v4": 2.494, "amplitude": 40.636, "phase_angle": 157.653, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 170.157, 216.266, 161.397 ], "x_axis": [ -0.804, 0.581, -0.124 ], "y_axis": [ 0.566, 0.686, -0.456 ], "z_axis": [ -0.180, -0.437, -0.881 ], "quaternion": [ -0.015, 0.312, 0.918, -0.243 ] } }, { "index": 239, "index_chain": 42, "chain_name": "J", "nt_resnum": 42, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/42", "linked_nts": [ "///J/41", "///J/43" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -52.858, "beta": 128.164, "gamma": 24.297, "delta": 139.147, "epsilon": -92.066, "zeta": 173.476, "epsilon_zeta": 94.459, "bb_type": "BII", "chi": -83.166, "glyco_bond": "anti", "C5prime_xyz": [ -3.277, 7.542, -2.628 ], "P_xyz": [ -0.912, 8.502, -3.164 ], "form": ".", "ssZp": 0.826, "Dp": 0.898, "splay_angle": 26.657, "splay_distance": 4.589, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": -175.598, "theta": -161.980, "eta_prime": -158.033, "theta_prime": -166.058, "eta_base": -123.529, "theta_base": -105.645, "v0": -32.443, "v1": 42.936, "v2": -36.456, "v3": 18.813, "v4": 8.226, "amplitude": 42.098, "phase_angle": 149.995, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.067, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 170.890, 215.324, 157.584 ], "x_axis": [ -0.419, 0.845, -0.334 ], "y_axis": [ 0.886, 0.300, -0.354 ], "z_axis": [ -0.199, -0.444, -0.874 ], "quaternion": [ 0.042, 0.538, 0.805, -0.248 ] } }, { "index": 240, "index_chain": 43, "chain_name": "J", "nt_resnum": 43, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/43", "linked_nts": [ "///J/42", "///J/44" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -61.763, "beta": 119.075, "gamma": 48.617, "delta": 141.570, "epsilon": -95.785, "zeta": 162.336, "epsilon_zeta": 101.879, "bb_type": "BII", "chi": -92.888, "glyco_bond": "anti", "C5prime_xyz": [ -3.201, 7.879, -2.318 ], "P_xyz": [ -0.683, 8.207, -2.925 ], "form": ".", "ssZp": 1.075, "Dp": 1.032, "splay_angle": 23.338, "splay_distance": 3.996, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": -173.911, "theta": -170.590, "eta_prime": -145.838, "theta_prime": 174.899, "eta_base": -96.882, "theta_base": -122.870, "v0": -33.948, "v1": 45.253, "v2": -38.522, "v3": 20.211, "v4": 8.190, "amplitude": 44.277, "phase_angle": 150.463, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.099, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 172.468, 214.745, 153.315 ], "x_axis": [ 0.287, 0.827, -0.483 ], "y_axis": [ 0.935, -0.351, -0.045 ], "z_axis": [ -0.207, -0.439, -0.875 ], "quaternion": [ 0.124, 0.793, 0.556, -0.217 ] } }, { "index": 241, "index_chain": 44, "chain_name": "J", "nt_resnum": 44, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/44", "linked_nts": [ "///J/43", "///J/45" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.826, "beta": 141.833, "gamma": 25.287, "delta": 147.787, "epsilon": -172.553, "zeta": -126.572, "epsilon_zeta": -45.981, "bb_type": "BI", "chi": -92.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.034, 7.751, -2.397 ], "P_xyz": [ 0.515, 8.276, -2.161 ], "form": "B", "ssZp": 1.752, "Dp": 1.961, "splay_angle": 20.287, "splay_distance": 3.365, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 164.817, "theta": -141.253, "eta_prime": -170.140, "theta_prime": -162.007, "eta_base": -112.774, "theta_base": -115.005, "v0": -14.817, "v1": 31.686, "v2": -35.625, "v3": 27.853, "v4": -8.455, "amplitude": 35.779, "phase_angle": 174.687, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.215, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 173.022, 211.991, 150.472 ], "x_axis": [ 0.848, 0.305, -0.434 ], "y_axis": [ 0.470, -0.810, 0.349 ], "z_axis": [ -0.245, -0.500, -0.831 ], "quaternion": [ 0.227, 0.934, 0.208, -0.182 ] } }, { "index": 242, "index_chain": 45, "chain_name": "J", "nt_resnum": 45, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/45", "linked_nts": [ "///J/44", "///J/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.565, "beta": 155.501, "gamma": 59.051, "delta": 143.618, "epsilon": -141.739, "zeta": -144.815, "epsilon_zeta": 3.076, "bb_type": "--", "chi": -109.887, "glyco_bond": "anti", "C5prime_xyz": [ -2.185, 8.436, -1.728 ], "P_xyz": [ 0.362, 8.961, -1.919 ], "form": "B", "ssZp": 1.781, "Dp": 1.813, "splay_angle": 20.990, "splay_distance": 3.551, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 177.102, "theta": -145.836, "eta_prime": -158.097, "theta_prime": -161.854, "eta_base": -109.271, "theta_base": -118.893, "v0": -26.562, "v1": 39.941, "v2": -37.330, "v3": 22.997, "v4": 1.988, "amplitude": 40.151, "phase_angle": 158.398, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 172.751, 209.820, 147.915 ], "x_axis": [ 0.957, -0.253, -0.143 ], "y_axis": [ -0.150, -0.851, 0.504 ], "z_axis": [ -0.249, -0.461, -0.852 ], "quaternion": [ 0.252, 0.956, -0.105, -0.102 ] } }, { "index": 243, "index_chain": 46, "chain_name": "J", "nt_resnum": 46, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/46", "linked_nts": [ "///J/45", "///J/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -41.387, "beta": 147.033, "gamma": 33.849, "delta": 135.524, "epsilon": -167.855, "zeta": -113.702, "epsilon_zeta": -54.154, "bb_type": "BI", "chi": -109.491, "glyco_bond": "anti", "C5prime_xyz": [ -2.197, 8.313, -1.860 ], "P_xyz": [ 0.275, 9.126, -1.639 ], "form": "B", "ssZp": 2.158, "Dp": 2.233, "splay_angle": 19.469, "splay_distance": 3.369, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 162.887, "theta": -138.818, "eta_prime": -172.374, "theta_prime": -156.824, "eta_base": -124.432, "theta_base": -121.439, "v0": -25.759, "v1": 35.192, "v2": -30.941, "v3": 16.869, "v4": 5.345, "amplitude": 34.860, "phase_angle": 152.569, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 171.532, 207.785, 145.272 ], "x_axis": [ 0.696, -0.681, 0.228 ], "y_axis": [ -0.685, -0.533, 0.496 ], "z_axis": [ -0.217, -0.501, -0.838 ], "quaternion": [ 0.285, 0.876, -0.390, 0.003 ] } }, { "index": 244, "index_chain": 47, "chain_name": "J", "nt_resnum": 47, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/47", "linked_nts": [ "///J/46", "///J/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.244, "beta": 160.473, "gamma": 48.298, "delta": 118.614, "epsilon": -177.919, "zeta": -105.939, "epsilon_zeta": -71.980, "bb_type": "BI", "chi": -126.613, "glyco_bond": "anti", "C5prime_xyz": [ -2.456, 8.741, -1.366 ], "P_xyz": [ -0.182, 10.009, -1.331 ], "form": "B", "ssZp": 2.601, "Dp": 2.588, "splay_angle": 20.150, "splay_distance": 3.335, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.937, "theta": -160.136, "eta_prime": -171.575, "theta_prime": -165.853, "eta_base": -127.277, "theta_base": -127.750, "v0": -35.626, "v1": 34.129, "v2": -20.156, "v3": 0.367, "v4": 22.007, "amplitude": 35.891, "phase_angle": 124.167, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 171.417, 206.133, 142.339 ], "x_axis": [ 0.239, -0.837, 0.493 ], "y_axis": [ -0.952, -0.102, 0.288 ], "z_axis": [ -0.190, -0.538, -0.821 ], "quaternion": [ 0.281, 0.735, -0.608, 0.103 ] } }, { "index": 245, "index_chain": 48, "chain_name": "J", "nt_resnum": 48, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/48", "linked_nts": [ "///J/47", "///J/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.326, "beta": 175.939, "gamma": 54.999, "delta": 142.943, "epsilon": -175.131, "zeta": -99.253, "epsilon_zeta": -75.878, "bb_type": "BI", "chi": -119.195, "glyco_bond": "anti", "C5prime_xyz": [ -2.013, 8.589, -1.274 ], "P_xyz": [ 0.380, 9.507, -0.747 ], "form": "B", "ssZp": 2.127, "Dp": 2.193, "splay_angle": 19.693, "splay_distance": 3.317, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 166.951, "theta": -130.670, "eta_prime": -165.504, "theta_prime": -146.826, "eta_base": -121.438, "theta_base": -115.698, "v0": -23.427, "v1": 36.869, "v2": -35.575, "v3": 22.963, "v4": 0.043, "amplitude": 37.590, "phase_angle": 161.151, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 171.211, 204.422, 139.484 ], "x_axis": [ -0.341, -0.725, 0.599 ], "y_axis": [ -0.919, 0.391, -0.051 ], "z_axis": [ -0.197, -0.567, -0.799 ], "quaternion": [ -0.250, -0.517, 0.796, -0.194 ] } }, { "index": 246, "index_chain": 49, "chain_name": "J", "nt_resnum": 49, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/49", "linked_nts": [ "///J/48", "///J/50" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.126, "beta": -163.056, "gamma": 37.543, "delta": 146.446, "epsilon": -174.035, "zeta": -116.109, "epsilon_zeta": -57.926, "bb_type": "BI", "chi": -98.442, "glyco_bond": "anti", "C5prime_xyz": [ -2.183, 8.027, -2.196 ], "P_xyz": [ -0.156, 9.659, -1.888 ], "form": "B", "ssZp": 1.865, "Dp": 1.977, "splay_angle": 17.844, "splay_distance": 2.922, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 164.708, "theta": -151.085, "eta_prime": -171.186, "theta_prime": -158.744, "eta_base": -131.136, "theta_base": -111.424, "v0": -20.149, "v1": 35.993, "v2": -37.415, "v3": 26.745, "v4": -4.445, "amplitude": 38.283, "phase_angle": 167.773, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 171.165, 202.117, 137.099 ], "x_axis": [ -0.788, -0.330, 0.520 ], "y_axis": [ -0.579, 0.685, -0.443 ], "z_axis": [ -0.210, -0.650, -0.730 ], "quaternion": [ -0.204, -0.254, 0.895, -0.305 ] } }, { "index": 247, "index_chain": 50, "chain_name": "J", "nt_resnum": 50, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/50", "linked_nts": [ "///J/49", "///J/51" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.048, "beta": -178.781, "gamma": 39.223, "delta": 144.762, "epsilon": -178.858, "zeta": -95.548, "epsilon_zeta": -83.309, "bb_type": "BI", "chi": -94.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.030, 7.866, -2.342 ], "P_xyz": [ 0.352, 8.948, -2.306 ], "form": "B", "ssZp": 1.817, "Dp": 2.020, "splay_angle": 20.099, "splay_distance": 3.362, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 165.155, "theta": -130.807, "eta_prime": -170.948, "theta_prime": -144.892, "eta_base": -119.873, "theta_base": -101.606, "v0": -14.150, "v1": 29.649, "v2": -33.145, "v3": 25.827, "v4": -7.611, "amplitude": 33.316, "phase_angle": 174.200, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 170.014, 200.437, 135.004 ], "x_axis": [ -0.951, 0.243, 0.190 ], "y_axis": [ 0.009, 0.638, -0.770 ], "z_axis": [ -0.308, -0.731, -0.609 ], "quaternion": [ -0.139, 0.070, 0.894, -0.420 ] } }, { "index": 248, "index_chain": 51, "chain_name": "J", "nt_resnum": 51, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/51", "linked_nts": [ "///J/50", "///J/52" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -47.341, "beta": -170.978, "gamma": 32.339, "delta": 149.467, "epsilon": -83.992, "zeta": 169.389, "epsilon_zeta": 106.619, "bb_type": "BII", "chi": -70.926, "glyco_bond": "anti", "C5prime_xyz": [ -3.005, 7.119, -2.950 ], "P_xyz": [ -1.111, 8.649, -3.921 ], "form": ".", "ssZp": 0.234, "Dp": 0.354, "splay_angle": 22.832, "splay_distance": 3.949, "splay_ratio": 0.209, "d22": 4.969, "d64": 3.508, "eta": -157.414, "theta": -167.522, "eta_prime": -137.979, "theta_prime": -166.372, "eta_base": -99.642, "theta_base": -114.508, "v0": -23.273, "v1": 40.004, "v2": -40.570, "v3": 28.291, "v4": -3.436, "amplitude": 41.845, "phase_angle": 165.819, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 168.034, 198.996, 132.700 ], "x_axis": [ -0.802, 0.518, -0.296 ], "y_axis": [ 0.430, 0.157, -0.889 ], "z_axis": [ -0.415, -0.841, -0.349 ], "quaternion": [ -0.039, 0.312, 0.760, -0.569 ] } }, { "index": 249, "index_chain": 52, "chain_name": "J", "nt_resnum": 52, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/52", "linked_nts": [ "///J/51", "///J/53" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -57.094, "beta": 134.300, "gamma": 18.685, "delta": 146.468, "epsilon": -94.067, "zeta": 159.548, "epsilon_zeta": 106.385, "bb_type": "BII", "chi": -65.963, "glyco_bond": "--", "C5prime_xyz": [ -3.371, 6.983, -2.946 ], "P_xyz": [ -1.067, 7.843, -3.833 ], "form": ".", "ssZp": 0.562, "Dp": 0.781, "splay_angle": 24.625, "splay_distance": 4.310, "splay_ratio": 0.226, "d22": 4.891, "d64": 3.720, "eta": -179.065, "theta": -171.281, "eta_prime": -159.053, "theta_prime": 179.498, "eta_base": -116.381, "theta_base": -115.887, "v0": -26.557, "v1": 41.383, "v2": -39.560, "v3": 25.294, "v4": 0.513, "amplitude": 41.972, "phase_angle": 160.482, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 167.769, 196.549, 129.612 ], "x_axis": [ -0.386, 0.556, -0.737 ], "y_axis": [ 0.769, -0.248, -0.589 ], "z_axis": [ -0.510, -0.794, -0.331 ], "quaternion": [ 0.093, 0.546, 0.606, -0.571 ] } }, { "index": 250, "index_chain": 53, "chain_name": "J", "nt_resnum": 53, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/53", "linked_nts": [ "///J/52", "///J/54" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -63.200, "beta": 121.173, "gamma": 44.186, "delta": 139.593, "epsilon": -93.826, "zeta": 177.079, "epsilon_zeta": 89.094, "bb_type": "BII", "chi": -94.663, "glyco_bond": "anti", "C5prime_xyz": [ -3.070, 7.946, -2.276 ], "P_xyz": [ -0.539, 8.298, -2.788 ], "form": ".", "ssZp": 1.057, "Dp": 1.005, "splay_angle": 25.808, "splay_distance": 4.402, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": -171.610, "theta": -159.346, "eta_prime": -150.215, "theta_prime": -170.494, "eta_base": -97.694, "theta_base": -115.295, "v0": -33.626, "v1": 44.105, "v2": -37.001, "v3": 18.707, "v4": 9.006, "amplitude": 43.101, "phase_angle": 149.147, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.141, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 167.969, 193.269, 126.824 ], "x_axis": [ 0.202, 0.257, -0.945 ], "y_axis": [ 0.840, -0.542, 0.032 ], "z_axis": [ -0.504, -0.800, -0.325 ], "quaternion": [ 0.289, 0.719, 0.381, -0.504 ] } }, { "index": 251, "index_chain": 54, "chain_name": "J", "nt_resnum": 54, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/54", "linked_nts": [ "///J/53", "///J/55" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -62.760, "beta": 123.683, "gamma": 45.874, "delta": 145.991, "epsilon": -119.960, "zeta": -172.001, "epsilon_zeta": 52.042, "bb_type": "BII", "chi": -99.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.935, 8.142, -2.066 ], "P_xyz": [ -0.376, 8.629, -2.315 ], "form": "B", "ssZp": 1.530, "Dp": 1.530, "splay_angle": 20.778, "splay_distance": 3.480, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 173.165, "theta": -155.936, "eta_prime": -155.175, "theta_prime": -177.292, "eta_base": -107.398, "theta_base": -121.211, "v0": -32.664, "v1": 46.338, "v2": -41.386, "v3": 23.861, "v4": 5.125, "amplitude": 45.785, "phase_angle": 154.679, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.166, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 167.471, 189.013, 125.814 ], "x_axis": [ 0.681, -0.163, -0.714 ], "y_axis": [ 0.554, -0.523, 0.648 ], "z_axis": [ -0.479, -0.836, -0.267 ], "quaternion": [ 0.472, 0.786, 0.124, -0.379 ] } }, { "index": 252, "index_chain": 55, "chain_name": "J", "nt_resnum": 55, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/55", "linked_nts": [ "///J/54", "///J/56" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.118, "beta": 134.852, "gamma": 45.108, "delta": 139.239, "epsilon": -162.734, "zeta": -134.566, "epsilon_zeta": -28.168, "bb_type": "--", "chi": -117.435, "glyco_bond": "anti", "C5prime_xyz": [ -2.288, 8.566, -1.420 ], "P_xyz": [ 0.289, 8.972, -1.212 ], "form": "B", "ssZp": 2.307, "Dp": 2.266, "splay_angle": 20.301, "splay_distance": 3.317, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 159.170, "theta": -144.696, "eta_prime": -174.891, "theta_prime": -165.322, "eta_base": -116.390, "theta_base": -127.897, "v0": -28.025, "v1": 38.911, "v2": -34.335, "v3": 19.073, "v4": 5.374, "amplitude": 38.447, "phase_angle": 153.262, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.295, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 166.019, 185.855, 125.661 ], "x_axis": [ 0.874, -0.470, -0.120 ], "y_axis": [ 0.009, -0.230, 0.973 ], "z_axis": [ -0.485, -0.852, -0.197 ], "quaternion": [ 0.602, 0.758, -0.152, -0.199 ] } }, { "index": 253, "index_chain": 56, "chain_name": "J", "nt_resnum": 56, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/56", "linked_nts": [ "///J/55", "///J/57" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.961, "beta": 158.337, "gamma": 45.622, "delta": 135.366, "epsilon": -163.682, "zeta": -112.616, "epsilon_zeta": -51.066, "bb_type": "BI", "chi": -129.123, "glyco_bond": "anti", "C5prime_xyz": [ -1.901, 8.666, -0.876 ], "P_xyz": [ 0.549, 9.274, -0.181 ], "form": "B", "ssZp": 2.339, "Dp": 2.309, "splay_angle": 19.915, "splay_distance": 3.327, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 168.557, "theta": -137.120, "eta_prime": -172.044, "theta_prime": -149.290, "eta_base": -125.780, "theta_base": -120.320, "v0": -24.261, "v1": 33.228, "v2": -29.183, "v3": 15.983, "v4": 4.972, "amplitude": 32.859, "phase_angle": 152.639, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 164.033, 183.364, 124.737 ], "x_axis": [ 0.744, -0.466, 0.479 ], "y_axis": [ -0.464, 0.157, 0.872 ], "z_axis": [ -0.482, -0.871, -0.099 ], "quaternion": [ 0.671, 0.649, -0.358, -0.001 ] } }, { "index": 254, "index_chain": 57, "chain_name": "J", "nt_resnum": 57, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/57", "linked_nts": [ "///J/56", "///J/58" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.346, "beta": 177.000, "gamma": 28.798, "delta": 148.444, "epsilon": -161.685, "zeta": -113.755, "epsilon_zeta": -47.929, "bb_type": "BI", "chi": -111.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.810, 8.390, -1.530 ], "P_xyz": [ 0.295, 9.661, -0.659 ], "form": "B", "ssZp": 1.702, "Dp": 1.812, "splay_angle": 18.479, "splay_distance": 3.149, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 168.825, "theta": -135.273, "eta_prime": -166.532, "theta_prime": -147.422, "eta_base": -129.008, "theta_base": -112.390, "v0": -18.047, "v1": 34.895, "v2": -37.582, "v3": 28.224, "v4": -6.687, "amplitude": 38.036, "phase_angle": 171.139, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 162.560, 180.596, 123.623 ], "x_axis": [ 0.418, -0.205, 0.885 ], "y_axis": [ -0.786, 0.406, 0.466 ], "z_axis": [ -0.455, -0.890, 0.009 ], "quaternion": [ 0.677, 0.501, -0.495, 0.215 ] } }, { "index": 255, "index_chain": 58, "chain_name": "J", "nt_resnum": 58, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/58", "linked_nts": [ "///J/57", "///J/59" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.169, "beta": -175.610, "gamma": 1.261, "delta": 148.539, "epsilon": 179.563, "zeta": -104.933, "epsilon_zeta": -75.504, "bb_type": "BI", "chi": -101.471, "glyco_bond": "anti", "C5prime_xyz": [ -1.725, 7.990, -1.961 ], "P_xyz": [ 0.107, 9.793, -1.507 ], "form": ".", "ssZp": 1.918, "Dp": 2.001, "splay_angle": 15.700, "splay_distance": 2.715, "splay_ratio": 0.139, "d22": null, "d64": null, "eta": 158.687, "theta": -149.725, "eta_prime": -178.453, "theta_prime": -157.062, "eta_base": -134.761, "theta_base": -126.402, "v0": -11.049, "v1": 28.668, "v2": -34.407, "v3": 28.889, "v4": -11.477, "amplitude": 34.408, "phase_angle": 180.351, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 161.458, 177.649, 123.490 ], "x_axis": [ -0.017, 0.211, 0.977 ], "y_axis": [ -0.889, 0.444, -0.111 ], "z_axis": [ -0.457, -0.871, 0.180 ], "quaternion": [ 0.634, 0.300, -0.566, 0.434 ] } }, { "index": 256, "index_chain": 59, "chain_name": "J", "nt_resnum": 59, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/59", "linked_nts": [ "///J/58", "///J/60" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.636, "beta": 179.821, "gamma": 30.621, "delta": 143.708, "epsilon": -167.454, "zeta": -134.810, "epsilon_zeta": -32.644, "bb_type": "--", "chi": -98.160, "glyco_bond": "anti", "C5prime_xyz": [ -2.512, 8.149, -2.166 ], "P_xyz": [ -0.469, 9.772, -2.181 ], "form": "B", "ssZp": 2.177, "Dp": 2.181, "splay_angle": 18.322, "splay_distance": 3.052, "splay_ratio": 0.159, "d22": 4.379, "d64": 3.637, "eta": 165.388, "theta": -160.454, "eta_prime": -172.225, "theta_prime": -168.354, "eta_base": -136.445, "theta_base": -133.730, "v0": -26.795, "v1": 40.405, "v2": -37.809, "v3": 23.311, "v4": 1.871, "amplitude": 40.627, "phase_angle": 158.533, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 160.891, 175.075, 124.140 ], "x_axis": [ -0.429, 0.411, 0.805 ], "y_axis": [ -0.835, 0.159, -0.526 ], "z_axis": [ -0.345, -0.898, 0.275 ], "quaternion": [ 0.501, 0.185, -0.573, 0.621 ] } }, { "index": 257, "index_chain": 60, "chain_name": "J", "nt_resnum": 60, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/60", "linked_nts": [ "///J/59", "///J/61" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.518, "beta": 160.917, "gamma": 39.280, "delta": 138.496, "epsilon": -159.330, "zeta": -117.798, "epsilon_zeta": -41.532, "bb_type": "BI", "chi": -106.541, "glyco_bond": "anti", "C5prime_xyz": [ -2.372, 8.281, -1.948 ], "P_xyz": [ -0.016, 9.392, -1.889 ], "form": "B", "ssZp": 2.017, "Dp": 2.099, "splay_angle": 25.759, "splay_distance": 4.241, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 174.542, "theta": -141.050, "eta_prime": -167.805, "theta_prime": -148.819, "eta_base": -130.920, "theta_base": -102.257, "v0": -26.847, "v1": 37.731, "v2": -33.814, "v3": 19.303, "v4": 4.478, "amplitude": 37.479, "phase_angle": 154.448, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 160.118, 172.270, 125.061 ], "x_axis": [ -0.779, 0.482, 0.401 ], "y_axis": [ -0.532, -0.170, -0.829 ], "z_axis": [ -0.332, -0.859, 0.389 ], "quaternion": [ 0.332, 0.023, -0.552, 0.765 ] } }, { "index": 258, "index_chain": 61, "chain_name": "J", "nt_resnum": 61, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/61", "linked_nts": [ "///J/60", "///J/62" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.282, "beta": 177.300, "gamma": 34.298, "delta": 145.148, "epsilon": -160.742, "zeta": -124.099, "epsilon_zeta": -36.643, "bb_type": "BI", "chi": -86.592, "glyco_bond": "anti", "C5prime_xyz": [ -2.141, 7.520, -2.613 ], "P_xyz": [ 0.233, 8.590, -2.775 ], "form": "B", "ssZp": 1.370, "Dp": 1.889, "splay_angle": 21.995, "splay_distance": 3.768, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 176.963, "theta": -138.408, "eta_prime": -158.845, "theta_prime": -149.228, "eta_base": -111.735, "theta_base": -112.131, "v0": -13.045, "v1": 28.792, "v2": -32.789, "v3": 26.117, "v4": -8.488, "amplitude": 32.874, "phase_angle": 175.901, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 157.475, 169.006, 125.653 ], "x_axis": [ -0.893, 0.319, -0.318 ], "y_axis": [ 0.106, -0.538, -0.836 ], "z_axis": [ -0.438, -0.780, 0.447 ], "quaternion": [ 0.063, -0.223, -0.477, 0.848 ] } }, { "index": 259, "index_chain": 62, "chain_name": "J", "nt_resnum": 62, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/62", "linked_nts": [ "///J/61", "///J/63" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -31.753, "beta": 150.664, "gamma": 35.302, "delta": 136.290, "epsilon": -90.483, "zeta": 157.731, "epsilon_zeta": 111.787, "bb_type": "BII", "chi": -85.340, "glyco_bond": "anti", "C5prime_xyz": [ -3.479, 7.610, -2.507 ], "P_xyz": [ -1.412, 8.833, -3.508 ], "form": ".", "ssZp": 1.016, "Dp": 0.993, "splay_angle": 24.356, "splay_distance": 4.188, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": -163.664, "theta": -176.200, "eta_prime": -144.542, "theta_prime": -176.828, "eta_base": -112.280, "theta_base": -116.649, "v0": -35.810, "v1": 44.146, "v2": -35.008, "v3": 15.627, "v4": 12.241, "amplitude": 42.948, "phase_angle": 144.600, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 155.481, 165.843, 126.120 ], "x_axis": [ -0.749, -0.005, -0.663 ], "y_axis": [ 0.451, -0.736, -0.505 ], "z_axis": [ -0.485, -0.677, 0.553 ], "quaternion": [ -0.131, -0.329, -0.339, 0.872 ] } }, { "index": 260, "index_chain": 63, "chain_name": "J", "nt_resnum": 63, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/63", "linked_nts": [ "///J/62", "///J/64" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -48.752, "beta": 115.946, "gamma": 33.570, "delta": 136.372, "epsilon": -117.445, "zeta": 171.672, "epsilon_zeta": 70.884, "bb_type": "BII", "chi": -95.809, "glyco_bond": "anti", "C5prime_xyz": [ -3.294, 7.975, -2.222 ], "P_xyz": [ -0.823, 8.753, -2.504 ], "form": ".", "ssZp": 1.684, "Dp": 1.632, "splay_angle": 23.886, "splay_distance": 4.100, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -179.711, "theta": -172.207, "eta_prime": -156.312, "theta_prime": 176.914, "eta_base": -102.953, "theta_base": -125.992, "v0": -37.042, "v1": 45.658, "v2": -36.164, "v3": 16.033, "v4": 12.769, "amplitude": 44.429, "phase_angle": 144.484, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.024, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 154.392, 161.897, 127.003 ], "x_axis": [ -0.321, -0.529, -0.785 ], "y_axis": [ 0.833, -0.552, 0.032 ], "z_axis": [ -0.450, -0.644, 0.618 ], "quaternion": [ -0.432, -0.391, -0.194, 0.789 ] } }, { "index": 261, "index_chain": 64, "chain_name": "J", "nt_resnum": 64, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/64", "linked_nts": [ "///J/63", "///J/65" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.700, "beta": 127.578, "gamma": 45.064, "delta": 140.843, "epsilon": -162.609, "zeta": -122.952, "epsilon_zeta": -39.657, "bb_type": "BI", "chi": -116.172, "glyco_bond": "anti", "C5prime_xyz": [ -2.097, 8.552, -1.454 ], "P_xyz": [ 0.512, 8.579, -1.219 ], "form": "B", "ssZp": 2.272, "Dp": 2.215, "splay_angle": 19.457, "splay_distance": 3.207, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 163.366, "theta": -131.818, "eta_prime": -168.538, "theta_prime": -156.752, "eta_base": -111.866, "theta_base": -110.674, "v0": -25.033, "v1": 37.204, "v2": -34.543, "v3": 20.818, "v4": 2.450, "amplitude": 37.368, "phase_angle": 157.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.241, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 154.038, 158.989, 129.872 ], "x_axis": [ 0.285, -0.787, -0.547 ], "y_axis": [ 0.885, -0.003, 0.466 ], "z_axis": [ -0.368, -0.617, 0.695 ], "quaternion": [ 0.703, 0.385, 0.064, -0.594 ] } }, { "index": 262, "index_chain": 65, "chain_name": "J", "nt_resnum": 65, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/65", "linked_nts": [ "///J/64", "///J/66" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -63.492, "beta": 157.866, "gamma": 58.830, "delta": 138.956, "epsilon": -156.301, "zeta": -136.601, "epsilon_zeta": -19.700, "bb_type": "--", "chi": -124.202, "glyco_bond": "anti", "C5prime_xyz": [ -2.065, 8.611, -1.084 ], "P_xyz": [ 0.480, 9.144, -0.976 ], "form": "B", "ssZp": 2.356, "Dp": 2.250, "splay_angle": 21.888, "splay_distance": 3.619, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.438, "theta": -149.256, "eta_prime": -167.842, "theta_prime": -166.045, "eta_base": -111.688, "theta_base": -132.007, "v0": -25.869, "v1": 36.595, "v2": -32.653, "v3": 18.609, "v4": 4.379, "amplitude": 36.219, "phase_angle": 154.361, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 153.254, 156.867, 132.145 ], "x_axis": [ 0.789, -0.601, -0.126 ], "y_axis": [ 0.493, 0.498, 0.714 ], "z_axis": [ -0.366, -0.626, 0.689 ], "quaternion": [ 0.863, 0.388, -0.070, -0.317 ] } }, { "index": 263, "index_chain": 66, "chain_name": "J", "nt_resnum": 66, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/66", "linked_nts": [ "///J/65", "///J/67" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.433, "beta": 153.126, "gamma": 42.154, "delta": 128.398, "epsilon": -170.186, "zeta": -94.126, "epsilon_zeta": -76.059, "bb_type": "BI", "chi": -135.826, "glyco_bond": "anti", "C5prime_xyz": [ -1.836, 8.840, -0.641 ], "P_xyz": [ 0.570, 9.434, 0.202 ], "form": ".", "ssZp": 2.368, "Dp": 2.399, "splay_angle": 18.384, "splay_distance": 3.243, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 168.478, "theta": -130.922, "eta_prime": -171.790, "theta_prime": -143.977, "eta_base": -128.860, "theta_base": -118.345, "v0": -24.850, "v1": 29.999, "v2": -23.783, "v3": 10.111, "v4": 9.119, "amplitude": 29.527, "phase_angle": 143.654, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 151.039, 154.873, 134.198 ], "x_axis": [ 0.946, -0.209, 0.249 ], "y_axis": [ 0.033, 0.823, 0.567 ], "z_axis": [ -0.324, -0.528, 0.785 ], "quaternion": [ 0.943, 0.290, -0.152, -0.064 ] } }, { "index": 264, "index_chain": 67, "chain_name": "J", "nt_resnum": 67, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/67", "linked_nts": [ "///J/66", "///J/68" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.677, "beta": -178.339, "gamma": 28.618, "delta": 143.821, "epsilon": -157.309, "zeta": -130.020, "epsilon_zeta": -27.289, "bb_type": "--", "chi": -113.299, "glyco_bond": "anti", "C5prime_xyz": [ -2.327, 8.476, -1.565 ], "P_xyz": [ -0.502, 10.215, -0.883 ], "form": "B", "ssZp": 1.961, "Dp": 2.017, "splay_angle": 17.588, "splay_distance": 2.880, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 168.779, "theta": -157.918, "eta_prime": -165.392, "theta_prime": -161.397, "eta_base": -129.253, "theta_base": -119.235, "v0": -27.976, "v1": 41.386, "v2": -38.245, "v3": 23.246, "v4": 2.640, "amplitude": 41.397, "phase_angle": 157.500, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 149.995, 152.283, 135.849 ], "x_axis": [ 0.839, 0.223, 0.497 ], "y_axis": [ -0.445, 0.806, 0.390 ], "z_axis": [ -0.314, -0.548, 0.776 ], "quaternion": [ 0.925, 0.253, -0.219, 0.180 ] } }, { "index": 265, "index_chain": 68, "chain_name": "J", "nt_resnum": 68, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/68", "linked_nts": [ "///J/67", "///J/69" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.493, "beta": 174.178, "gamma": 31.154, "delta": 145.816, "epsilon": 178.208, "zeta": -95.076, "epsilon_zeta": -86.716, "bb_type": "BI", "chi": -109.001, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.203, -1.665 ], "P_xyz": [ 0.685, 9.183, -1.034 ], "form": "B", "ssZp": 1.924, "Dp": 1.976, "splay_angle": 18.678, "splay_distance": 3.163, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 159.554, "theta": -135.404, "eta_prime": -177.036, "theta_prime": -152.457, "eta_base": -128.754, "theta_base": -120.203, "v0": -11.543, "v1": 28.215, "v2": -33.138, "v3": 27.436, "v4": -10.254, "amplitude": 33.145, "phase_angle": 178.839, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 148.923, 150.583, 137.911 ], "x_axis": [ 0.407, 0.758, 0.509 ], "y_axis": [ -0.883, 0.470, 0.006 ], "z_axis": [ -0.235, -0.452, 0.861 ], "quaternion": [ 0.827, 0.138, -0.225, 0.496 ] } }, { "index": 266, "index_chain": 69, "chain_name": "J", "nt_resnum": 69, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/69", "linked_nts": [ "///J/68", "///J/70" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.495, "beta": -154.261, "gamma": 6.252, "delta": 152.963, "epsilon": -177.360, "zeta": -110.714, "epsilon_zeta": -66.646, "bb_type": "BI", "chi": -100.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 7.851, -1.924 ], "P_xyz": [ 0.142, 9.774, -1.359 ], "form": "B", "ssZp": 1.647, "Dp": 1.798, "splay_angle": 16.769, "splay_distance": 2.844, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 172.626, "theta": -152.060, "eta_prime": -167.970, "theta_prime": -158.636, "eta_base": -128.934, "theta_base": -128.528, "v0": -4.502, "v1": 24.830, "v2": -34.508, "v3": 32.833, "v4": -18.141, "amplitude": 35.217, "phase_angle": 191.518, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 148.758, 148.858, 140.557 ], "x_axis": [ -0.114, 0.926, 0.359 ], "y_axis": [ -0.967, -0.022, -0.252 ], "z_axis": [ -0.226, -0.376, 0.899 ], "quaternion": [ 0.664, 0.047, -0.220, 0.713 ] } }, { "index": 267, "index_chain": 70, "chain_name": "J", "nt_resnum": 70, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/70", "linked_nts": [ "///J/69", "///J/71" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -14.733, "beta": -169.640, "gamma": -4.704, "delta": 154.140, "epsilon": -169.275, "zeta": -126.958, "epsilon_zeta": -42.317, "bb_type": "BI", "chi": -88.983, "glyco_bond": "anti", "C5prime_xyz": [ -1.781, 7.575, -2.396 ], "P_xyz": [ -0.042, 9.517, -2.408 ], "form": "B", "ssZp": 1.368, "Dp": 1.687, "splay_angle": 19.055, "splay_distance": 3.223, "splay_ratio": 0.169, "d22": 4.798, "d64": 3.522, "eta": 174.945, "theta": -152.162, "eta_prime": -166.735, "theta_prime": -159.056, "eta_base": -134.900, "theta_base": -114.183, "v0": -6.613, "v1": 27.395, "v2": -36.696, "v3": 33.797, "v4": -17.446, "amplitude": 37.121, "phase_angle": 188.677, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 148.667, 147.481, 143.043 ], "x_axis": [ -0.577, 0.793, 0.195 ], "y_axis": [ -0.808, -0.521, -0.274 ], "z_axis": [ -0.116, -0.316, 0.942 ], "quaternion": [ 0.459, 0.023, -0.169, 0.872 ] } }, { "index": 268, "index_chain": 71, "chain_name": "J", "nt_resnum": 71, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/71", "linked_nts": [ "///J/70", "///J/72" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 22.143, "beta": -171.978, "gamma": -39.126, "delta": 165.732, "epsilon": -165.168, "zeta": -115.315, "epsilon_zeta": -49.853, "bb_type": "BI", "chi": -78.071, "glyco_bond": "--", "C5prime_xyz": [ -1.423, 6.936, -2.517 ], "P_xyz": [ 0.379, 8.619, -3.338 ], "form": ".", "ssZp": 0.702, "Dp": 1.471, "splay_angle": 25.365, "splay_distance": 4.346, "splay_ratio": 0.225, "d22": 4.670, "d64": 3.713, "eta": -176.788, "theta": -146.154, "eta_prime": -159.315, "theta_prime": -147.941, "eta_base": -117.532, "theta_base": -93.310, "v0": 8.871, "v1": 17.523, "v2": -35.738, "v3": 41.881, "v4": -32.285, "amplitude": 41.597, "phase_angle": 210.779, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ 147.509, 146.130, 145.731 ], "x_axis": [ -0.942, 0.330, -0.054 ], "y_axis": [ -0.318, -0.935, -0.159 ], "z_axis": [ -0.103, -0.132, 0.986 ], "quaternion": [ 0.165, -0.040, -0.074, 0.983 ] } }, { "index": 269, "index_chain": 72, "chain_name": "J", "nt_resnum": 72, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/72", "linked_nts": [ "///J/71", "///J/73" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -38.860, "beta": 151.485, "gamma": 42.123, "delta": 142.364, "epsilon": -95.887, "zeta": 169.296, "epsilon_zeta": 94.817, "bb_type": "BII", "chi": -78.241, "glyco_bond": "anti", "C5prime_xyz": [ -3.281, 7.480, -2.686 ], "P_xyz": [ -1.036, 8.258, -3.786 ], "form": ".", "ssZp": 0.894, "Dp": 0.946, "splay_angle": 23.608, "splay_distance": 4.111, "splay_ratio": 0.214, "d22": 4.933, "d64": 3.757, "eta": -169.504, "theta": -171.956, "eta_prime": -139.872, "theta_prime": -177.104, "eta_base": -95.140, "theta_base": -126.740, "v0": -30.549, "v1": 42.790, "v2": -37.908, "v3": 21.439, "v4": 5.378, "amplitude": 42.229, "phase_angle": 153.852, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 145.156, 143.689, 148.449 ], "x_axis": [ -0.940, -0.311, -0.143 ], "y_axis": [ 0.307, -0.950, 0.052 ], "z_axis": [ -0.152, 0.005, 0.988 ], "quaternion": [ -0.157, -0.075, 0.014, 0.985 ] } }, { "index": 270, "index_chain": 73, "chain_name": "J", "nt_resnum": 73, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/73", "linked_nts": [ "///J/72", "///J/74" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -56.672, "beta": 128.363, "gamma": 32.896, "delta": 146.181, "epsilon": -85.559, "zeta": 171.252, "epsilon_zeta": 103.189, "bb_type": "BII", "chi": -86.961, "glyco_bond": "anti", "C5prime_xyz": [ -3.107, 7.802, -2.439 ], "P_xyz": [ -0.632, 8.529, -2.880 ], "form": ".", "ssZp": 0.912, "Dp": 0.845, "splay_angle": 26.559, "splay_distance": 4.478, "splay_ratio": 0.231, "d22": 4.710, "d64": 3.879, "eta": -173.148, "theta": -144.421, "eta_prime": -151.102, "theta_prime": -156.453, "eta_base": -111.587, "theta_base": -99.456, "v0": -32.017, "v1": 45.675, "v2": -40.838, "v3": 23.654, "v4": 4.896, "amplitude": 45.104, "phase_angle": 154.878, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.217, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 145.389, 142.060, 152.217 ], "x_axis": [ -0.594, -0.796, -0.117 ], "y_axis": [ 0.785, -0.605, 0.132 ], "z_axis": [ -0.176, -0.013, 0.984 ], "quaternion": [ -0.443, -0.082, 0.033, 0.892 ] } }, { "index": 271, "index_chain": 74, "chain_name": "J", "nt_resnum": 74, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/74", "linked_nts": [ "///J/73", "///J/75" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -44.335, "beta": 119.176, "gamma": 23.033, "delta": 139.482, "epsilon": -109.675, "zeta": 167.230, "epsilon_zeta": 83.096, "bb_type": "BII", "chi": -84.378, "glyco_bond": "anti", "C5prime_xyz": [ -3.622, 7.661, -2.461 ], "P_xyz": [ -1.340, 8.805, -3.030 ], "form": "B", "ssZp": 1.583, "Dp": 1.507, "splay_angle": 21.666, "splay_distance": 3.726, "splay_ratio": 0.188, "d22": 4.630, "d64": 4.050, "eta": 176.051, "theta": -170.981, "eta_prime": -157.171, "theta_prime": 173.410, "eta_base": -106.375, "theta_base": -146.849, "v0": -37.980, "v1": 48.150, "v2": -38.963, "v3": 18.362, "v4": 11.816, "amplitude": 46.763, "phase_angle": 146.429, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 145.873, 140.031, 156.179 ], "x_axis": [ 0.065, -0.998, -0.014 ], "y_axis": [ 0.981, 0.061, 0.186 ], "z_axis": [ -0.185, -0.026, 0.982 ], "quaternion": [ 0.726, 0.073, -0.059, -0.681 ] } }, { "index": 272, "index_chain": 75, "chain_name": "J", "nt_resnum": 75, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/75", "linked_nts": [ "///J/74", "///J/76" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.402, "beta": 127.075, "gamma": 36.768, "delta": 107.241, "epsilon": 176.055, "zeta": -91.619, "epsilon_zeta": -92.326, "bb_type": "BI", "chi": -125.165, "glyco_bond": "anti", "C5prime_xyz": [ -2.798, 8.602, -1.584 ], "P_xyz": [ -0.376, 9.588, -1.665 ], "form": "B", "ssZp": 2.765, "Dp": 2.786, "splay_angle": 20.186, "splay_distance": 3.459, "splay_ratio": 0.177, "d22": 4.022, "d64": 3.754, "eta": 167.298, "theta": -149.436, "eta_prime": 179.098, "theta_prime": -160.859, "eta_base": -139.218, "theta_base": -119.875, "v0": -38.234, "v1": 29.136, "v2": -10.161, "v3": -11.347, "v4": 31.188, "amplitude": 37.127, "phase_angle": 105.884, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "4a", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 145.151, 140.648, 159.781 ], "x_axis": [ 0.530, -0.841, 0.111 ], "y_axis": [ 0.832, 0.541, 0.128 ], "z_axis": [ -0.168, 0.025, 0.986 ], "quaternion": [ 0.874, 0.030, -0.080, -0.478 ] } }, { "index": 273, "index_chain": 76, "chain_name": "J", "nt_resnum": 76, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/76", "linked_nts": [ "///J/75", "///J/77" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.685, "beta": 172.739, "gamma": 51.770, "delta": 127.128, "epsilon": -166.905, "zeta": -97.221, "epsilon_zeta": -69.684, "bb_type": "BI", "chi": -126.278, "glyco_bond": "anti", "C5prime_xyz": [ -2.275, 8.713, -1.212 ], "P_xyz": [ -0.021, 9.977, -0.846 ], "form": ".", "ssZp": 2.406, "Dp": 2.407, "splay_angle": 17.079, "splay_distance": 3.073, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 177.189, "theta": -139.109, "eta_prime": -160.942, "theta_prime": -152.338, "eta_base": -112.501, "theta_base": -113.686, "v0": -32.024, "v1": 35.819, "v2": -26.114, "v3": 8.452, "v4": 14.618, "amplitude": 35.500, "phase_angle": 137.360, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 144.776, 139.738, 163.097 ], "x_axis": [ 0.920, -0.372, 0.122 ], "y_axis": [ 0.366, 0.928, 0.069 ], "z_axis": [ -0.139, -0.019, 0.990 ], "quaternion": [ 0.980, 0.023, -0.067, -0.188 ] } }, { "index": 274, "index_chain": 77, "chain_name": "J", "nt_resnum": 77, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/77", "linked_nts": [ "///J/76", "///J/78" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.363, "beta": 166.521, "gamma": 50.204, "delta": 107.209, "epsilon": -178.661, "zeta": -88.151, "epsilon_zeta": -90.510, "bb_type": "BI", "chi": -137.933, "glyco_bond": "anti", "C5prime_xyz": [ -2.526, 8.868, -0.991 ], "P_xyz": [ -0.395, 10.352, -0.768 ], "form": ".", "ssZp": 2.822, "Dp": 2.822, "splay_angle": 18.806, "splay_distance": 3.364, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 160.640, "theta": -155.529, "eta_prime": -179.377, "theta_prime": -160.411, "eta_base": -129.428, "theta_base": -130.696, "v0": -36.665, "v1": 27.442, "v2": -9.021, "v3": -11.644, "v4": 30.403, "amplitude": 35.652, "phase_angle": 104.657, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 144.778, 138.625, 165.962 ], "x_axis": [ 0.978, 0.210, 0.011 ], "y_axis": [ -0.211, 0.977, 0.015 ], "z_axis": [ -0.008, -0.017, 1.000 ], "quaternion": [ 0.994, 0.008, -0.005, 0.106 ] } }, { "index": 275, "index_chain": 78, "chain_name": "J", "nt_resnum": 78, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/78", "linked_nts": [ "///J/77", "///J/79" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.981, "beta": 179.774, "gamma": 38.971, "delta": 127.762, "epsilon": -165.898, "zeta": -97.810, "epsilon_zeta": -68.089, "bb_type": "BI", "chi": -130.917, "glyco_bond": "anti", "C5prime_xyz": [ -2.221, 8.817, -1.014 ], "P_xyz": [ -0.353, 10.382, -0.088 ], "form": ".", "ssZp": 2.189, "Dp": 2.285, "splay_angle": 18.743, "splay_distance": 3.269, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 173.542, "theta": -145.393, "eta_prime": -167.000, "theta_prime": -149.315, "eta_base": -129.954, "theta_base": -119.215, "v0": -32.464, "v1": 36.723, "v2": -27.235, "v3": 9.391, "v4": 14.259, "amplitude": 36.342, "phase_angle": 138.539, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 145.293, 137.274, 168.999 ], "x_axis": [ 0.741, 0.661, -0.117 ], "y_axis": [ -0.667, 0.745, -0.011 ], "z_axis": [ 0.080, 0.086, 0.993 ], "quaternion": [ 0.933, -0.026, 0.053, 0.356 ] } }, { "index": 276, "index_chain": 79, "chain_name": "J", "nt_resnum": 79, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/79", "linked_nts": [ "///J/78", "///J/80" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.804, "beta": -162.239, "gamma": 4.246, "delta": 153.149, "epsilon": -161.099, "zeta": -127.354, "epsilon_zeta": -33.745, "bb_type": "BI", "chi": -102.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.118, -1.860 ], "P_xyz": [ -0.070, 10.083, -1.307 ], "form": "B", "ssZp": 1.735, "Dp": 1.802, "splay_angle": 16.371, "splay_distance": 2.780, "splay_ratio": 0.142, "d22": null, "d64": null, "eta": 167.722, "theta": -155.613, "eta_prime": -172.172, "theta_prime": -158.893, "eta_base": -135.798, "theta_base": -125.961, "v0": -13.544, "v1": 32.738, "v2": -38.372, "v3": 31.585, "v4": -11.585, "amplitude": 38.386, "phase_angle": 178.490, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 146.252, 136.791, 172.086 ], "x_axis": [ 0.245, 0.942, -0.228 ], "y_axis": [ -0.958, 0.271, 0.091 ], "z_axis": [ 0.147, 0.196, 0.970 ], "quaternion": [ 0.788, -0.033, 0.119, 0.603 ] } }, { "index": 277, "index_chain": 80, "chain_name": "J", "nt_resnum": 80, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/80", "linked_nts": [ "///J/79", "///J/81" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -41.098, "beta": 161.982, "gamma": 26.854, "delta": 137.887, "epsilon": -143.355, "zeta": -130.312, "epsilon_zeta": -13.043, "bb_type": "--", "chi": -105.123, "glyco_bond": "anti", "C5prime_xyz": [ -2.256, 8.263, -2.011 ], "P_xyz": [ 0.005, 9.558, -1.798 ], "form": "B", "ssZp": 1.738, "Dp": 1.946, "splay_angle": 17.181, "splay_distance": 3.019, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 170.298, "theta": -139.811, "eta_prime": -172.212, "theta_prime": -158.185, "eta_base": -136.472, "theta_base": -124.533, "v0": -24.884, "v1": 35.585, "v2": -32.359, "v3": 18.862, "v4": 3.542, "amplitude": 35.529, "phase_angle": 155.613, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 146.810, 136.950, 174.805 ], "x_axis": [ -0.278, 0.926, -0.255 ], "y_axis": [ -0.941, -0.209, 0.268 ], "z_axis": [ 0.195, 0.314, 0.929 ], "quaternion": [ 0.601, -0.019, 0.187, 0.777 ] } }, { "index": 278, "index_chain": 81, "chain_name": "J", "nt_resnum": 81, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/81", "linked_nts": [ "///J/80", "///J/82" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 41.412, "beta": -134.849, "gamma": -102.680, "delta": 166.686, "epsilon": -155.631, "zeta": -128.298, "epsilon_zeta": -27.332, "bb_type": "--", "chi": -115.146, "glyco_bond": "anti", "C5prime_xyz": [ -1.160, 8.104, -0.924 ], "P_xyz": [ 0.003, 9.784, -2.523 ], "form": "B", "ssZp": 1.280, "Dp": 1.383, "splay_angle": 17.608, "splay_distance": 2.967, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": -162.658, "theta": -169.401, "eta_prime": -159.283, "theta_prime": -158.944, "eta_base": -125.598, "theta_base": -116.792, "v0": -0.150, "v1": 26.330, "v2": -41.014, "v3": 42.081, "v4": -26.599, "amplitude": 43.245, "phase_angle": 198.485, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 147.538, 137.851, 177.592 ], "x_axis": [ -0.731, 0.667, -0.144 ], "y_axis": [ -0.643, -0.603, 0.473 ], "z_axis": [ 0.228, 0.438, 0.869 ], "quaternion": [ 0.366, 0.024, 0.255, 0.895 ] } }, { "index": 279, "index_chain": 82, "chain_name": "J", "nt_resnum": 82, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/82", "linked_nts": [ "///J/81", "///J/83" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 21.016, "beta": 150.850, "gamma": -32.380, "delta": 156.277, "epsilon": -139.096, "zeta": -86.912, "epsilon_zeta": -52.184, "bb_type": "BI", "chi": -71.700, "glyco_bond": "--", "C5prime_xyz": [ -2.322, 6.967, -2.903 ], "P_xyz": [ -0.639, 8.896, -3.430 ], "form": ".", "ssZp": 0.660, "Dp": 1.473, "splay_angle": 23.159, "splay_distance": 4.045, "splay_ratio": 0.206, "d22": 4.280, "d64": 3.444, "eta": 165.684, "theta": -138.531, "eta_prime": -166.126, "theta_prime": -154.803, "eta_base": -125.091, "theta_base": -95.871, "v0": -8.718, "v1": 30.086, "v2": -38.933, "v3": 34.757, "v4": -16.639, "amplitude": 39.147, "phase_angle": 185.999, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 147.956, 138.933, 180.323 ], "x_axis": [ -0.961, 0.225, 0.158 ], "y_axis": [ -0.077, -0.772, 0.631 ], "z_axis": [ 0.264, 0.594, 0.760 ], "quaternion": [ 0.081, 0.113, 0.328, 0.934 ] } }, { "index": 280, "index_chain": 83, "chain_name": "J", "nt_resnum": 83, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/83", "linked_nts": [ "///J/82", "///J/84" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -95.571, "beta": 59.817, "gamma": 160.368, "delta": 140.963, "epsilon": -130.365, "zeta": -118.626, "epsilon_zeta": -11.739, "bb_type": "--", "chi": -130.282, "glyco_bond": "anti", "C5prime_xyz": [ -1.582, 8.664, -0.675 ], "P_xyz": [ -1.399, 8.607, -3.293 ], "form": ".", "ssZp": 1.561, "Dp": 1.703, "splay_angle": 26.369, "splay_distance": 4.560, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": -117.501, "theta": 130.345, "eta_prime": -144.931, "theta_prime": 176.783, "eta_base": -93.289, "theta_base": -126.940, "v0": -17.928, "v1": 31.183, "v2": -32.032, "v3": 22.384, "v4": -3.068, "amplitude": 32.942, "phase_angle": 166.505, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 147.308, 139.038, 184.315 ], "x_axis": [ -0.814, -0.259, 0.520 ], "y_axis": [ 0.537, -0.677, 0.503 ], "z_axis": [ 0.222, 0.689, 0.690 ], "quaternion": [ -0.223, 0.208, 0.334, 0.892 ] } }, { "index": 281, "index_chain": 84, "chain_name": "J", "nt_resnum": 84, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/84", "linked_nts": [ "///J/83", "///J/85" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.635, "beta": 160.261, "gamma": 48.661, "delta": 142.267, "epsilon": -173.350, "zeta": -120.397, "epsilon_zeta": -52.953, "bb_type": "BI", "chi": -88.609, "glyco_bond": "--", "C5prime_xyz": [ -2.113, 7.576, -2.588 ], "P_xyz": [ 0.450, 7.831, -2.978 ], "form": "B", "ssZp": 1.657, "Dp": 2.076, "splay_angle": 20.021, "splay_distance": 3.406, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 155.370, "theta": -137.029, "eta_prime": -163.228, "theta_prime": -162.394, "eta_base": -113.382, "theta_base": -116.396, "v0": -14.023, "v1": 28.238, "v2": -30.967, "v3": 23.578, "v4": -6.271, "amplitude": 31.228, "phase_angle": 172.580, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 149.740, 140.456, 187.902 ], "x_axis": [ -0.176, -0.613, 0.771 ], "y_axis": [ 0.969, -0.246, 0.026 ], "z_axis": [ 0.174, 0.751, 0.637 ], "quaternion": [ 0.551, -0.329, -0.271, -0.717 ] } }, { "index": 282, "index_chain": 85, "chain_name": "J", "nt_resnum": 85, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/85", "linked_nts": [ "///J/84", "///J/86" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.408, "beta": 143.716, "gamma": 53.919, "delta": 123.334, "epsilon": -160.976, "zeta": -124.576, "epsilon_zeta": -36.399, "bb_type": "BI", "chi": -122.166, "glyco_bond": "anti", "C5prime_xyz": [ -2.639, 8.585, -1.511 ], "P_xyz": [ -0.230, 9.523, -1.791 ], "form": "B", "ssZp": 2.395, "Dp": 2.392, "splay_angle": 22.115, "splay_distance": 3.682, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 174.010, "theta": -153.373, "eta_prime": -161.759, "theta_prime": -163.766, "eta_base": -110.886, "theta_base": -119.921, "v0": -36.792, "v1": 38.200, "v2": -25.415, "v3": 5.001, "v4": 19.724, "amplitude": 38.674, "phase_angle": 131.084, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 150.832, 142.251, 190.582 ], "x_axis": [ 0.377, -0.676, 0.633 ], "y_axis": [ 0.911, 0.145, -0.387 ], "z_axis": [ 0.170, 0.723, 0.670 ], "quaternion": [ 0.740, -0.375, -0.156, -0.536 ] } }, { "index": 283, "index_chain": 86, "chain_name": "J", "nt_resnum": 86, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/86", "linked_nts": [ "///J/85", "///J/87" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -40.765, "beta": 155.879, "gamma": 41.749, "delta": 134.488, "epsilon": -168.976, "zeta": -120.708, "epsilon_zeta": -48.268, "bb_type": "BI", "chi": -120.599, "glyco_bond": "anti", "C5prime_xyz": [ -2.263, 8.564, -1.358 ], "P_xyz": [ 0.157, 9.499, -1.055 ], "form": "B", "ssZp": 2.472, "Dp": 2.391, "splay_angle": 20.753, "splay_distance": 3.478, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 167.541, "theta": -143.277, "eta_prime": -167.275, "theta_prime": -156.951, "eta_base": -116.920, "theta_base": -115.409, "v0": -29.213, "v1": 37.340, "v2": -30.886, "v3": 14.878, "v4": 8.728, "amplitude": 36.594, "phase_angle": 147.567, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 151.657, 144.675, 193.228 ], "x_axis": [ 0.853, -0.456, 0.254 ], "y_axis": [ 0.485, 0.512, -0.709 ], "z_axis": [ 0.193, 0.728, 0.658 ], "quaternion": [ 0.869, -0.413, -0.017, -0.271 ] } }, { "index": 284, "index_chain": 87, "chain_name": "J", "nt_resnum": 87, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/87", "linked_nts": [ "///J/86", "///J/88" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.376, "beta": 160.083, "gamma": 35.074, "delta": 132.285, "epsilon": -175.514, "zeta": -94.413, "epsilon_zeta": -81.101, "bb_type": "BI", "chi": -123.299, "glyco_bond": "anti", "C5prime_xyz": [ -2.186, 8.617, -1.249 ], "P_xyz": [ 0.070, 9.764, -0.615 ], "form": ".", "ssZp": 2.367, "Dp": 2.372, "splay_angle": 20.498, "splay_distance": 3.654, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 169.728, "theta": -133.961, "eta_prime": -166.135, "theta_prime": -145.631, "eta_base": -115.049, "theta_base": -108.323, "v0": -28.670, "v1": 35.785, "v2": -29.112, "v3": 13.414, "v4": 9.344, "amplitude": 35.106, "phase_angle": 146.022, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 152.549, 146.709, 195.904 ], "x_axis": [ 0.972, -0.064, -0.225 ], "y_axis": [ -0.128, 0.658, -0.742 ], "z_axis": [ 0.196, 0.750, 0.632 ], "quaternion": [ 0.903, -0.413, 0.116, 0.018 ] } }, { "index": 285, "index_chain": 88, "chain_name": "J", "nt_resnum": 88, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/88", "linked_nts": [ "///J/87", "///J/89" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.702, "beta": -177.783, "gamma": 34.400, "delta": 137.598, "epsilon": -157.177, "zeta": -124.439, "epsilon_zeta": -32.738, "bb_type": "BI", "chi": -114.583, "glyco_bond": "anti", "C5prime_xyz": [ -2.469, 8.545, -1.601 ], "P_xyz": [ -0.629, 10.302, -1.037 ], "form": "B", "ssZp": 2.083, "Dp": 2.136, "splay_angle": 17.735, "splay_distance": 3.043, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 172.277, "theta": -149.983, "eta_prime": -164.261, "theta_prime": -156.235, "eta_base": -118.132, "theta_base": -109.563, "v0": -31.432, "v1": 41.241, "v2": -34.922, "v3": 17.917, "v4": 8.110, "amplitude": 40.457, "phase_angle": 149.676, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 154.341, 148.636, 198.440 ], "x_axis": [ 0.713, 0.265, -0.649 ], "y_axis": [ -0.657, 0.576, -0.486 ], "z_axis": [ 0.245, 0.773, 0.584 ], "quaternion": [ 0.848, -0.372, 0.264, 0.272 ] } }, { "index": 286, "index_chain": 89, "chain_name": "J", "nt_resnum": 89, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/89", "linked_nts": [ "///J/88", "///J/90" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.916, "beta": 154.935, "gamma": 36.781, "delta": 121.783, "epsilon": -170.949, "zeta": -107.830, "epsilon_zeta": -63.119, "bb_type": "BI", "chi": -119.630, "glyco_bond": "anti", "C5prime_xyz": [ -2.510, 8.567, -1.627 ], "P_xyz": [ -0.270, 9.877, -1.426 ], "form": "B", "ssZp": 2.367, "Dp": 2.452, "splay_angle": 17.888, "splay_distance": 3.061, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 164.745, "theta": -152.738, "eta_prime": -174.685, "theta_prime": -159.878, "eta_base": -121.293, "theta_base": -130.283, "v0": -33.593, "v1": 33.932, "v2": -21.884, "v3": 3.345, "v4": 18.838, "amplitude": 34.735, "phase_angle": 129.052, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 155.666, 150.985, 199.849 ], "x_axis": [ 0.157, 0.499, -0.852 ], "y_axis": [ -0.939, 0.344, 0.029 ], "z_axis": [ 0.307, 0.795, 0.523 ], "quaternion": [ 0.711, -0.269, 0.407, 0.505 ] } }, { "index": 287, "index_chain": 90, "chain_name": "J", "nt_resnum": 90, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/90", "linked_nts": [ "///J/89", "///J/91" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -45.873, "beta": 175.824, "gamma": 32.843, "delta": 142.939, "epsilon": -152.108, "zeta": -140.315, "epsilon_zeta": -11.793, "bb_type": "--", "chi": -107.044, "glyco_bond": "anti", "C5prime_xyz": [ -2.246, 8.361, -1.842 ], "P_xyz": [ -0.115, 9.822, -1.518 ], "form": "B", "ssZp": 1.935, "Dp": 1.968, "splay_angle": 16.969, "splay_distance": 2.866, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 172.429, "theta": -160.450, "eta_prime": -168.190, "theta_prime": -166.090, "eta_base": -134.143, "theta_base": -129.866, "v0": -26.336, "v1": 39.391, "v2": -36.701, "v3": 22.542, "v4": 2.073, "amplitude": 39.537, "phase_angle": 158.165, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 157.195, 153.120, 201.422 ], "x_axis": [ -0.375, 0.513, -0.772 ], "y_axis": [ -0.860, 0.117, 0.496 ], "z_axis": [ 0.345, 0.850, 0.398 ], "quaternion": [ 0.534, -0.166, 0.523, 0.643 ] } }, { "index": 288, "index_chain": 91, "chain_name": "J", "nt_resnum": 91, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/91", "linked_nts": [ "///J/90", "///J/92" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.970, "beta": 153.999, "gamma": 44.105, "delta": 141.410, "epsilon": -158.884, "zeta": -114.632, "epsilon_zeta": -44.253, "bb_type": "BI", "chi": -111.126, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.402, -1.696 ], "P_xyz": [ 0.359, 9.124, -1.465 ], "form": "B", "ssZp": 1.977, "Dp": 2.034, "splay_angle": 19.127, "splay_distance": 3.211, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 163.980, "theta": -131.627, "eta_prime": -173.090, "theta_prime": -147.501, "eta_base": -133.133, "theta_base": -104.123, "v0": -23.911, "v1": 36.331, "v2": -34.396, "v3": 21.570, "v4": 1.183, "amplitude": 36.753, "phase_angle": 159.369, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 158.321, 155.186, 203.058 ], "x_axis": [ -0.807, 0.430, -0.406 ], "y_axis": [ -0.496, -0.120, 0.860 ], "z_axis": [ 0.320, 0.895, 0.310 ], "quaternion": [ 0.309, -0.028, 0.587, 0.748 ] } }, { "index": 289, "index_chain": 92, "chain_name": "J", "nt_resnum": 92, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/92", "linked_nts": [ "///J/91", "///J/93" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -58.210, "beta": 162.328, "gamma": 49.208, "delta": 142.197, "epsilon": -87.610, "zeta": 171.828, "epsilon_zeta": 100.561, "bb_type": "BII", "chi": -99.702, "glyco_bond": "anti", "C5prime_xyz": [ -2.808, 8.128, -2.115 ], "P_xyz": [ -0.499, 9.269, -2.498 ], "form": ".", "ssZp": 0.727, "Dp": 0.722, "splay_angle": 23.055, "splay_distance": 3.980, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -167.333, "theta": -166.600, "eta_prime": -146.501, "theta_prime": -165.663, "eta_base": -103.574, "theta_base": -108.214, "v0": -30.722, "v1": 42.831, "v2": -37.888, "v3": 21.297, "v4": 5.568, "amplitude": 42.290, "phase_angle": 153.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 158.611, 158.196, 204.138 ], "x_axis": [ -0.948, 0.264, 0.178 ], "y_axis": [ 0.120, -0.219, 0.968 ], "z_axis": [ 0.294, 0.939, 0.176 ], "quaternion": [ 0.047, 0.154, 0.623, 0.765 ] } }, { "index": 290, "index_chain": 93, "chain_name": "J", "nt_resnum": 93, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/93", "linked_nts": [ "///J/92", "///J/94" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -49.041, "beta": 132.860, "gamma": 22.084, "delta": 150.083, "epsilon": -83.810, "zeta": 165.506, "epsilon_zeta": 110.683, "bb_type": "BII", "chi": -76.748, "glyco_bond": "anti", "C5prime_xyz": [ -2.794, 7.300, -2.810 ], "P_xyz": [ -0.298, 8.050, -3.047 ], "form": ".", "ssZp": 0.202, "Dp": 0.374, "splay_angle": 24.228, "splay_distance": 4.150, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": -171.535, "theta": -152.234, "eta_prime": -147.581, "theta_prime": -164.324, "eta_base": -100.618, "theta_base": -108.004, "v0": -20.819, "v1": 38.006, "v2": -39.707, "v3": 28.874, "v4": -5.344, "amplitude": 40.504, "phase_angle": 168.615, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.049, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 160.397, 160.859, 206.496 ], "x_axis": [ -0.590, 0.144, 0.795 ], "y_axis": [ 0.739, -0.300, 0.603 ], "z_axis": [ 0.325, 0.943, 0.071 ], "quaternion": [ -0.213, 0.400, 0.552, 0.700 ] } }, { "index": 291, "index_chain": 94, "chain_name": "J", "nt_resnum": 94, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/94", "linked_nts": [ "///J/93", "///J/95" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.167, "beta": 120.733, "gamma": 28.282, "delta": 139.642, "epsilon": -94.232, "zeta": 153.498, "epsilon_zeta": 112.270, "bb_type": "BII", "chi": -81.648, "glyco_bond": "anti", "C5prime_xyz": [ -3.595, 7.506, -2.545 ], "P_xyz": [ -1.243, 8.436, -3.202 ], "form": "B", "ssZp": 1.163, "Dp": 1.097, "splay_angle": 24.234, "splay_distance": 4.125, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": -179.102, "theta": -175.505, "eta_prime": -155.795, "theta_prime": 173.041, "eta_base": -109.918, "theta_base": -126.752, "v0": -35.814, "v1": 45.846, "v2": -37.512, "v3": 18.151, "v4": 10.663, "amplitude": 44.587, "phase_angle": 147.281, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.035, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 163.148, 163.623, 207.916 ], "x_axis": [ -0.018, -0.005, 1.000 ], "y_axis": [ 0.940, -0.341, 0.016 ], "z_axis": [ 0.341, 0.940, 0.011 ], "quaternion": [ -0.404, 0.573, 0.408, 0.585 ] } }, { "index": 292, "index_chain": 95, "chain_name": "J", "nt_resnum": 95, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/95", "linked_nts": [ "///J/94", "///J/96" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -58.610, "beta": 129.917, "gamma": 35.057, "delta": 139.546, "epsilon": -159.169, "zeta": -142.058, "epsilon_zeta": -17.111, "bb_type": "--", "chi": -107.005, "glyco_bond": "anti", "C5prime_xyz": [ -2.517, 8.343, -1.888 ], "P_xyz": [ 0.017, 8.966, -1.727 ], "form": "B", "ssZp": 2.174, "Dp": 2.174, "splay_angle": 21.074, "splay_distance": 3.468, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 167.575, "theta": -149.802, "eta_prime": -168.294, "theta_prime": -166.919, "eta_base": -111.356, "theta_base": -125.536, "v0": -29.086, "v1": 40.330, "v2": -35.626, "v3": 19.861, "v4": 5.516, "amplitude": 39.867, "phase_angle": 153.331, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.234, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 165.777, 166.795, 207.710 ], "x_axis": [ 0.617, -0.177, 0.767 ], "y_axis": [ 0.685, -0.359, -0.634 ], "z_axis": [ 0.388, 0.916, -0.100 ], "quaternion": [ 0.538, -0.721, -0.176, -0.401 ] } }, { "index": 293, "index_chain": 96, "chain_name": "J", "nt_resnum": 96, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/96", "linked_nts": [ "///J/95", "///J/97" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -44.378, "beta": 155.365, "gamma": 44.217, "delta": 139.632, "epsilon": -171.634, "zeta": -95.712, "epsilon_zeta": -75.921, "bb_type": "BI", "chi": -115.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.912, 8.463, -1.469 ], "P_xyz": [ 0.603, 9.058, -1.095 ], "form": ".", "ssZp": 2.145, "Dp": 2.163, "splay_angle": 20.522, "splay_distance": 3.669, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 168.117, "theta": -120.153, "eta_prime": -168.622, "theta_prime": -139.593, "eta_base": -121.727, "theta_base": -103.383, "v0": -21.517, "v1": 33.686, "v2": -32.525, "v3": 20.988, "v4": 0.090, "amplitude": 34.382, "phase_angle": 161.083, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 167.069, 169.936, 207.011 ], "x_axis": [ 0.889, -0.395, 0.231 ], "y_axis": [ 0.164, -0.194, -0.967 ], "z_axis": [ 0.427, 0.898, -0.108 ], "quaternion": [ 0.630, -0.740, 0.078, -0.222 ] } }, { "index": 294, "index_chain": 97, "chain_name": "J", "nt_resnum": 97, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/97", "linked_nts": [ "///J/96", "///J/98" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -48.337, "beta": 172.810, "gamma": 33.887, "delta": 144.830, "epsilon": -111.976, "zeta": -176.619, "epsilon_zeta": 64.643, "bb_type": "BII", "chi": -107.834, "glyco_bond": "anti", "C5prime_xyz": [ -2.950, 8.413, -1.719 ], "P_xyz": [ -1.122, 10.266, -1.520 ], "form": "B", "ssZp": 1.534, "Dp": 1.543, "splay_angle": 19.057, "splay_distance": 3.224, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": -178.627, "theta": -167.204, "eta_prime": -152.014, "theta_prime": -171.285, "eta_base": -109.153, "theta_base": -127.032, "v0": -36.288, "v1": 48.821, "v2": -41.509, "v3": 22.033, "v4": 8.433, "amplitude": 47.569, "phase_angle": 150.762, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 169.543, 172.623, 207.354 ], "x_axis": [ 0.811, -0.491, -0.317 ], "y_axis": [ -0.331, 0.062, -0.942 ], "z_axis": [ 0.482, 0.869, -0.113 ], "quaternion": [ 0.663, -0.682, 0.301, -0.060 ] } }, { "index": 295, "index_chain": 98, "chain_name": "J", "nt_resnum": 98, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/98", "linked_nts": [ "///J/97", "///J/99" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.636, "beta": 134.460, "gamma": 24.857, "delta": 129.036, "epsilon": -165.736, "zeta": -116.066, "epsilon_zeta": -49.670, "bb_type": "BI", "chi": -117.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.538, 8.528, -1.639 ], "P_xyz": [ -0.266, 9.700, -1.119 ], "form": ".", "ssZp": 2.264, "Dp": 2.306, "splay_angle": 18.204, "splay_distance": 3.240, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 163.758, "theta": -142.042, "eta_prime": -178.275, "theta_prime": -156.504, "eta_base": -129.869, "theta_base": -120.825, "v0": -34.078, "v1": 39.214, "v2": -29.460, "v3": 10.678, "v4": 14.451, "amplitude": 38.663, "phase_angle": 139.637, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.031, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 170.866, 175.561, 207.480 ], "x_axis": [ 0.491, -0.350, -0.798 ], "y_axis": [ -0.757, 0.282, -0.589 ], "z_axis": [ 0.431, 0.893, -0.127 ], "quaternion": [ 0.641, -0.578, 0.479, 0.159 ] } }, { "index": 296, "index_chain": 99, "chain_name": "J", "nt_resnum": 99, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/99", "linked_nts": [ "///J/98", "///J/100" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.926, "beta": 160.782, "gamma": 32.769, "delta": 113.470, "epsilon": -178.485, "zeta": -95.235, "epsilon_zeta": -83.251, "bb_type": "BI", "chi": -128.052, "glyco_bond": "anti", "C5prime_xyz": [ -2.505, 8.716, -1.369 ], "P_xyz": [ -0.460, 10.277, -0.981 ], "form": "B", "ssZp": 2.583, "Dp": 2.642, "splay_angle": 17.282, "splay_distance": 2.978, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 167.318, "theta": -156.841, "eta_prime": -176.249, "theta_prime": -160.468, "eta_base": -131.409, "theta_base": -122.695, "v0": -35.245, "v1": 30.186, "v2": -14.611, "v3": -5.070, "v4": 25.299, "amplitude": 34.386, "phase_angle": 115.146, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 173.126, 177.867, 207.217 ], "x_axis": [ -0.025, -0.225, -0.974 ], "y_axis": [ -0.896, 0.436, -0.078 ], "z_axis": [ 0.442, 0.871, -0.213 ], "quaternion": [ 0.547, -0.434, 0.647, 0.307 ] } }, { "index": 297, "index_chain": 100, "chain_name": "J", "nt_resnum": 100, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/100", "linked_nts": [ "///J/99", "///J/101" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.438, "beta": 175.628, "gamma": 46.443, "delta": 135.757, "epsilon": -169.785, "zeta": -119.136, "epsilon_zeta": -50.649, "bb_type": "BI", "chi": -118.079, "glyco_bond": "anti", "C5prime_xyz": [ -2.240, 8.620, -1.478 ], "P_xyz": [ -0.054, 9.967, -1.053 ], "form": "B", "ssZp": 2.142, "Dp": 2.204, "splay_angle": 16.282, "splay_distance": 2.659, "splay_ratio": 0.142, "d22": null, "d64": null, "eta": 169.950, "theta": -156.866, "eta_prime": -165.538, "theta_prime": -164.344, "eta_base": -122.014, "theta_base": -125.469, "v0": -29.926, "v1": 39.004, "v2": -32.895, "v3": 16.641, "v4": 8.017, "amplitude": 38.289, "phase_angle": 149.219, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 174.998, 179.987, 206.284 ], "x_axis": [ -0.535, 0.011, -0.845 ], "y_axis": [ -0.700, 0.553, 0.451 ], "z_axis": [ 0.472, 0.833, -0.288 ], "quaternion": [ 0.427, -0.223, 0.771, 0.417 ] } }, { "index": 298, "index_chain": 101, "chain_name": "J", "nt_resnum": 101, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/101", "linked_nts": [ "///J/100", "///J/102" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -35.705, "beta": -167.637, "gamma": 14.858, "delta": 154.950, "epsilon": 179.028, "zeta": -95.583, "epsilon_zeta": -85.388, "bb_type": "BI", "chi": -101.056, "glyco_bond": "anti", "C5prime_xyz": [ -1.315, 7.796, -1.844 ], "P_xyz": [ 0.800, 9.111, -1.123 ], "form": "B", "ssZp": 1.574, "Dp": 1.745, "splay_angle": 17.297, "splay_distance": 2.917, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 170.553, "theta": -133.787, "eta_prime": -170.450, "theta_prime": -145.023, "eta_base": -127.633, "theta_base": -109.920, "v0": 1.681, "v1": 19.868, "v2": -32.367, "v3": 34.339, "v4": -22.962, "amplitude": 34.772, "phase_angle": 201.438, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 176.595, 182.041, 205.738 ], "x_axis": [ -0.891, 0.283, -0.354 ], "y_axis": [ -0.183, 0.491, 0.852 ], "z_axis": [ 0.415, 0.824, -0.385 ], "quaternion": [ 0.231, 0.030, 0.832, 0.504 ] } }, { "index": 299, "index_chain": 102, "chain_name": "J", "nt_resnum": 102, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/102", "linked_nts": [ "///J/101", "///J/103" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -68.557, "beta": -177.035, "gamma": 45.890, "delta": 146.738, "epsilon": -105.807, "zeta": -170.784, "epsilon_zeta": 64.978, "bb_type": "BII", "chi": -95.033, "glyco_bond": "anti", "C5prime_xyz": [ -2.513, 8.024, -2.275 ], "P_xyz": [ -0.275, 9.375, -2.407 ], "form": "B", "ssZp": 0.890, "Dp": 0.987, "splay_angle": 21.240, "splay_distance": 3.720, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": -178.256, "theta": -157.064, "eta_prime": -155.911, "theta_prime": -159.077, "eta_base": -119.995, "theta_base": -110.719, "v0": -25.948, "v1": 40.909, "v2": -39.427, "v3": 25.521, "v4": -0.051, "amplitude": 41.647, "phase_angle": 161.210, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 177.702, 184.501, 204.629 ], "x_axis": [ -0.887, 0.433, 0.163 ], "y_axis": [ 0.339, 0.367, 0.866 ], "z_axis": [ 0.315, 0.823, -0.472 ], "quaternion": [ 0.046, 0.234, 0.826, 0.512 ] } }, { "index": 300, "index_chain": 103, "chain_name": "J", "nt_resnum": 103, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/103", "linked_nts": [ "///J/102", "///J/104" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -48.829, "beta": 128.924, "gamma": 30.812, "delta": 142.937, "epsilon": -86.199, "zeta": 151.580, "epsilon_zeta": 122.221, "bb_type": "BII", "chi": -86.400, "glyco_bond": "anti", "C5prime_xyz": [ -3.023, 7.702, -2.568 ], "P_xyz": [ -0.548, 8.430, -2.980 ], "form": ".", "ssZp": 0.674, "Dp": 0.706, "splay_angle": 22.652, "splay_distance": 3.895, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": -176.301, "theta": -164.669, "eta_prime": -153.279, "theta_prime": -174.992, "eta_base": -111.721, "theta_base": -108.762, "v0": -30.004, "v1": 42.473, "v2": -37.976, "v3": 21.719, "v4": 4.893, "amplitude": 42.062, "phase_angle": 154.538, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.122, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 179.643, 187.663, 204.366 ], "x_axis": [ -0.528, 0.571, 0.628 ], "y_axis": [ 0.806, 0.102, 0.584 ], "z_axis": [ 0.269, 0.814, -0.514 ], "quaternion": [ -0.123, 0.470, 0.732, 0.477 ] } }, { "index": 301, "index_chain": 104, "chain_name": "J", "nt_resnum": 104, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/104", "linked_nts": [ "///J/103", "///J/105" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -46.216, "beta": 118.188, "gamma": 27.060, "delta": 138.510, "epsilon": -112.034, "zeta": 168.713, "epsilon_zeta": 79.253, "bb_type": "BII", "chi": -84.989, "glyco_bond": "anti", "C5prime_xyz": [ -3.473, 7.625, -2.490 ], "P_xyz": [ -1.074, 8.515, -3.001 ], "form": ".", "ssZp": 1.473, "Dp": 1.472, "splay_angle": 26.531, "splay_distance": 4.529, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": -176.461, "theta": -168.933, "eta_prime": -153.836, "theta_prime": -178.627, "eta_base": -96.076, "theta_base": -117.548, "v0": -35.641, "v1": 45.372, "v2": -36.949, "v3": 17.604, "v4": 10.914, "amplitude": 44.140, "phase_angle": 146.832, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.012, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 182.034, 190.672, 203.732 ], "x_axis": [ 0.209, 0.714, 0.669 ], "y_axis": [ 0.964, -0.266, -0.017 ], "z_axis": [ 0.166, 0.648, -0.743 ], "quaternion": [ -0.223, 0.745, 0.563, 0.280 ] } }, { "index": 302, "index_chain": 105, "chain_name": "J", "nt_resnum": 105, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/105", "linked_nts": [ "///J/104", "///J/106" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.163, "beta": 122.729, "gamma": 46.791, "delta": 135.781, "epsilon": -153.915, "zeta": -113.533, "epsilon_zeta": -40.382, "bb_type": "BI", "chi": -108.366, "glyco_bond": "anti", "C5prime_xyz": [ -2.392, 8.329, -1.901 ], "P_xyz": [ 0.214, 8.474, -1.970 ], "form": "B", "ssZp": 2.008, "Dp": 2.094, "splay_angle": 24.443, "splay_distance": 4.228, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 171.897, "theta": -119.093, "eta_prime": -160.387, "theta_prime": -143.483, "eta_base": -103.530, "theta_base": -103.526, "v0": -28.245, "v1": 37.594, "v2": -32.322, "v3": 16.889, "v4": 6.901, "amplitude": 37.067, "phase_angle": 150.688, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.139, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 184.809, 192.721, 200.796 ], "x_axis": [ 0.824, 0.332, 0.459 ], "y_axis": [ 0.533, -0.728, -0.431 ], "z_axis": [ 0.191, 0.600, -0.777 ], "quaternion": [ -0.282, 0.912, 0.237, 0.178 ] } }, { "index": 303, "index_chain": 106, "chain_name": "J", "nt_resnum": 106, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/106", "linked_nts": [ "///J/105", "///J/107" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -46.678, "beta": 153.013, "gamma": 48.100, "delta": 125.487, "epsilon": -161.053, "zeta": -151.138, "epsilon_zeta": -9.915, "bb_type": "--", "chi": -110.071, "glyco_bond": "anti", "C5prime_xyz": [ -3.184, 8.344, -1.879 ], "P_xyz": [ -1.081, 9.735, -2.503 ], "form": "B", "ssZp": 2.538, "Dp": 2.454, "splay_angle": 20.038, "splay_distance": 3.304, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 169.989, "theta": 178.478, "eta_prime": -161.610, "theta_prime": 172.149, "eta_base": -115.137, "theta_base": -144.179, "v0": -40.223, "v1": 42.809, "v2": -28.888, "v3": 6.784, "v4": 20.546, "amplitude": 42.704, "phase_angle": 132.568, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 187.037, 195.056, 198.065 ], "x_axis": [ 0.980, -0.161, 0.120 ], "y_axis": [ -0.042, -0.749, -0.661 ], "z_axis": [ 0.196, 0.643, -0.740 ], "quaternion": [ -0.350, 0.931, -0.054, 0.085 ] } }, { "index": 304, "index_chain": 107, "chain_name": "J", "nt_resnum": 107, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/107", "linked_nts": [ "///J/106", "///J/108" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.439, "beta": 139.938, "gamma": 58.535, "delta": 133.957, "epsilon": -160.578, "zeta": -97.918, "epsilon_zeta": -62.659, "bb_type": "BI", "chi": -131.740, "glyco_bond": "anti", "C5prime_xyz": [ -1.965, 8.802, -0.767 ], "P_xyz": [ 0.626, 8.992, -0.512 ], "form": ".", "ssZp": 2.211, "Dp": 2.248, "splay_angle": 17.924, "splay_distance": 3.149, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 170.654, "theta": -119.397, "eta_prime": -166.913, "theta_prime": -145.141, "eta_base": -122.424, "theta_base": -121.387, "v0": -26.010, "v1": 34.182, "v2": -29.294, "v3": 15.027, "v4": 6.708, "amplitude": 33.796, "phase_angle": 150.085, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 187.151, 197.225, 195.576 ], "x_axis": [ 0.773, -0.579, -0.259 ], "y_axis": [ -0.600, -0.535, -0.595 ], "z_axis": [ 0.206, 0.615, -0.761 ], "quaternion": [ -0.345, 0.876, -0.337, -0.015 ] } }, { "index": 305, "index_chain": 108, "chain_name": "J", "nt_resnum": 108, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/108", "linked_nts": [ "///J/107", "///J/109" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.816, "beta": 173.835, "gamma": 47.658, "delta": 119.663, "epsilon": -176.196, "zeta": -99.203, "epsilon_zeta": -76.993, "bb_type": "BI", "chi": -120.454, "glyco_bond": "anti", "C5prime_xyz": [ -2.560, 8.542, -1.647 ], "P_xyz": [ -0.469, 10.081, -1.648 ], "form": "B", "ssZp": 2.461, "Dp": 2.508, "splay_angle": 16.780, "splay_distance": 2.859, "splay_ratio": 0.147, "d22": null, "d64": null, "eta": 158.101, "theta": -155.161, "eta_prime": -178.251, "theta_prime": -161.128, "eta_base": -141.323, "theta_base": -118.078, "v0": -35.842, "v1": 34.601, "v2": -20.833, "v3": 0.946, "v4": 21.820, "amplitude": 36.254, "phase_angle": 125.074, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 188.371, 199.635, 193.956 ], "x_axis": [ 0.354, -0.791, -0.499 ], "y_axis": [ -0.887, -0.115, -0.446 ], "z_axis": [ 0.296, 0.601, -0.743 ], "quaternion": [ -0.352, 0.743, -0.564, -0.068 ] } }, { "index": 306, "index_chain": 109, "chain_name": "J", "nt_resnum": 109, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/109", "linked_nts": [ "///J/108", "///J/110" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.952, "beta": 173.846, "gamma": 49.895, "delta": 133.315, "epsilon": -168.020, "zeta": -113.770, "epsilon_zeta": -54.251, "bb_type": "BI", "chi": -120.408, "glyco_bond": "anti", "C5prime_xyz": [ -2.230, 8.625, -1.403 ], "P_xyz": [ 0.032, 9.843, -1.046 ], "form": "B", "ssZp": 2.235, "Dp": 2.265, "splay_angle": 18.741, "splay_distance": 3.108, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 165.206, "theta": -151.751, "eta_prime": -171.017, "theta_prime": -159.609, "eta_base": -121.456, "theta_base": -125.412, "v0": -29.027, "v1": 36.669, "v2": -30.000, "v3": 14.179, "v4": 9.120, "amplitude": 35.892, "phase_angle": 146.706, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 189.695, 200.788, 191.700 ], "x_axis": [ -0.285, -0.804, -0.522 ], "y_axis": [ -0.904, 0.406, -0.132 ], "z_axis": [ 0.318, 0.434, -0.843 ], "quaternion": [ 0.264, -0.537, 0.796, 0.095 ] } }, { "index": 307, "index_chain": 110, "chain_name": "J", "nt_resnum": 110, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/110", "linked_nts": [ "///J/109", "///J/111" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.690, "beta": -178.906, "gamma": 40.624, "delta": 146.197, "epsilon": -161.275, "zeta": -125.302, "epsilon_zeta": -35.972, "bb_type": "BI", "chi": -107.927, "glyco_bond": "anti", "C5prime_xyz": [ -1.871, 8.323, -1.756 ], "P_xyz": [ 0.422, 9.446, -1.245 ], "form": "B", "ssZp": 1.831, "Dp": 1.916, "splay_angle": 17.457, "splay_distance": 2.926, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 169.255, "theta": -146.487, "eta_prime": -169.645, "theta_prime": -156.836, "eta_base": -130.390, "theta_base": -116.100, "v0": -19.229, "v1": 34.751, "v2": -36.275, "v3": 26.155, "v4": -4.612, "amplitude": 37.051, "phase_angle": 168.254, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 191.150, 202.153, 189.317 ], "x_axis": [ -0.779, -0.461, -0.426 ], "y_axis": [ -0.563, 0.813, 0.150 ], "z_axis": [ 0.277, 0.357, -0.892 ], "quaternion": [ 0.188, -0.274, 0.933, 0.136 ] } }, { "index": 308, "index_chain": 111, "chain_name": "J", "nt_resnum": 111, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/111", "linked_nts": [ "///J/110", "///J/112" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.783, "beta": 162.196, "gamma": 45.573, "delta": 139.671, "epsilon": -173.834, "zeta": -115.512, "epsilon_zeta": -58.322, "bb_type": "BI", "chi": -106.514, "glyco_bond": "anti", "C5prime_xyz": [ -2.249, 8.269, -1.917 ], "P_xyz": [ 0.208, 9.148, -1.845 ], "form": "B", "ssZp": 2.094, "Dp": 2.160, "splay_angle": 18.410, "splay_distance": 3.071, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 160.177, "theta": -141.935, "eta_prime": -171.854, "theta_prime": -160.179, "eta_base": -125.118, "theta_base": -120.839, "v0": -23.421, "v1": 35.215, "v2": -33.128, "v3": 20.519, "v4": 1.499, "amplitude": 35.541, "phase_angle": 158.766, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 191.985, 203.476, 186.844 ], "x_axis": [ -0.966, 0.079, -0.248 ], "y_axis": [ 0.004, 0.957, 0.290 ], "z_axis": [ 0.260, 0.279, -0.924 ], "quaternion": [ 0.129, 0.021, 0.981, 0.145 ] } }, { "index": 309, "index_chain": 112, "chain_name": "J", "nt_resnum": 112, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/112", "linked_nts": [ "///J/111", "///J/113" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.305, "beta": 176.721, "gamma": 31.425, "delta": 134.462, "epsilon": 177.930, "zeta": -103.373, "epsilon_zeta": -78.697, "bb_type": "BI", "chi": -98.966, "glyco_bond": "anti", "C5prime_xyz": [ -2.196, 7.989, -2.320 ], "P_xyz": [ 0.020, 9.348, -2.399 ], "form": "B", "ssZp": 1.978, "Dp": 2.201, "splay_angle": 22.072, "splay_distance": 3.657, "splay_ratio": 0.192, "d22": 4.734, "d64": 3.945, "eta": 172.654, "theta": -150.617, "eta_prime": -167.447, "theta_prime": -158.863, "eta_base": -122.814, "theta_base": -113.747, "v0": -21.051, "v1": 30.731, "v2": -28.454, "v3": 17.045, "v4": 2.256, "amplitude": 30.888, "phase_angle": 157.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 192.537, 204.167, 183.903 ], "x_axis": [ -0.762, 0.640, -0.101 ], "y_axis": [ 0.606, 0.759, 0.238 ], "z_axis": [ 0.228, 0.120, -0.966 ], "quaternion": [ 0.088, 0.334, 0.934, 0.096 ] } }, { "index": 310, "index_chain": 113, "chain_name": "J", "nt_resnum": 113, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/113", "linked_nts": [ "///J/112", "///J/114" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.148, "beta": -175.847, "gamma": 34.764, "delta": 144.895, "epsilon": -173.900, "zeta": -118.872, "epsilon_zeta": -55.028, "bb_type": "BI", "chi": -88.401, "glyco_bond": "anti", "C5prime_xyz": [ -2.212, 7.656, -2.559 ], "P_xyz": [ 0.027, 8.955, -2.751 ], "form": "B", "ssZp": 1.662, "Dp": 1.930, "splay_angle": 21.741, "splay_distance": 3.639, "splay_ratio": 0.189, "d22": 4.326, "d64": 3.555, "eta": 179.166, "theta": -145.894, "eta_prime": -156.344, "theta_prime": -156.736, "eta_base": -111.022, "theta_base": -108.187, "v0": -15.629, "v1": 31.494, "v2": -34.616, "v3": 26.481, "v4": -7.111, "amplitude": 34.894, "phase_angle": 172.761, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 193.264, 205.582, 180.610 ], "x_axis": [ -0.231, 0.972, 0.035 ], "y_axis": [ 0.967, 0.226, 0.120 ], "z_axis": [ 0.109, 0.061, -0.992 ], "quaternion": [ 0.024, 0.620, 0.782, 0.058 ] } }, { "index": 311, "index_chain": 114, "chain_name": "J", "nt_resnum": 114, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/114", "linked_nts": [ "///J/113", "///J/115" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -33.102, "beta": 162.675, "gamma": 34.550, "delta": 149.545, "epsilon": -88.215, "zeta": -179.584, "epsilon_zeta": 91.369, "bb_type": "BII", "chi": -90.903, "glyco_bond": "anti", "C5prime_xyz": [ -2.706, 7.861, -2.363 ], "P_xyz": [ -0.417, 9.075, -2.673 ], "form": ".", "ssZp": 0.662, "Dp": 0.658, "splay_angle": 25.562, "splay_distance": 4.312, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": -161.358, "theta": -146.952, "eta_prime": -139.892, "theta_prime": -151.939, "eta_base": -96.840, "theta_base": -96.610, "v0": -27.078, "v1": 42.957, "v2": -41.481, "v3": 26.973, "v4": -0.226, "amplitude": 43.754, "phase_angle": 161.451, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 194.418, 206.930, 177.432 ], "x_axis": [ 0.389, 0.912, 0.127 ], "y_axis": [ 0.921, -0.389, -0.029 ], "z_axis": [ 0.023, 0.128, -0.992 ], "quaternion": [ -0.047, 0.832, 0.551, 0.045 ] } }, { "index": 312, "index_chain": 115, "chain_name": "J", "nt_resnum": 115, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/115", "linked_nts": [ "///J/114", "///J/116" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -46.937, "beta": 114.501, "gamma": 31.917, "delta": 131.701, "epsilon": -104.816, "zeta": 160.270, "epsilon_zeta": 94.914, "bb_type": "BII", "chi": -88.513, "glyco_bond": "anti", "C5prime_xyz": [ -3.784, 7.628, -2.379 ], "P_xyz": [ -1.501, 8.640, -3.129 ], "form": "B", "ssZp": 1.526, "Dp": 1.453, "splay_angle": 21.893, "splay_distance": 3.755, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 176.868, "theta": 172.294, "eta_prime": -155.903, "theta_prime": 162.864, "eta_base": -106.194, "theta_base": -149.260, "v0": -41.054, "v1": 47.179, "v2": -34.611, "v3": 12.184, "v4": 17.561, "amplitude": 46.076, "phase_angle": 138.691, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 196.652, 207.129, 173.750 ], "x_axis": [ 0.884, 0.467, 0.029 ], "y_axis": [ 0.467, -0.876, -0.118 ], "z_axis": [ -0.029, 0.118, -0.993 ], "quaternion": [ -0.061, 0.969, 0.241, 0.000 ] } }, { "index": 313, "index_chain": 116, "chain_name": "J", "nt_resnum": 116, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/116", "linked_nts": [ "///J/115", "///J/117" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -68.006, "beta": 134.943, "gamma": 42.926, "delta": 137.164, "epsilon": -156.015, "zeta": -118.452, "epsilon_zeta": -37.562, "bb_type": "BI", "chi": -119.316, "glyco_bond": "anti", "C5prime_xyz": [ -2.015, 8.556, -1.380 ], "P_xyz": [ 0.543, 8.898, -0.978 ], "form": "B", "ssZp": 2.010, "Dp": 2.049, "splay_angle": 22.313, "splay_distance": 3.848, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 167.792, "theta": -125.950, "eta_prime": -172.269, "theta_prime": -147.090, "eta_base": -127.027, "theta_base": -109.146, "v0": -26.143, "v1": 36.363, "v2": -32.475, "v3": 18.315, "v4": 4.693, "amplitude": 36.151, "phase_angle": 153.937, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.253, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 195.792, 206.448, 170.159 ], "x_axis": [ 0.993, -0.114, -0.016 ], "y_axis": [ -0.114, -0.993, -0.001 ], "z_axis": [ -0.016, 0.003, -1.000 ], "quaternion": [ -0.001, 0.998, -0.057, -0.008 ] } }, { "index": 314, "index_chain": 117, "chain_name": "J", "nt_resnum": 117, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/117", "linked_nts": [ "///J/116", "///J/118" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -36.936, "beta": 156.563, "gamma": 31.172, "delta": 119.744, "epsilon": -172.887, "zeta": -103.583, "epsilon_zeta": -69.305, "bb_type": "BI", "chi": -121.645, "glyco_bond": "anti", "C5prime_xyz": [ -2.404, 8.621, -1.544 ], "P_xyz": [ -0.232, 10.016, -1.204 ], "form": "B", "ssZp": 2.430, "Dp": 2.504, "splay_angle": 18.928, "splay_distance": 3.339, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 166.501, "theta": -148.551, "eta_prime": -170.694, "theta_prime": -156.812, "eta_base": -122.526, "theta_base": -117.413, "v0": -32.788, "v1": 31.988, "v2": -19.618, "v3": 1.427, "v4": 19.598, "amplitude": 33.335, "phase_angle": 126.052, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 196.226, 206.604, 166.338 ], "x_axis": [ 0.747, -0.665, 0.027 ], "y_axis": [ -0.665, -0.744, 0.069 ], "z_axis": [ -0.026, -0.070, -0.997 ], "quaternion": [ 0.037, 0.934, -0.356, 0.000 ] } }, { "index": 315, "index_chain": 118, "chain_name": "J", "nt_resnum": 118, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/118", "linked_nts": [ "///J/117", "///J/119" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.174, "beta": 167.632, "gamma": 24.597, "delta": 120.271, "epsilon": -167.431, "zeta": -95.784, "epsilon_zeta": -71.648, "bb_type": "BI", "chi": -124.894, "glyco_bond": "anti", "C5prime_xyz": [ -2.184, 8.713, -1.370 ], "P_xyz": [ -0.154, 10.257, -0.827 ], "form": "B", "ssZp": 2.595, "Dp": 2.626, "splay_angle": 17.952, "splay_distance": 3.112, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 170.925, "theta": -149.637, "eta_prime": -172.213, "theta_prime": -159.491, "eta_base": -124.831, "theta_base": -122.173, "v0": -31.200, "v1": 30.610, "v2": -18.887, "v3": 1.542, "v4": 18.546, "amplitude": 31.820, "phase_angle": 126.410, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 197.059, 206.357, 163.114 ], "x_axis": [ 0.256, -0.955, 0.148 ], "y_axis": [ -0.967, -0.253, 0.040 ], "z_axis": [ -0.001, -0.153, -0.988 ], "quaternion": [ 0.061, 0.790, -0.608, 0.046 ] } }, { "index": 316, "index_chain": 119, "chain_name": "J", "nt_resnum": 119, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/119", "linked_nts": [ "///J/118", "///J/120" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -76.104, "beta": 164.309, "gamma": 52.789, "delta": 80.755, "epsilon": 74.510, "zeta": 68.776, "epsilon_zeta": 5.734, "bb_type": "--", "chi": -147.436, "glyco_bond": "anti", "C5prime_xyz": [ -2.109, 8.979, -0.434 ], "P_xyz": [ 0.245, 10.043, -0.743 ], "form": ".", "ssZp": 2.363, "Dp": 2.367, "splay_angle": 17.815, "splay_distance": 3.205, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -179.407, "theta": -145.571, "eta_prime": -167.875, "theta_prime": -147.384, "eta_base": -123.472, "theta_base": -114.253, "v0": -15.552, "v1": -9.490, "v2": 29.094, "v3": -38.841, "v4": 34.463, "amplitude": 38.877, "phase_angle": 41.552, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 197.675, 205.768, 160.122 ], "x_axis": [ -0.298, -0.932, 0.208 ], "y_axis": [ -0.955, 0.289, -0.075 ], "z_axis": [ 0.009, -0.221, -0.975 ], "quaternion": [ -0.062, -0.589, 0.800, -0.092 ] } }, { "index": 317, "index_chain": 120, "chain_name": "J", "nt_resnum": 120, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/120", "linked_nts": [ "///J/119", "///J/121" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -144.792, "beta": 162.028, "gamma": 67.256, "delta": 113.530, "epsilon": -176.413, "zeta": -87.910, "epsilon_zeta": -88.503, "bb_type": "BI", "chi": -134.463, "glyco_bond": "anti", "C5prime_xyz": [ -2.753, 8.841, -1.142 ], "P_xyz": [ -0.593, 10.296, -1.374 ], "form": ".", "ssZp": 2.528, "Dp": 2.580, "splay_angle": 20.490, "splay_distance": 3.628, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 155.802, "theta": -151.690, "eta_prime": -168.931, "theta_prime": -159.161, "eta_base": -127.174, "theta_base": -128.780, "v0": -40.421, "v1": 36.229, "v2": -19.017, "v3": -3.562, "v4": 27.499, "amplitude": 39.831, "phase_angle": 118.520, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 198.375, 204.187, 157.422 ], "x_axis": [ -0.740, -0.637, 0.216 ], "y_axis": [ -0.673, 0.701, -0.235 ], "z_axis": [ -0.002, -0.319, -0.948 ], "quaternion": [ -0.059, -0.356, 0.920, -0.151 ] } }, { "index": 318, "index_chain": 121, "chain_name": "J", "nt_resnum": 121, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/121", "linked_nts": [ "///J/120", "///J/122" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.634, "beta": -159.551, "gamma": 19.833, "delta": 141.222, "epsilon": -177.311, "zeta": -104.754, "epsilon_zeta": -72.557, "bb_type": "BI", "chi": -104.146, "glyco_bond": "anti", "C5prime_xyz": [ -2.126, 8.189, -1.996 ], "P_xyz": [ -0.530, 10.205, -1.520 ], "form": ".", "ssZp": 2.053, "Dp": 2.128, "splay_angle": 16.574, "splay_distance": 2.966, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 169.544, "theta": -150.722, "eta_prime": -170.919, "theta_prime": -156.892, "eta_base": -134.213, "theta_base": -118.504, "v0": -21.835, "v1": 34.749, "v2": -33.911, "v3": 22.180, "v4": -0.510, "amplitude": 35.655, "phase_angle": 162.008, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 198.909, 201.962, 154.608 ], "x_axis": [ -0.982, -0.147, 0.116 ], "y_axis": [ -0.180, 0.911, -0.372 ], "z_axis": [ -0.051, -0.386, -0.921 ], "quaternion": [ -0.043, -0.084, 0.976, -0.194 ] } }, { "index": 319, "index_chain": 122, "chain_name": "J", "nt_resnum": 122, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/122", "linked_nts": [ "///J/121", "///J/123" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.251, "beta": 173.245, "gamma": 32.100, "delta": 126.030, "epsilon": -172.372, "zeta": -109.906, "epsilon_zeta": -62.467, "bb_type": "BI", "chi": -111.802, "glyco_bond": "anti", "C5prime_xyz": [ -2.571, 8.394, -1.919 ], "P_xyz": [ -0.634, 10.133, -1.815 ], "form": "B", "ssZp": 2.251, "Dp": 2.362, "splay_angle": 17.338, "splay_distance": 2.970, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 169.192, "theta": -155.873, "eta_prime": -171.787, "theta_prime": -159.814, "eta_base": -128.125, "theta_base": -123.088, "v0": -32.529, "v1": 35.854, "v2": -25.782, "v3": 7.856, "v4": 15.262, "amplitude": 35.653, "phase_angle": 136.314, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 198.164, 200.135, 152.393 ], "x_axis": [ -0.927, 0.375, -0.013 ], "y_axis": [ 0.337, 0.816, -0.469 ], "z_axis": [ -0.166, -0.440, -0.883 ], "quaternion": [ -0.040, 0.187, 0.952, -0.239 ] } }, { "index": 320, "index_chain": 123, "chain_name": "J", "nt_resnum": 123, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/123", "linked_nts": [ "///J/122", "///J/124" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -36.031, "beta": 173.365, "gamma": 27.691, "delta": 143.506, "epsilon": -140.053, "zeta": -155.795, "epsilon_zeta": 15.742, "bb_type": "--", "chi": -94.863, "glyco_bond": "anti", "C5prime_xyz": [ -2.600, 8.019, -2.311 ], "P_xyz": [ -0.556, 9.616, -2.490 ], "form": "B", "ssZp": 1.671, "Dp": 1.778, "splay_angle": 22.292, "splay_distance": 3.796, "splay_ratio": 0.196, "d22": 4.497, "d64": 3.655, "eta": -179.874, "theta": -157.491, "eta_prime": -161.260, "theta_prime": -160.249, "eta_base": -123.480, "theta_base": -112.780, "v0": -27.897, "v1": 41.030, "v2": -37.865, "v3": 22.790, "v4": 2.872, "amplitude": 41.077, "phase_angle": 157.191, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 197.144, 198.758, 149.968 ], "x_axis": [ -0.615, 0.745, -0.258 ], "y_axis": [ 0.727, 0.410, -0.551 ], "z_axis": [ -0.305, -0.526, -0.794 ], "quaternion": [ -0.014, 0.439, 0.839, -0.321 ] } }, { "index": 321, "index_chain": 124, "chain_name": "J", "nt_resnum": 124, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/124", "linked_nts": [ "///J/123", "///J/125" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -30.514, "beta": 130.670, "gamma": 35.998, "delta": 136.536, "epsilon": -104.244, "zeta": 162.676, "epsilon_zeta": 93.080, "bb_type": "BII", "chi": -100.865, "glyco_bond": "anti", "C5prime_xyz": [ -3.032, 8.134, -2.109 ], "P_xyz": [ -0.612, 9.032, -2.378 ], "form": ".", "ssZp": 1.305, "Dp": 1.281, "splay_angle": 22.823, "splay_distance": 4.044, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": -171.662, "theta": 179.064, "eta_prime": -151.437, "theta_prime": 174.324, "eta_base": -107.508, "theta_base": -125.387, "v0": -35.894, "v1": 44.682, "v2": -35.851, "v3": 16.201, "v4": 12.023, "amplitude": 43.606, "phase_angle": 145.302, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 196.640, 197.689, 146.360 ], "x_axis": [ -0.083, 0.857, -0.508 ], "y_axis": [ 0.932, -0.114, -0.345 ], "z_axis": [ -0.354, -0.502, -0.789 ], "quaternion": [ 0.058, 0.675, 0.663, -0.319 ] } }, { "index": 322, "index_chain": 125, "chain_name": "J", "nt_resnum": 125, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/125", "linked_nts": [ "///J/124", "///J/126" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.264, "beta": 133.701, "gamma": 40.357, "delta": 148.119, "epsilon": -158.889, "zeta": -112.005, "epsilon_zeta": -46.884, "bb_type": "BI", "chi": -100.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.922, 8.040, -2.071 ], "P_xyz": [ 0.658, 8.101, -1.747 ], "form": "B", "ssZp": 1.566, "Dp": 1.746, "splay_angle": 20.826, "splay_distance": 3.563, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 168.269, "theta": -111.933, "eta_prime": -161.068, "theta_prime": -139.984, "eta_base": -106.151, "theta_base": -96.162, "v0": -16.772, "v1": 33.691, "v2": -37.196, "v3": 28.386, "v4": -7.583, "amplitude": 37.493, "phase_angle": 172.785, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.358, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 197.005, 194.732, 143.626 ], "x_axis": [ 0.503, 0.441, -0.744 ], "y_axis": [ 0.768, -0.623, 0.149 ], "z_axis": [ -0.398, -0.646, -0.652 ], "quaternion": [ 0.239, 0.833, 0.363, -0.342 ] } }, { "index": 323, "index_chain": 126, "chain_name": "J", "nt_resnum": 126, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/126", "linked_nts": [ "///J/125", "///J/127" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -51.147, "beta": 153.759, "gamma": 44.947, "delta": 137.800, "epsilon": -105.854, "zeta": 167.318, "epsilon_zeta": 86.827, "bb_type": "BII", "chi": -102.056, "glyco_bond": "anti", "C5prime_xyz": [ -3.282, 8.131, -1.996 ], "P_xyz": [ -1.156, 9.524, -2.524 ], "form": ".", "ssZp": 1.503, "Dp": 1.424, "splay_angle": 21.837, "splay_distance": 3.726, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -178.586, "theta": 174.239, "eta_prime": -151.944, "theta_prime": 172.941, "eta_base": -105.826, "theta_base": -132.314, "v0": -38.470, "v1": 47.162, "v2": -36.934, "v3": 16.128, "v4": 13.567, "amplitude": 45.745, "phase_angle": 143.840, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 196.817, 192.646, 140.744 ], "x_axis": [ 0.868, 0.049, -0.494 ], "y_axis": [ 0.324, -0.809, 0.489 ], "z_axis": [ -0.375, -0.585, -0.719 ], "quaternion": [ 0.292, 0.921, 0.101, -0.236 ] } }, { "index": 324, "index_chain": 127, "chain_name": "J", "nt_resnum": 127, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/127", "linked_nts": [ "///J/126", "///J/128" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.092, "beta": 142.482, "gamma": 29.572, "delta": 145.332, "epsilon": -170.247, "zeta": -106.556, "epsilon_zeta": -63.690, "bb_type": "BI", "chi": -108.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.674, 8.213, -1.725 ], "P_xyz": [ 0.827, 8.555, -1.047 ], "form": "B", "ssZp": 1.853, "Dp": 1.953, "splay_angle": 18.417, "splay_distance": 3.195, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 165.114, "theta": -121.475, "eta_prime": -172.147, "theta_prime": -144.384, "eta_base": -118.815, "theta_base": -112.364, "v0": -14.220, "v1": 30.079, "v2": -33.768, "v3": 26.391, "v4": -7.917, "amplitude": 33.924, "phase_angle": 174.509, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.358, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 194.894, 189.839, 139.226 ], "x_axis": [ 0.864, -0.502, -0.048 ], "y_axis": [ -0.290, -0.573, 0.767 ], "z_axis": [ -0.412, -0.648, -0.640 ], "quaternion": [ 0.403, 0.877, -0.226, -0.131 ] } }, { "index": 325, "index_chain": 128, "chain_name": "J", "nt_resnum": 128, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/128", "linked_nts": [ "///J/127", "///J/129" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.413, "beta": 173.618, "gamma": 25.152, "delta": 136.150, "epsilon": -166.956, "zeta": -119.580, "epsilon_zeta": -47.376, "bb_type": "BI", "chi": -104.905, "glyco_bond": "anti", "C5prime_xyz": [ -2.389, 8.251, -2.046 ], "P_xyz": [ -0.389, 9.924, -1.891 ], "form": "B", "ssZp": 2.090, "Dp": 2.194, "splay_angle": 17.647, "splay_distance": 3.070, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 166.012, "theta": -152.208, "eta_prime": -170.662, "theta_prime": -162.375, "eta_base": -129.164, "theta_base": -119.726, "v0": -27.260, "v1": 36.809, "v2": -31.993, "v3": 17.136, "v4": 6.080, "amplitude": 36.335, "phase_angle": 151.702, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 194.017, 187.882, 136.859 ], "x_axis": [ 0.613, -0.685, 0.394 ], "y_axis": [ -0.716, -0.270, 0.644 ], "z_axis": [ -0.335, -0.677, -0.656 ], "quaternion": [ 0.415, 0.797, -0.440, 0.018 ] } }, { "index": 326, "index_chain": 129, "chain_name": "J", "nt_resnum": 129, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/129", "linked_nts": [ "///J/128", "///J/130" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -41.536, "beta": 155.474, "gamma": 40.896, "delta": 108.968, "epsilon": -179.781, "zeta": -94.947, "epsilon_zeta": -84.834, "bb_type": "BI", "chi": -125.079, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.688, -1.581 ], "P_xyz": [ -0.224, 9.984, -1.671 ], "form": "B", "ssZp": 2.610, "Dp": 2.732, "splay_angle": 20.412, "splay_distance": 3.443, "splay_ratio": 0.177, "d22": 4.510, "d64": 3.860, "eta": 169.629, "theta": -160.224, "eta_prime": -174.343, "theta_prime": -162.670, "eta_base": -125.352, "theta_base": -131.734, "v0": -34.758, "v1": 26.895, "v2": -9.921, "v3": -9.668, "v4": 27.987, "amplitude": 33.758, "phase_angle": 107.091, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 193.619, 185.528, 134.929 ], "x_axis": [ 0.128, -0.699, 0.704 ], "y_axis": [ -0.957, 0.099, 0.272 ], "z_axis": [ -0.259, -0.708, -0.657 ], "quaternion": [ 0.377, 0.649, -0.638, 0.171 ] } }, { "index": 327, "index_chain": 130, "chain_name": "J", "nt_resnum": 130, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/130", "linked_nts": [ "///J/129", "///J/131" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.985, "beta": -174.798, "gamma": 38.991, "delta": 146.781, "epsilon": -168.162, "zeta": -108.581, "epsilon_zeta": -59.580, "bb_type": "BI", "chi": -103.958, "glyco_bond": "anti", "C5prime_xyz": [ -2.077, 8.186, -1.933 ], "P_xyz": [ 0.118, 9.537, -1.523 ], "form": "B", "ssZp": 1.865, "Dp": 1.953, "splay_angle": 18.228, "splay_distance": 3.048, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 174.420, "theta": -137.224, "eta_prime": -160.990, "theta_prime": -148.663, "eta_base": -127.351, "theta_base": -105.934, "v0": -19.288, "v1": 35.252, "v2": -37.009, "v3": 26.932, "v4": -5.069, "amplitude": 37.727, "phase_angle": 168.807, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 193.000, 183.118, 132.550 ], "x_axis": [ -0.349, -0.491, 0.798 ], "y_axis": [ -0.910, 0.381, -0.164 ], "z_axis": [ -0.224, -0.783, -0.580 ], "quaternion": [ -0.336, -0.461, 0.760, -0.311 ] } }, { "index": 328, "index_chain": 131, "chain_name": "J", "nt_resnum": 131, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/131", "linked_nts": [ "///J/130", "///J/132" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.214, "beta": 178.844, "gamma": 37.796, "delta": 143.246, "epsilon": -175.723, "zeta": -113.881, "epsilon_zeta": -61.842, "bb_type": "BI", "chi": -98.967, "glyco_bond": "anti", "C5prime_xyz": [ -2.342, 8.056, -2.174 ], "P_xyz": [ -0.122, 9.422, -2.113 ], "form": "B", "ssZp": 2.039, "Dp": 2.121, "splay_angle": 17.273, "splay_distance": 2.857, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 157.482, "theta": -148.402, "eta_prime": -174.517, "theta_prime": -160.667, "eta_base": -124.783, "theta_base": -130.097, "v0": -21.679, "v1": 35.634, "v2": -35.264, "v3": 23.722, "v4": -1.587, "amplitude": 36.766, "phase_angle": 163.570, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 191.910, 180.566, 131.288 ], "x_axis": [ -0.769, -0.012, 0.640 ], "y_axis": [ -0.553, 0.516, -0.654 ], "z_axis": [ -0.323, -0.856, -0.403 ], "quaternion": [ -0.293, -0.172, 0.820, -0.461 ] } }, { "index": 329, "index_chain": 132, "chain_name": "J", "nt_resnum": 132, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/132", "linked_nts": [ "///J/131", "///J/133" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.657, "beta": -165.920, "gamma": 12.825, "delta": 150.259, "epsilon": -171.786, "zeta": -111.315, "epsilon_zeta": -60.471, "bb_type": "BI", "chi": -85.049, "glyco_bond": "anti", "C5prime_xyz": [ -1.895, 7.405, -2.617 ], "P_xyz": [ 0.078, 9.111, -2.705 ], "form": "B", "ssZp": 1.337, "Dp": 1.806, "splay_angle": 22.555, "splay_distance": 3.802, "splay_ratio": 0.198, "d22": 4.567, "d64": 3.624, "eta": 175.689, "theta": -143.244, "eta_prime": -169.145, "theta_prime": -148.389, "eta_base": -136.059, "theta_base": -97.086, "v0": -7.407, "v1": 26.299, "v2": -34.281, "v3": 30.845, "v4": -15.035, "amplitude": 34.508, "phase_angle": 186.582, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 191.185, 178.001, 130.260 ], "x_axis": [ -0.910, 0.350, 0.223 ], "y_axis": [ -0.132, 0.264, -0.955 ], "z_axis": [ -0.393, -0.899, -0.194 ], "quaternion": [ -0.200, 0.071, 0.769, -0.602 ] } }, { "index": 330, "index_chain": 133, "chain_name": "J", "nt_resnum": 133, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/133", "linked_nts": [ "///J/132", "///J/134" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -36.503, "beta": 165.188, "gamma": 35.655, "delta": 141.713, "epsilon": -137.877, "zeta": -176.270, "epsilon_zeta": 38.394, "bb_type": "--", "chi": -79.856, "glyco_bond": "anti", "C5prime_xyz": [ -2.954, 7.477, -2.775 ], "P_xyz": [ -0.748, 8.565, -3.659 ], "form": "B", "ssZp": 1.350, "Dp": 1.770, "splay_angle": 20.736, "splay_distance": 3.669, "splay_ratio": 0.191, "d22": 4.663, "d64": 3.603, "eta": -179.317, "theta": -171.044, "eta_prime": -153.846, "theta_prime": -177.396, "eta_base": -105.431, "theta_base": -134.875, "v0": -26.562, "v1": 38.940, "v2": -35.920, "v3": 21.563, "v4": 2.859, "amplitude": 39.006, "phase_angle": 157.057, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 188.606, 176.004, 128.306 ], "x_axis": [ -0.805, 0.436, -0.403 ], "y_axis": [ 0.358, -0.184, -0.915 ], "z_axis": [ -0.473, -0.881, -0.008 ], "quaternion": [ 0.028, -0.311, -0.638, 0.704 ] } }, { "index": 331, "index_chain": 134, "chain_name": "J", "nt_resnum": 134, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/134", "linked_nts": [ "///J/133", "///J/135" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -29.565, "beta": 117.676, "gamma": 40.591, "delta": 133.848, "epsilon": -121.977, "zeta": -173.626, "epsilon_zeta": 51.649, "bb_type": "BII", "chi": -99.196, "glyco_bond": "anti", "C5prime_xyz": [ -3.114, 8.070, -2.184 ], "P_xyz": [ -0.594, 8.587, -2.588 ], "form": ".", "ssZp": 1.717, "Dp": 1.743, "splay_angle": 28.466, "splay_distance": 4.837, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": -178.567, "theta": -157.453, "eta_prime": -159.534, "theta_prime": -166.464, "eta_base": -121.592, "theta_base": -106.104, "v0": -36.603, "v1": 43.820, "v2": -33.881, "v3": 13.805, "v4": 13.954, "amplitude": 42.817, "phase_angle": 142.307, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 187.786, 172.631, 127.118 ], "x_axis": [ -0.540, 0.282, -0.793 ], "y_axis": [ 0.668, -0.429, -0.608 ], "z_axis": [ -0.512, -0.858, 0.043 ], "quaternion": [ -0.136, -0.460, -0.517, 0.709 ] } }, { "index": 332, "index_chain": 135, "chain_name": "J", "nt_resnum": 135, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/135", "linked_nts": [ "///J/134", "///J/136" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -41.352, "beta": 118.526, "gamma": 52.265, "delta": 141.688, "epsilon": -140.840, "zeta": -151.276, "epsilon_zeta": 10.436, "bb_type": "--", "chi": -106.263, "glyco_bond": "anti", "C5prime_xyz": [ -2.516, 8.273, -1.925 ], "P_xyz": [ 0.083, 8.287, -2.097 ], "form": "B", "ssZp": 1.755, "Dp": 1.810, "splay_angle": 22.971, "splay_distance": 3.872, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 173.022, "theta": -132.220, "eta_prime": -150.663, "theta_prime": -158.458, "eta_base": -95.256, "theta_base": -114.235, "v0": -30.018, "v1": 41.761, "v2": -37.096, "v3": 20.772, "v4": 5.490, "amplitude": 41.390, "phase_angle": 153.672, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.028, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 187.228, 168.154, 125.373 ], "x_axis": [ 0.111, -0.125, -0.986 ], "y_axis": [ 0.866, -0.475, 0.157 ], "z_axis": [ -0.488, -0.871, 0.055 ], "quaternion": [ 0.416, 0.619, 0.300, -0.596 ] } }, { "index": 333, "index_chain": 136, "chain_name": "J", "nt_resnum": 136, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/136", "linked_nts": [ "///J/135", "///J/137" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -26.523, "beta": 135.730, "gamma": 29.388, "delta": 139.056, "epsilon": -120.905, "zeta": -159.325, "epsilon_zeta": 38.419, "bb_type": "--", "chi": -102.530, "glyco_bond": "anti", "C5prime_xyz": [ -2.883, 8.259, -2.037 ], "P_xyz": [ -0.544, 9.394, -2.000 ], "form": "B", "ssZp": 1.575, "Dp": 1.584, "splay_angle": 18.667, "splay_distance": 3.228, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -178.128, "theta": -160.690, "eta_prime": -156.039, "theta_prime": -171.846, "eta_base": -111.282, "theta_base": -122.730, "v0": -35.068, "v1": 45.377, "v2": -37.715, "v3": 18.646, "v4": 9.930, "amplitude": 44.335, "phase_angle": 148.286, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 185.906, 164.515, 125.331 ], "x_axis": [ 0.592, -0.397, -0.701 ], "y_axis": [ 0.635, -0.305, 0.709 ], "z_axis": [ -0.496, -0.866, 0.072 ], "quaternion": [ 0.583, 0.676, 0.088, -0.443 ] } }, { "index": 334, "index_chain": 137, "chain_name": "J", "nt_resnum": 137, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/137", "linked_nts": [ "///J/136", "///J/138" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -70.665, "beta": 128.833, "gamma": 58.607, "delta": 121.006, "epsilon": 176.954, "zeta": -107.463, "epsilon_zeta": -75.583, "bb_type": "BI", "chi": -127.274, "glyco_bond": "anti", "C5prime_xyz": [ -2.375, 8.725, -1.277 ], "P_xyz": [ 0.198, 9.020, -1.628 ], "form": "B", "ssZp": 2.623, "Dp": 2.585, "splay_angle": 20.963, "splay_distance": 3.380, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 151.200, "theta": -149.425, "eta_prime": 179.997, "theta_prime": -171.197, "eta_base": -125.420, "theta_base": -131.931, "v0": -33.313, "v1": 33.053, "v2": -20.557, "v3": 2.042, "v4": 19.562, "amplitude": 34.139, "phase_angle": 127.024, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 184.517, 161.808, 126.408 ], "x_axis": [ 0.851, -0.507, -0.135 ], "y_axis": [ 0.148, -0.015, 0.989 ], "z_axis": [ -0.503, -0.862, 0.062 ], "quaternion": [ 0.689, 0.672, -0.134, -0.238 ] } }, { "index": 335, "index_chain": 138, "chain_name": "J", "nt_resnum": 138, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/138", "linked_nts": [ "///J/137", "///J/139" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.368, "beta": -174.515, "gamma": 42.174, "delta": 145.786, "epsilon": -170.589, "zeta": -94.317, "epsilon_zeta": -76.272, "bb_type": "BI", "chi": -125.564, "glyco_bond": "anti", "C5prime_xyz": [ -1.358, 8.470, -0.805 ], "P_xyz": [ 0.873, 9.109, 0.385 ], "form": ".", "ssZp": 2.071, "Dp": 2.063, "splay_angle": 17.764, "splay_distance": 3.107, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 173.577, "theta": -123.007, "eta_prime": -166.529, "theta_prime": -137.180, "eta_base": -119.919, "theta_base": -106.273, "v0": -12.189, "v1": 28.115, "v2": -32.442, "v3": 26.236, "v4": -9.018, "amplitude": 32.484, "phase_angle": 177.104, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 182.513, 159.088, 126.304 ], "x_axis": [ 0.819, -0.312, 0.482 ], "y_axis": [ -0.350, 0.394, 0.850 ], "z_axis": [ -0.455, -0.865, 0.213 ], "quaternion": [ 0.779, 0.550, -0.301, 0.012 ] } }, { "index": 336, "index_chain": 139, "chain_name": "J", "nt_resnum": 139, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/139", "linked_nts": [ "///J/138", "///J/140" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.442, "beta": -171.644, "gamma": 14.662, "delta": 146.391, "epsilon": -168.302, "zeta": -113.324, "epsilon_zeta": -54.978, "bb_type": "BI", "chi": -106.599, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 8.298, -1.787 ], "P_xyz": [ -0.090, 10.096, -1.205 ], "form": "B", "ssZp": 1.992, "Dp": 1.995, "splay_angle": 19.612, "splay_distance": 3.345, "splay_ratio": 0.171, "d22": 4.280, "d64": 3.698, "eta": 162.592, "theta": -151.803, "eta_prime": -170.471, "theta_prime": -157.753, "eta_base": -128.022, "theta_base": -127.659, "v0": -18.738, "v1": 34.627, "v2": -36.351, "v3": 26.599, "v4": -5.189, "amplitude": 37.021, "phase_angle": 169.084, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 181.656, 156.102, 126.323 ], "x_axis": [ 0.519, 0.001, 0.855 ], "y_axis": [ -0.753, 0.475, 0.456 ], "z_axis": [ -0.405, -0.880, 0.247 ], "quaternion": [ 0.748, 0.446, -0.421, 0.252 ] } }, { "index": 337, "index_chain": 140, "chain_name": "J", "nt_resnum": 140, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/140", "linked_nts": [ "///J/139", "///J/141" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -22.868, "beta": -162.009, "gamma": -8.513, "delta": 160.078, "epsilon": -165.510, "zeta": -122.238, "epsilon_zeta": -43.272, "bb_type": "BI", "chi": -103.215, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 7.961, -1.689 ], "P_xyz": [ 0.372, 9.862, -1.111 ], "form": "B", "ssZp": 1.588, "Dp": 1.669, "splay_angle": 17.046, "splay_distance": 2.894, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 172.268, "theta": -157.171, "eta_prime": -171.323, "theta_prime": -159.342, "eta_base": -137.232, "theta_base": -124.508, "v0": -3.591, "v1": 26.893, "v2": -38.444, "v3": 37.458, "v4": -21.494, "amplitude": 39.541, "phase_angle": 193.529, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 180.700, 152.910, 126.620 ], "x_axis": [ 0.149, 0.443, 0.884 ], "y_axis": [ -0.908, 0.415, -0.055 ], "z_axis": [ -0.392, -0.795, 0.464 ], "quaternion": [ 0.712, 0.260, -0.448, 0.474 ] } }, { "index": 338, "index_chain": 141, "chain_name": "J", "nt_resnum": 141, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/141", "linked_nts": [ "///J/140", "///J/142" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.537, "beta": 175.306, "gamma": 34.278, "delta": 147.963, "epsilon": -177.505, "zeta": -103.502, "epsilon_zeta": -74.002, "bb_type": "BI", "chi": -101.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.745, 7.976, -2.021 ], "P_xyz": [ 0.669, 8.909, -1.643 ], "form": "B", "ssZp": 1.838, "Dp": 1.958, "splay_angle": 19.841, "splay_distance": 3.292, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 157.342, "theta": -134.958, "eta_prime": -176.247, "theta_prime": -150.703, "eta_base": -136.827, "theta_base": -116.841, "v0": -11.727, "v1": 29.024, "v2": -34.264, "v3": 28.425, "v4": -10.741, "amplitude": 34.268, "phase_angle": 179.139, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 179.224, 150.481, 127.159 ], "x_axis": [ -0.323, 0.679, 0.659 ], "y_axis": [ -0.868, 0.066, -0.492 ], "z_axis": [ -0.378, -0.731, 0.568 ], "quaternion": [ 0.573, 0.104, -0.453, 0.676 ] } }, { "index": 339, "index_chain": 142, "chain_name": "J", "nt_resnum": 142, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/142", "linked_nts": [ "///J/141", "///J/143" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.585, "beta": -165.632, "gamma": 20.561, "delta": 148.016, "epsilon": 170.976, "zeta": -104.898, "epsilon_zeta": -84.126, "bb_type": "BI", "chi": -85.287, "glyco_bond": "anti", "C5prime_xyz": [ -2.069, 7.453, -2.621 ], "P_xyz": [ -0.057, 9.113, -2.746 ], "form": "B", "ssZp": 1.658, "Dp": 1.895, "splay_angle": 17.811, "splay_distance": 2.939, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 169.224, "theta": -150.262, "eta_prime": -166.248, "theta_prime": -161.074, "eta_base": -127.671, "theta_base": -111.075, "v0": -10.579, "v1": 28.423, "v2": -34.544, "v3": 29.275, "v4": -12.061, "amplitude": 34.552, "phase_angle": 181.258, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 177.900, 148.142, 129.060 ], "x_axis": [ -0.740, 0.613, 0.275 ], "y_axis": [ -0.598, -0.415, -0.686 ], "z_axis": [ -0.307, -0.672, 0.674 ], "quaternion": [ 0.360, -0.010, -0.404, 0.841 ] } }, { "index": 340, "index_chain": 143, "chain_name": "J", "nt_resnum": 143, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/143", "linked_nts": [ "///J/142", "///J/144" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -33.714, "beta": -176.469, "gamma": 28.697, "delta": 150.561, "epsilon": -136.289, "zeta": -141.706, "epsilon_zeta": 5.417, "bb_type": "--", "chi": -80.534, "glyco_bond": "anti", "C5prime_xyz": [ -2.519, 7.410, -2.718 ], "P_xyz": [ -0.413, 8.885, -3.133 ], "form": ".", "ssZp": 1.062, "Dp": 1.434, "splay_angle": 26.127, "splay_distance": 4.465, "splay_ratio": 0.231, "d22": 5.013, "d64": 3.994, "eta": -171.606, "theta": -141.248, "eta_prime": -152.925, "theta_prime": -146.473, "eta_base": -105.526, "theta_base": -100.982, "v0": -17.023, "v1": 34.850, "v2": -38.530, "v3": 29.795, "v4": -8.304, "amplitude": 38.789, "phase_angle": 173.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ 176.119, 146.525, 130.748 ], "x_axis": [ -0.962, 0.234, -0.141 ], "y_axis": [ -0.120, -0.826, -0.551 ], "z_axis": [ -0.245, -0.513, 0.822 ], "quaternion": [ 0.093, -0.102, -0.280, 0.950 ] } }, { "index": 341, "index_chain": 144, "chain_name": "J", "nt_resnum": 144, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/144", "linked_nts": [ "///J/143", "///J/145" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -35.549, "beta": 139.136, "gamma": 34.845, "delta": 130.696, "epsilon": -91.208, "zeta": 164.323, "epsilon_zeta": 104.469, "bb_type": "BII", "chi": -79.685, "glyco_bond": "anti", "C5prime_xyz": [ -3.613, 7.341, -2.695 ], "P_xyz": [ -1.489, 8.201, -3.936 ], "form": ".", "ssZp": 0.777, "Dp": 1.034, "splay_angle": 27.252, "splay_distance": 4.735, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": -166.942, "theta": -177.122, "eta_prime": -147.818, "theta_prime": -176.551, "eta_base": -109.381, "theta_base": -124.371, "v0": -35.971, "v1": 41.391, "v2": -30.748, "v3": 11.072, "v4": 15.267, "amplitude": 40.592, "phase_angle": 139.244, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 174.006, 142.918, 132.318 ], "x_axis": [ -0.841, -0.259, -0.474 ], "y_axis": [ 0.410, -0.878, -0.246 ], "z_axis": [ -0.353, -0.402, 0.845 ], "quaternion": [ -0.177, -0.219, -0.172, 0.944 ] } }, { "index": 342, "index_chain": 145, "chain_name": "J", "nt_resnum": 145, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/145", "linked_nts": [ "///J/144", "///J/146" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -55.253, "beta": 117.835, "gamma": 42.478, "delta": 138.214, "epsilon": -117.709, "zeta": 167.373, "epsilon_zeta": 74.918, "bb_type": "BII", "chi": -92.523, "glyco_bond": "anti", "C5prime_xyz": [ -3.329, 7.846, -2.338 ], "P_xyz": [ -0.845, 8.394, -2.918 ], "form": ".", "ssZp": 1.584, "Dp": 1.566, "splay_angle": 24.696, "splay_distance": 4.223, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": -179.358, "theta": -176.122, "eta_prime": -153.560, "theta_prime": 169.987, "eta_base": -110.945, "theta_base": -133.066, "v0": -36.159, "v1": 45.492, "v2": -36.804, "v3": 17.229, "v4": 11.441, "amplitude": 44.296, "phase_angle": 146.188, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.033, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 173.598, 139.087, 135.070 ], "x_axis": [ -0.426, -0.728, -0.537 ], "y_axis": [ 0.844, -0.534, 0.053 ], "z_axis": [ -0.325, -0.431, 0.842 ], "quaternion": [ -0.470, -0.258, -0.113, 0.837 ] } }, { "index": 343, "index_chain": 146, "chain_name": "J", "nt_resnum": 146, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/146", "linked_nts": [ "///J/145", "///J/147" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.985, "beta": 132.970, "gamma": 43.933, "delta": 144.317, "epsilon": -162.630, "zeta": -120.570, "epsilon_zeta": -42.060, "bb_type": "BI", "chi": -109.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.952, 8.321, -1.709 ], "P_xyz": [ 0.639, 8.379, -1.420 ], "form": "B", "ssZp": 1.921, "Dp": 1.984, "splay_angle": 20.045, "splay_distance": 3.346, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 168.027, "theta": -124.552, "eta_prime": -164.106, "theta_prime": -150.991, "eta_base": -111.503, "theta_base": -103.177, "v0": -20.938, "v1": 35.478, "v2": -35.871, "v3": 24.655, "v4": -2.580, "amplitude": 37.103, "phase_angle": 165.194, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.365, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 173.919, 137.325, 138.895 ], "x_axis": [ 0.214, -0.929, -0.303 ], "y_axis": [ 0.947, 0.121, 0.296 ], "z_axis": [ -0.238, -0.350, 0.906 ], "quaternion": [ 0.749, 0.216, 0.022, -0.627 ] } }, { "index": 344, "index_chain": 147, "chain_name": "J", "nt_resnum": 147, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/147", "linked_nts": [ "///J/146", "///J/148" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -45.957, "beta": 159.585, "gamma": 40.260, "delta": 140.671, "epsilon": -156.441, "zeta": -136.851, "epsilon_zeta": -19.590, "bb_type": "--", "chi": -110.484, "glyco_bond": "anti", "C5prime_xyz": [ -2.314, 8.416, -1.724 ], "P_xyz": [ 0.068, 9.439, -1.551 ], "form": "B", "ssZp": 2.128, "Dp": 2.130, "splay_angle": 20.166, "splay_distance": 3.371, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 166.746, "theta": -153.823, "eta_prime": -165.864, "theta_prime": -167.031, "eta_base": -109.751, "theta_base": -128.293, "v0": -27.518, "v1": 39.125, "v2": -35.173, "v3": 20.209, "v4": 4.357, "amplitude": 38.852, "phase_angle": 154.864, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 173.718, 135.653, 141.786 ], "x_axis": [ 0.774, -0.630, -0.070 ], "y_axis": [ 0.590, 0.676, 0.442 ], "z_axis": [ -0.231, -0.383, 0.894 ], "quaternion": [ 0.914, 0.226, -0.044, -0.333 ] } }, { "index": 345, "index_chain": 148, "chain_name": "J", "nt_resnum": 148, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/148", "linked_nts": [ "///J/147", "///J/149" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.696, "beta": 148.696, "gamma": 53.794, "delta": 130.751, "epsilon": -168.736, "zeta": -117.330, "epsilon_zeta": -51.407, "bb_type": "BI", "chi": -129.592, "glyco_bond": "anti", "C5prime_xyz": [ -2.162, 8.816, -1.005 ], "P_xyz": [ 0.332, 9.495, -0.779 ], "form": "B", "ssZp": 2.397, "Dp": 2.405, "splay_angle": 17.605, "splay_distance": 2.857, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 165.321, "theta": -150.745, "eta_prime": -171.668, "theta_prime": -163.028, "eta_base": -126.058, "theta_base": -127.603, "v0": -32.486, "v1": 38.265, "v2": -29.304, "v3": 11.424, "v4": 13.075, "amplitude": 37.578, "phase_angle": 141.243, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 172.531, 134.447, 144.702 ], "x_axis": [ 0.976, -0.141, 0.167 ], "y_axis": [ 0.072, 0.928, 0.365 ], "z_axis": [ -0.206, -0.345, 0.916 ], "quaternion": [ 0.977, 0.182, -0.095, -0.055 ] } }, { "index": 346, "index_chain": 149, "chain_name": "J", "nt_resnum": 149, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/149", "linked_nts": [ "///J/148", "///J/150" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.899, "beta": -177.179, "gamma": 47.758, "delta": 145.554, "epsilon": -177.706, "zeta": -99.813, "epsilon_zeta": -77.893, "bb_type": "BI", "chi": -115.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.470, 8.387, -1.339 ], "P_xyz": [ 0.942, 9.012, -0.572 ], "form": "B", "ssZp": 1.992, "Dp": 2.026, "splay_angle": 18.604, "splay_distance": 3.131, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 163.327, "theta": -130.944, "eta_prime": -173.318, "theta_prime": -147.880, "eta_base": -129.879, "theta_base": -112.140, "v0": -11.012, "v1": 27.356, "v2": -32.351, "v3": 26.797, "v4": -10.157, "amplitude": 32.355, "phase_angle": 179.187, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 171.378, 133.274, 147.037 ], "x_axis": [ 0.824, 0.491, 0.283 ], "y_axis": [ -0.553, 0.806, 0.210 ], "z_axis": [ -0.125, -0.330, 0.936 ], "quaternion": [ 0.944, 0.143, -0.108, 0.276 ] } }, { "index": 347, "index_chain": 150, "chain_name": "J", "nt_resnum": 150, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/150", "linked_nts": [ "///J/149", "///J/151" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.774, "beta": -176.843, "gamma": 41.670, "delta": 142.689, "epsilon": -170.842, "zeta": -108.550, "epsilon_zeta": -62.292, "bb_type": "BI", "chi": -112.818, "glyco_bond": "anti", "C5prime_xyz": [ -2.001, 8.445, -1.588 ], "P_xyz": [ 0.188, 9.720, -0.953 ], "form": "B", "ssZp": 2.014, "Dp": 2.083, "splay_angle": 17.446, "splay_distance": 2.922, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 163.356, "theta": -141.380, "eta_prime": -169.661, "theta_prime": -153.236, "eta_base": -123.672, "theta_base": -115.405, "v0": -22.507, "v1": 35.909, "v2": -35.090, "v3": 23.052, "v4": -0.645, "amplitude": 36.859, "phase_angle": 162.178, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 171.249, 131.957, 149.874 ], "x_axis": [ 0.384, 0.879, 0.282 ], "y_axis": [ -0.917, 0.399, 0.002 ], "z_axis": [ -0.111, -0.259, 0.959 ], "quaternion": [ 0.828, 0.079, -0.119, 0.542 ] } }, { "index": 348, "index_chain": 151, "chain_name": "J", "nt_resnum": 151, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/151", "linked_nts": [ "///J/150", "///J/152" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -23.471, "beta": -160.153, "gamma": -3.855, "delta": 157.549, "epsilon": 177.638, "zeta": -102.209, "epsilon_zeta": -80.152, "bb_type": "BI", "chi": -93.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.384, 7.645, -2.164 ], "P_xyz": [ 0.431, 9.518, -1.928 ], "form": "B", "ssZp": 1.525, "Dp": 1.719, "splay_angle": 18.085, "splay_distance": 3.040, "splay_ratio": 0.157, "d22": 4.241, "d64": 3.503, "eta": 170.658, "theta": -148.471, "eta_prime": -169.115, "theta_prime": -154.848, "eta_base": -125.795, "theta_base": -117.316, "v0": -1.450, "v1": 23.989, "v2": -36.140, "v3": 36.263, "v4": -22.144, "amplitude": 37.694, "phase_angle": 196.510, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 171.340, 131.211, 152.698 ], "x_axis": [ -0.245, 0.957, 0.158 ], "y_axis": [ -0.969, -0.238, -0.060 ], "z_axis": [ -0.020, -0.168, 0.986 ], "quaternion": [ 0.613, 0.044, -0.073, 0.786 ] } }, { "index": 349, "index_chain": 152, "chain_name": "J", "nt_resnum": 152, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/152", "linked_nts": [ "///J/151", "///J/153" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -50.354, "beta": -173.930, "gamma": 31.718, "delta": 146.856, "epsilon": -141.209, "zeta": -142.578, "epsilon_zeta": 1.369, "bb_type": "--", "chi": -90.106, "glyco_bond": "anti", "C5prime_xyz": [ -2.271, 7.816, -2.466 ], "P_xyz": [ -0.114, 9.282, -2.600 ], "form": "B", "ssZp": 1.379, "Dp": 1.684, "splay_angle": 20.891, "splay_distance": 3.630, "splay_ratio": 0.187, "d22": 4.806, "d64": 3.705, "eta": 176.490, "theta": -153.893, "eta_prime": -163.652, "theta_prime": -162.151, "eta_base": -125.419, "theta_base": -119.113, "v0": -19.347, "v1": 35.198, "v2": -36.796, "v3": 26.615, "v4": -4.826, "amplitude": 37.554, "phase_angle": 168.469, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 171.111, 130.788, 155.700 ], "x_axis": [ -0.708, 0.705, 0.053 ], "y_axis": [ -0.706, -0.708, -0.019 ], "z_axis": [ 0.024, -0.050, 0.998 ], "quaternion": [ 0.382, 0.021, -0.019, 0.924 ] } }, { "index": 350, "index_chain": 153, "chain_name": "J", "nt_resnum": 153, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/153", "linked_nts": [ "///J/152", "///J/154" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -51.705, "beta": 141.437, "gamma": 44.535, "delta": 103.478, "epsilon": 48.114, "zeta": 54.986, "epsilon_zeta": -6.871, "bb_type": "--", "chi": -110.066, "glyco_bond": "anti", "C5prime_xyz": [ -2.571, 8.244, -2.196 ], "P_xyz": [ -0.125, 8.783, -2.961 ], "form": ".", "ssZp": 0.805, "Dp": 0.870, "splay_angle": 29.594, "splay_distance": 4.708, "splay_ratio": 0.259, "d22": 5.285, "d64": 4.148, "eta": -166.961, "theta": -144.164, "eta_prime": -148.061, "theta_prime": -146.963, "eta_base": -112.032, "theta_base": -93.196, "v0": -28.109, "v1": 18.517, "v2": -3.114, "v3": -12.785, "v4": 25.760, "amplitude": 27.849, "phase_angle": 96.420, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 170.440, 129.727, 159.107 ], "x_axis": [ -0.979, 0.202, 0.022 ], "y_axis": [ -0.200, -0.978, 0.056 ], "z_axis": [ 0.033, 0.051, 0.998 ], "quaternion": [ 0.101, 0.014, 0.027, 0.994 ] } }, { "index": 351, "index_chain": 154, "chain_name": "J", "nt_resnum": 154, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/154", "linked_nts": [ "///J/153", "///J/155" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": 171.085, "beta": -130.619, "gamma": 75.077, "delta": 151.149, "epsilon": -93.239, "zeta": 160.805, "epsilon_zeta": 105.956, "bb_type": "BII", "chi": -58.737, "glyco_bond": "--", "C5prime_xyz": [ -3.539, 6.676, -3.000 ], "P_xyz": [ -1.276, 7.611, -3.936 ], "form": ".", "ssZp": 0.561, "Dp": 0.665, "splay_angle": 25.406, "splay_distance": 4.378, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 176.675, "theta": -172.558, "eta_prime": -147.691, "theta_prime": 176.077, "eta_base": -103.223, "theta_base": -128.832, "v0": -24.327, "v1": 41.397, "v2": -41.681, "v3": 28.893, "v4": -3.166, "amplitude": 43.092, "phase_angle": 165.295, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 169.201, 127.485, 163.057 ], "x_axis": [ -0.853, -0.520, 0.043 ], "y_axis": [ 0.520, -0.842, 0.145 ], "z_axis": [ -0.040, 0.146, 0.988 ], "quaternion": [ -0.271, 0.001, 0.076, 0.960 ] } }, { "index": 352, "index_chain": 155, "chain_name": "J", "nt_resnum": 155, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/155", "linked_nts": [ "///J/154", "///J/156" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -75.533, "beta": 135.611, "gamma": 47.023, "delta": 144.688, "epsilon": -112.060, "zeta": 176.019, "epsilon_zeta": 71.921, "bb_type": "BII", "chi": -88.049, "glyco_bond": "anti", "C5prime_xyz": [ -2.950, 7.764, -2.494 ], "P_xyz": [ -0.451, 8.200, -3.166 ], "form": ".", "ssZp": 1.154, "Dp": 1.229, "splay_angle": 21.873, "splay_distance": 3.874, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -175.383, "theta": -171.660, "eta_prime": -156.614, "theta_prime": 174.503, "eta_base": -113.582, "theta_base": -127.615, "v0": -28.564, "v1": 42.316, "v2": -39.088, "v3": 23.769, "v4": 2.713, "amplitude": 42.308, "phase_angle": 157.502, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.364, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 170.498, 126.386, 167.092 ], "x_axis": [ -0.361, -0.926, 0.110 ], "y_axis": [ 0.932, -0.354, 0.083 ], "z_axis": [ -0.038, 0.132, 0.990 ], "quaternion": [ 0.565, -0.022, -0.065, -0.822 ] } }, { "index": 353, "index_chain": 156, "chain_name": "J", "nt_resnum": 156, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/156", "linked_nts": [ "///J/155", "///J/157" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.394, "beta": 138.256, "gamma": 42.560, "delta": 138.626, "epsilon": -169.651, "zeta": -109.867, "epsilon_zeta": -59.784, "bb_type": "BI", "chi": -101.080, "glyco_bond": "anti", "C5prime_xyz": [ -2.024, 8.076, -2.175 ], "P_xyz": [ 0.587, 8.181, -2.188 ], "form": "B", "ssZp": 1.896, "Dp": 2.124, "splay_angle": 23.264, "splay_distance": 4.000, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 163.230, "theta": -123.148, "eta_prime": -171.832, "theta_prime": -146.631, "eta_base": -117.555, "theta_base": -106.199, "v0": -17.746, "v1": 29.763, "v2": -29.981, "v3": 20.497, "v4": -1.950, "amplitude": 31.067, "phase_angle": 164.804, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.469, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 172.241, 127.027, 170.491 ], "x_axis": [ 0.345, -0.922, 0.179 ], "y_axis": [ 0.938, 0.347, -0.019 ], "z_axis": [ -0.044, 0.174, 0.984 ], "quaternion": [ 0.818, -0.059, -0.068, -0.568 ] } }, { "index": 354, "index_chain": 157, "chain_name": "J", "nt_resnum": 157, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/157", "linked_nts": [ "///J/156", "///J/158" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -35.832, "beta": 157.824, "gamma": 40.583, "delta": 138.612, "epsilon": -125.619, "zeta": -175.089, "epsilon_zeta": 49.470, "bb_type": "BII", "chi": -105.105, "glyco_bond": "anti", "C5prime_xyz": [ -2.910, 8.311, -1.931 ], "P_xyz": [ -0.731, 9.699, -2.156 ], "form": "B", "ssZp": 1.771, "Dp": 1.731, "splay_angle": 19.722, "splay_distance": 3.357, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -174.674, "theta": -173.169, "eta_prime": -149.054, "theta_prime": -178.558, "eta_base": -105.340, "theta_base": -133.977, "v0": -35.607, "v1": 45.358, "v2": -37.125, "v3": 17.815, "v4": 10.745, "amplitude": 44.212, "phase_angle": 147.108, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 173.117, 126.850, 174.390 ], "x_axis": [ 0.813, -0.568, 0.124 ], "y_axis": [ 0.579, 0.810, -0.089 ], "z_axis": [ -0.050, 0.144, 0.988 ], "quaternion": [ 0.950, -0.061, -0.046, -0.302 ] } }, { "index": 355, "index_chain": 158, "chain_name": "J", "nt_resnum": 158, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/158", "linked_nts": [ "///J/157", "///J/159" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.580, "beta": 131.674, "gamma": 34.602, "delta": 131.287, "epsilon": -174.803, "zeta": -103.402, "epsilon_zeta": -71.401, "bb_type": "BI", "chi": -118.070, "glyco_bond": "anti", "C5prime_xyz": [ -2.256, 8.537, -1.534 ], "P_xyz": [ 0.251, 9.128, -1.108 ], "form": ".", "ssZp": 2.353, "Dp": 2.367, "splay_angle": 20.181, "splay_distance": 3.533, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 161.254, "theta": -131.718, "eta_prime": -176.609, "theta_prime": -152.122, "eta_base": -128.609, "theta_base": -114.664, "v0": -29.235, "v1": 35.840, "v2": -28.720, "v3": 12.638, "v4": 10.204, "amplitude": 35.201, "phase_angle": 144.676, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.087, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 172.487, 128.015, 177.475 ], "x_axis": [ 0.998, -0.009, 0.061 ], "y_axis": [ 0.020, 0.983, -0.183 ], "z_axis": [ -0.059, 0.184, 0.981 ], "quaternion": [ 0.995, -0.092, -0.030, -0.007 ] } }, { "index": 356, "index_chain": 159, "chain_name": "J", "nt_resnum": 159, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/159", "linked_nts": [ "///J/158", "///J/160" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.058, "beta": 172.181, "gamma": 43.798, "delta": 125.545, "epsilon": -178.378, "zeta": -95.916, "epsilon_zeta": -82.462, "bb_type": "BI", "chi": -126.357, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.764, -1.276 ], "P_xyz": [ -0.165, 10.196, -0.797 ], "form": ".", "ssZp": 2.390, "Dp": 2.439, "splay_angle": 18.076, "splay_distance": 3.102, "splay_ratio": 0.160, "d22": 4.172, "d64": 3.720, "eta": 169.471, "theta": -148.347, "eta_prime": -168.254, "theta_prime": -155.671, "eta_base": -119.541, "theta_base": -114.371, "v0": -33.165, "v1": 36.115, "v2": -25.531, "v3": 7.266, "v4": 16.034, "amplitude": 35.985, "phase_angle": 135.193, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 173.042, 127.913, 180.962 ], "x_axis": [ 0.832, 0.543, -0.114 ], "y_axis": [ -0.554, 0.806, -0.207 ], "z_axis": [ -0.021, 0.236, 0.972 ], "quaternion": [ 0.950, -0.117, 0.024, 0.289 ] } }, { "index": 357, "index_chain": 160, "chain_name": "J", "nt_resnum": 160, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/160", "linked_nts": [ "///J/159", "///J/161" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.349, "beta": -173.065, "gamma": 39.368, "delta": 137.475, "epsilon": -166.221, "zeta": -114.767, "epsilon_zeta": -51.454, "bb_type": "BI", "chi": -112.920, "glyco_bond": "anti", "C5prime_xyz": [ -2.036, 8.482, -1.678 ], "P_xyz": [ 0.078, 9.924, -1.164 ], "form": "B", "ssZp": 2.109, "Dp": 2.155, "splay_angle": 15.887, "splay_distance": 2.742, "splay_ratio": 0.139, "d22": null, "d64": null, "eta": 170.221, "theta": -148.095, "eta_prime": -168.583, "theta_prime": -157.217, "eta_base": -120.429, "theta_base": -124.370, "v0": -25.037, "v1": 35.508, "v2": -32.107, "v3": 18.534, "v4": 3.830, "amplitude": 35.394, "phase_angle": 155.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 173.834, 128.410, 183.919 ], "x_axis": [ 0.330, 0.908, -0.258 ], "y_axis": [ -0.943, 0.331, -0.040 ], "z_axis": [ 0.049, 0.256, 0.965 ], "quaternion": [ 0.810, -0.092, 0.094, 0.571 ] } }, { "index": 358, "index_chain": 161, "chain_name": "J", "nt_resnum": 161, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/161", "linked_nts": [ "///J/160", "///J/162" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.754, "beta": 165.869, "gamma": 35.877, "delta": 127.230, "epsilon": 179.863, "zeta": -94.660, "epsilon_zeta": -85.476, "bb_type": "BI", "chi": -115.682, "glyco_bond": "anti", "C5prime_xyz": [ -2.288, 8.519, -1.738 ], "P_xyz": [ -0.084, 9.895, -1.518 ], "form": ".", "ssZp": 2.279, "Dp": 2.362, "splay_angle": 16.782, "splay_distance": 2.986, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 162.006, "theta": -145.501, "eta_prime": -176.138, "theta_prime": -155.603, "eta_base": -135.749, "theta_base": -126.058, "v0": -29.625, "v1": 34.052, "v2": -25.715, "v3": 9.397, "v4": 12.522, "amplitude": 33.651, "phase_angle": 139.833, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 174.540, 128.915, 186.520 ], "x_axis": [ -0.206, 0.920, -0.332 ], "y_axis": [ -0.971, -0.150, 0.186 ], "z_axis": [ 0.122, 0.361, 0.925 ], "quaternion": [ 0.626, -0.070, 0.181, 0.755 ] } }, { "index": 359, "index_chain": 162, "chain_name": "J", "nt_resnum": 162, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/162", "linked_nts": [ "///J/161", "///J/163" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -45.918, "beta": -173.134, "gamma": 26.539, "delta": 141.484, "epsilon": -148.461, "zeta": -163.489, "epsilon_zeta": 15.028, "bb_type": "--", "chi": -101.915, "glyco_bond": "anti", "C5prime_xyz": [ -2.510, 8.186, -2.076 ], "P_xyz": [ -0.725, 10.081, -1.901 ], "form": "B", "ssZp": 1.883, "Dp": 1.966, "splay_angle": 18.477, "splay_distance": 3.145, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 175.516, "theta": -152.724, "eta_prime": -166.398, "theta_prime": -163.429, "eta_base": -132.141, "theta_base": -115.919, "v0": -27.398, "v1": 39.597, "v2": -36.090, "v3": 21.309, "v4": 3.525, "amplitude": 39.474, "phase_angle": 156.105, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 175.717, 130.439, 188.801 ], "x_axis": [ -0.652, 0.712, -0.261 ], "y_axis": [ -0.737, -0.514, 0.438 ], "z_axis": [ 0.178, 0.478, 0.860 ], "quaternion": [ 0.417, -0.024, 0.263, 0.870 ] } }, { "index": 360, "index_chain": 163, "chain_name": "J", "nt_resnum": 163, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/163", "linked_nts": [ "///J/162", "///J/164" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 104.641, "beta": -117.283, "gamma": -165.453, "delta": 136.403, "epsilon": -145.809, "zeta": -102.320, "epsilon_zeta": -43.488, "bb_type": "BI", "chi": -143.193, "glyco_bond": "anti", "C5prime_xyz": [ -2.068, 8.900, -0.170 ], "P_xyz": [ -0.229, 9.489, -1.918 ], "form": "B", "ssZp": 1.797, "Dp": 1.997, "splay_angle": 20.059, "splay_distance": 3.360, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -158.253, "theta": -169.608, "eta_prime": -157.095, "theta_prime": -161.555, "eta_base": -110.217, "theta_base": -109.786, "v0": -28.863, "v1": 38.262, "v2": -32.770, "v3": 16.975, "v4": 7.224, "amplitude": 37.702, "phase_angle": 150.366, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 175.769, 131.996, 191.533 ], "x_axis": [ -0.961, 0.275, 0.021 ], "y_axis": [ -0.215, -0.794, 0.569 ], "z_axis": [ 0.173, 0.543, 0.822 ], "quaternion": [ 0.129, 0.051, 0.294, 0.946 ] } }, { "index": 361, "index_chain": 164, "chain_name": "J", "nt_resnum": 164, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/164", "linked_nts": [ "///J/163", "///J/165" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.308, "beta": 179.821, "gamma": 8.062, "delta": 150.992, "epsilon": -165.499, "zeta": -126.868, "epsilon_zeta": -38.630, "bb_type": "BI", "chi": -91.359, "glyco_bond": "anti", "C5prime_xyz": [ -2.038, 7.696, -2.366 ], "P_xyz": [ -0.060, 9.384, -2.321 ], "form": "B", "ssZp": 1.639, "Dp": 1.841, "splay_angle": 20.408, "splay_distance": 3.498, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 156.747, "theta": -151.112, "eta_prime": -169.322, "theta_prime": -162.732, "eta_base": -114.566, "theta_base": -120.703, "v0": -12.526, "v1": 31.051, "v2": -36.632, "v3": 30.370, "v4": -11.475, "amplitude": 36.637, "phase_angle": 179.120, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 175.867, 133.702, 194.426 ], "x_axis": [ -0.840, -0.329, 0.432 ], "y_axis": [ 0.519, -0.716, 0.466 ], "z_axis": [ 0.156, 0.616, 0.772 ], "quaternion": [ -0.232, 0.161, 0.296, 0.912 ] } }, { "index": 362, "index_chain": 165, "chain_name": "J", "nt_resnum": 165, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/165", "linked_nts": [ "///J/164", "///J/166" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.363, "beta": 148.179, "gamma": 46.612, "delta": 111.228, "epsilon": -179.049, "zeta": -95.486, "epsilon_zeta": -83.563, "bb_type": "BI", "chi": -126.014, "glyco_bond": "anti", "C5prime_xyz": [ -2.618, 8.641, -1.518 ], "P_xyz": [ -0.284, 9.789, -1.675 ], "form": "B", "ssZp": 2.594, "Dp": 2.660, "splay_angle": 21.265, "splay_distance": 3.597, "splay_ratio": 0.185, "d22": 4.433, "d64": 3.987, "eta": 168.737, "theta": -152.977, "eta_prime": -172.410, "theta_prime": -159.757, "eta_base": -125.169, "theta_base": -121.895, "v0": -36.441, "v1": 30.117, "v2": -13.394, "v3": -7.001, "v4": 27.231, "amplitude": 35.382, "phase_angle": 112.245, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 176.171, 135.662, 197.307 ], "x_axis": [ -0.444, -0.681, 0.582 ], "y_axis": [ 0.882, -0.445, 0.153 ], "z_axis": [ 0.155, 0.582, 0.799 ], "quaternion": [ -0.477, 0.225, 0.224, 0.820 ] } }, { "index": 363, "index_chain": 166, "chain_name": "J", "nt_resnum": 166, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/166", "linked_nts": [ "///J/165", "///J/167" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -40.057, "beta": -177.875, "gamma": 33.534, "delta": 144.697, "epsilon": -161.695, "zeta": -134.072, "epsilon_zeta": -27.623, "bb_type": "--", "chi": -105.891, "glyco_bond": "anti", "C5prime_xyz": [ -2.192, 8.272, -1.852 ], "P_xyz": [ -0.069, 9.737, -1.427 ], "form": "B", "ssZp": 2.032, "Dp": 2.061, "splay_angle": 20.154, "splay_distance": 3.340, "splay_ratio": 0.176, "d22": 4.462, "d64": 3.640, "eta": 176.837, "theta": -153.615, "eta_prime": -159.718, "theta_prime": -161.220, "eta_base": -117.530, "theta_base": -110.525, "v0": -23.110, "v1": 37.533, "v2": -36.904, "v3": 24.539, "v4": -1.147, "amplitude": 38.612, "phase_angle": 162.892, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 176.234, 137.471, 200.415 ], "x_axis": [ 0.132, -0.828, 0.545 ], "y_axis": [ 0.985, 0.048, -0.165 ], "z_axis": [ 0.111, 0.559, 0.822 ], "quaternion": [ 0.708, -0.256, -0.154, -0.641 ] } }, { "index": 364, "index_chain": 167, "chain_name": "J", "nt_resnum": 167, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/167", "linked_nts": [ "///J/166", "///J/168" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.950, "beta": 152.908, "gamma": 42.687, "delta": 133.294, "epsilon": -166.939, "zeta": -119.751, "epsilon_zeta": -47.188, "bb_type": "BI", "chi": -114.671, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.531, -1.654 ], "P_xyz": [ 0.419, 9.243, -1.504 ], "form": "B", "ssZp": 2.259, "Dp": 2.302, "splay_angle": 19.252, "splay_distance": 3.304, "splay_ratio": 0.168, "d22": 4.427, "d64": 4.030, "eta": 169.214, "theta": -143.358, "eta_prime": -167.556, "theta_prime": -158.136, "eta_base": -112.111, "theta_base": -134.180, "v0": -26.338, "v1": 34.308, "v2": -29.000, "v3": 14.541, "v4": 7.184, "amplitude": 33.776, "phase_angle": 149.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 177.057, 139.057, 203.237 ], "x_axis": [ 0.740, -0.586, 0.329 ], "y_axis": [ 0.668, 0.586, -0.458 ], "z_axis": [ 0.076, 0.559, 0.826 ], "quaternion": [ 0.888, -0.287, -0.071, -0.353 ] } }, { "index": 365, "index_chain": 168, "chain_name": "J", "nt_resnum": 168, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/168", "linked_nts": [ "///J/167", "///J/169" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -34.182, "beta": 163.737, "gamma": 32.076, "delta": 136.770, "epsilon": -165.098, "zeta": -116.568, "epsilon_zeta": -48.530, "bb_type": "BI", "chi": -109.386, "glyco_bond": "anti", "C5prime_xyz": [ -2.461, 8.360, -1.882 ], "P_xyz": [ -0.320, 9.822, -1.648 ], "form": "B", "ssZp": 2.068, "Dp": 2.151, "splay_angle": 20.275, "splay_distance": 3.358, "splay_ratio": 0.176, "d22": 4.531, "d64": 3.588, "eta": 172.055, "theta": -146.556, "eta_prime": -166.666, "theta_prime": -153.497, "eta_base": -136.499, "theta_base": -103.408, "v0": -30.425, "v1": 40.006, "v2": -34.159, "v3": 17.553, "v4": 7.761, "amplitude": 39.434, "phase_angle": 150.024, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 176.505, 140.653, 206.077 ], "x_axis": [ 0.958, -0.276, 0.078 ], "y_axis": [ 0.277, 0.823, -0.496 ], "z_axis": [ 0.073, 0.497, 0.865 ], "quaternion": [ 0.955, -0.260, -0.001, -0.145 ] } }, { "index": 366, "index_chain": 169, "chain_name": "J", "nt_resnum": 169, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/169", "linked_nts": [ "///J/168", "///J/170" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -44.015, "beta": 173.826, "gamma": 33.326, "delta": 144.194, "epsilon": -165.666, "zeta": -118.989, "epsilon_zeta": -46.677, "bb_type": "BI", "chi": -92.874, "glyco_bond": "anti", "C5prime_xyz": [ -2.313, 7.916, -2.397 ], "P_xyz": [ -0.021, 9.151, -2.532 ], "form": "B", "ssZp": 1.835, "Dp": 2.010, "splay_angle": 22.127, "splay_distance": 3.856, "splay_ratio": 0.193, "d22": 4.289, "d64": 4.085, "eta": 169.838, "theta": -137.286, "eta_prime": -165.326, "theta_prime": -149.724, "eta_base": -111.851, "theta_base": -118.270, "v0": -20.585, "v1": 35.052, "v2": -35.557, "v3": 24.618, "v4": -2.825, "amplitude": 36.718, "phase_angle": 165.553, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 177.734, 142.482, 208.610 ], "x_axis": [ 0.900, 0.322, -0.293 ], "y_axis": [ -0.405, 0.867, -0.290 ], "z_axis": [ 0.161, 0.380, 0.911 ], "quaternion": [ 0.959, -0.175, 0.118, 0.189 ] } }, { "index": 367, "index_chain": 170, "chain_name": "J", "nt_resnum": 170, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/170", "linked_nts": [ "///J/169", "///J/171" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -29.005, "beta": 161.163, "gamma": 23.859, "delta": 139.708, "epsilon": -106.422, "zeta": 160.250, "epsilon_zeta": 93.328, "bb_type": "BII", "chi": -92.897, "glyco_bond": "anti", "C5prime_xyz": [ -3.216, 7.973, -2.258 ], "P_xyz": [ -1.335, 9.715, -2.733 ], "form": "B", "ssZp": 1.467, "Dp": 1.363, "splay_angle": 23.120, "splay_distance": 3.962, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -171.116, "theta": -179.805, "eta_prime": -153.206, "theta_prime": -178.518, "eta_base": -121.738, "theta_base": -124.153, "v0": -35.796, "v1": 45.982, "v2": -37.777, "v3": 18.371, "v4": 10.492, "amplitude": 44.762, "phase_angle": 147.560, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 179.018, 144.298, 211.760 ], "x_axis": [ 0.604, 0.655, -0.454 ], "y_axis": [ -0.755, 0.653, -0.060 ], "z_axis": [ 0.257, 0.379, 0.889 ], "quaternion": [ 0.887, -0.124, 0.200, 0.397 ] } }, { "index": 368, "index_chain": 171, "chain_name": "J", "nt_resnum": 171, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/171", "linked_nts": [ "///J/170", "///J/172" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -33.862, "beta": 123.777, "gamma": 22.476, "delta": 131.705, "epsilon": -170.161, "zeta": -117.624, "epsilon_zeta": -52.537, "bb_type": "BI", "chi": -103.099, "glyco_bond": "anti", "C5prime_xyz": [ -2.352, 8.148, -2.180 ], "P_xyz": [ 0.143, 8.817, -1.820 ], "form": "B", "ssZp": 2.096, "Dp": 2.285, "splay_angle": 18.370, "splay_distance": 3.194, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 168.979, "theta": -138.744, "eta_prime": -170.856, "theta_prime": -158.696, "eta_base": -117.222, "theta_base": -124.431, "v0": -26.152, "v1": 33.500, "v2": -28.018, "v3": 13.622, "v4": 7.666, "amplitude": 33.006, "phase_angle": 148.090, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 178.793, 146.343, 215.146 ], "x_axis": [ -0.003, 0.928, -0.372 ], "y_axis": [ -0.978, 0.075, 0.194 ], "z_axis": [ 0.208, 0.365, 0.908 ], "quaternion": [ 0.703, -0.061, 0.206, 0.677 ] } }, { "index": 369, "index_chain": 172, "chain_name": "J", "nt_resnum": 172, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/172", "linked_nts": [ "///J/171", "///J/173" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.734, "beta": 149.199, "gamma": 51.961, "delta": 111.038, "epsilon": -174.189, "zeta": -103.085, "epsilon_zeta": -71.103, "bb_type": "BI", "chi": -131.965, "glyco_bond": "anti", "C5prime_xyz": [ -2.742, 8.767, -1.241 ], "P_xyz": [ -0.469, 10.016, -1.374 ], "form": "B", "ssZp": 2.698, "Dp": 2.694, "splay_angle": 19.057, "splay_distance": 3.267, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 172.468, "theta": -156.395, "eta_prime": -169.078, "theta_prime": -164.666, "eta_base": -126.437, "theta_base": -121.738, "v0": -39.002, "v1": 32.320, "v2": -14.310, "v3": -7.537, "v4": 29.172, "amplitude": 37.906, "phase_angle": 112.180, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 179.831, 147.779, 217.804 ], "x_axis": [ -0.475, 0.844, -0.250 ], "y_axis": [ -0.851, -0.367, 0.376 ], "z_axis": [ 0.226, 0.392, 0.892 ], "quaternion": [ 0.513, -0.007, 0.232, 0.827 ] } }, { "index": 370, "index_chain": 173, "chain_name": "J", "nt_resnum": 173, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/173", "linked_nts": [ "///J/172", "///J/174" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.909, "beta": 164.463, "gamma": 48.587, "delta": 127.973, "epsilon": -167.859, "zeta": -114.197, "epsilon_zeta": -53.663, "bb_type": "BI", "chi": -129.751, "glyco_bond": "anti", "C5prime_xyz": [ -2.349, 8.796, -1.037 ], "P_xyz": [ -0.060, 9.980, -0.613 ], "form": "B", "ssZp": 2.523, "Dp": 2.479, "splay_angle": 19.679, "splay_distance": 3.265, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 171.304, "theta": -152.836, "eta_prime": -165.604, "theta_prime": -161.035, "eta_base": -114.995, "theta_base": -120.223, "v0": -32.891, "v1": 37.078, "v2": -27.087, "v3": 8.909, "v4": 14.861, "amplitude": 36.637, "phase_angle": 137.676, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 180.747, 149.730, 220.259 ], "x_axis": [ -0.878, 0.478, 0.035 ], "y_axis": [ -0.409, -0.785, 0.465 ], "z_axis": [ 0.249, 0.394, 0.885 ], "quaternion": [ 0.235, 0.075, 0.228, 0.942 ] } }, { "index": 371, "index_chain": 174, "chain_name": "J", "nt_resnum": 174, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/174", "linked_nts": [ "///J/173", "///J/175" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.647, "beta": 165.096, "gamma": 58.686, "delta": 136.036, "epsilon": -171.050, "zeta": -91.417, "epsilon_zeta": -79.633, "bb_type": "BI", "chi": -130.078, "glyco_bond": "anti", "C5prime_xyz": [ -2.118, 8.778, -0.857 ], "P_xyz": [ 0.302, 9.615, -0.353 ], "form": ".", "ssZp": 2.195, "Dp": 2.283, "splay_angle": 19.315, "splay_distance": 3.514, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 165.677, "theta": -122.890, "eta_prime": -166.928, "theta_prime": -143.423, "eta_base": -117.780, "theta_base": -98.771, "v0": -28.008, "v1": 37.157, "v2": -31.804, "v3": 16.571, "v4": 6.907, "amplitude": 36.561, "phase_angle": 150.446, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 181.741, 151.470, 222.836 ], "x_axis": [ -0.949, -0.087, 0.303 ], "y_axis": [ 0.187, -0.928, 0.321 ], "z_axis": [ 0.253, 0.361, 0.897 ], "quaternion": [ -0.070, 0.143, 0.176, 0.971 ] } }, { "index": 372, "index_chain": 175, "chain_name": "J", "nt_resnum": 175, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/175", "linked_nts": [ "///J/174", "///J/176" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.740, "beta": 176.867, "gamma": 45.667, "delta": 118.745, "epsilon": -179.985, "zeta": -101.564, "epsilon_zeta": -78.421, "bb_type": "BI", "chi": -126.920, "glyco_bond": "anti", "C5prime_xyz": [ -2.544, 8.743, -1.370 ], "P_xyz": [ -0.546, 10.405, -1.070 ], "form": ".", "ssZp": 2.580, "Dp": 2.584, "splay_angle": 15.278, "splay_distance": 2.585, "splay_ratio": 0.134, "d22": null, "d64": null, "eta": 161.346, "theta": -161.980, "eta_prime": -173.054, "theta_prime": -165.453, "eta_base": -114.739, "theta_base": -133.320, "v0": -36.763, "v1": 35.180, "v2": -20.774, "v3": 0.379, "v4": 22.624, "amplitude": 36.988, "phase_angle": 124.169, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 181.173, 153.172, 225.857 ], "x_axis": [ -0.614, -0.649, 0.449 ], "y_axis": [ 0.747, -0.661, 0.065 ], "z_axis": [ 0.254, 0.375, 0.891 ], "quaternion": [ -0.392, 0.198, 0.124, 0.890 ] } }, { "index": 373, "index_chain": 176, "chain_name": "J", "nt_resnum": 176, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/176", "linked_nts": [ "///J/175", "///J/177" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -62.552, "beta": -179.196, "gamma": 51.142, "delta": 138.515, "epsilon": -159.820, "zeta": -129.160, "epsilon_zeta": -30.660, "bb_type": "--", "chi": -111.569, "glyco_bond": "anti", "C5prime_xyz": [ -2.255, 8.446, -1.722 ], "P_xyz": [ 0.030, 9.692, -1.508 ], "form": "B", "ssZp": 2.092, "Dp": 2.131, "splay_angle": 19.266, "splay_distance": 3.206, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 172.046, "theta": -156.368, "eta_prime": -168.150, "theta_prime": -164.353, "eta_base": -132.151, "theta_base": -121.198, "v0": -26.491, "v1": 37.356, "v2": -33.523, "v3": 19.171, "v4": 4.329, "amplitude": 37.113, "phase_angle": 154.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 181.130, 154.678, 227.958 ], "x_axis": [ -0.116, -0.901, 0.417 ], "y_axis": [ 0.989, -0.142, -0.033 ], "z_axis": [ 0.089, 0.409, 0.908 ], "quaternion": [ 0.642, -0.172, -0.128, -0.736 ] } }, { "index": 374, "index_chain": 177, "chain_name": "J", "nt_resnum": 177, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/177", "linked_nts": [ "///J/176", "///J/178" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.234, "beta": 157.320, "gamma": 57.330, "delta": 139.746, "epsilon": -165.306, "zeta": -118.235, "epsilon_zeta": -47.072, "bb_type": "BI", "chi": -114.430, "glyco_bond": "anti", "C5prime_xyz": [ -2.132, 8.507, -1.560 ], "P_xyz": [ 0.415, 9.100, -1.578 ], "form": "B", "ssZp": 2.137, "Dp": 2.158, "splay_angle": 18.948, "splay_distance": 3.162, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 165.225, "theta": -140.816, "eta_prime": -167.354, "theta_prime": -160.798, "eta_base": -120.129, "theta_base": -121.868, "v0": -24.820, "v1": 36.632, "v2": -33.942, "v3": 20.537, "v4": 2.432, "amplitude": 36.749, "phase_angle": 157.464, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 181.655, 156.156, 230.754 ], "x_axis": [ 0.504, -0.795, 0.337 ], "y_axis": [ 0.863, 0.449, -0.230 ], "z_axis": [ 0.032, 0.407, 0.913 ], "quaternion": [ 0.846, -0.188, -0.090, -0.490 ] } }, { "index": 375, "index_chain": 178, "chain_name": "J", "nt_resnum": 178, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/178", "linked_nts": [ "///J/177", "///J/179" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.172, "beta": 164.454, "gamma": 58.562, "delta": 137.680, "epsilon": -164.163, "zeta": -116.582, "epsilon_zeta": -47.581, "bb_type": "BI", "chi": -116.953, "glyco_bond": "anti", "C5prime_xyz": [ -2.242, 8.614, -1.492 ], "P_xyz": [ 0.223, 9.497, -1.482 ], "form": "B", "ssZp": 2.216, "Dp": 2.231, "splay_angle": 21.067, "splay_distance": 3.487, "splay_ratio": 0.183, "d22": 4.501, "d64": 3.765, "eta": 165.657, "theta": -143.110, "eta_prime": -168.518, "theta_prime": -157.712, "eta_base": -122.538, "theta_base": -110.718, "v0": -29.340, "v1": 39.516, "v2": -34.166, "v3": 18.209, "v4": 6.727, "amplitude": 38.921, "phase_angle": 151.382, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 181.540, 157.325, 233.690 ], "x_axis": [ 0.915, -0.375, 0.151 ], "y_axis": [ 0.404, 0.849, -0.340 ], "z_axis": [ -0.001, 0.372, 0.928 ], "quaternion": [ 0.961, -0.185, -0.040, -0.203 ] } }, { "index": 376, "index_chain": 179, "chain_name": "J", "nt_resnum": 179, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/179", "linked_nts": [ "///J/178", "///J/180" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.750, "beta": 165.132, "gamma": 59.654, "delta": 139.278, "epsilon": -162.291, "zeta": -115.072, "epsilon_zeta": -47.220, "bb_type": "BI", "chi": -116.811, "glyco_bond": "anti", "C5prime_xyz": [ -2.200, 8.585, -1.477 ], "P_xyz": [ 0.298, 9.392, -1.457 ], "form": "B", "ssZp": 2.205, "Dp": 2.203, "splay_angle": 20.013, "splay_distance": 3.284, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 166.425, "theta": -141.001, "eta_prime": -165.544, "theta_prime": -153.768, "eta_base": -112.059, "theta_base": -116.835, "v0": -27.787, "v1": 38.773, "v2": -34.390, "v3": 19.353, "v4": 5.022, "amplitude": 38.349, "phase_angle": 153.735, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 182.053, 158.603, 236.894 ], "x_axis": [ 0.958, 0.268, -0.106 ], "y_axis": [ -0.288, 0.897, -0.334 ], "z_axis": [ 0.006, 0.351, 0.936 ], "quaternion": [ 0.974, -0.176, 0.029, 0.143 ] } }, { "index": 377, "index_chain": 180, "chain_name": "J", "nt_resnum": 180, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/180", "linked_nts": [ "///J/179", "///J/181" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -82.728, "beta": -177.394, "gamma": 58.084, "delta": 145.695, "epsilon": -171.035, "zeta": -107.188, "epsilon_zeta": -63.847, "bb_type": "BI", "chi": -107.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.769, 8.275, -1.757 ], "P_xyz": [ 0.746, 8.946, -1.420 ], "form": "B", "ssZp": 1.885, "Dp": 1.975, "splay_angle": 19.499, "splay_distance": 3.276, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 157.483, "theta": -131.326, "eta_prime": -175.348, "theta_prime": -150.006, "eta_base": -130.870, "theta_base": -108.650, "v0": -15.072, "v1": 30.974, "v2": -34.302, "v3": 26.496, "v4": -7.414, "amplitude": 34.528, "phase_angle": 173.443, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 181.890, 160.006, 239.859 ], "x_axis": [ 0.537, 0.654, -0.533 ], "y_axis": [ -0.819, 0.556, -0.143 ], "z_axis": [ 0.203, 0.514, 0.834 ], "quaternion": [ 0.855, -0.192, 0.215, 0.430 ] } }, { "index": 378, "index_chain": 181, "chain_name": "J", "nt_resnum": 181, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/181", "linked_nts": [ "///J/180", "///J/182" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -57.985, "beta": 175.644, "gamma": 44.572, "delta": 139.073, "epsilon": -156.044, "zeta": -138.590, "epsilon_zeta": -17.453, "bb_type": "--", "chi": -101.239, "glyco_bond": "anti", "C5prime_xyz": [ -2.368, 8.207, -2.138 ], "P_xyz": [ -0.046, 9.397, -2.307 ], "form": "B", "ssZp": 2.008, "Dp": 2.106, "splay_angle": 21.495, "splay_distance": 3.643, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 170.043, "theta": -159.152, "eta_prime": -166.300, "theta_prime": -167.976, "eta_base": -118.833, "theta_base": -121.566, "v0": -26.130, "v1": 37.395, "v2": -33.817, "v3": 19.630, "v4": 3.847, "amplitude": 37.206, "phase_angle": 155.359, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 182.632, 162.024, 242.331 ], "x_axis": [ -0.049, 0.872, -0.488 ], "y_axis": [ -0.952, 0.106, 0.286 ], "z_axis": [ 0.301, 0.478, 0.825 ], "quaternion": [ 0.686, -0.070, 0.287, 0.665 ] } }, { "index": 379, "index_chain": 182, "chain_name": "J", "nt_resnum": 182, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/182", "linked_nts": [ "///J/181", "///J/183" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.575, "beta": 139.607, "gamma": 60.348, "delta": 131.607, "epsilon": -159.274, "zeta": -116.843, "epsilon_zeta": -42.431, "bb_type": "BI", "chi": -123.932, "glyco_bond": "anti", "C5prime_xyz": [ -2.345, 8.695, -1.267 ], "P_xyz": [ 0.220, 9.167, -1.444 ], "form": "B", "ssZp": 2.305, "Dp": 2.302, "splay_angle": 21.097, "splay_distance": 3.539, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 169.358, "theta": -139.870, "eta_prime": -163.587, "theta_prime": -157.950, "eta_base": -114.269, "theta_base": -127.348, "v0": -31.270, "v1": 37.638, "v2": -29.525, "v3": 12.348, "v4": 11.654, "amplitude": 36.918, "phase_angle": 143.104, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 183.010, 163.853, 245.458 ], "x_axis": [ -0.592, 0.770, -0.237 ], "y_axis": [ -0.752, -0.423, 0.505 ], "z_axis": [ 0.289, 0.477, 0.830 ], "quaternion": [ 0.451, 0.015, 0.291, 0.843 ] } }, { "index": 380, "index_chain": 183, "chain_name": "J", "nt_resnum": 183, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/183", "linked_nts": [ "///J/182", "///J/184" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -61.155, "beta": 167.424, "gamma": 53.327, "delta": 139.476, "epsilon": -141.893, "zeta": -138.470, "epsilon_zeta": -3.423, "bb_type": "--", "chi": -109.504, "glyco_bond": "anti", "C5prime_xyz": [ -2.527, 8.380, -1.790 ], "P_xyz": [ -0.161, 9.511, -1.884 ], "form": ".", "ssZp": 1.910, "Dp": 1.923, "splay_angle": 28.036, "splay_distance": 4.677, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 176.338, "theta": -156.476, "eta_prime": -162.271, "theta_prime": -158.738, "eta_base": -127.200, "theta_base": -101.685, "v0": -29.788, "v1": 40.807, "v2": -35.653, "v3": 19.512, "v4": 6.161, "amplitude": 40.213, "phase_angle": 152.449, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 184.531, 165.545, 248.169 ], "x_axis": [ -0.891, 0.441, 0.108 ], "y_axis": [ -0.291, -0.736, 0.611 ], "z_axis": [ 0.349, 0.513, 0.784 ], "quaternion": [ 0.198, 0.124, 0.304, 0.923 ] } }, { "index": 381, "index_chain": 184, "chain_name": "J", "nt_resnum": 184, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/184", "linked_nts": [ "///J/183", "///J/185" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.560, "beta": 158.956, "gamma": 61.951, "delta": 149.524, "epsilon": 172.993, "zeta": -90.724, "epsilon_zeta": -96.283, "bb_type": "BI", "chi": -98.791, "glyco_bond": "anti", "C5prime_xyz": [ -1.738, 7.885, -2.078 ], "P_xyz": [ 0.883, 7.752, -2.200 ], "form": ".", "ssZp": 1.845, "Dp": 1.933, "splay_angle": 18.614, "splay_distance": 3.385, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 154.891, "theta": -110.678, "eta_prime": -162.521, "theta_prime": -152.128, "eta_base": -105.740, "theta_base": -128.871, "v0": -9.200, "v1": 27.451, "v2": -34.222, "v3": 29.850, "v4": -13.222, "amplitude": 34.285, "phase_angle": 183.489, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 185.310, 165.840, 252.771 ], "x_axis": [ -0.813, -0.325, 0.482 ], "y_axis": [ 0.509, -0.799, 0.320 ], "z_axis": [ 0.282, 0.505, 0.816 ], "quaternion": [ -0.225, 0.206, 0.223, 0.926 ] } }, { "index": 382, "index_chain": 185, "chain_name": "J", "nt_resnum": 185, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/185", "linked_nts": [ "///J/184", "///J/186" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.381, "beta": -168.937, "gamma": 28.153, "delta": 131.880, "epsilon": -161.190, "zeta": -116.713, "epsilon_zeta": -44.478, "bb_type": "BI", "chi": -103.545, "glyco_bond": "anti", "C5prime_xyz": [ -2.670, 8.181, -2.144 ], "P_xyz": [ -1.024, 10.218, -2.127 ], "form": ".", "ssZp": 2.132, "Dp": 2.239, "splay_angle": 26.719, "splay_distance": 4.491, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 171.193, "theta": -155.325, "eta_prime": -172.450, "theta_prime": -153.287, "eta_base": -140.232, "theta_base": -103.160, "v0": -31.054, "v1": 37.976, "v2": -30.277, "v3": 13.300, "v4": 10.882, "amplitude": 37.218, "phase_angle": 144.442, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 185.329, 168.218, 255.180 ], "x_axis": [ -0.531, -0.669, 0.519 ], "y_axis": [ 0.826, -0.546, 0.140 ], "z_axis": [ 0.190, 0.503, 0.843 ], "quaternion": [ -0.437, 0.207, 0.188, 0.854 ] } }, { "index": 383, "index_chain": 186, "chain_name": "J", "nt_resnum": 186, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/186", "linked_nts": [ "///J/185", "///J/187" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.655, "beta": 151.286, "gamma": 60.068, "delta": 135.525, "epsilon": -130.319, "zeta": -163.578, "epsilon_zeta": 33.259, "bb_type": "--", "chi": -110.380, "glyco_bond": "anti", "C5prime_xyz": [ -2.871, 8.327, -1.795 ], "P_xyz": [ -0.505, 9.286, -2.330 ], "form": "B", "ssZp": 1.834, "Dp": 1.827, "splay_angle": 19.854, "splay_distance": 3.367, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -173.205, "theta": -167.208, "eta_prime": -146.580, "theta_prime": -178.227, "eta_base": -98.370, "theta_base": -147.173, "v0": -34.884, "v1": 43.037, "v2": -34.268, "v3": 15.341, "v4": 11.883, "amplitude": 41.949, "phase_angle": 144.777, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 186.466, 168.417, 259.520 ], "x_axis": [ 0.142, -0.879, 0.455 ], "y_axis": [ 0.979, 0.057, -0.195 ], "z_axis": [ 0.145, 0.473, 0.869 ], "quaternion": [ 0.719, -0.232, -0.108, -0.646 ] } }, { "index": 384, "index_chain": 187, "chain_name": "J", "nt_resnum": 187, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/187", "linked_nts": [ "///J/186", "///J/188" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.353, "beta": 137.117, "gamma": 32.471, "delta": 124.342, "epsilon": -175.765, "zeta": -94.410, "epsilon_zeta": -81.355, "bb_type": "BI", "chi": -117.936, "glyco_bond": "anti", "C5prime_xyz": [ -2.430, 8.575, -1.650 ], "P_xyz": [ -0.002, 9.497, -1.357 ], "form": "B", "ssZp": 2.424, "Dp": 2.463, "splay_angle": 20.461, "splay_distance": 3.588, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 161.951, "theta": -132.748, "eta_prime": 179.372, "theta_prime": -146.885, "eta_base": -145.646, "theta_base": -98.047, "v0": -31.525, "v1": 33.890, "v2": -23.697, "v3": 6.254, "v4": 15.698, "amplitude": 33.958, "phase_angle": 134.253, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 186.289, 170.851, 261.841 ], "x_axis": [ 0.604, -0.741, 0.294 ], "y_axis": [ 0.783, 0.485, -0.389 ], "z_axis": [ 0.146, 0.465, 0.873 ], "quaternion": [ 0.860, -0.248, -0.043, -0.443 ] } }, { "index": 385, "index_chain": 188, "chain_name": "J", "nt_resnum": 188, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/188", "linked_nts": [ "///J/187", "///J/189" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.288, "beta": 163.439, "gamma": 54.109, "delta": 124.908, "epsilon": -167.554, "zeta": -123.538, "epsilon_zeta": -44.016, "bb_type": "BI", "chi": -123.312, "glyco_bond": "anti", "C5prime_xyz": [ -2.861, 8.623, -1.430 ], "P_xyz": [ -0.733, 10.132, -1.462 ], "form": "B", "ssZp": 2.433, "Dp": 2.448, "splay_angle": 20.001, "splay_distance": 3.286, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 173.419, "theta": -165.243, "eta_prime": -157.991, "theta_prime": -171.119, "eta_base": -100.343, "theta_base": -130.876, "v0": -38.265, "v1": 40.573, "v2": -27.442, "v3": 6.403, "v4": 19.635, "amplitude": 40.595, "phase_angle": 132.531, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 187.855, 171.123, 265.057 ], "x_axis": [ 0.959, -0.282, 0.003 ], "y_axis": [ 0.257, 0.869, -0.424 ], "z_axis": [ 0.117, 0.407, 0.906 ], "quaternion": [ 0.966, -0.215, 0.029, -0.140 ] } }, { "index": 386, "index_chain": 189, "chain_name": "J", "nt_resnum": 189, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/189", "linked_nts": [ "///J/188", "///J/190" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.811, "beta": 166.777, "gamma": 55.336, "delta": 139.344, "epsilon": -174.947, "zeta": -98.252, "epsilon_zeta": -76.695, "bb_type": "BI", "chi": -118.358, "glyco_bond": "anti", "C5prime_xyz": [ -2.120, 8.587, -1.377 ], "P_xyz": [ 0.342, 9.440, -1.096 ], "form": "B", "ssZp": 2.181, "Dp": 2.222, "splay_angle": 19.643, "splay_distance": 3.407, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.534, "theta": -128.347, "eta_prime": -167.636, "theta_prime": -148.559, "eta_base": -123.167, "theta_base": -99.977, "v0": -25.201, "v1": 36.663, "v2": -33.651, "v3": 20.023, "v4": 2.992, "amplitude": 36.669, "phase_angle": 156.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 187.947, 171.967, 268.232 ], "x_axis": [ 0.923, 0.318, -0.216 ], "y_axis": [ -0.374, 0.874, -0.311 ], "z_axis": [ 0.089, 0.368, 0.925 ], "quaternion": [ 0.965, -0.176, 0.079, 0.179 ] } }, { "index": 387, "index_chain": 190, "chain_name": "J", "nt_resnum": 190, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/190", "linked_nts": [ "///J/189", "///J/191" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.494, "beta": 173.047, "gamma": 53.730, "delta": 130.717, "epsilon": -167.884, "zeta": -120.481, "epsilon_zeta": -47.403, "bb_type": "BI", "chi": -119.384, "glyco_bond": "anti", "C5prime_xyz": [ -2.632, 8.570, -1.506 ], "P_xyz": [ -0.446, 10.011, -1.414 ], "form": "B", "ssZp": 2.395, "Dp": 2.391, "splay_angle": 20.089, "splay_distance": 3.295, "splay_ratio": 0.174, "d22": 4.696, "d64": 3.908, "eta": 166.744, "theta": -160.151, "eta_prime": -165.983, "theta_prime": -166.760, "eta_base": -107.157, "theta_base": -129.466, "v0": -34.567, "v1": 40.379, "v2": -30.559, "v3": 11.649, "v4": 14.057, "amplitude": 39.567, "phase_angle": 140.564, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 189.485, 173.338, 270.945 ], "x_axis": [ 0.474, 0.814, -0.336 ], "y_axis": [ -0.873, 0.484, -0.060 ], "z_axis": [ 0.114, 0.322, 0.940 ], "quaternion": [ 0.851, -0.112, 0.132, 0.495 ] } }, { "index": 388, "index_chain": 191, "chain_name": "J", "nt_resnum": 191, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/191", "linked_nts": [ "///J/190", "///J/192" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.222, "beta": 172.151, "gamma": 59.776, "delta": 140.982, "epsilon": -165.506, "zeta": -114.737, "epsilon_zeta": -50.769, "bb_type": "BI", "chi": -119.473, "glyco_bond": "anti", "C5prime_xyz": [ -1.952, 8.634, -1.304 ], "P_xyz": [ 0.545, 9.389, -1.016 ], "form": "B", "ssZp": 2.158, "Dp": 2.168, "splay_angle": 19.875, "splay_distance": 3.310, "splay_ratio": 0.173, "d22": 4.559, "d64": 3.900, "eta": 166.723, "theta": -140.433, "eta_prime": -170.942, "theta_prime": -156.359, "eta_base": -128.678, "theta_base": -119.576, "v0": -24.622, "v1": 36.994, "v2": -34.623, "v3": 21.331, "v4": 1.846, "amplitude": 37.231, "phase_angle": 158.427, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 190.206, 173.993, 274.092 ], "x_axis": [ -0.156, 0.913, -0.377 ], "y_axis": [ -0.980, -0.096, 0.175 ], "z_axis": [ 0.123, 0.397, 0.910 ], "quaternion": [ 0.644, -0.086, 0.194, 0.735 ] } }, { "index": 389, "index_chain": 192, "chain_name": "J", "nt_resnum": 192, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/192", "linked_nts": [ "///J/191", "///J/193" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.909, "beta": 170.223, "gamma": 58.500, "delta": 138.629, "epsilon": -165.409, "zeta": -112.802, "epsilon_zeta": -52.607, "bb_type": "BI", "chi": -118.477, "glyco_bond": "anti", "C5prime_xyz": [ -2.137, 8.627, -1.406 ], "P_xyz": [ 0.324, 9.528, -1.234 ], "form": "B", "ssZp": 2.219, "Dp": 2.224, "splay_angle": 16.728, "splay_distance": 2.768, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 164.247, "theta": -141.318, "eta_prime": -169.712, "theta_prime": -155.576, "eta_base": -124.695, "theta_base": -120.825, "v0": -27.493, "v1": 38.211, "v2": -33.840, "v3": 18.962, "v4": 5.081, "amplitude": 37.798, "phase_angle": 153.545, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 190.993, 175.215, 277.066 ], "x_axis": [ -0.700, 0.684, -0.207 ], "y_axis": [ -0.702, -0.607, 0.372 ], "z_axis": [ 0.129, 0.406, 0.905 ], "quaternion": [ 0.387, -0.022, 0.217, 0.896 ] } }, { "index": 390, "index_chain": 193, "chain_name": "J", "nt_resnum": 193, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/193", "linked_nts": [ "///J/192", "///J/194" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -74.226, "beta": 173.970, "gamma": 57.000, "delta": 140.891, "epsilon": -161.375, "zeta": -133.427, "epsilon_zeta": -27.947, "bb_type": "--", "chi": -108.035, "glyco_bond": "anti", "C5prime_xyz": [ -2.279, 8.300, -1.844 ], "P_xyz": [ 0.154, 9.279, -1.895 ], "form": "B", "ssZp": 2.068, "Dp": 2.109, "splay_angle": 18.971, "splay_distance": 3.134, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 162.537, "theta": -155.721, "eta_prime": -172.090, "theta_prime": -168.570, "eta_base": -130.242, "theta_base": -128.965, "v0": -25.549, "v1": 37.779, "v2": -34.994, "v3": 21.222, "v4": 2.445, "amplitude": 37.869, "phase_angle": 157.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 191.559, 176.445, 279.480 ], "x_axis": [ -0.983, 0.183, -0.005 ], "y_axis": [ -0.156, -0.821, 0.550 ], "z_axis": [ 0.096, 0.542, 0.835 ], "quaternion": [ 0.089, 0.024, 0.286, 0.954 ] } }, { "index": 391, "index_chain": 194, "chain_name": "J", "nt_resnum": 194, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/194", "linked_nts": [ "///J/193", "///J/195" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.914, "beta": 160.625, "gamma": 50.826, "delta": 138.566, "epsilon": -167.552, "zeta": -112.022, "epsilon_zeta": -55.530, "bb_type": "BI", "chi": -111.864, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 8.425, -1.681 ], "P_xyz": [ 0.526, 9.033, -1.630 ], "form": "B", "ssZp": 2.178, "Dp": 2.206, "splay_angle": 22.996, "splay_distance": 3.847, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 167.152, "theta": -134.913, "eta_prime": -170.262, "theta_prime": -152.058, "eta_base": -126.501, "theta_base": -100.389, "v0": -21.402, "v1": 32.902, "v2": -31.307, "v3": 19.783, "v4": 0.797, "amplitude": 33.343, "phase_angle": 159.870, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 192.272, 178.009, 282.100 ], "x_axis": [ -0.883, -0.320, 0.343 ], "y_axis": [ 0.460, -0.734, 0.499 ], "z_axis": [ 0.092, 0.599, 0.796 ], "quaternion": [ -0.211, 0.118, 0.297, 0.924 ] } }, { "index": 392, "index_chain": 195, "chain_name": "J", "nt_resnum": 195, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/195", "linked_nts": [ "///J/194", "///J/196" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -50.733, "beta": 158.775, "gamma": 55.426, "delta": 130.219, "epsilon": -140.936, "zeta": -138.488, "epsilon_zeta": -2.449, "bb_type": "--", "chi": -114.982, "glyco_bond": "anti", "C5prime_xyz": [ -2.385, 8.545, -1.671 ], "P_xyz": [ 0.078, 9.383, -1.938 ], "form": ".", "ssZp": 2.101, "Dp": 2.157, "splay_angle": 29.820, "splay_distance": 5.037, "splay_ratio": 0.267, "d22": 5.666, "d64": 4.797, "eta": -178.613, "theta": -157.930, "eta_prime": -155.007, "theta_prime": -160.437, "eta_base": -98.553, "theta_base": -113.595, "v0": -30.895, "v1": 36.471, "v2": -28.005, "v3": 11.048, "v4": 12.268, "amplitude": 35.789, "phase_angle": 141.489, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 192.038, 179.265, 285.728 ], "x_axis": [ -0.325, -0.661, 0.676 ], "y_axis": [ 0.942, -0.288, 0.171 ], "z_axis": [ 0.082, 0.693, 0.716 ], "quaternion": [ 0.525, -0.248, -0.283, -0.763 ] } }, { "index": 393, "index_chain": 196, "chain_name": "J", "nt_resnum": 196, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/196", "linked_nts": [ "///J/195", "///J/197" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.350, "beta": 145.077, "gamma": 63.103, "delta": 140.419, "epsilon": -163.491, "zeta": -116.465, "epsilon_zeta": -47.026, "bb_type": "BI", "chi": -110.367, "glyco_bond": "anti", "C5prime_xyz": [ -2.062, 8.422, -1.722 ], "P_xyz": [ 0.532, 8.452, -2.120 ], "form": "B", "ssZp": 2.182, "Dp": 2.185, "splay_angle": 25.064, "splay_distance": 4.216, "splay_ratio": 0.217, "d22": 4.788, "d64": 4.330, "eta": 168.418, "theta": -130.744, "eta_prime": -156.676, "theta_prime": -156.768, "eta_base": -110.603, "theta_base": -119.114, "v0": -22.782, "v1": 34.820, "v2": -32.961, "v3": 20.744, "v4": 1.048, "amplitude": 35.187, "phase_angle": 159.511, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 194.185, 182.071, 289.319 ], "x_axis": [ 0.397, -0.654, 0.644 ], "y_axis": [ 0.910, 0.190, -0.369 ], "z_axis": [ 0.119, 0.732, 0.670 ], "quaternion": [ 0.751, -0.367, -0.175, -0.520 ] } }, { "index": 394, "index_chain": 197, "chain_name": "J", "nt_resnum": 197, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/197", "linked_nts": [ "///J/196", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -57.730, "beta": 164.208, "gamma": 57.209, "delta": 133.613, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -115.513, "glyco_bond": "anti", "C5prime_xyz": [ -2.355, 8.569, -1.622 ], "P_xyz": [ 0.089, 9.510, -1.746 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -30.429, "v1": 38.090, "v2": -30.950, "v3": 14.346, "v4": 9.823, "amplitude": 37.287, "phase_angle": 146.105, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 195.092, 184.973, 292.239 ], "x_axis": [ 0.858, -0.415, 0.301 ], "y_axis": [ 0.495, 0.519, -0.697 ], "z_axis": [ 0.133, 0.747, 0.651 ], "quaternion": [ 0.870, -0.415, -0.048, -0.262 ] } } ], "num_hbonds": 1997, "hbonds": [ { "index": 1, "atom1_serNum": 37, "atom2_serNum": 8289, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/40/NH2", "atom2_id": "///I/108/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2, "atom1_serNum": 38, "atom2_serNum": 8306, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/41/N", "atom2_id": "///I/109/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 3, "atom1_serNum": 50, "atom2_serNum": 13585, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/42/N", "atom2_id": "///J/169/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 4, "atom1_serNum": 53, "atom2_serNum": 72, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///A/42/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 57, "atom2_serNum": 12041, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/42/NE", "atom2_id": "///J/94/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 59, "atom2_serNum": 13605, "donAcc_type": "standard", "distance": 2.436, "atom1_id": "///A/42/NH1", "atom2_id": "///J/170/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 7, "atom1_serNum": 60, "atom2_serNum": 12041, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/42/NH2", "atom2_id": "///J/94/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 8, "atom1_serNum": 68, "atom2_serNum": 8284, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/44/N", "atom2_id": "///I/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 9, "atom1_serNum": 71, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/44/O", "atom2_id": "///B/44/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 72, "atom2_serNum": 8284, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/45/N", "atom2_id": "///I/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 11, "atom1_serNum": 75, "atom2_serNum": 99, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 79, "atom2_serNum": 8284, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/46/N", "atom2_id": "///I/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 13, "atom1_serNum": 82, "atom2_serNum": 110, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 86, "atom2_serNum": 8284, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/47/N", "atom2_id": "///I/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 15, "atom1_serNum": 89, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 94, "atom2_serNum": 127, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 102, "atom2_serNum": 138, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 113, "atom2_serNum": 149, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 117, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///A/50/OE1", "atom2_id": "///B/39/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 122, "atom2_serNum": 161, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 130, "atom2_serNum": 170, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 141, "atom2_serNum": 170, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/53/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 141, "atom2_serNum": 179, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 152, "atom2_serNum": 970, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/54/O", "atom2_id": "///B/40/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 164, "atom2_serNum": 5069, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/55/O", "atom2_id": "///G/81/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 164, "atom2_serNum": 5266, "donAcc_type": "questionable", "distance": 3.164, "atom1_id": "///A/55/O", "atom2_id": "///G/107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 168, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/55/OE1", "atom2_id": "///G/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 169, "atom2_serNum": 966, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///A/55/NE2", "atom2_id": "///B/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 169, "atom2_serNum": 5288, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/55/NE2", "atom2_id": "///G/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 173, "atom2_serNum": 5069, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/56/O", "atom2_id": "///G/81/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 184, "atom2_serNum": 200, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///A/57/OG", "atom2_id": "///A/59/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 184, "atom2_serNum": 973, "donAcc_type": "acceptable", "distance": 3.297, "atom1_id": "///A/57/OG", "atom2_id": "///B/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 192, "atom2_serNum": 199, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///A/59/N", "atom2_id": "///A/59/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 195, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/59/O", "atom2_id": "///B/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 195, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/59/O", "atom2_id": "///B/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 209, "atom2_serNum": 511, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/61/N", "atom2_id": "///A/97/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 212, "atom2_serNum": 935, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/61/O", "atom2_id": "///B/36/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 212, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/61/O", "atom2_id": "///B/36/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 217, "atom2_serNum": 512, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/62/N", "atom2_id": "///A/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 220, "atom2_serNum": 483, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/62/O", "atom2_id": "///A/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 228, "atom2_serNum": 260, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 232, "atom2_serNum": 8455, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///A/63/NE", "atom2_id": "///I/116/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 43, "atom1_serNum": 232, "atom2_serNum": 8469, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///A/63/NE", "atom2_id": "///I/117/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 44, "atom1_serNum": 234, "atom2_serNum": 11873, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///A/63/NH1", "atom2_id": "///J/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 45, "atom1_serNum": 236, "atom2_serNum": 8469, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/64/N", "atom2_id": "///I/117/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 46, "atom1_serNum": 239, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 245, "atom2_serNum": 8470, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/65/N", "atom2_id": "///I/117/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 48, "atom1_serNum": 248, "atom2_serNum": 280, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 256, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 263, "atom2_serNum": 299, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 274, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 283, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 287, "atom2_serNum": 851, "donAcc_type": "questionable", "distance": 3.289, "atom1_id": "///A/69/NE", "atom2_id": "///B/25/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 289, "atom2_serNum": 8449, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/69/NH1", "atom2_id": "///I/116/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 290, "atom2_serNum": 8448, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/69/NH2", "atom2_id": "///I/116/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 56, "atom1_serNum": 290, "atom2_serNum": 8449, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/69/NH2", "atom2_id": "///I/116/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 57, "atom1_serNum": 294, "atom2_serNum": 326, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 302, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 309, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 315, "atom2_serNum": 11664, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/72/NH1", "atom2_id": "///J/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 61, "atom1_serNum": 316, "atom2_serNum": 11664, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/72/NH2", "atom2_id": "///J/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 62, "atom1_serNum": 316, "atom2_serNum": 11665, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/72/NH2", "atom2_id": "///J/76/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 63, "atom1_serNum": 324, "atom2_serNum": 1118, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/73/OE1", "atom2_id": "///B/59/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 325, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/73/OE2", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 325, "atom2_serNum": 850, "donAcc_type": "questionable", "distance": 2.798, "atom1_id": "///A/73/OE2", "atom2_id": "///B/25/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 329, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/74/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 337, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/75/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 337, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 375, "atom2_serNum": 1270, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/79/NZ", "atom2_id": "///B/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 399, "atom2_serNum": 1281, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/83/N", "atom2_id": "///B/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 402, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/83/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 409, "atom2_serNum": 11656, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///A/83/NH2", "atom2_id": "///J/75/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 73, "atom1_serNum": 410, "atom2_serNum": 11664, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///A/84/N", "atom2_id": "///J/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 74, "atom1_serNum": 413, "atom2_serNum": 11665, "donAcc_type": "questionable", "distance": 2.997, "atom1_id": "///A/84/O", "atom2_id": "///J/76/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 75, "atom1_serNum": 421, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/85/N", "atom2_id": "///B/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 424, "atom2_serNum": 442, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/85/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 424, "atom2_serNum": 447, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 428, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/85/OE1", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 429, "atom2_serNum": 11644, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/85/NE2", "atom2_id": "///J/75/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 80, "atom1_serNum": 430, "atom2_serNum": 11645, "donAcc_type": "standard", "distance": 3.832, "atom1_id": "///A/86/N", "atom2_id": "///J/75/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 433, "atom2_serNum": 454, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 439, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 445, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 450, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 457, "atom2_serNum": 484, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 465, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 470, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 478, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 483, "atom2_serNum": 512, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/93/NE2", "atom2_id": "///A/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 487, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 491, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/94/OE1", "atom2_id": "///G/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 491, "atom2_serNum": 5253, "donAcc_type": "questionable", "distance": 2.802, "atom1_id": "///A/94/OE1", "atom2_id": "///G/104/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 496, "atom2_serNum": 518, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 501, "atom2_serNum": 530, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 507, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 511, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 3.986, "atom1_id": "///A/97/OE1", "atom2_id": "///B/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 516, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 521, "atom2_serNum": 549, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 529, "atom2_serNum": 755, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///A/99/OH", "atom2_id": "///A/128/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 529, "atom2_serNum": 798, "donAcc_type": "acceptable", "distance": 2.177, "atom1_id": "///A/99/OH", "atom2_id": "///A/133/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 533, "atom2_serNum": 557, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 541, "atom2_serNum": 568, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 548, "atom2_serNum": 577, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 552, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 552, "atom2_serNum": 590, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///A/103/O", "atom2_id": "///A/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 560, "atom2_serNum": 592, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 571, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 575, "atom2_serNum": 3817, "donAcc_type": "standard", "distance": 3.921, "atom1_id": "///A/105/OE1", "atom2_id": "///E/129/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 580, "atom2_serNum": 608, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 583, "atom2_serNum": 785, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/106/OD1", "atom2_id": "///A/131/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 584, "atom2_serNum": 3816, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/106/OD2", "atom2_id": "///E/129/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 588, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 595, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 603, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 611, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 617, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/111/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 622, "atom2_serNum": 642, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/112/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 636, "atom2_serNum": 3764, "donAcc_type": "standard", "distance": 2.349, "atom1_id": "///A/113/NE2", "atom2_id": "///E/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 660, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 2.485, "atom1_id": "///A/116/NH1", "atom2_id": "///A/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 660, "atom2_serNum": 714, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/116/NH1", "atom2_id": "///A/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 661, "atom2_serNum": 714, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/116/NH2", "atom2_id": "///A/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 661, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 2.307, "atom1_id": "///A/116/NH2", "atom2_id": "///A/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 662, "atom2_serNum": 12085, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/117/N", "atom2_id": "///J/96/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 124, "atom1_serNum": 665, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/117/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 669, "atom2_serNum": 12085, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/118/N", "atom2_id": "///J/96/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 126, "atom1_serNum": 674, "atom2_serNum": 1007, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///A/118/OG1", "atom2_id": "///B/45/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 674, "atom2_serNum": 12085, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///A/118/OG1", "atom2_id": "///J/96/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 128, "atom1_serNum": 676, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/119/N", "atom2_id": "///B/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 679, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/119/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 684, "atom2_serNum": 714, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///A/120/N", "atom2_id": "///A/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 687, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 687, "atom2_serNum": 716, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 695, "atom2_serNum": 724, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 702, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 707, "atom2_serNum": 3680, "donAcc_type": "standard", "distance": 3.861, "atom1_id": "///A/122/NZ", "atom2_id": "///E/113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 711, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 715, "atom2_serNum": 3686, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/123/OD2", "atom2_id": "///E/113/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 719, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 727, "atom2_serNum": 757, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 732, "atom2_serNum": 1071, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/125/NE2", "atom2_id": "///B/53/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 736, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 744, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 749, "atom2_serNum": 787, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 749, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/128/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 760, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/129/O", "atom2_id": "///A/129/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 799, "atom2_serNum": 1411, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/133/OE2", "atom2_id": "///B/95/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 836, "atom2_serNum": 842, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///B/24/N", "atom2_id": "///B/24/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 839, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/24/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 847, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/25/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 855, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///B/26/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 868, "atom2_serNum": 1062, "donAcc_type": "standard", "distance": 3.631, "atom1_id": "///B/27/NE2", "atom2_id": "///B/52/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 872, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/28/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 876, "atom2_serNum": 1087, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/29/O", "atom2_id": "///B/55/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 876, "atom2_serNum": 1090, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///B/29/O", "atom2_id": "///B/55/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 884, "atom2_serNum": 909, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 886, "atom2_serNum": 11875, "donAcc_type": "acceptable", "distance": 3.618, "atom1_id": "///B/30/OG1", "atom2_id": "///J/86/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 157, "atom1_serNum": 891, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 900, "atom2_serNum": 928, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 907, "atom2_serNum": 939, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 912, "atom2_serNum": 947, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 920, "atom2_serNum": 952, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 924, "atom2_serNum": 1054, "donAcc_type": "acceptable", "distance": 3.788, "atom1_id": "///B/35/NE", "atom2_id": "///B/51/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 931, "atom2_serNum": 963, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 937, "atom2_serNum": 11873, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/36/NH1", "atom2_id": "///J/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 165, "atom1_serNum": 937, "atom2_serNum": 11874, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/36/NH1", "atom2_id": "///J/86/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 166, "atom1_serNum": 938, "atom2_serNum": 11873, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///B/36/NH2", "atom2_id": "///J/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 167, "atom1_serNum": 942, "atom2_serNum": 974, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 950, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 950, "atom2_serNum": 982, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/38/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 955, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/39/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 961, "atom2_serNum": 985, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///B/39/NH1", "atom2_id": "///B/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 961, "atom2_serNum": 992, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/39/NH1", "atom2_id": "///B/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1009, "atom2_serNum": 8265, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///B/46/N", "atom2_id": "///I/107/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 174, "atom1_serNum": 1020, "atom2_serNum": 1035, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/47/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1023, "atom2_serNum": 8247, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/48/N", "atom2_id": "///I/106/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 176, "atom1_serNum": 1030, "atom2_serNum": 1064, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/49/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1038, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/50/O", "atom2_id": "///B/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1038, "atom2_serNum": 1078, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///B/50/O", "atom2_id": "///B/54/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1046, "atom2_serNum": 1080, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/51/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1058, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/52/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1067, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/53/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1076, "atom2_serNum": 1102, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1083, "atom2_serNum": 1110, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1094, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1098, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1105, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1113, "atom2_serNum": 1145, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1122, "atom2_serNum": 1154, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1129, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1140, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1148, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1154, "atom2_serNum": 1160, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/64/N", "atom2_id": "///B/64/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1157, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1157, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///B/64/O", "atom2_id": "///B/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1165, "atom2_serNum": 1196, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1172, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1180, "atom2_serNum": 1208, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1180, "atom2_serNum": 1213, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///B/67/O", "atom2_id": "///B/71/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1191, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1194, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/68/OD1", "atom2_id": "///B/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1199, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1199, "atom2_serNum": 1232, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///B/69/O", "atom2_id": "///B/73/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1204, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1211, "atom2_serNum": 1243, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1218, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1226, "atom2_serNum": 2682, "donAcc_type": "acceptable", "distance": 3.285, "atom1_id": "///B/72/OH", "atom2_id": "///D/76/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1230, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/73/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1237, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/74/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1237, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///B/74/O", "atom2_id": "///D/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1241, "atom2_serNum": 2867, "donAcc_type": "standard", "distance": 3.819, "atom1_id": "///B/74/OE1", "atom2_id": "///D/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1246, "atom2_serNum": 2809, "donAcc_type": "standard", "distance": 3.670, "atom1_id": "///B/75/O", "atom2_id": "///D/92/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1249, "atom2_serNum": 2844, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///B/75/ND1", "atom2_id": "///D/96/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1274, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///B/78/NE", "atom2_id": "///B/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1277, "atom2_serNum": 1327, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/78/NH2", "atom2_id": "///B/85/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1277, "atom2_serNum": 1328, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///B/78/NH2", "atom2_id": "///B/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1278, "atom2_serNum": 8675, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/79/N", "atom2_id": "///I/127/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 217, "atom1_serNum": 1286, "atom2_serNum": 8653, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/79/NZ", "atom2_id": "///I/126/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 218, "atom1_serNum": 1286, "atom2_serNum": 8654, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/79/NZ", "atom2_id": "///I/126/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 219, "atom1_serNum": 1287, "atom2_serNum": 8675, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/80/N", "atom2_id": "///I/127/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 220, "atom1_serNum": 1301, "atom2_serNum": 1328, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///B/82/N", "atom2_id": "///B/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1304, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1306, "atom2_serNum": 1321, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///B/82/OG1", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1311, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1316, "atom2_serNum": 1343, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1324, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1332, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1339, "atom2_serNum": 1368, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1346, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1358, "atom2_serNum": 1388, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/89/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1363, "atom2_serNum": 1388, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/90/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1363, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1363, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/90/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1371, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1380, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///B/92/O", "atom2_id": "///B/92/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1400, "atom2_serNum": 5218, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/94/O", "atom2_id": "///G/99/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1410, "atom2_serNum": 5218, "donAcc_type": "questionable", "distance": 2.864, "atom1_id": "///B/95/NH1", "atom2_id": "///G/99/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1415, "atom2_serNum": 5226, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///B/96/O", "atom2_id": "///G/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1427, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/98/N", "atom2_id": "///G/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1430, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/98/O", "atom2_id": "///G/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1438, "atom2_serNum": 5667, "donAcc_type": "acceptable", "distance": 2.291, "atom1_id": "///B/98/OH", "atom2_id": "///H/68/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1439, "atom2_serNum": 5633, "donAcc_type": "acceptable", "distance": 3.504, "atom1_id": "///B/99/N", "atom2_id": "///H/64/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1462, "atom2_serNum": 5659, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/102/OXT", "atom2_id": "///H/67/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1476, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 3.749, "atom1_id": "///C/11/NE", "atom2_id": "///C/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1478, "atom2_serNum": 8989, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///C/11/NH1", "atom2_id": "///I/142/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 245, "atom1_serNum": 1478, "atom2_serNum": 9009, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///C/11/NH1", "atom2_id": "///I/143/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 246, "atom1_serNum": 1479, "atom2_serNum": 11249, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///C/11/NH2", "atom2_id": "///J/55/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 247, "atom1_serNum": 1483, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///C/12/O", "atom2_id": "///C/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1493, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///C/13/NZ", "atom2_id": "///C/14/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1494, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///C/14/N", "atom2_id": "///I/145/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 250, "atom1_serNum": 1511, "atom2_serNum": 1537, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///C/16/O", "atom2_id": "///C/19/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1511, "atom2_serNum": 1538, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///C/16/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1513, "atom2_serNum": 1532, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///C/16/OG1", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1515, "atom2_serNum": 11253, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///C/17/N", "atom2_id": "///J/56/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 254, "atom1_serNum": 1518, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1522, "atom2_serNum": 3031, "donAcc_type": "acceptable", "distance": 2.491, "atom1_id": "///C/17/NE", "atom2_id": "///D/121/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1524, "atom2_serNum": 1628, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///C/17/NH1", "atom2_id": "///C/31/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1525, "atom2_serNum": 1743, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/17/NH2", "atom2_id": "///C/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1525, "atom2_serNum": 3031, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///C/17/NH2", "atom2_id": "///D/121/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1529, "atom2_serNum": 1554, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1529, "atom2_serNum": 1558, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/18/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1531, "atom2_serNum": 1578, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///C/18/OG", "atom2_id": "///C/25/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1531, "atom2_serNum": 1593, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///C/18/OG", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1545, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/20/NE", "atom2_id": "///D/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1548, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/20/NH2", "atom2_id": "///D/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1573, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///C/24/OE1", "atom2_id": "///D/43/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1578, "atom2_serNum": 1593, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/25/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1589, "atom2_serNum": 1615, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1596, "atom2_serNum": 1622, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1603, "atom2_serNum": 1632, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1607, "atom2_serNum": 1643, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 1613, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/29/NH1", "atom2_id": "///D/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1613, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/29/NH1", "atom2_id": "///D/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1613, "atom2_serNum": 9100, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///C/29/NH1", "atom2_id": "///I/148/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 274, "atom1_serNum": 1614, "atom2_serNum": 9100, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///C/29/NH2", "atom2_id": "///I/148/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 275, "atom1_serNum": 1618, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 1625, "atom2_serNum": 1659, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/31/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 1631, "atom2_serNum": 1732, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///C/31/NE2", "atom2_id": "///C/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 1635, "atom2_serNum": 1670, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/32/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 1642, "atom2_serNum": 11231, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/32/NH2", "atom2_id": "///J/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 280, "atom1_serNum": 1646, "atom2_serNum": 1679, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/33/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 1686, "atom2_serNum": 4736, "donAcc_type": "questionable", "distance": 2.842, "atom1_id": "///C/38/O", "atom2_id": "///G/38/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 1694, "atom2_serNum": 1708, "donAcc_type": "acceptable", "distance": 2.337, "atom1_id": "///C/39/O", "atom2_id": "///C/40/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 1709, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///C/41/N", "atom2_id": "///D/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 1716, "atom2_serNum": 2773, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///C/41/OE1", "atom2_id": "///D/87/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 1718, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///C/42/N", "atom2_id": "///D/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 1721, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///C/42/O", "atom2_id": "///D/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 1728, "atom2_serNum": 8880, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///C/42/NH2", "atom2_id": "///I/137/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 288, "atom1_serNum": 1729, "atom2_serNum": 8895, "donAcc_type": "standard", "distance": 2.555, "atom1_id": "///C/43/N", "atom2_id": "///I/138/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 289, "atom1_serNum": 1736, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/44/N", "atom2_id": "///D/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 1739, "atom2_serNum": 1749, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///C/44/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 1740, "atom2_serNum": 8875, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///C/45/N", "atom2_id": "///I/137/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 292, "atom1_serNum": 1748, "atom2_serNum": 1768, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 1752, "atom2_serNum": 1780, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 1757, "atom2_serNum": 1788, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 1764, "atom2_serNum": 1793, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 1771, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/50/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 1779, "atom2_serNum": 2837, "donAcc_type": "acceptable", "distance": 3.586, "atom1_id": "///C/50/OH", "atom2_id": "///D/95/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 1783, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/51/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 1791, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 1796, "atom2_serNum": 1822, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/53/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 1801, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/54/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 1808, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/55/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 1808, "atom2_serNum": 1847, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///C/55/O", "atom2_id": "///C/59/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 1816, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/56/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 1825, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 1837, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 1845, "atom2_serNum": 1871, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 1852, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 1857, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 1862, "atom2_serNum": 15822, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///C/61/OE2", "atom2_id": "///M/251/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 1862, "atom2_serNum": 15825, "donAcc_type": "standard", "distance": 2.435, "atom1_id": "///C/61/OE2", "atom2_id": "///M/251/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 1862, "atom2_serNum": 15826, "donAcc_type": "standard", "distance": 3.730, "atom1_id": "///C/61/OE2", "atom2_id": "///M/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 1866, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 1874, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 1882, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 1886, "atom2_serNum": 14413, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///C/64/OE1", "atom2_id": "///M/49/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 1886, "atom2_serNum": 14431, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///C/64/OE1", "atom2_id": "///M/51/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 1887, "atom2_serNum": 14412, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/64/OE2", "atom2_id": "///M/49/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 1887, "atom2_serNum": 14413, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/64/OE2", "atom2_id": "///M/49/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 1887, "atom2_serNum": 14431, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///C/64/OE2", "atom2_id": "///M/51/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 1891, "atom2_serNum": 1913, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 1899, "atom2_serNum": 1918, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 1904, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 1908, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 1911, "atom2_serNum": 2481, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/68/OD1", "atom2_id": "///D/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 1916, "atom2_serNum": 1942, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/69/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 1921, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/70/O", "atom2_id": "///C/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 1921, "atom2_serNum": 1959, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///C/70/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 1926, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/71/O", "atom2_id": "///C/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 1949, "atom2_serNum": 2029, "donAcc_type": "questionable", "distance": 3.055, "atom1_id": "///C/73/ND2", "atom2_id": "///C/82/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 1967, "atom2_serNum": 9306, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///C/75/NZ", "atom2_id": "///I/158/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 332, "atom1_serNum": 1968, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///C/76/N", "atom2_id": "///I/157/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 333, "atom1_serNum": 1971, "atom2_serNum": 2502, "donAcc_type": "acceptable", "distance": 2.318, "atom1_id": "///C/76/O", "atom2_id": "///D/52/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 1971, "atom2_serNum": 2504, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///C/76/O", "atom2_id": "///D/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 1973, "atom2_serNum": 9269, "donAcc_type": "acceptable", "distance": 3.052, "atom1_id": "///C/76/OG1", "atom2_id": "///I/156/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 336, "atom1_serNum": 1973, "atom2_serNum": 9283, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///C/76/OG1", "atom2_id": "///I/157/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 337, "atom1_serNum": 1975, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/77/N", "atom2_id": "///I/157/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 338, "atom1_serNum": 1978, "atom2_serNum": 2026, "donAcc_type": "acceptable", "distance": 3.480, "atom1_id": "///C/77/O", "atom2_id": "///C/82/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 1986, "atom2_serNum": 2507, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/78/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 1989, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/78/O", "atom2_id": "///D/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 1989, "atom2_serNum": 2521, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///C/78/O", "atom2_id": "///D/55/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 1994, "atom2_serNum": 2026, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///C/79/N", "atom2_id": "///C/82/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 1997, "atom2_serNum": 2020, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/79/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 1997, "atom2_serNum": 2030, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/79/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2005, "atom2_serNum": 2038, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/80/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2012, "atom2_serNum": 2047, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/81/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2019, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/81/NH2", "atom2_id": "///C/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2019, "atom2_serNum": 3214, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/81/NH2", "atom2_id": "///E/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2019, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/81/NH2", "atom2_id": "///E/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2023, "atom2_serNum": 2055, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2033, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2041, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2045, "atom2_serNum": 2075, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///C/84/OE1", "atom2_id": "///C/88/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2045, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///C/84/OE1", "atom2_id": "///C/88/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2046, "atom2_serNum": 2212, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/84/NE2", "atom2_id": "///C/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2050, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2050, "atom2_serNum": 2086, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///C/85/O", "atom2_id": "///C/89/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2063, "atom2_serNum": 2087, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///C/87/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2063, "atom2_serNum": 2090, "donAcc_type": "questionable", "distance": 3.136, "atom1_id": "///C/87/O", "atom2_id": "///C/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2071, "atom2_serNum": 15456, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///C/88/O", "atom2_id": "///M/203/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2077, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///C/88/NH1", "atom2_id": "///C/94/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2077, "atom2_serNum": 2149, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///C/88/NH1", "atom2_id": "///C/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2078, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///C/88/NH2", "atom2_id": "///C/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2085, "atom2_serNum": 15464, "donAcc_type": "standard", "distance": 3.492, "atom1_id": "///C/89/OD1", "atom2_id": "///M/204/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2090, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/90/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2093, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/90/OD1", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2093, "atom2_serNum": 15437, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///C/90/OD1", "atom2_id": "///M/201/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2093, "atom2_serNum": 15814, "donAcc_type": "acceptable", "distance": 2.301, "atom1_id": "///C/90/OD1", "atom2_id": "///M/250/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2094, "atom2_serNum": 15814, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///C/90/OD2", "atom2_id": "///M/250/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2094, "atom2_serNum": 15824, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///C/90/OD2", "atom2_id": "///M/251/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2094, "atom2_serNum": 15825, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///C/90/OD2", "atom2_id": "///M/251/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2095, "atom2_serNum": 15437, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///C/91/N", "atom2_id": "///M/201/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2098, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/91/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2102, "atom2_serNum": 15242, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///C/91/OE1", "atom2_id": "///M/179/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2102, "atom2_serNum": 15249, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///C/91/OE1", "atom2_id": "///M/180/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2103, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///C/91/OE2", "atom2_id": "///C/95/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2103, "atom2_serNum": 15249, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///C/91/OE2", "atom2_id": "///M/180/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2107, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/92/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2111, "atom2_serNum": 15824, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/92/OE1", "atom2_id": "///M/251/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2112, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///C/92/OE2", "atom2_id": "///D/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2116, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/93/O", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2128, "atom2_serNum": 15456, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///C/94/ND2", "atom2_id": "///M/203/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2141, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///C/96/O", "atom2_id": "///D/72/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2149, "atom2_serNum": 2169, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///C/97/O", "atom2_id": "///C/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2165, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/99/NE", "atom2_id": "///F/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2168, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/99/NH2", "atom2_id": "///F/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2176, "atom2_serNum": 4465, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/101/N", "atom2_id": "///F/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2179, "atom2_serNum": 4477, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/101/O", "atom2_id": "///F/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2186, "atom2_serNum": 2205, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/102/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2191, "atom2_serNum": 4480, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/103/N", "atom2_id": "///F/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2216, "atom2_serNum": 3214, "donAcc_type": "questionable", "distance": 3.288, "atom1_id": "///C/107/O", "atom2_id": "///E/55/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2223, "atom2_serNum": 2235, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///C/108/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2235, "atom2_serNum": 3218, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///C/110/N", "atom2_id": "///E/55/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2238, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///C/110/O", "atom2_id": "///E/55/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2241, "atom2_serNum": 2243, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/110/OD1", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2254, "atom2_serNum": 2272, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/112/O", "atom2_id": "///C/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2263, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/113/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2275, "atom2_serNum": 4047, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///C/115/O", "atom2_id": "///F/44/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2313, "atom2_serNum": 2317, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///D/30/NZ", "atom2_id": "///D/31/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2313, "atom2_serNum": 9140, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///D/30/NZ", "atom2_id": "///I/150/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 401, "atom1_serNum": 2323, "atom2_serNum": 2330, "donAcc_type": "acceptable", "distance": 2.382, "atom1_id": "///D/31/NH1", "atom2_id": "///D/32/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2340, "atom2_serNum": 11194, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///D/33/NH1", "atom2_id": "///J/53/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 403, "atom1_serNum": 2341, "atom2_serNum": 9105, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "///D/33/NH2", "atom2_id": "///I/148/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 404, "atom1_serNum": 2342, "atom2_serNum": 9119, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///D/34/N", "atom2_id": "///I/149/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 405, "atom1_serNum": 2363, "atom2_serNum": 9100, "donAcc_type": "questionable", "distance": 3.353, "atom1_id": "///D/36/O", "atom2_id": "///I/148/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 406, "atom1_serNum": 2365, "atom2_serNum": 2383, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///D/36/OG", "atom2_id": "///D/38/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 2369, "atom2_serNum": 2404, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/37/O", "atom2_id": "///D/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2381, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/38/O", "atom2_id": "///D/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 2387, "atom2_serNum": 2423, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/39/O", "atom2_id": "///D/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 2395, "atom2_serNum": 2432, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/40/O", "atom2_id": "///D/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 2403, "atom2_serNum": 9078, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///D/40/OH", "atom2_id": "///I/147/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 412, "atom1_serNum": 2403, "atom2_serNum": 9080, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///D/40/OH", "atom2_id": "///I/147/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 413, "atom1_serNum": 2407, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/41/O", "atom2_id": "///D/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 2414, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/42/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 2422, "atom2_serNum": 11069, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///D/42/OH", "atom2_id": "///J/47/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 416, "atom1_serNum": 2426, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/43/O", "atom2_id": "///D/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 2435, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/44/O", "atom2_id": "///D/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 2442, "atom2_serNum": 2472, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///D/45/O", "atom2_id": "///D/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 2455, "atom2_serNum": 2485, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///D/46/NZ", "atom2_id": "///D/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 2455, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///D/46/NZ", "atom2_id": "///D/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 2468, "atom2_serNum": 2478, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///D/48/O", "atom2_id": "///D/49/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 2468, "atom2_serNum": 14413, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///D/48/O", "atom2_id": "///M/49/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 2508, "atom2_serNum": 11047, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/54/N", "atom2_id": "///J/46/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 424, "atom1_serNum": 2519, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/55/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 2522, "atom2_serNum": 11028, "donAcc_type": "standard", "distance": 2.451, "atom1_id": "///D/56/N", "atom2_id": "///J/45/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 426, "atom1_serNum": 2525, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/56/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 2527, "atom2_serNum": 11028, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///D/56/OG", "atom2_id": "///J/45/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 428, "atom1_serNum": 2527, "atom2_serNum": 11029, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///D/56/OG", "atom2_id": "///J/45/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 429, "atom1_serNum": 2531, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/57/O", "atom2_id": "///D/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 2540, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/58/O", "atom2_id": "///D/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 2545, "atom2_serNum": 2570, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///D/59/O", "atom2_id": "///D/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 2553, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/60/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 2553, "atom2_serNum": 2583, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///D/60/O", "atom2_id": "///D/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 2557, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 2565, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 2573, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 2581, "atom2_serNum": 2610, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///D/64/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 2583, "atom2_serNum": 4489, "donAcc_type": "acceptable", "distance": 3.564, "atom1_id": "///D/64/OG", "atom2_id": "///F/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 2587, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 2598, "atom2_serNum": 2626, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 2605, "atom2_serNum": 2637, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 2613, "atom2_serNum": 2646, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 2616, "atom2_serNum": 2653, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/68/OD1", "atom2_id": "///D/72/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 2617, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/68/OD2", "atom2_id": "///D/72/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 2617, "atom2_serNum": 4488, "donAcc_type": "acceptable", "distance": 2.389, "atom1_id": "///D/68/OD2", "atom2_id": "///F/98/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 2621, "atom2_serNum": 2657, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/69/O", "atom2_id": "///D/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 2629, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/70/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 2640, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/71/O", "atom2_id": "///D/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 2649, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/72/O", "atom2_id": "///D/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 2660, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/73/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 2668, "atom2_serNum": 2688, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///D/74/O", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 2673, "atom2_serNum": 2693, "donAcc_type": "acceptable", "distance": 2.624, "atom1_id": "///D/75/O", "atom2_id": "///D/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 2673, "atom2_serNum": 2694, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/75/O", "atom2_id": "///D/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 2677, "atom2_serNum": 2705, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/76/O", "atom2_id": "///D/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 2686, "atom2_serNum": 2713, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/77/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 2691, "atom2_serNum": 2718, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/78/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 2697, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///D/79/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 2708, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/80/O", "atom2_id": "///D/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 2708, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///D/80/O", "atom2_id": "///D/84/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 2716, "atom2_serNum": 2748, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///D/81/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 2716, "atom2_serNum": 2757, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/81/O", "atom2_id": "///D/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 2721, "atom2_serNum": 2748, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///D/82/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 2766, "atom2_serNum": 11465, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///D/86/NH1", "atom2_id": "///J/66/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 464, "atom1_serNum": 2768, "atom2_serNum": 11443, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///D/87/N", "atom2_id": "///J/65/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 465, "atom1_serNum": 2774, "atom2_serNum": 11443, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///D/88/N", "atom2_id": "///J/65/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 466, "atom1_serNum": 2789, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///D/90/N", "atom2_id": "///D/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 2792, "atom2_serNum": 2822, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/90/O", "atom2_id": "///D/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 2794, "atom2_serNum": 2802, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///D/90/OG1", "atom2_id": "///D/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 2794, "atom2_serNum": 2820, "donAcc_type": "acceptable", "distance": 2.219, "atom1_id": "///D/90/OG1", "atom2_id": "///D/93/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 2799, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///D/91/O", "atom2_id": "///D/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 2805, "atom2_serNum": 2839, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/92/O", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 2813, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///D/93/N", "atom2_id": "///D/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 2816, "atom2_serNum": 2846, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/93/O", "atom2_id": "///D/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 2825, "atom2_serNum": 2851, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/94/O", "atom2_id": "///D/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 2833, "atom2_serNum": 2858, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/95/O", "atom2_id": "///D/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 2837, "atom2_serNum": 2981, "donAcc_type": "acceptable", "distance": 3.748, "atom1_id": "///D/95/OE1", "atom2_id": "///D/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 2842, "atom2_serNum": 2869, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/96/O", "atom2_id": "///D/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 2849, "atom2_serNum": 2877, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/97/O", "atom2_id": "///D/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 2854, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/98/O", "atom2_id": "///D/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 2896, "atom2_serNum": 2913, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///D/103/O", "atom2_id": "///D/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 2903, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///D/104/O", "atom2_id": "///D/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 2907, "atom2_serNum": 2935, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/105/O", "atom2_id": "///D/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 2912, "atom2_serNum": 15261, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///D/105/OE2", "atom2_id": "///M/181/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 2916, "atom2_serNum": 2945, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/106/O", "atom2_id": "///D/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 2924, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/107/O", "atom2_id": "///D/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 2929, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/108/O", "atom2_id": "///D/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 2929, "atom2_serNum": 2962, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///D/108/O", "atom2_id": "///D/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 2938, "atom2_serNum": 2963, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/109/O", "atom2_id": "///D/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 2948, "atom2_serNum": 2972, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/110/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 2953, "atom2_serNum": 2976, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///D/111/O", "atom2_id": "///D/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 2953, "atom2_serNum": 2981, "donAcc_type": "acceptable", "distance": 2.774, "atom1_id": "///D/111/O", "atom2_id": "///D/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 2960, "atom2_serNum": 2983, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/112/O", "atom2_id": "///D/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 2966, "atom2_serNum": 2992, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///D/113/O", "atom2_id": "///D/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 2970, "atom2_serNum": 15843, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///D/113/OE1", "atom2_id": "///M/253/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 2975, "atom2_serNum": 2997, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/114/O", "atom2_id": "///D/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 2979, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///D/115/O", "atom2_id": "///D/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 2979, "atom2_serNum": 3009, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///D/115/O", "atom2_id": "///D/119/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 2986, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/116/O", "atom2_id": "///D/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 2995, "atom2_serNum": 3020, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///D/117/O", "atom2_id": "///D/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3000, "atom2_serNum": 3032, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/118/O", "atom2_id": "///D/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3000, "atom2_serNum": 3037, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///D/118/O", "atom2_id": "///D/122/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3007, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/119/O", "atom2_id": "///D/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3014, "atom2_serNum": 3044, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///D/120/O", "atom2_id": "///D/123/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3014, "atom2_serNum": 3045, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/120/O", "atom2_id": "///D/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3087, "atom2_serNum": 12344, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///E/40/NH2", "atom2_id": "///J/108/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 506, "atom1_serNum": 3088, "atom2_serNum": 12352, "donAcc_type": "standard", "distance": 3.488, "atom1_id": "///E/41/N", "atom2_id": "///J/109/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 507, "atom1_serNum": 3100, "atom2_serNum": 9528, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///E/42/N", "atom2_id": "///I/169/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 508, "atom1_serNum": 3103, "atom2_serNum": 3122, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///E/42/O", "atom2_id": "///E/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3107, "atom2_serNum": 9529, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///E/42/NE", "atom2_id": "///I/169/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 510, "atom1_serNum": 3110, "atom2_serNum": 9529, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///E/42/NH2", "atom2_id": "///I/169/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 511, "atom1_serNum": 3118, "atom2_serNum": 12317, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///E/44/N", "atom2_id": "///J/107/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 512, "atom1_serNum": 3118, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///E/44/N", "atom2_id": "///J/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 513, "atom1_serNum": 3122, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///E/45/N", "atom2_id": "///J/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 514, "atom1_serNum": 3125, "atom2_serNum": 3149, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///E/45/O", "atom2_id": "///E/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3127, "atom2_serNum": 9528, "donAcc_type": "acceptable", "distance": 3.242, "atom1_id": "///E/45/OG1", "atom2_id": "///I/169/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 516, "atom1_serNum": 3129, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/46/N", "atom2_id": "///J/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 517, "atom1_serNum": 3132, "atom2_serNum": 3160, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///E/46/O", "atom2_id": "///E/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 3136, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///E/47/N", "atom2_id": "///J/108/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 519, "atom1_serNum": 3139, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///E/47/O", "atom2_id": "///E/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3144, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///E/48/O", "atom2_id": "///E/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3152, "atom2_serNum": 3188, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///E/49/O", "atom2_id": "///E/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3163, "atom2_serNum": 3199, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///E/50/O", "atom2_id": "///E/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 3167, "atom2_serNum": 3210, "donAcc_type": "acceptable", "distance": 3.509, "atom1_id": "///E/50/OE1", "atom2_id": "///E/54/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 3172, "atom2_serNum": 3211, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/51/O", "atom2_id": "///E/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 3180, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///E/52/O", "atom2_id": "///E/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 3191, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///E/53/O", "atom2_id": "///E/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 3191, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///E/53/O", "atom2_id": "///E/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 3202, "atom2_serNum": 4022, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///E/54/O", "atom2_id": "///F/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 3219, "atom2_serNum": 4016, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///E/55/NE2", "atom2_id": "///F/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 3232, "atom2_serNum": 4022, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///E/57/O", "atom2_id": "///F/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 3245, "atom2_serNum": 4023, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///E/59/O", "atom2_id": "///F/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 3259, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///E/61/N", "atom2_id": "///E/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 3262, "atom2_serNum": 3985, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///E/61/O", "atom2_id": "///F/36/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 3262, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///E/61/O", "atom2_id": "///F/36/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 3267, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/62/N", "atom2_id": "///E/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 3270, "atom2_serNum": 3533, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///E/62/O", "atom2_id": "///E/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 3278, "atom2_serNum": 3310, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///E/63/O", "atom2_id": "///E/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 3286, "atom2_serNum": 12517, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///E/64/N", "atom2_id": "///J/117/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 539, "atom1_serNum": 3289, "atom2_serNum": 3321, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///E/64/O", "atom2_id": "///E/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 3295, "atom2_serNum": 12518, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/65/N", "atom2_id": "///J/117/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 541, "atom1_serNum": 3298, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///E/65/O", "atom2_id": "///E/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 3306, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///E/66/O", "atom2_id": "///E/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 3313, "atom2_serNum": 3349, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/67/O", "atom2_id": "///E/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 3324, "atom2_serNum": 3356, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///E/68/O", "atom2_id": "///E/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 3328, "atom2_serNum": 3366, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///E/68/OE1", "atom2_id": "///E/72/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 3333, "atom2_serNum": 3367, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/69/O", "atom2_id": "///E/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 3339, "atom2_serNum": 12497, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///E/69/NH1", "atom2_id": "///J/116/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 548, "atom1_serNum": 3340, "atom2_serNum": 12497, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///E/69/NH2", "atom2_id": "///J/116/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 549, "atom1_serNum": 3344, "atom2_serNum": 3376, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///E/70/O", "atom2_id": "///E/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 3352, "atom2_serNum": 3384, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///E/71/O", "atom2_id": "///E/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 3359, "atom2_serNum": 3389, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/72/O", "atom2_id": "///E/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 3365, "atom2_serNum": 7641, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///E/72/NH1", "atom2_id": "///I/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 553, "atom1_serNum": 3366, "atom2_serNum": 7641, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///E/72/NH2", "atom2_id": "///I/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 554, "atom1_serNum": 3366, "atom2_serNum": 7642, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///E/72/NH2", "atom2_id": "///I/76/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 555, "atom1_serNum": 3379, "atom2_serNum": 3398, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///E/74/O", "atom2_id": "///E/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 3387, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///E/75/O", "atom2_id": "///E/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 3387, "atom2_serNum": 3417, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///E/75/O", "atom2_id": "///E/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 3396, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 3.637, "atom1_id": "///E/76/OE1", "atom2_id": "///F/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 3397, "atom2_serNum": 3870, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///E/76/NE2", "atom2_id": "///F/22/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 3425, "atom2_serNum": 4320, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///E/79/NZ", "atom2_id": "///F/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 3439, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///E/81/OD1", "atom2_id": "///F/20/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 3449, "atom2_serNum": 4331, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///E/83/N", "atom2_id": "///F/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 3452, "atom2_serNum": 4344, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///E/83/O", "atom2_id": "///F/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 3458, "atom2_serNum": 7624, "donAcc_type": "standard", "distance": 3.818, "atom1_id": "///E/83/NH1", "atom2_id": "///I/75/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 565, "atom1_serNum": 3459, "atom2_serNum": 12688, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///E/83/NH2", "atom2_id": "///J/125/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 566, "atom1_serNum": 3460, "atom2_serNum": 7641, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///E/84/N", "atom2_id": "///I/76/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 567, "atom1_serNum": 3463, "atom2_serNum": 7642, "donAcc_type": "questionable", "distance": 2.823, "atom1_id": "///E/84/O", "atom2_id": "///I/76/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 568, "atom1_serNum": 3471, "atom2_serNum": 4347, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///E/85/N", "atom2_id": "///F/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 3474, "atom2_serNum": 3492, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///E/85/O", "atom2_id": "///E/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 3474, "atom2_serNum": 3497, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///E/85/O", "atom2_id": "///E/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 3478, "atom2_serNum": 4358, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///E/85/OE1", "atom2_id": "///F/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 3480, "atom2_serNum": 7620, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///E/86/N", "atom2_id": "///I/75/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 573, "atom1_serNum": 3483, "atom2_serNum": 3504, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///E/86/O", "atom2_id": "///E/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 3485, "atom2_serNum": 7620, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///E/86/OG", "atom2_id": "///I/75/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 575, "atom1_serNum": 3489, "atom2_serNum": 3512, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///E/87/O", "atom2_id": "///E/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 3495, "atom2_serNum": 3517, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/88/O", "atom2_id": "///E/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 3500, "atom2_serNum": 3525, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/89/O", "atom2_id": "///E/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 3507, "atom2_serNum": 3534, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///E/90/O", "atom2_id": "///E/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 3515, "atom2_serNum": 3543, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///E/91/O", "atom2_id": "///E/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 3520, "atom2_serNum": 3548, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///E/92/O", "atom2_id": "///E/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 3528, "atom2_serNum": 3554, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///E/93/O", "atom2_id": "///E/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 3533, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///E/93/NE2", "atom2_id": "///E/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 3537, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///E/94/O", "atom2_id": "///E/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 3546, "atom2_serNum": 3568, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///E/95/O", "atom2_id": "///E/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 3551, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///E/96/O", "atom2_id": "///E/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 3557, "atom2_serNum": 3588, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///E/97/O", "atom2_id": "///E/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 3566, "atom2_serNum": 3595, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///E/98/O", "atom2_id": "///E/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 3571, "atom2_serNum": 3599, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///E/99/O", "atom2_id": "///E/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 3579, "atom2_serNum": 3805, "donAcc_type": "acceptable", "distance": 3.507, "atom1_id": "///E/99/OH", "atom2_id": "///E/128/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 3579, "atom2_serNum": 3848, "donAcc_type": "acceptable", "distance": 2.258, "atom1_id": "///E/99/OH", "atom2_id": "///E/133/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 3579, "atom2_serNum": 3849, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///E/99/OH", "atom2_id": "///E/133/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 3583, "atom2_serNum": 3607, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///E/100/O", "atom2_id": "///E/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 3591, "atom2_serNum": 3618, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/101/O", "atom2_id": "///E/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 3598, "atom2_serNum": 3627, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///E/102/O", "atom2_id": "///E/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 3598, "atom2_serNum": 3836, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///E/102/O", "atom2_id": "///E/131/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 3602, "atom2_serNum": 3635, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///E/103/O", "atom2_id": "///E/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 3602, "atom2_serNum": 3640, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///E/103/O", "atom2_id": "///E/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 3610, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///E/104/O", "atom2_id": "///E/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 3621, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///E/105/O", "atom2_id": "///E/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 3630, "atom2_serNum": 3658, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///E/106/O", "atom2_id": "///E/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 3634, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///E/106/OD2", "atom2_id": "///E/131/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 3634, "atom2_serNum": 3836, "donAcc_type": "standard", "distance": 2.296, "atom1_id": "///E/106/OD2", "atom2_id": "///E/131/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 3638, "atom2_serNum": 3664, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/107/O", "atom2_id": "///E/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 3645, "atom2_serNum": 3669, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///E/108/O", "atom2_id": "///E/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 3653, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/109/O", "atom2_id": "///E/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 3661, "atom2_serNum": 3687, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///E/110/O", "atom2_id": "///E/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 3667, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///E/111/O", "atom2_id": "///E/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 3672, "atom2_serNum": 3692, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///E/112/O", "atom2_id": "///E/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 3710, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///E/116/NH1", "atom2_id": "///E/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 3710, "atom2_serNum": 3765, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///E/116/NH1", "atom2_id": "///E/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 3711, "atom2_serNum": 3764, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///E/116/NH2", "atom2_id": "///E/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 3711, "atom2_serNum": 3765, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/116/NH2", "atom2_id": "///E/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 3712, "atom2_serNum": 8045, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///E/117/N", "atom2_id": "///I/96/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 614, "atom1_serNum": 3719, "atom2_serNum": 8045, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/118/N", "atom2_id": "///I/96/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 615, "atom1_serNum": 3724, "atom2_serNum": 8045, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///E/118/OG1", "atom2_id": "///I/96/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 616, "atom1_serNum": 3726, "atom2_serNum": 4051, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///E/119/N", "atom2_id": "///F/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 3729, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///E/119/O", "atom2_id": "///F/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 3734, "atom2_serNum": 3765, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///E/120/N", "atom2_id": "///E/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 3737, "atom2_serNum": 3758, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///E/120/O", "atom2_id": "///E/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 3737, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///E/120/O", "atom2_id": "///E/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 3745, "atom2_serNum": 3774, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///E/121/O", "atom2_id": "///E/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 3752, "atom2_serNum": 3783, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///E/122/O", "atom2_id": "///E/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 3761, "atom2_serNum": 3791, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/123/O", "atom2_id": "///E/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 3769, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/124/O", "atom2_id": "///E/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 3777, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///E/125/O", "atom2_id": "///E/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 3782, "atom2_serNum": 4121, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///E/125/NE2", "atom2_id": "///F/53/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 3786, "atom2_serNum": 3818, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///E/126/O", "atom2_id": "///E/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 3794, "atom2_serNum": 3826, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///E/127/O", "atom2_id": "///E/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 3799, "atom2_serNum": 3837, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///E/128/O", "atom2_id": "///E/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 3799, "atom2_serNum": 3841, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///E/128/O", "atom2_id": "///E/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 3805, "atom2_serNum": 3848, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///E/128/NH1", "atom2_id": "///E/133/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 3810, "atom2_serNum": 3816, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///E/129/O", "atom2_id": "///E/129/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 3897, "atom2_serNum": 3919, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/25/O", "atom2_id": "///F/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 3905, "atom2_serNum": 3923, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///F/26/O", "atom2_id": "///F/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 3917, "atom2_serNum": 4139, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///F/27/OE1", "atom2_id": "///F/55/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 3918, "atom2_serNum": 4113, "donAcc_type": "standard", "distance": 3.618, "atom1_id": "///F/27/NE2", "atom2_id": "///F/52/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 3922, "atom2_serNum": 3931, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///F/28/O", "atom2_id": "///F/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 3926, "atom2_serNum": 4137, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///F/29/O", "atom2_id": "///F/55/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 3926, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///F/29/O", "atom2_id": "///F/55/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 3934, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///F/30/O", "atom2_id": "///F/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 3941, "atom2_serNum": 3967, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///F/31/O", "atom2_id": "///F/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 3950, "atom2_serNum": 3978, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///F/32/O", "atom2_id": "///F/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 3957, "atom2_serNum": 3989, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///F/33/O", "atom2_id": "///F/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 3962, "atom2_serNum": 3997, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///F/34/O", "atom2_id": "///F/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 3970, "atom2_serNum": 4002, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///F/35/O", "atom2_id": "///F/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 3981, "atom2_serNum": 4013, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///F/36/O", "atom2_id": "///F/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 3987, "atom2_serNum": 7842, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///F/36/NH1", "atom2_id": "///I/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 648, "atom1_serNum": 3987, "atom2_serNum": 7843, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///F/36/NH1", "atom2_id": "///I/86/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 649, "atom1_serNum": 3988, "atom2_serNum": 7842, "donAcc_type": "standard", "distance": 2.373, "atom1_id": "///F/36/NH2", "atom2_id": "///I/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 650, "atom1_serNum": 3992, "atom2_serNum": 4024, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///F/37/O", "atom2_id": "///F/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 4000, "atom2_serNum": 4028, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///F/38/O", "atom2_id": "///F/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 4000, "atom2_serNum": 4032, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///F/38/O", "atom2_id": "///F/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 4005, "atom2_serNum": 4028, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///F/39/O", "atom2_id": "///F/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 4011, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///F/39/NH1", "atom2_id": "///F/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 4011, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///F/39/NH1", "atom2_id": "///F/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 4057, "atom2_serNum": 12315, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///F/45/NH1", "atom2_id": "///J/107/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 657, "atom1_serNum": 4059, "atom2_serNum": 12310, "donAcc_type": "standard", "distance": 2.337, "atom1_id": "///F/46/N", "atom2_id": "///J/107/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 658, "atom1_serNum": 4070, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///F/47/O", "atom2_id": "///F/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 4072, "atom2_serNum": 12291, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///F/47/OG", "atom2_id": "///J/106/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 660, "atom1_serNum": 4073, "atom2_serNum": 12292, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///F/48/N", "atom2_id": "///J/106/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 661, "atom1_serNum": 4080, "atom2_serNum": 4114, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/49/O", "atom2_id": "///F/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 4088, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///F/50/O", "atom2_id": "///F/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 4088, "atom2_serNum": 4128, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///F/50/O", "atom2_id": "///F/54/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 4096, "atom2_serNum": 4130, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///F/51/O", "atom2_id": "///F/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 4108, "atom2_serNum": 4141, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///F/52/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 4117, "atom2_serNum": 4145, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///F/53/O", "atom2_id": "///F/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 4126, "atom2_serNum": 4152, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/54/O", "atom2_id": "///F/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 4133, "atom2_serNum": 4160, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///F/55/O", "atom2_id": "///F/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 4144, "atom2_serNum": 4169, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///F/56/O", "atom2_id": "///F/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 4148, "atom2_serNum": 4176, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///F/57/O", "atom2_id": "///F/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 4155, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///F/58/O", "atom2_id": "///F/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 4163, "atom2_serNum": 4195, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///F/59/O", "atom2_id": "///F/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 4172, "atom2_serNum": 4204, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/60/O", "atom2_id": "///F/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 4179, "atom2_serNum": 4212, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///F/61/O", "atom2_id": "///F/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 4190, "atom2_serNum": 4219, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/62/O", "atom2_id": "///F/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 4198, "atom2_serNum": 4227, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/63/O", "atom2_id": "///F/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 4204, "atom2_serNum": 4210, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///F/64/N", "atom2_id": "///F/64/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 4207, "atom2_serNum": 4238, "donAcc_type": "standard", "distance": 3.669, "atom1_id": "///F/64/O", "atom2_id": "///F/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 4207, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///F/64/O", "atom2_id": "///F/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 4215, "atom2_serNum": 4246, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/65/O", "atom2_id": "///F/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 4222, "atom2_serNum": 4251, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///F/66/O", "atom2_id": "///F/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 4230, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/67/O", "atom2_id": "///F/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 4230, "atom2_serNum": 4263, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///F/67/O", "atom2_id": "///F/71/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 4241, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///F/68/O", "atom2_id": "///F/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 4249, "atom2_serNum": 4277, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///F/69/O", "atom2_id": "///F/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 4249, "atom2_serNum": 4282, "donAcc_type": "acceptable", "distance": 2.941, "atom1_id": "///F/69/O", "atom2_id": "///F/73/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 4254, "atom2_serNum": 4284, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///F/70/O", "atom2_id": "///F/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 4261, "atom2_serNum": 4293, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///F/71/O", "atom2_id": "///F/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 4268, "atom2_serNum": 4303, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///F/72/O", "atom2_id": "///F/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 4276, "atom2_serNum": 5732, "donAcc_type": "acceptable", "distance": 2.812, "atom1_id": "///F/72/OH", "atom2_id": "///H/76/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 4280, "atom2_serNum": 4317, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/73/O", "atom2_id": "///F/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 4282, "atom2_serNum": 4378, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///F/73/OG1", "atom2_id": "///F/85/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 4287, "atom2_serNum": 4308, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///F/74/O", "atom2_id": "///F/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 4287, "atom2_serNum": 5862, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///F/74/O", "atom2_id": "///H/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 4292, "atom2_serNum": 5918, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///F/74/OE2", "atom2_id": "///H/99/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 4296, "atom2_serNum": 5862, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///F/75/O", "atom2_id": "///H/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 4299, "atom2_serNum": 5894, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///F/75/ND1", "atom2_id": "///H/96/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 4302, "atom2_serNum": 5870, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///F/75/NE2", "atom2_id": "///H/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 4316, "atom2_serNum": 7438, "donAcc_type": "standard", "distance": 3.496, "atom1_id": "///F/77/NZ", "atom2_id": "///I/66/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 700, "atom1_serNum": 4326, "atom2_serNum": 4340, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///F/78/NH1", "atom2_id": "///F/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 4326, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///F/78/NH1", "atom2_id": "///F/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 4327, "atom2_serNum": 4377, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///F/78/NH2", "atom2_id": "///F/85/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 4327, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///F/78/NH2", "atom2_id": "///F/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 4328, "atom2_serNum": 12726, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///F/79/N", "atom2_id": "///J/127/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 705, "atom1_serNum": 4342, "atom2_serNum": 12726, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///F/80/OG1", "atom2_id": "///J/127/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 706, "atom1_serNum": 4354, "atom2_serNum": 4379, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///F/82/O", "atom2_id": "///F/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 4356, "atom2_serNum": 4371, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///F/82/OG1", "atom2_id": "///F/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 4361, "atom2_serNum": 4386, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///F/83/O", "atom2_id": "///F/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 4366, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///F/84/O", "atom2_id": "///F/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 4374, "atom2_serNum": 4405, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/85/O", "atom2_id": "///F/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 4382, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///F/86/O", "atom2_id": "///F/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 4389, "atom2_serNum": 4418, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///F/87/O", "atom2_id": "///F/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 4396, "atom2_serNum": 4427, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///F/88/O", "atom2_id": "///F/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 4408, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/89/O", "atom2_id": "///F/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 4413, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///F/90/O", "atom2_id": "///F/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 4413, "atom2_serNum": 4447, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///F/90/O", "atom2_id": "///F/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 4413, "atom2_serNum": 4451, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/90/O", "atom2_id": "///F/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 4421, "atom2_serNum": 4447, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///F/91/O", "atom2_id": "///F/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 4430, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///F/92/O", "atom2_id": "///F/92/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 4496, "atom2_serNum": 4508, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///F/100/O", "atom2_id": "///F/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 4514, "atom2_serNum": 7261, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///G/10/N", "atom2_id": "///I/57/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 722, "atom1_serNum": 4519, "atom2_serNum": 13049, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///G/11/N", "atom2_id": "///J/142/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 723, "atom1_serNum": 4519, "atom2_serNum": 13057, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///G/11/N", "atom2_id": "///J/143/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 724, "atom1_serNum": 4526, "atom2_serNum": 4533, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///G/11/NE", "atom2_id": "///G/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 4528, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///G/11/NH1", "atom2_id": "///I/55/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 726, "atom1_serNum": 4528, "atom2_serNum": 13084, "donAcc_type": "standard", "distance": 2.331, "atom1_id": "///G/11/NH1", "atom2_id": "///J/144/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 727, "atom1_serNum": 4533, "atom2_serNum": 4544, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///G/12/O", "atom2_id": "///G/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 4561, "atom2_serNum": 4588, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///G/16/O", "atom2_id": "///G/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 4563, "atom2_serNum": 4582, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///G/16/OG1", "atom2_id": "///G/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 4563, "atom2_serNum": 4587, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///G/16/OG1", "atom2_id": "///G/19/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 4565, "atom2_serNum": 7229, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///G/17/N", "atom2_id": "///I/56/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 732, "atom1_serNum": 4568, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/17/O", "atom2_id": "///G/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 4572, "atom2_serNum": 6081, "donAcc_type": "acceptable", "distance": 2.468, "atom1_id": "///G/17/NE", "atom2_id": "///H/121/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 4574, "atom2_serNum": 4678, "donAcc_type": "acceptable", "distance": 3.200, "atom1_id": "///G/17/NH1", "atom2_id": "///G/31/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 4575, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///G/17/NH2", "atom2_id": "///G/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 4575, "atom2_serNum": 6081, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///G/17/NH2", "atom2_id": "///H/121/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 4579, "atom2_serNum": 4604, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///G/18/O", "atom2_id": "///G/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 4579, "atom2_serNum": 4608, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///G/18/O", "atom2_id": "///G/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 4581, "atom2_serNum": 4628, "donAcc_type": "acceptable", "distance": 2.344, "atom1_id": "///G/18/OG", "atom2_id": "///G/25/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 4581, "atom2_serNum": 4643, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///G/18/OG", "atom2_id": "///G/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 4597, "atom2_serNum": 6098, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///G/20/NH1", "atom2_id": "///H/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 4598, "atom2_serNum": 7249, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///G/20/NH2", "atom2_id": "///I/57/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 743, "atom1_serNum": 4616, "atom2_serNum": 4870, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///G/24/N", "atom2_id": "///G/56/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 4628, "atom2_serNum": 4643, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///G/25/O", "atom2_id": "///G/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 4639, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///G/26/O", "atom2_id": "///G/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 4646, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///G/27/O", "atom2_id": "///G/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 4653, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/28/O", "atom2_id": "///G/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 4657, "atom2_serNum": 4693, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///G/29/O", "atom2_id": "///G/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 4663, "atom2_serNum": 5413, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///G/29/NH1", "atom2_id": "///H/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 4663, "atom2_serNum": 13157, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///G/29/NH1", "atom2_id": "///J/148/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 751, "atom1_serNum": 4664, "atom2_serNum": 13142, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///G/29/NH2", "atom2_id": "///J/147/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 752, "atom1_serNum": 4664, "atom2_serNum": 13157, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///G/29/NH2", "atom2_id": "///J/148/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 753, "atom1_serNum": 4668, "atom2_serNum": 4701, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///G/30/O", "atom2_id": "///G/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 4675, "atom2_serNum": 4709, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///G/31/O", "atom2_id": "///G/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 4681, "atom2_serNum": 4782, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///G/31/NE2", "atom2_id": "///G/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 4685, "atom2_serNum": 4720, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///G/32/O", "atom2_id": "///G/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 4689, "atom2_serNum": 7208, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///G/32/NE", "atom2_id": "///I/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 758, "atom1_serNum": 4691, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///G/32/NH1", "atom2_id": "///H/35/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 4692, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///G/32/NH2", "atom2_id": "///H/35/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 4692, "atom2_serNum": 7208, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///G/32/NH2", "atom2_id": "///I/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 761, "atom1_serNum": 4696, "atom2_serNum": 4729, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///G/33/O", "atom2_id": "///G/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 4744, "atom2_serNum": 4758, "donAcc_type": "acceptable", "distance": 2.447, "atom1_id": "///G/39/O", "atom2_id": "///G/40/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 4744, "atom2_serNum": 5743, "donAcc_type": "acceptable", "distance": 2.682, "atom1_id": "///G/39/O", "atom2_id": "///H/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 4759, "atom2_serNum": 5821, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///G/41/N", "atom2_id": "///H/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 4768, "atom2_serNum": 5821, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///G/42/N", "atom2_id": "///H/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 4771, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///G/42/O", "atom2_id": "///H/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 4779, "atom2_serNum": 12951, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///G/43/N", "atom2_id": "///J/138/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 768, "atom1_serNum": 4786, "atom2_serNum": 5834, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///G/44/N", "atom2_id": "///H/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 4789, "atom2_serNum": 4799, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///G/44/O", "atom2_id": "///G/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 4790, "atom2_serNum": 12930, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///G/45/N", "atom2_id": "///J/137/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 771, "atom1_serNum": 4798, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///G/46/O", "atom2_id": "///G/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 4802, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///G/47/O", "atom2_id": "///G/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 4807, "atom2_serNum": 4838, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///G/48/O", "atom2_id": "///G/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 4814, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///G/49/O", "atom2_id": "///G/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 4821, "atom2_serNum": 4848, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///G/50/O", "atom2_id": "///G/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 4829, "atom2_serNum": 5887, "donAcc_type": "acceptable", "distance": 3.388, "atom1_id": "///G/50/OH", "atom2_id": "///H/95/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 4833, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///G/51/O", "atom2_id": "///G/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 4841, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///G/52/O", "atom2_id": "///G/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 4846, "atom2_serNum": 4872, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///G/53/O", "atom2_id": "///G/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 4851, "atom2_serNum": 4884, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///G/54/O", "atom2_id": "///G/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 4858, "atom2_serNum": 4892, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///G/55/O", "atom2_id": "///G/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 4858, "atom2_serNum": 4897, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///G/55/O", "atom2_id": "///G/59/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 4866, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///G/56/O", "atom2_id": "///G/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 4875, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///G/57/O", "atom2_id": "///G/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 4887, "atom2_serNum": 4913, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///G/58/O", "atom2_id": "///G/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 4895, "atom2_serNum": 4921, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///G/59/O", "atom2_id": "///G/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 4902, "atom2_serNum": 4929, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///G/60/O", "atom2_id": "///G/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 4907, "atom2_serNum": 4938, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///G/61/O", "atom2_id": "///G/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 4912, "atom2_serNum": 17603, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///G/61/OE2", "atom2_id": "///N/251/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 4912, "atom2_serNum": 17604, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///G/61/OE2", "atom2_id": "///N/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 4916, "atom2_serNum": 4946, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///G/62/O", "atom2_id": "///G/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 4924, "atom2_serNum": 4951, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///G/63/O", "atom2_id": "///G/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 4932, "atom2_serNum": 4955, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///G/64/O", "atom2_id": "///G/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 4932, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///G/64/O", "atom2_id": "///H/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 4936, "atom2_serNum": 16209, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///G/64/OE1", "atom2_id": "///N/51/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 4937, "atom2_serNum": 16209, "donAcc_type": "acceptable", "distance": 2.939, "atom1_id": "///G/64/OE2", "atom2_id": "///N/51/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 4941, "atom2_serNum": 4963, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///G/65/O", "atom2_id": "///G/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 4949, "atom2_serNum": 4968, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///G/66/O", "atom2_id": "///G/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 4954, "atom2_serNum": 4973, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///G/67/O", "atom2_id": "///G/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 4958, "atom2_serNum": 4984, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///G/68/O", "atom2_id": "///G/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 4961, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///G/68/OD1", "atom2_id": "///G/71/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 4966, "atom2_serNum": 4992, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///G/69/O", "atom2_id": "///G/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 4971, "atom2_serNum": 5000, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///G/70/O", "atom2_id": "///G/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 4971, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///G/70/O", "atom2_id": "///G/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 4976, "atom2_serNum": 5000, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///G/71/O", "atom2_id": "///G/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 4995, "atom2_serNum": 4999, "donAcc_type": "standard", "distance": 2.192, "atom1_id": "///G/73/O", "atom2_id": "///G/73/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 4998, "atom2_serNum": 5079, "donAcc_type": "standard", "distance": 3.626, "atom1_id": "///G/73/OD1", "atom2_id": "///G/82/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 5017, "atom2_serNum": 13361, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///G/75/NZ", "atom2_id": "///J/158/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 809, "atom1_serNum": 5018, "atom2_serNum": 13341, "donAcc_type": "standard", "distance": 2.461, "atom1_id": "///G/76/N", "atom2_id": "///J/157/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 810, "atom1_serNum": 5021, "atom2_serNum": 5554, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/76/O", "atom2_id": "///H/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 5023, "atom2_serNum": 13342, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///G/76/OG1", "atom2_id": "///J/157/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 812, "atom1_serNum": 5025, "atom2_serNum": 13341, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///G/77/N", "atom2_id": "///J/157/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 813, "atom1_serNum": 5028, "atom2_serNum": 5076, "donAcc_type": "acceptable", "distance": 3.748, "atom1_id": "///G/77/O", "atom2_id": "///G/82/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 5036, "atom2_serNum": 5557, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///G/78/N", "atom2_id": "///H/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 5039, "atom2_serNum": 5566, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///G/78/O", "atom2_id": "///H/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 5044, "atom2_serNum": 5076, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///G/79/N", "atom2_id": "///G/82/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 5047, "atom2_serNum": 5070, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/79/O", "atom2_id": "///G/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 5047, "atom2_serNum": 5080, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///G/79/O", "atom2_id": "///G/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 5055, "atom2_serNum": 5088, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///G/80/O", "atom2_id": "///G/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 5062, "atom2_serNum": 5097, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/81/O", "atom2_id": "///G/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 5068, "atom2_serNum": 5258, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///G/81/NH1", "atom2_id": "///G/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 5068, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///G/81/NH1", "atom2_id": "///G/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 5069, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///G/81/NH2", "atom2_id": "///G/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 5073, "atom2_serNum": 5105, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///G/82/O", "atom2_id": "///G/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 5083, "atom2_serNum": 5110, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/83/O", "atom2_id": "///G/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 5091, "atom2_serNum": 5118, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///G/84/O", "atom2_id": "///G/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 5095, "atom2_serNum": 5125, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///G/84/OE1", "atom2_id": "///G/88/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 5096, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///G/84/NE2", "atom2_id": "///G/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 5100, "atom2_serNum": 5129, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///G/85/O", "atom2_id": "///G/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 5113, "atom2_serNum": 5137, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///G/87/O", "atom2_id": "///G/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 5113, "atom2_serNum": 5140, "donAcc_type": "questionable", "distance": 3.193, "atom1_id": "///G/87/O", "atom2_id": "///G/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 5121, "atom2_serNum": 17234, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///G/88/O", "atom2_id": "///N/203/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 5127, "atom2_serNum": 5177, "donAcc_type": "standard", "distance": 2.354, "atom1_id": "///G/88/NH1", "atom2_id": "///G/94/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 5127, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///G/88/NH1", "atom2_id": "///G/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 5128, "atom2_serNum": 5222, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///G/88/NH2", "atom2_id": "///G/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 5140, "atom2_serNum": 5171, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///G/90/O", "atom2_id": "///G/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 5143, "atom2_serNum": 5145, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///G/90/OD1", "atom2_id": "///G/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 5143, "atom2_serNum": 17215, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///G/90/OD1", "atom2_id": "///N/201/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 5143, "atom2_serNum": 17592, "donAcc_type": "acceptable", "distance": 2.595, "atom1_id": "///G/90/OD1", "atom2_id": "///N/250/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 5144, "atom2_serNum": 17602, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///G/90/OD2", "atom2_id": "///N/251/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 5144, "atom2_serNum": 17603, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///G/90/OD2", "atom2_id": "///N/251/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 5145, "atom2_serNum": 17215, "donAcc_type": "acceptable", "distance": 2.499, "atom1_id": "///G/91/N", "atom2_id": "///N/201/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 5148, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///G/91/O", "atom2_id": "///G/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 5153, "atom2_serNum": 5187, "donAcc_type": "standard", "distance": 3.804, "atom1_id": "///G/91/OE2", "atom2_id": "///G/95/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 5157, "atom2_serNum": 5188, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///G/92/O", "atom2_id": "///G/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 5161, "atom2_serNum": 5954, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///G/92/OE1", "atom2_id": "///H/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 5162, "atom2_serNum": 17602, "donAcc_type": "standard", "distance": 2.465, "atom1_id": "///G/92/OE2", "atom2_id": "///N/251/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 5166, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///G/93/O", "atom2_id": "///G/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 5174, "atom2_serNum": 5204, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///G/94/O", "atom2_id": "///G/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 5178, "atom2_serNum": 17234, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///G/94/ND2", "atom2_id": "///N/203/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 5191, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///G/96/O", "atom2_id": "///H/72/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 5199, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///G/97/O", "atom2_id": "///G/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 5236, "atom2_serNum": 5255, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///G/102/O", "atom2_id": "///G/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 5246, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///G/104/N", "atom2_id": "///G/104/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 5273, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///G/108/O", "atom2_id": "///G/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 5304, "atom2_serNum": 5322, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///G/112/O", "atom2_id": "///G/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 5313, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///G/113/O", "atom2_id": "///G/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 5363, "atom2_serNum": 7168, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///H/30/NZ", "atom2_id": "///I/53/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 859, "atom1_serNum": 5367, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///H/31/O", "atom2_id": "///H/31/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 5371, "atom2_serNum": 13183, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///H/31/NE", "atom2_id": "///J/149/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 861, "atom1_serNum": 5371, "atom2_serNum": 13198, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///H/31/NE", "atom2_id": "///J/150/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 862, "atom1_serNum": 5378, "atom2_serNum": 5400, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///H/32/O", "atom2_id": "///H/34/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 5380, "atom2_serNum": 8720, "donAcc_type": "acceptable", "distance": 3.233, "atom1_id": "///H/32/OG", "atom2_id": "///I/129/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 864, "atom1_serNum": 5391, "atom2_serNum": 7153, "donAcc_type": "standard", "distance": 3.650, "atom1_id": "///H/33/NH2", "atom2_id": "///I/52/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 865, "atom1_serNum": 5392, "atom2_serNum": 13176, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///H/34/N", "atom2_id": "///J/149/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 866, "atom1_serNum": 5413, "atom2_serNum": 13157, "donAcc_type": "questionable", "distance": 3.196, "atom1_id": "///H/36/O", "atom2_id": "///J/148/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 867, "atom1_serNum": 5415, "atom2_serNum": 5428, "donAcc_type": "acceptable", "distance": 3.217, "atom1_id": "///H/36/OG", "atom2_id": "///H/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 5415, "atom2_serNum": 5433, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///H/36/OG", "atom2_id": "///H/38/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 5419, "atom2_serNum": 5454, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///H/37/O", "atom2_id": "///H/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 5431, "atom2_serNum": 5461, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/38/O", "atom2_id": "///H/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 5433, "atom2_serNum": 5627, "donAcc_type": "acceptable", "distance": 3.526, "atom1_id": "///H/38/OG", "atom2_id": "///H/63/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 5437, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///H/39/O", "atom2_id": "///H/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 5445, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///H/40/O", "atom2_id": "///H/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 5453, "atom2_serNum": 13135, "donAcc_type": "acceptable", "distance": 2.993, "atom1_id": "///H/40/OH", "atom2_id": "///J/147/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 875, "atom1_serNum": 5453, "atom2_serNum": 13137, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///H/40/OH", "atom2_id": "///J/147/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 876, "atom1_serNum": 5457, "atom2_serNum": 5489, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///H/41/O", "atom2_id": "///H/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 5464, "atom2_serNum": 5497, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///H/42/O", "atom2_id": "///H/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 5472, "atom2_serNum": 7027, "donAcc_type": "acceptable", "distance": 2.276, "atom1_id": "///H/42/OH", "atom2_id": "///I/46/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 879, "atom1_serNum": 5476, "atom2_serNum": 5506, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/43/O", "atom2_id": "///H/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 5485, "atom2_serNum": 5515, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/44/O", "atom2_id": "///H/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 5492, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///H/45/O", "atom2_id": "///H/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 5505, "atom2_serNum": 5550, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///H/46/NZ", "atom2_id": "///H/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 5539, "atom2_serNum": 5545, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///H/51/N", "atom2_id": "///H/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 5545, "atom2_serNum": 5547, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///H/51/OD1", "atom2_id": "///H/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 5545, "atom2_serNum": 5552, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///H/51/OD1", "atom2_id": "///H/52/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 5558, "atom2_serNum": 7025, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///H/54/N", "atom2_id": "///I/46/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 887, "atom1_serNum": 5569, "atom2_serNum": 5592, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///H/55/O", "atom2_id": "///H/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 5571, "atom2_serNum": 7004, "donAcc_type": "acceptable", "distance": 3.421, "atom1_id": "///H/55/OG", "atom2_id": "///I/45/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 889, "atom1_serNum": 5572, "atom2_serNum": 7005, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///H/56/N", "atom2_id": "///I/45/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 890, "atom1_serNum": 5575, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///H/56/O", "atom2_id": "///H/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 5577, "atom2_serNum": 7005, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///H/56/OG", "atom2_id": "///I/45/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 892, "atom1_serNum": 5581, "atom2_serNum": 5604, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/57/O", "atom2_id": "///H/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 5590, "atom2_serNum": 5612, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///H/58/O", "atom2_id": "///H/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 5595, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///H/59/O", "atom2_id": "///H/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 5603, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/60/O", "atom2_id": "///H/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 5603, "atom2_serNum": 5633, "donAcc_type": "acceptable", "distance": 3.007, "atom1_id": "///H/60/O", "atom2_id": "///H/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 5607, "atom2_serNum": 5634, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/61/O", "atom2_id": "///H/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 5615, "atom2_serNum": 5645, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///H/62/O", "atom2_id": "///H/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 5623, "atom2_serNum": 5652, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///H/63/O", "atom2_id": "///H/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 5631, "atom2_serNum": 5660, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///H/64/O", "atom2_id": "///H/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 5637, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///H/65/O", "atom2_id": "///H/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 5648, "atom2_serNum": 5676, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/66/O", "atom2_id": "///H/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 5655, "atom2_serNum": 5687, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///H/67/O", "atom2_id": "///H/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 5663, "atom2_serNum": 5696, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///H/68/O", "atom2_id": "///H/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 5666, "atom2_serNum": 5703, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///H/68/OD1", "atom2_id": "///H/72/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 5667, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///H/68/OD2", "atom2_id": "///H/72/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 5671, "atom2_serNum": 5707, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///H/69/O", "atom2_id": "///H/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 5679, "atom2_serNum": 5715, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/70/O", "atom2_id": "///H/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 5690, "atom2_serNum": 5720, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///H/71/O", "atom2_id": "///H/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 5699, "atom2_serNum": 5724, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///H/72/O", "atom2_id": "///H/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 5710, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///H/73/O", "atom2_id": "///H/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 5718, "atom2_serNum": 5738, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///H/74/O", "atom2_id": "///H/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 5723, "atom2_serNum": 5744, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/75/O", "atom2_id": "///H/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 5727, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///H/76/O", "atom2_id": "///H/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 5731, "atom2_serNum": 5751, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///H/76/OE1", "atom2_id": "///H/79/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 5731, "atom2_serNum": 5754, "donAcc_type": "standard", "distance": 2.434, "atom1_id": "///H/76/OE1", "atom2_id": "///H/79/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 5736, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/77/O", "atom2_id": "///H/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 5741, "atom2_serNum": 5768, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/78/O", "atom2_id": "///H/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 5747, "atom2_serNum": 5778, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///H/79/O", "atom2_id": "///H/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 5758, "atom2_serNum": 5790, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///H/80/O", "atom2_id": "///H/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 5758, "atom2_serNum": 5796, "donAcc_type": "questionable", "distance": 2.810, "atom1_id": "///H/80/O", "atom2_id": "///H/84/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 5766, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///H/81/O", "atom2_id": "///H/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 5766, "atom2_serNum": 5807, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///H/81/O", "atom2_id": "///H/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 5771, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///H/82/O", "atom2_id": "///H/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 5793, "atom2_serNum": 5816, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///H/84/O", "atom2_id": "///H/86/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 5818, "atom2_serNum": 7415, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///H/87/N", "atom2_id": "///I/65/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 927, "atom1_serNum": 5824, "atom2_serNum": 7415, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///H/88/N", "atom2_id": "///I/65/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 928, "atom1_serNum": 5839, "atom2_serNum": 5871, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///H/90/N", "atom2_id": "///H/93/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 5842, "atom2_serNum": 5872, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///H/90/O", "atom2_id": "///H/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 5844, "atom2_serNum": 5852, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///H/90/OG1", "atom2_id": "///H/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 5844, "atom2_serNum": 5871, "donAcc_type": "acceptable", "distance": 2.317, "atom1_id": "///H/90/OG1", "atom2_id": "///H/93/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 5849, "atom2_serNum": 5880, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///H/91/O", "atom2_id": "///H/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 5855, "atom2_serNum": 5889, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///H/92/O", "atom2_id": "///H/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 5855, "atom2_serNum": 5894, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///H/92/O", "atom2_id": "///H/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 5866, "atom2_serNum": 5896, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///H/93/O", "atom2_id": "///H/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 5875, "atom2_serNum": 5901, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///H/94/O", "atom2_id": "///H/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 5883, "atom2_serNum": 5908, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///H/95/O", "atom2_id": "///H/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 5887, "atom2_serNum": 6031, "donAcc_type": "acceptable", "distance": 3.558, "atom1_id": "///H/95/OE1", "atom2_id": "///H/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 5892, "atom2_serNum": 5919, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///H/96/O", "atom2_id": "///H/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 5894, "atom2_serNum": 5917, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///H/96/OG1", "atom2_id": "///H/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 5899, "atom2_serNum": 5927, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///H/97/O", "atom2_id": "///H/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 5904, "atom2_serNum": 5935, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///H/98/O", "atom2_id": "///H/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 5946, "atom2_serNum": 5963, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///H/103/O", "atom2_id": "///H/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 5953, "atom2_serNum": 5976, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///H/104/O", "atom2_id": "///H/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 5957, "atom2_serNum": 5985, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/105/O", "atom2_id": "///H/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 5962, "atom2_serNum": 17039, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///H/105/OE2", "atom2_id": "///N/181/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 5966, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///H/106/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 5974, "atom2_serNum": 6000, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///H/107/O", "atom2_id": "///H/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 5979, "atom2_serNum": 6007, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///H/108/O", "atom2_id": "///H/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 5979, "atom2_serNum": 6012, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///H/108/O", "atom2_id": "///H/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 5988, "atom2_serNum": 6013, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/109/O", "atom2_id": "///H/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 5998, "atom2_serNum": 6022, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///H/110/O", "atom2_id": "///H/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 6003, "atom2_serNum": 6026, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///H/111/O", "atom2_id": "///H/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 6003, "atom2_serNum": 6031, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///H/111/O", "atom2_id": "///H/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 6010, "atom2_serNum": 6033, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/112/O", "atom2_id": "///H/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 6016, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///H/113/O", "atom2_id": "///H/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 6020, "atom2_serNum": 17621, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///H/113/OE1", "atom2_id": "///N/253/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 6020, "atom2_serNum": 17622, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///H/113/OE1", "atom2_id": "///N/253/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 6025, "atom2_serNum": 6047, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///H/114/O", "atom2_id": "///H/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 6029, "atom2_serNum": 6054, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///H/115/O", "atom2_id": "///H/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 6029, "atom2_serNum": 6059, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///H/115/O", "atom2_id": "///H/119/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 6036, "atom2_serNum": 6061, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///H/116/O", "atom2_id": "///H/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 6045, "atom2_serNum": 6070, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///H/117/O", "atom2_id": "///H/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 6050, "atom2_serNum": 6082, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///H/118/O", "atom2_id": "///H/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 6050, "atom2_serNum": 6087, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///H/118/O", "atom2_id": "///H/122/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 6057, "atom2_serNum": 6089, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/119/O", "atom2_id": "///H/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 6064, "atom2_serNum": 6095, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/120/O", "atom2_id": "///H/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 6117, "atom2_serNum": 14176, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/1/O6", "atom2_id": "///J/197/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 969, "atom1_serNum": 6118, "atom2_serNum": 14174, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/1/N1", "atom2_id": "///J/197/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 970, "atom1_serNum": 6120, "atom2_serNum": 14173, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///I/1/N2", "atom2_id": "///J/197/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 971, "atom1_serNum": 6139, "atom2_serNum": 14157, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/2/O6", "atom2_id": "///J/196/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 972, "atom1_serNum": 6140, "atom2_serNum": 14155, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///I/2/N1", "atom2_id": "///J/196/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 973, "atom1_serNum": 6142, "atom2_serNum": 14154, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///I/2/N2", "atom2_id": "///J/196/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 974, "atom1_serNum": 6161, "atom2_serNum": 14138, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/3/O6", "atom2_id": "///J/195/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 975, "atom1_serNum": 6162, "atom2_serNum": 14136, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///I/3/N1", "atom2_id": "///J/195/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 976, "atom1_serNum": 6164, "atom2_serNum": 14135, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///I/3/N2", "atom2_id": "///J/195/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 977, "atom1_serNum": 6180, "atom2_serNum": 14119, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/4/O2", "atom2_id": "///J/194/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 978, "atom1_serNum": 6181, "atom2_serNum": 14117, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/4/N3", "atom2_id": "///J/194/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 979, "atom1_serNum": 6183, "atom2_serNum": 14116, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/4/N4", "atom2_id": "///J/194/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 980, "atom1_serNum": 6200, "atom2_serNum": 14096, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///I/5/N3", "atom2_id": "///J/193/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 981, "atom1_serNum": 6202, "atom2_serNum": 14095, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///I/5/O4", "atom2_id": "///J/193/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 982, "atom1_serNum": 6222, "atom2_serNum": 14076, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/6/O6", "atom2_id": "///J/192/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 983, "atom1_serNum": 6223, "atom2_serNum": 14074, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/6/N1", "atom2_id": "///J/192/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 984, "atom1_serNum": 6225, "atom2_serNum": 14073, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///I/6/N2", "atom2_id": "///J/192/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 985, "atom1_serNum": 6244, "atom2_serNum": 14057, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/7/O6", "atom2_id": "///J/191/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 986, "atom1_serNum": 6245, "atom2_serNum": 14055, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/7/N1", "atom2_id": "///J/191/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 987, "atom1_serNum": 6247, "atom2_serNum": 14054, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/7/N2", "atom2_id": "///J/191/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 988, "atom1_serNum": 6266, "atom2_serNum": 14037, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///I/8/N6", "atom2_id": "///J/190/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 989, "atom1_serNum": 6267, "atom2_serNum": 14035, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///I/8/N1", "atom2_id": "///J/190/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 990, "atom1_serNum": 6284, "atom2_serNum": 14018, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///I/9/O2", "atom2_id": "///J/189/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 991, "atom1_serNum": 6285, "atom2_serNum": 14016, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///I/9/N3", "atom2_id": "///J/189/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 992, "atom1_serNum": 6287, "atom2_serNum": 14015, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///I/9/N4", "atom2_id": "///J/189/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 993, "atom1_serNum": 6303, "atom2_serNum": 13996, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///I/10/O2", "atom2_id": "///J/188/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 994, "atom1_serNum": 6304, "atom2_serNum": 13994, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///I/10/N3", "atom2_id": "///J/188/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 995, "atom1_serNum": 6306, "atom2_serNum": 13993, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///I/10/N4", "atom2_id": "///J/188/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 996, "atom1_serNum": 6322, "atom2_serNum": 13974, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///I/11/O2", "atom2_id": "///J/187/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 997, "atom1_serNum": 6323, "atom2_serNum": 13972, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/11/N3", "atom2_id": "///J/187/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 998, "atom1_serNum": 6325, "atom2_serNum": 13971, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/11/N4", "atom2_id": "///J/187/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 999, "atom1_serNum": 6342, "atom2_serNum": 13951, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///I/12/N3", "atom2_id": "///J/186/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1000, "atom1_serNum": 6344, "atom2_serNum": 13950, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///I/12/O4", "atom2_id": "///J/186/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1001, "atom1_serNum": 6364, "atom2_serNum": 13930, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///I/13/N6", "atom2_id": "///J/185/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1002, "atom1_serNum": 6365, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///I/13/N1", "atom2_id": "///J/185/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1003, "atom1_serNum": 6383, "atom2_serNum": 13910, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///I/14/N3", "atom2_id": "///J/184/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1004, "atom1_serNum": 6385, "atom2_serNum": 13909, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///I/14/O4", "atom2_id": "///J/184/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1005, "atom1_serNum": 6405, "atom2_serNum": 13889, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/15/N6", "atom2_id": "///J/183/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1006, "atom1_serNum": 6406, "atom2_serNum": 13887, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///I/15/N1", "atom2_id": "///J/183/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1007, "atom1_serNum": 6423, "atom2_serNum": 13870, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///I/16/O2", "atom2_id": "///J/182/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1008, "atom1_serNum": 6424, "atom2_serNum": 13868, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/16/N3", "atom2_id": "///J/182/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1009, "atom1_serNum": 6426, "atom2_serNum": 13867, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///I/16/N4", "atom2_id": "///J/182/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1010, "atom1_serNum": 6445, "atom2_serNum": 13848, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/17/O6", "atom2_id": "///J/181/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1011, "atom1_serNum": 6446, "atom2_serNum": 13846, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///I/17/N1", "atom2_id": "///J/181/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1012, "atom1_serNum": 6448, "atom2_serNum": 13845, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/17/N2", "atom2_id": "///J/181/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1013, "atom1_serNum": 6464, "atom2_serNum": 13829, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///I/18/O2", "atom2_id": "///J/180/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1014, "atom1_serNum": 6465, "atom2_serNum": 13827, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/18/N3", "atom2_id": "///J/180/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1015, "atom1_serNum": 6467, "atom2_serNum": 13826, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/18/N4", "atom2_id": "///J/180/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1016, "atom1_serNum": 6486, "atom2_serNum": 13807, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///I/19/O6", "atom2_id": "///J/179/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1017, "atom1_serNum": 6487, "atom2_serNum": 13805, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/19/N1", "atom2_id": "///J/179/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1018, "atom1_serNum": 6489, "atom2_serNum": 13804, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///I/19/N2", "atom2_id": "///J/179/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1019, "atom1_serNum": 6508, "atom2_serNum": 13788, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/20/O6", "atom2_id": "///J/178/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1020, "atom1_serNum": 6509, "atom2_serNum": 13786, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/20/N1", "atom2_id": "///J/178/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1021, "atom1_serNum": 6511, "atom2_serNum": 13785, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///I/20/N2", "atom2_id": "///J/178/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1022, "atom1_serNum": 6527, "atom2_serNum": 13769, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///I/21/O2", "atom2_id": "///J/177/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1023, "atom1_serNum": 6528, "atom2_serNum": 13767, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/21/N3", "atom2_id": "///J/177/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1024, "atom1_serNum": 6530, "atom2_serNum": 13766, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/21/N4", "atom2_id": "///J/177/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1025, "atom1_serNum": 6546, "atom2_serNum": 13747, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///I/22/O2", "atom2_id": "///J/176/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1026, "atom1_serNum": 6547, "atom2_serNum": 13745, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/22/N3", "atom2_id": "///J/176/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1027, "atom1_serNum": 6549, "atom2_serNum": 13744, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/22/N4", "atom2_id": "///J/176/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1028, "atom1_serNum": 6568, "atom2_serNum": 13725, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/23/O6", "atom2_id": "///J/175/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1029, "atom1_serNum": 6569, "atom2_serNum": 13723, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/23/N1", "atom2_id": "///J/175/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1030, "atom1_serNum": 6571, "atom2_serNum": 13722, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///I/23/N2", "atom2_id": "///J/175/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1031, "atom1_serNum": 6587, "atom2_serNum": 13706, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///I/24/O2", "atom2_id": "///J/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1032, "atom1_serNum": 6588, "atom2_serNum": 13704, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/24/N3", "atom2_id": "///J/174/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1033, "atom1_serNum": 6590, "atom2_serNum": 13681, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///I/24/N4", "atom2_id": "///J/173/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1034, "atom1_serNum": 6590, "atom2_serNum": 13703, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/24/N4", "atom2_id": "///J/174/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1035, "atom1_serNum": 6606, "atom2_serNum": 13684, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///I/25/O2", "atom2_id": "///J/173/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1036, "atom1_serNum": 6607, "atom2_serNum": 13682, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///I/25/N3", "atom2_id": "///J/173/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1037, "atom1_serNum": 6609, "atom2_serNum": 13681, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/25/N4", "atom2_id": "///J/173/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1038, "atom1_serNum": 6625, "atom2_serNum": 13662, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///I/26/O2", "atom2_id": "///J/172/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1039, "atom1_serNum": 6626, "atom2_serNum": 13660, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/26/N3", "atom2_id": "///J/172/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1040, "atom1_serNum": 6628, "atom2_serNum": 13659, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/26/N4", "atom2_id": "///J/172/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1041, "atom1_serNum": 6645, "atom2_serNum": 13639, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/27/N3", "atom2_id": "///J/171/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1042, "atom1_serNum": 6647, "atom2_serNum": 13638, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/27/O4", "atom2_id": "///J/171/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1043, "atom1_serNum": 6667, "atom2_serNum": 13619, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///I/28/O6", "atom2_id": "///J/170/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1044, "atom1_serNum": 6668, "atom2_serNum": 13617, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/28/N1", "atom2_id": "///J/170/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1045, "atom1_serNum": 6670, "atom2_serNum": 13616, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///I/28/N2", "atom2_id": "///J/170/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1046, "atom1_serNum": 6689, "atom2_serNum": 13600, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///I/29/O6", "atom2_id": "///J/169/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1047, "atom1_serNum": 6690, "atom2_serNum": 13598, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/29/N1", "atom2_id": "///J/169/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1048, "atom1_serNum": 6692, "atom2_serNum": 13597, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///I/29/N2", "atom2_id": "///J/169/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1049, "atom1_serNum": 6711, "atom2_serNum": 13580, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/30/N6", "atom2_id": "///J/168/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1050, "atom1_serNum": 6712, "atom2_serNum": 13578, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/30/N1", "atom2_id": "///J/168/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1051, "atom1_serNum": 6732, "atom2_serNum": 13561, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/31/O6", "atom2_id": "///J/167/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1052, "atom1_serNum": 6733, "atom2_serNum": 13559, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/31/N1", "atom2_id": "///J/167/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1053, "atom1_serNum": 6735, "atom2_serNum": 13558, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///I/31/N2", "atom2_id": "///J/167/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1054, "atom1_serNum": 6754, "atom2_serNum": 13541, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///I/32/N6", "atom2_id": "///J/166/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1055, "atom1_serNum": 6755, "atom2_serNum": 13539, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/32/N1", "atom2_id": "///J/166/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1056, "atom1_serNum": 6775, "atom2_serNum": 13521, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///I/33/N6", "atom2_id": "///J/165/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1057, "atom1_serNum": 6776, "atom2_serNum": 13519, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/33/N1", "atom2_id": "///J/165/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1058, "atom1_serNum": 6794, "atom2_serNum": 13501, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///I/34/N3", "atom2_id": "///J/164/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1059, "atom1_serNum": 6796, "atom2_serNum": 13500, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///I/34/O4", "atom2_id": "///J/164/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1060, "atom1_serNum": 6813, "atom2_serNum": 13481, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///I/35/O2", "atom2_id": "///J/163/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1061, "atom1_serNum": 6814, "atom2_serNum": 13479, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/35/N3", "atom2_id": "///J/163/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1062, "atom1_serNum": 6816, "atom2_serNum": 13478, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/35/N4", "atom2_id": "///J/163/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1063, "atom1_serNum": 6832, "atom2_serNum": 13459, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///I/36/O2", "atom2_id": "///J/162/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1064, "atom1_serNum": 6833, "atom2_serNum": 13457, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/36/N3", "atom2_id": "///J/162/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1065, "atom1_serNum": 6835, "atom2_serNum": 13456, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/36/N4", "atom2_id": "///J/162/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1066, "atom1_serNum": 6851, "atom2_serNum": 13437, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///I/37/O2", "atom2_id": "///J/161/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1067, "atom1_serNum": 6852, "atom2_serNum": 13435, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/37/N3", "atom2_id": "///J/161/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1068, "atom1_serNum": 6854, "atom2_serNum": 13434, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/37/N4", "atom2_id": "///J/161/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1069, "atom1_serNum": 6873, "atom2_serNum": 13396, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///I/38/O6", "atom2_id": "///J/159/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1070, "atom1_serNum": 6873, "atom2_serNum": 13415, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/38/O6", "atom2_id": "///J/160/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1071, "atom1_serNum": 6874, "atom2_serNum": 13413, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/38/N1", "atom2_id": "///J/160/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1072, "atom1_serNum": 6876, "atom2_serNum": 13412, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///I/38/N2", "atom2_id": "///J/160/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1073, "atom1_serNum": 6895, "atom2_serNum": 13396, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///I/39/O6", "atom2_id": "///J/159/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1074, "atom1_serNum": 6896, "atom2_serNum": 13394, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/39/N1", "atom2_id": "///J/159/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1075, "atom1_serNum": 6898, "atom2_serNum": 13393, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///I/39/N2", "atom2_id": "///J/159/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1076, "atom1_serNum": 6915, "atom2_serNum": 13376, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///I/40/N3", "atom2_id": "///J/158/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1077, "atom1_serNum": 6917, "atom2_serNum": 13375, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/40/O4", "atom2_id": "///J/158/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1078, "atom1_serNum": 6937, "atom2_serNum": 13356, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///I/41/O6", "atom2_id": "///J/157/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1079, "atom1_serNum": 6938, "atom2_serNum": 13354, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/41/N1", "atom2_id": "///J/157/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1080, "atom1_serNum": 6940, "atom2_serNum": 13353, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///I/41/N2", "atom2_id": "///J/157/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1081, "atom1_serNum": 6956, "atom2_serNum": 13337, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///I/42/O2", "atom2_id": "///J/156/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1082, "atom1_serNum": 6957, "atom2_serNum": 13335, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/42/N3", "atom2_id": "///J/156/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1083, "atom1_serNum": 6959, "atom2_serNum": 13334, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/42/N4", "atom2_id": "///J/156/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1084, "atom1_serNum": 6975, "atom2_serNum": 13315, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///I/43/O2", "atom2_id": "///J/155/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1085, "atom1_serNum": 6976, "atom2_serNum": 13313, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///I/43/N3", "atom2_id": "///J/155/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1086, "atom1_serNum": 6978, "atom2_serNum": 13312, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/43/N4", "atom2_id": "///J/155/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1087, "atom1_serNum": 6997, "atom2_serNum": 13293, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///I/44/O6", "atom2_id": "///J/154/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1088, "atom1_serNum": 6998, "atom2_serNum": 13291, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/44/N1", "atom2_id": "///J/154/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 7000, "atom2_serNum": 13290, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///I/44/N2", "atom2_id": "///J/154/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 7019, "atom2_serNum": 13273, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///I/45/N6", "atom2_id": "///J/153/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 7020, "atom2_serNum": 13271, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///I/45/N1", "atom2_id": "///J/153/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 7040, "atom2_serNum": 13254, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/46/O6", "atom2_id": "///J/152/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 7041, "atom2_serNum": 13252, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/46/N1", "atom2_id": "///J/152/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 7043, "atom2_serNum": 13251, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///I/46/N2", "atom2_id": "///J/152/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 7043, "atom2_serNum": 13270, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///I/46/N2", "atom2_id": "///J/153/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 7062, "atom2_serNum": 13235, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///I/47/O6", "atom2_id": "///J/151/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 7063, "atom2_serNum": 13233, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/47/N1", "atom2_id": "///J/151/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 7063, "atom2_serNum": 13252, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///I/47/N1", "atom2_id": "///J/152/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 7065, "atom2_serNum": 13232, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///I/47/N2", "atom2_id": "///J/151/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1100, "atom1_serNum": 7081, "atom2_serNum": 13216, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///I/48/O2", "atom2_id": "///J/150/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1101, "atom1_serNum": 7082, "atom2_serNum": 13214, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/48/N3", "atom2_id": "///J/150/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1102, "atom1_serNum": 7084, "atom2_serNum": 13213, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/48/N4", "atom2_id": "///J/150/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1103, "atom1_serNum": 7100, "atom2_serNum": 13194, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///I/49/O2", "atom2_id": "///J/149/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1104, "atom1_serNum": 7101, "atom2_serNum": 13192, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/49/N3", "atom2_id": "///J/149/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1105, "atom1_serNum": 7103, "atom2_serNum": 13191, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/49/N4", "atom2_id": "///J/149/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1106, "atom1_serNum": 7122, "atom2_serNum": 13172, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/50/O6", "atom2_id": "///J/148/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1107, "atom1_serNum": 7123, "atom2_serNum": 13170, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/50/N1", "atom2_id": "///J/148/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1108, "atom1_serNum": 7125, "atom2_serNum": 13169, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///I/50/N2", "atom2_id": "///J/148/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1109, "atom1_serNum": 7141, "atom2_serNum": 13153, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///I/51/O2", "atom2_id": "///J/147/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1110, "atom1_serNum": 7142, "atom2_serNum": 13129, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///I/51/N3", "atom2_id": "///J/146/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1111, "atom1_serNum": 7142, "atom2_serNum": 13151, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/51/N3", "atom2_id": "///J/147/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 7144, "atom2_serNum": 13150, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/51/N4", "atom2_id": "///J/147/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 7161, "atom2_serNum": 13130, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///I/52/N3", "atom2_id": "///J/146/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 7163, "atom2_serNum": 13129, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///I/52/O4", "atom2_id": "///J/146/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 7180, "atom2_serNum": 13110, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///I/53/O2", "atom2_id": "///J/145/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 7181, "atom2_serNum": 13108, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/53/N3", "atom2_id": "///J/145/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 7183, "atom2_serNum": 13107, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///I/53/N4", "atom2_id": "///J/145/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 7202, "atom2_serNum": 13087, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///I/54/N6", "atom2_id": "///J/144/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 7203, "atom2_serNum": 13085, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///I/54/N1", "atom2_id": "///J/144/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 7223, "atom2_serNum": 13067, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///I/55/N6", "atom2_id": "///J/143/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 7224, "atom2_serNum": 13065, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/55/N1", "atom2_id": "///J/143/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 7242, "atom2_serNum": 13047, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/56/N3", "atom2_id": "///J/142/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 7242, "atom2_serNum": 13064, "donAcc_type": "standard", "distance": 3.990, "atom1_id": "///I/56/N3", "atom2_id": "///J/143/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 7244, "atom2_serNum": 13046, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/56/O4", "atom2_id": "///J/142/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1125, "atom1_serNum": 7262, "atom2_serNum": 13026, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///I/57/N3", "atom2_id": "///J/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 7262, "atom2_serNum": 13047, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///I/57/N3", "atom2_id": "///J/142/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 7264, "atom2_serNum": 13025, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/57/O4", "atom2_id": "///J/141/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 7284, "atom2_serNum": 13006, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/58/O6", "atom2_id": "///J/140/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1129, "atom1_serNum": 7285, "atom2_serNum": 13004, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///I/58/N1", "atom2_id": "///J/140/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 7287, "atom2_serNum": 13003, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///I/58/N2", "atom2_id": "///J/140/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 7306, "atom2_serNum": 12987, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/59/O6", "atom2_id": "///J/139/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 7307, "atom2_serNum": 12985, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///I/59/N1", "atom2_id": "///J/139/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 7309, "atom2_serNum": 12984, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///I/59/N2", "atom2_id": "///J/139/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1134, "atom1_serNum": 7326, "atom2_serNum": 12967, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///I/60/N3", "atom2_id": "///J/138/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1135, "atom1_serNum": 7328, "atom2_serNum": 12966, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/60/O4", "atom2_id": "///J/138/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1136, "atom1_serNum": 7345, "atom2_serNum": 12947, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///I/61/O2", "atom2_id": "///J/137/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1137, "atom1_serNum": 7346, "atom2_serNum": 12945, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/61/N3", "atom2_id": "///J/137/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1138, "atom1_serNum": 7348, "atom2_serNum": 12944, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/61/N4", "atom2_id": "///J/137/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1139, "atom1_serNum": 7367, "atom2_serNum": 12925, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///I/62/O6", "atom2_id": "///J/136/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1140, "atom1_serNum": 7368, "atom2_serNum": 12923, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/62/N1", "atom2_id": "///J/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1141, "atom1_serNum": 7370, "atom2_serNum": 12922, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///I/62/N2", "atom2_id": "///J/136/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1142, "atom1_serNum": 7387, "atom2_serNum": 12905, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///I/63/N3", "atom2_id": "///J/135/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1143, "atom1_serNum": 7389, "atom2_serNum": 12904, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///I/63/O4", "atom2_id": "///J/135/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1144, "atom1_serNum": 7409, "atom2_serNum": 12884, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///I/64/N6", "atom2_id": "///J/134/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1145, "atom1_serNum": 7410, "atom2_serNum": 12882, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///I/64/N1", "atom2_id": "///J/134/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1146, "atom1_serNum": 7430, "atom2_serNum": 12865, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/65/O6", "atom2_id": "///J/133/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1147, "atom1_serNum": 7431, "atom2_serNum": 12863, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/65/N1", "atom2_id": "///J/133/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1148, "atom1_serNum": 7433, "atom2_serNum": 12862, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///I/65/N2", "atom2_id": "///J/133/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1149, "atom1_serNum": 7433, "atom2_serNum": 12881, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///I/65/N2", "atom2_id": "///J/134/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1150, "atom1_serNum": 7452, "atom2_serNum": 12845, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///I/66/N6", "atom2_id": "///J/132/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1151, "atom1_serNum": 7453, "atom2_serNum": 12843, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///I/66/N1", "atom2_id": "///J/132/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1152, "atom1_serNum": 7470, "atom2_serNum": 12826, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///I/67/O2", "atom2_id": "///J/131/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1153, "atom1_serNum": 7471, "atom2_serNum": 12824, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///I/67/N3", "atom2_id": "///J/131/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1154, "atom1_serNum": 7473, "atom2_serNum": 12823, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///I/67/N4", "atom2_id": "///J/131/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1155, "atom1_serNum": 7492, "atom2_serNum": 12803, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///I/68/N6", "atom2_id": "///J/130/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1156, "atom1_serNum": 7493, "atom2_serNum": 12801, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/68/N1", "atom2_id": "///J/130/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1157, "atom1_serNum": 7513, "atom2_serNum": 12784, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///I/69/O6", "atom2_id": "///J/129/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1158, "atom1_serNum": 7514, "atom2_serNum": 12782, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///I/69/N1", "atom2_id": "///J/129/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1159, "atom1_serNum": 7516, "atom2_serNum": 12781, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///I/69/N2", "atom2_id": "///J/129/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1160, "atom1_serNum": 7532, "atom2_serNum": 12765, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///I/70/O2", "atom2_id": "///J/128/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1161, "atom1_serNum": 7533, "atom2_serNum": 12763, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/70/N3", "atom2_id": "///J/128/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1162, "atom1_serNum": 7535, "atom2_serNum": 12762, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/70/N4", "atom2_id": "///J/128/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1163, "atom1_serNum": 7552, "atom2_serNum": 12742, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///I/71/N3", "atom2_id": "///J/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1164, "atom1_serNum": 7554, "atom2_serNum": 12741, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/71/O4", "atom2_id": "///J/127/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1165, "atom1_serNum": 7571, "atom2_serNum": 12722, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///I/72/O2", "atom2_id": "///J/126/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1166, "atom1_serNum": 7572, "atom2_serNum": 12720, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/72/N3", "atom2_id": "///J/126/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1167, "atom1_serNum": 7574, "atom2_serNum": 12719, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///I/72/N4", "atom2_id": "///J/126/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1168, "atom1_serNum": 7591, "atom2_serNum": 12699, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///I/73/N3", "atom2_id": "///J/125/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1169, "atom1_serNum": 7593, "atom2_serNum": 12698, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///I/73/O4", "atom2_id": "///J/125/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1170, "atom1_serNum": 7613, "atom2_serNum": 12678, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///I/74/N6", "atom2_id": "///J/124/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1171, "atom1_serNum": 7614, "atom2_serNum": 12676, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///I/74/N1", "atom2_id": "///J/124/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1172, "atom1_serNum": 7634, "atom2_serNum": 12659, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/75/O6", "atom2_id": "///J/123/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1173, "atom1_serNum": 7635, "atom2_serNum": 12657, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/75/N1", "atom2_id": "///J/123/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1174, "atom1_serNum": 7637, "atom2_serNum": 12656, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///I/75/N2", "atom2_id": "///J/123/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1175, "atom1_serNum": 7653, "atom2_serNum": 12640, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///I/76/O2", "atom2_id": "///J/122/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1176, "atom1_serNum": 7654, "atom2_serNum": 12638, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/76/N3", "atom2_id": "///J/122/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1177, "atom1_serNum": 7656, "atom2_serNum": 12637, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///I/76/N4", "atom2_id": "///J/122/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1178, "atom1_serNum": 7675, "atom2_serNum": 12617, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///I/77/N6", "atom2_id": "///J/121/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1179, "atom1_serNum": 7676, "atom2_serNum": 12615, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///I/77/N1", "atom2_id": "///J/121/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1180, "atom1_serNum": 7693, "atom2_serNum": 12598, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/78/O2", "atom2_id": "///J/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1181, "atom1_serNum": 7694, "atom2_serNum": 12596, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/78/N3", "atom2_id": "///J/120/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1182, "atom1_serNum": 7696, "atom2_serNum": 12595, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/78/N4", "atom2_id": "///J/120/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1183, "atom1_serNum": 7712, "atom2_serNum": 12576, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///I/79/O2", "atom2_id": "///J/119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1184, "atom1_serNum": 7713, "atom2_serNum": 12574, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/79/N3", "atom2_id": "///J/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1185, "atom1_serNum": 7715, "atom2_serNum": 12573, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/79/N4", "atom2_id": "///J/119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1186, "atom1_serNum": 7734, "atom2_serNum": 12554, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///I/80/O6", "atom2_id": "///J/118/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1187, "atom1_serNum": 7735, "atom2_serNum": 12552, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///I/80/N1", "atom2_id": "///J/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1188, "atom1_serNum": 7737, "atom2_serNum": 12551, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///I/80/N2", "atom2_id": "///J/118/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1189, "atom1_serNum": 7753, "atom2_serNum": 12535, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///I/81/O2", "atom2_id": "///J/117/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1190, "atom1_serNum": 7754, "atom2_serNum": 12533, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///I/81/N3", "atom2_id": "///J/117/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1191, "atom1_serNum": 7756, "atom2_serNum": 12532, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/81/N4", "atom2_id": "///J/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1192, "atom1_serNum": 7773, "atom2_serNum": 12512, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///I/82/N3", "atom2_id": "///J/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1193, "atom1_serNum": 7775, "atom2_serNum": 12511, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///I/82/O4", "atom2_id": "///J/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1194, "atom1_serNum": 7793, "atom2_serNum": 12491, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/83/N3", "atom2_id": "///J/115/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1195, "atom1_serNum": 7795, "atom2_serNum": 12490, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///I/83/O4", "atom2_id": "///J/115/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1196, "atom1_serNum": 7815, "atom2_serNum": 12470, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///I/84/N6", "atom2_id": "///J/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1197, "atom1_serNum": 7816, "atom2_serNum": 12468, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///I/84/N1", "atom2_id": "///J/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1198, "atom1_serNum": 7836, "atom2_serNum": 12450, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///I/85/N6", "atom2_id": "///J/113/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1199, "atom1_serNum": 7837, "atom2_serNum": 12448, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/85/N1", "atom2_id": "///J/113/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1200, "atom1_serNum": 7857, "atom2_serNum": 12430, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///I/86/N6", "atom2_id": "///J/112/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1201, "atom1_serNum": 7858, "atom2_serNum": 12428, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///I/86/N1", "atom2_id": "///J/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1202, "atom1_serNum": 7875, "atom2_serNum": 12411, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///I/87/O2", "atom2_id": "///J/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1203, "atom1_serNum": 7876, "atom2_serNum": 12409, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///I/87/N3", "atom2_id": "///J/111/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1204, "atom1_serNum": 7878, "atom2_serNum": 12408, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///I/87/N4", "atom2_id": "///J/111/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1205, "atom1_serNum": 7897, "atom2_serNum": 12389, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///I/88/O6", "atom2_id": "///J/110/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1206, "atom1_serNum": 7898, "atom2_serNum": 12387, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/88/N1", "atom2_id": "///J/110/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1207, "atom1_serNum": 7900, "atom2_serNum": 12386, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///I/88/N2", "atom2_id": "///J/110/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1208, "atom1_serNum": 7916, "atom2_serNum": 12370, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///I/89/O2", "atom2_id": "///J/109/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1209, "atom1_serNum": 7917, "atom2_serNum": 12368, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/89/N3", "atom2_id": "///J/109/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1210, "atom1_serNum": 7919, "atom2_serNum": 12367, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/89/N4", "atom2_id": "///J/109/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1211, "atom1_serNum": 7938, "atom2_serNum": 12325, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///I/90/N6", "atom2_id": "///J/107/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1212, "atom1_serNum": 7938, "atom2_serNum": 12347, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///I/90/N6", "atom2_id": "///J/108/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1213, "atom1_serNum": 7939, "atom2_serNum": 12326, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///I/90/N1", "atom2_id": "///J/107/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1214, "atom1_serNum": 7939, "atom2_serNum": 12345, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///I/90/N1", "atom2_id": "///J/108/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1215, "atom1_serNum": 7956, "atom2_serNum": 12328, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///I/91/O2", "atom2_id": "///J/107/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1216, "atom1_serNum": 7957, "atom2_serNum": 12326, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/91/N3", "atom2_id": "///J/107/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1217, "atom1_serNum": 7959, "atom2_serNum": 12325, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/91/N4", "atom2_id": "///J/107/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1218, "atom1_serNum": 7978, "atom2_serNum": 12306, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///I/92/O6", "atom2_id": "///J/106/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1219, "atom1_serNum": 7979, "atom2_serNum": 12304, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/92/N1", "atom2_id": "///J/106/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1220, "atom1_serNum": 7981, "atom2_serNum": 12303, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///I/92/N2", "atom2_id": "///J/106/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1221, "atom1_serNum": 7998, "atom2_serNum": 12286, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///I/93/N3", "atom2_id": "///J/105/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1222, "atom1_serNum": 8000, "atom2_serNum": 12285, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///I/93/O4", "atom2_id": "///J/105/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1223, "atom1_serNum": 8020, "atom2_serNum": 12265, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///I/94/N6", "atom2_id": "///J/104/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1224, "atom1_serNum": 8021, "atom2_serNum": 12263, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/94/N1", "atom2_id": "///J/104/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1225, "atom1_serNum": 8038, "atom2_serNum": 12246, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/95/O2", "atom2_id": "///J/103/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1226, "atom1_serNum": 8039, "atom2_serNum": 12244, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/95/N3", "atom2_id": "///J/103/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1227, "atom1_serNum": 8041, "atom2_serNum": 12243, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/95/N4", "atom2_id": "///J/103/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1228, "atom1_serNum": 8060, "atom2_serNum": 12224, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///I/96/O6", "atom2_id": "///J/102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1229, "atom1_serNum": 8061, "atom2_serNum": 12222, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/96/N1", "atom2_id": "///J/102/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1230, "atom1_serNum": 8063, "atom2_serNum": 12221, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///I/96/N2", "atom2_id": "///J/102/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1231, "atom1_serNum": 8079, "atom2_serNum": 12205, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///I/97/O2", "atom2_id": "///J/101/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1232, "atom1_serNum": 8080, "atom2_serNum": 12203, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/97/N3", "atom2_id": "///J/101/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1233, "atom1_serNum": 8082, "atom2_serNum": 12202, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/97/N4", "atom2_id": "///J/101/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1234, "atom1_serNum": 8101, "atom2_serNum": 12183, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///I/98/O6", "atom2_id": "///J/100/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1235, "atom1_serNum": 8102, "atom2_serNum": 12181, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/98/N1", "atom2_id": "///J/100/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1236, "atom1_serNum": 8104, "atom2_serNum": 12180, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///I/98/N2", "atom2_id": "///J/100/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1237, "atom1_serNum": 8120, "atom2_serNum": 12164, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///I/99/O2", "atom2_id": "///J/99/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1238, "atom1_serNum": 8121, "atom2_serNum": 12162, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/99/N3", "atom2_id": "///J/99/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1239, "atom1_serNum": 8123, "atom2_serNum": 12161, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///I/99/N4", "atom2_id": "///J/99/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1240, "atom1_serNum": 8140, "atom2_serNum": 12141, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/100/N3", "atom2_id": "///J/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1241, "atom1_serNum": 8142, "atom2_serNum": 12140, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/100/O4", "atom2_id": "///J/98/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1242, "atom1_serNum": 8147, "atom2_serNum": 18286, "donAcc_type": "acceptable", "distance": 3.283, "atom1_id": "///I/101/OP1", "atom2_id": "///U/112/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 1243, "atom1_serNum": 8162, "atom2_serNum": 12121, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///I/101/O6", "atom2_id": "///J/97/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1244, "atom1_serNum": 8163, "atom2_serNum": 12119, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/101/N1", "atom2_id": "///J/97/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1245, "atom1_serNum": 8165, "atom2_serNum": 12118, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///I/101/N2", "atom2_id": "///J/97/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1246, "atom1_serNum": 8169, "atom2_serNum": 17910, "donAcc_type": "standard", "distance": 3.986, "atom1_id": "///I/102/OP1", "atom2_id": "///U/65/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1247, "atom1_serNum": 8182, "atom2_serNum": 12101, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///I/102/N3", "atom2_id": "///J/96/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1248, "atom1_serNum": 8184, "atom2_serNum": 12100, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/102/O4", "atom2_id": "///J/96/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1249, "atom1_serNum": 8201, "atom2_serNum": 12081, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///I/103/O2", "atom2_id": "///J/95/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1250, "atom1_serNum": 8202, "atom2_serNum": 12079, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///I/103/N3", "atom2_id": "///J/95/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1251, "atom1_serNum": 8204, "atom2_serNum": 12078, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/103/N4", "atom2_id": "///J/95/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1252, "atom1_serNum": 8220, "atom2_serNum": 12059, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///I/104/O2", "atom2_id": "///J/94/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1253, "atom1_serNum": 8221, "atom2_serNum": 12057, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///I/104/N3", "atom2_id": "///J/94/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1254, "atom1_serNum": 8223, "atom2_serNum": 12056, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///I/104/N4", "atom2_id": "///J/94/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1255, "atom1_serNum": 8239, "atom2_serNum": 12037, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///I/105/O2", "atom2_id": "///J/93/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1256, "atom1_serNum": 8239, "atom2_serNum": 12059, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///I/105/O2", "atom2_id": "///J/94/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1257, "atom1_serNum": 8240, "atom2_serNum": 12035, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///I/105/N3", "atom2_id": "///J/93/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1258, "atom1_serNum": 8242, "atom2_serNum": 12034, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/105/N4", "atom2_id": "///J/93/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1259, "atom1_serNum": 8258, "atom2_serNum": 12015, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///I/106/O2", "atom2_id": "///J/92/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1260, "atom1_serNum": 8258, "atom2_serNum": 12037, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///I/106/O2", "atom2_id": "///J/93/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1261, "atom1_serNum": 8259, "atom2_serNum": 12013, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/106/N3", "atom2_id": "///J/92/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1262, "atom1_serNum": 8261, "atom2_serNum": 12012, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///I/106/N4", "atom2_id": "///J/92/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1263, "atom1_serNum": 8277, "atom2_serNum": 11993, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///I/107/O2", "atom2_id": "///J/91/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1264, "atom1_serNum": 8278, "atom2_serNum": 11991, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/107/N3", "atom2_id": "///J/91/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1265, "atom1_serNum": 8280, "atom2_serNum": 11990, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///I/107/N4", "atom2_id": "///J/91/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1266, "atom1_serNum": 8299, "atom2_serNum": 11971, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///I/108/O6", "atom2_id": "///J/90/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1267, "atom1_serNum": 8300, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/108/N1", "atom2_id": "///J/90/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1268, "atom1_serNum": 8302, "atom2_serNum": 11968, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///I/108/N2", "atom2_id": "///J/90/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1269, "atom1_serNum": 8318, "atom2_serNum": 11952, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///I/109/O2", "atom2_id": "///J/89/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1270, "atom1_serNum": 8319, "atom2_serNum": 11950, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/109/N3", "atom2_id": "///J/89/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1271, "atom1_serNum": 8321, "atom2_serNum": 11949, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/109/N4", "atom2_id": "///J/89/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1272, "atom1_serNum": 8340, "atom2_serNum": 11930, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///I/110/O6", "atom2_id": "///J/88/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1273, "atom1_serNum": 8341, "atom2_serNum": 11928, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/110/N1", "atom2_id": "///J/88/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1274, "atom1_serNum": 8343, "atom2_serNum": 11927, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///I/110/N2", "atom2_id": "///J/88/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1275, "atom1_serNum": 8360, "atom2_serNum": 11910, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///I/111/N3", "atom2_id": "///J/87/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1276, "atom1_serNum": 8362, "atom2_serNum": 11909, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///I/111/O4", "atom2_id": "///J/87/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1277, "atom1_serNum": 8380, "atom2_serNum": 11889, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///I/112/N3", "atom2_id": "///J/86/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1278, "atom1_serNum": 8382, "atom2_serNum": 11888, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/112/O4", "atom2_id": "///J/86/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1279, "atom1_serNum": 8400, "atom2_serNum": 11868, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///I/113/N3", "atom2_id": "///J/85/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1280, "atom1_serNum": 8402, "atom2_serNum": 11867, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/113/O4", "atom2_id": "///J/85/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1281, "atom1_serNum": 8420, "atom2_serNum": 11847, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/114/N3", "atom2_id": "///J/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1282, "atom1_serNum": 8422, "atom2_serNum": 11846, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/114/O4", "atom2_id": "///J/84/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1283, "atom1_serNum": 8442, "atom2_serNum": 11826, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///I/115/N6", "atom2_id": "///J/83/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1284, "atom1_serNum": 8443, "atom2_serNum": 11824, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///I/115/N1", "atom2_id": "///J/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1285, "atom1_serNum": 8463, "atom2_serNum": 11806, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/116/N6", "atom2_id": "///J/82/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1286, "atom1_serNum": 8464, "atom2_serNum": 11804, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///I/116/N1", "atom2_id": "///J/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1287, "atom1_serNum": 8481, "atom2_serNum": 11787, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///I/117/O2", "atom2_id": "///J/81/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1288, "atom1_serNum": 8482, "atom2_serNum": 11785, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/117/N3", "atom2_id": "///J/81/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1289, "atom1_serNum": 8484, "atom2_serNum": 11784, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/117/N4", "atom2_id": "///J/81/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1290, "atom1_serNum": 8500, "atom2_serNum": 11765, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///I/118/O2", "atom2_id": "///J/80/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1291, "atom1_serNum": 8501, "atom2_serNum": 11763, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/118/N3", "atom2_id": "///J/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1292, "atom1_serNum": 8503, "atom2_serNum": 11762, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/118/N4", "atom2_id": "///J/80/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1293, "atom1_serNum": 8522, "atom2_serNum": 11743, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/119/O6", "atom2_id": "///J/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1294, "atom1_serNum": 8523, "atom2_serNum": 11741, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///I/119/N1", "atom2_id": "///J/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1295, "atom1_serNum": 8525, "atom2_serNum": 11740, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///I/119/N2", "atom2_id": "///J/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1296, "atom1_serNum": 8541, "atom2_serNum": 11724, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///I/120/O2", "atom2_id": "///J/78/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1297, "atom1_serNum": 8542, "atom2_serNum": 11722, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/120/N3", "atom2_id": "///J/78/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1298, "atom1_serNum": 8544, "atom2_serNum": 11721, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/120/N4", "atom2_id": "///J/78/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1299, "atom1_serNum": 8560, "atom2_serNum": 11702, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///I/121/O2", "atom2_id": "///J/77/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1300, "atom1_serNum": 8561, "atom2_serNum": 11700, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/121/N3", "atom2_id": "///J/77/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1301, "atom1_serNum": 8563, "atom2_serNum": 11699, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/121/N4", "atom2_id": "///J/77/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1302, "atom1_serNum": 8582, "atom2_serNum": 11659, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///I/122/N6", "atom2_id": "///J/75/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1303, "atom1_serNum": 8582, "atom2_serNum": 11679, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///I/122/N6", "atom2_id": "///J/76/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1304, "atom1_serNum": 8583, "atom2_serNum": 11677, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///I/122/N1", "atom2_id": "///J/76/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1305, "atom1_serNum": 8603, "atom2_serNum": 11659, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///I/123/N6", "atom2_id": "///J/75/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1306, "atom1_serNum": 8604, "atom2_serNum": 11657, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///I/123/N1", "atom2_id": "///J/75/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1307, "atom1_serNum": 8624, "atom2_serNum": 11640, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///I/124/O6", "atom2_id": "///J/74/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1308, "atom1_serNum": 8625, "atom2_serNum": 11638, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/124/N1", "atom2_id": "///J/74/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1309, "atom1_serNum": 8627, "atom2_serNum": 11637, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///I/124/N2", "atom2_id": "///J/74/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1310, "atom1_serNum": 8646, "atom2_serNum": 11621, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///I/125/O6", "atom2_id": "///J/73/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1311, "atom1_serNum": 8647, "atom2_serNum": 11619, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/125/N1", "atom2_id": "///J/73/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1312, "atom1_serNum": 8649, "atom2_serNum": 11618, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///I/125/N2", "atom2_id": "///J/73/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1313, "atom1_serNum": 8668, "atom2_serNum": 11602, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///I/126/O6", "atom2_id": "///J/72/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1314, "atom1_serNum": 8669, "atom2_serNum": 11600, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/126/N1", "atom2_id": "///J/72/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1315, "atom1_serNum": 8671, "atom2_serNum": 11599, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///I/126/N2", "atom2_id": "///J/72/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1316, "atom1_serNum": 8671, "atom2_serNum": 11618, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///I/126/N2", "atom2_id": "///J/73/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1317, "atom1_serNum": 8690, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/127/O6", "atom2_id": "///J/71/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1318, "atom1_serNum": 8691, "atom2_serNum": 11581, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/127/N1", "atom2_id": "///J/71/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1319, "atom1_serNum": 8693, "atom2_serNum": 11580, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/127/N2", "atom2_id": "///J/71/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1320, "atom1_serNum": 8693, "atom2_serNum": 11599, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///I/127/N2", "atom2_id": "///J/72/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1321, "atom1_serNum": 8712, "atom2_serNum": 11563, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///I/128/N6", "atom2_id": "///J/70/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1322, "atom1_serNum": 8713, "atom2_serNum": 11561, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///I/128/N1", "atom2_id": "///J/70/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1323, "atom1_serNum": 8731, "atom2_serNum": 11543, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///I/129/N3", "atom2_id": "///J/69/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1324, "atom1_serNum": 8733, "atom2_serNum": 11542, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///I/129/O4", "atom2_id": "///J/69/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1325, "atom1_serNum": 8751, "atom2_serNum": 11522, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/130/N3", "atom2_id": "///J/68/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1326, "atom1_serNum": 8753, "atom2_serNum": 11521, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///I/130/O4", "atom2_id": "///J/68/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1327, "atom1_serNum": 8773, "atom2_serNum": 11501, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///I/131/N6", "atom2_id": "///J/67/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1328, "atom1_serNum": 8774, "atom2_serNum": 11499, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///I/131/N1", "atom2_id": "///J/67/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1329, "atom1_serNum": 8791, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///I/132/O2", "atom2_id": "///J/66/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1330, "atom1_serNum": 8792, "atom2_serNum": 11480, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/132/N3", "atom2_id": "///J/66/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1331, "atom1_serNum": 8794, "atom2_serNum": 11479, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/132/N4", "atom2_id": "///J/66/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1332, "atom1_serNum": 8811, "atom2_serNum": 11459, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///I/133/N3", "atom2_id": "///J/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1333, "atom1_serNum": 8813, "atom2_serNum": 11458, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///I/133/O4", "atom2_id": "///J/65/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1334, "atom1_serNum": 8830, "atom2_serNum": 11439, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///I/134/O2", "atom2_id": "///J/64/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1335, "atom1_serNum": 8831, "atom2_serNum": 11437, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/134/N3", "atom2_id": "///J/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1336, "atom1_serNum": 8833, "atom2_serNum": 11436, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/134/N4", "atom2_id": "///J/64/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1337, "atom1_serNum": 8849, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///I/135/O2", "atom2_id": "///J/63/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1338, "atom1_serNum": 8850, "atom2_serNum": 11415, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///I/135/N3", "atom2_id": "///J/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1339, "atom1_serNum": 8852, "atom2_serNum": 11414, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///I/135/N4", "atom2_id": "///J/63/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1340, "atom1_serNum": 8868, "atom2_serNum": 11395, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///I/136/O2", "atom2_id": "///J/62/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1341, "atom1_serNum": 8869, "atom2_serNum": 11393, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/136/N3", "atom2_id": "///J/62/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1342, "atom1_serNum": 8871, "atom2_serNum": 11392, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///I/136/N4", "atom2_id": "///J/62/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1343, "atom1_serNum": 8887, "atom2_serNum": 11395, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///I/137/O2", "atom2_id": "///J/62/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1344, "atom1_serNum": 8888, "atom2_serNum": 11372, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///I/137/N3", "atom2_id": "///J/61/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1345, "atom1_serNum": 8890, "atom2_serNum": 11371, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///I/137/O4", "atom2_id": "///J/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1346, "atom1_serNum": 8910, "atom2_serNum": 11351, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///I/138/N6", "atom2_id": "///J/60/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1347, "atom1_serNum": 8911, "atom2_serNum": 11349, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///I/138/N1", "atom2_id": "///J/60/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1348, "atom1_serNum": 8931, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/139/O6", "atom2_id": "///J/59/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1349, "atom1_serNum": 8932, "atom2_serNum": 11330, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/139/N1", "atom2_id": "///J/59/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1350, "atom1_serNum": 8934, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/139/N2", "atom2_id": "///J/59/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1351, "atom1_serNum": 8951, "atom2_serNum": 11312, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///I/140/N3", "atom2_id": "///J/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1352, "atom1_serNum": 8953, "atom2_serNum": 11311, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///I/140/O4", "atom2_id": "///J/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1353, "atom1_serNum": 8970, "atom2_serNum": 11292, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///I/141/O2", "atom2_id": "///J/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1354, "atom1_serNum": 8971, "atom2_serNum": 11290, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///I/141/N3", "atom2_id": "///J/57/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1355, "atom1_serNum": 8973, "atom2_serNum": 11289, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/141/N4", "atom2_id": "///J/57/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1356, "atom1_serNum": 8990, "atom2_serNum": 11269, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///I/142/N3", "atom2_id": "///J/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1357, "atom1_serNum": 8992, "atom2_serNum": 11268, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/142/O4", "atom2_id": "///J/56/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1358, "atom1_serNum": 9009, "atom2_serNum": 11249, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///I/143/O2", "atom2_id": "///J/55/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1359, "atom1_serNum": 9010, "atom2_serNum": 11247, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///I/143/N3", "atom2_id": "///J/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1360, "atom1_serNum": 9012, "atom2_serNum": 11246, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/143/N4", "atom2_id": "///J/55/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1361, "atom1_serNum": 9028, "atom2_serNum": 11227, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///I/144/O2", "atom2_id": "///J/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1362, "atom1_serNum": 9029, "atom2_serNum": 11225, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/144/N3", "atom2_id": "///J/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1363, "atom1_serNum": 9031, "atom2_serNum": 11224, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/144/N4", "atom2_id": "///J/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1364, "atom1_serNum": 9050, "atom2_serNum": 11204, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///I/145/N6", "atom2_id": "///J/53/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1365, "atom1_serNum": 9051, "atom2_serNum": 11202, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///I/145/N1", "atom2_id": "///J/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1366, "atom1_serNum": 9071, "atom2_serNum": 11185, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///I/146/O6", "atom2_id": "///J/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1367, "atom1_serNum": 9072, "atom2_serNum": 11183, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/146/N1", "atom2_id": "///J/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1368, "atom1_serNum": 9074, "atom2_serNum": 11182, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///I/146/N2", "atom2_id": "///J/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1369, "atom1_serNum": 9093, "atom2_serNum": 11166, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///I/147/O6", "atom2_id": "///J/51/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1370, "atom1_serNum": 9094, "atom2_serNum": 11164, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/147/N1", "atom2_id": "///J/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1371, "atom1_serNum": 9096, "atom2_serNum": 11163, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///I/147/N2", "atom2_id": "///J/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1372, "atom1_serNum": 9112, "atom2_serNum": 11147, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///I/148/O2", "atom2_id": "///J/50/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1373, "atom1_serNum": 9113, "atom2_serNum": 11145, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/148/N3", "atom2_id": "///J/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1374, "atom1_serNum": 9115, "atom2_serNum": 11144, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/148/N4", "atom2_id": "///J/50/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1375, "atom1_serNum": 9134, "atom2_serNum": 11124, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///I/149/N6", "atom2_id": "///J/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1376, "atom1_serNum": 9135, "atom2_serNum": 11122, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///I/149/N1", "atom2_id": "///J/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1377, "atom1_serNum": 9152, "atom2_serNum": 11105, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///I/150/O2", "atom2_id": "///J/48/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1378, "atom1_serNum": 9153, "atom2_serNum": 11103, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/150/N3", "atom2_id": "///J/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1379, "atom1_serNum": 9155, "atom2_serNum": 11102, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/150/N4", "atom2_id": "///J/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1380, "atom1_serNum": 9174, "atom2_serNum": 11083, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/151/O6", "atom2_id": "///J/47/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1381, "atom1_serNum": 9175, "atom2_serNum": 11081, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///I/151/N1", "atom2_id": "///J/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1382, "atom1_serNum": 9177, "atom2_serNum": 11080, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///I/151/N2", "atom2_id": "///J/47/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1383, "atom1_serNum": 9194, "atom2_serNum": 11063, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///I/152/N3", "atom2_id": "///J/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1384, "atom1_serNum": 9196, "atom2_serNum": 11062, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///I/152/O4", "atom2_id": "///J/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1385, "atom1_serNum": 9216, "atom2_serNum": 11043, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/153/O6", "atom2_id": "///J/45/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1386, "atom1_serNum": 9217, "atom2_serNum": 11041, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/153/N1", "atom2_id": "///J/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1387, "atom1_serNum": 9219, "atom2_serNum": 11040, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///I/153/N2", "atom2_id": "///J/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1388, "atom1_serNum": 9236, "atom2_serNum": 11023, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///I/154/N3", "atom2_id": "///J/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1389, "atom1_serNum": 9238, "atom2_serNum": 11022, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///I/154/O4", "atom2_id": "///J/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1390, "atom1_serNum": 9255, "atom2_serNum": 11003, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///I/155/O2", "atom2_id": "///J/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1391, "atom1_serNum": 9256, "atom2_serNum": 11001, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/155/N3", "atom2_id": "///J/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1392, "atom1_serNum": 9258, "atom2_serNum": 11000, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///I/155/N4", "atom2_id": "///J/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1393, "atom1_serNum": 9277, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///I/156/N6", "atom2_id": "///J/42/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1394, "atom1_serNum": 9278, "atom2_serNum": 10978, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///I/156/N1", "atom2_id": "///J/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1395, "atom1_serNum": 9298, "atom2_serNum": 10961, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/157/O6", "atom2_id": "///J/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1396, "atom1_serNum": 9299, "atom2_serNum": 10959, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/157/N1", "atom2_id": "///J/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1397, "atom1_serNum": 9301, "atom2_serNum": 10958, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///I/157/N2", "atom2_id": "///J/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1398, "atom1_serNum": 9320, "atom2_serNum": 10941, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///I/158/N6", "atom2_id": "///J/40/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1399, "atom1_serNum": 9321, "atom2_serNum": 10939, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/158/N1", "atom2_id": "///J/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1400, "atom1_serNum": 9339, "atom2_serNum": 10921, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///I/159/N3", "atom2_id": "///J/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1401, "atom1_serNum": 9341, "atom2_serNum": 10920, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///I/159/O4", "atom2_id": "///J/39/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1402, "atom1_serNum": 9361, "atom2_serNum": 10900, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///I/160/N6", "atom2_id": "///J/38/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1403, "atom1_serNum": 9362, "atom2_serNum": 10898, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///I/160/N1", "atom2_id": "///J/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1404, "atom1_serNum": 9380, "atom2_serNum": 10880, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///I/161/N3", "atom2_id": "///J/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1405, "atom1_serNum": 9382, "atom2_serNum": 10879, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///I/161/O4", "atom2_id": "///J/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1406, "atom1_serNum": 9402, "atom2_serNum": 10859, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///I/162/N6", "atom2_id": "///J/36/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1407, "atom1_serNum": 9403, "atom2_serNum": 10857, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///I/162/N1", "atom2_id": "///J/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1408, "atom1_serNum": 9421, "atom2_serNum": 10839, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/163/N3", "atom2_id": "///J/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1409, "atom1_serNum": 9423, "atom2_serNum": 10838, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///I/163/O4", "atom2_id": "///J/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1410, "atom1_serNum": 9443, "atom2_serNum": 10818, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///I/164/N6", "atom2_id": "///J/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1411, "atom1_serNum": 9444, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///I/164/N1", "atom2_id": "///J/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1412, "atom1_serNum": 9461, "atom2_serNum": 10799, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///I/165/O2", "atom2_id": "///J/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1413, "atom1_serNum": 9462, "atom2_serNum": 10797, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/165/N3", "atom2_id": "///J/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1414, "atom1_serNum": 9464, "atom2_serNum": 10796, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///I/165/N4", "atom2_id": "///J/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1415, "atom1_serNum": 9483, "atom2_serNum": 10776, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///I/166/N6", "atom2_id": "///J/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1416, "atom1_serNum": 9484, "atom2_serNum": 10774, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///I/166/N1", "atom2_id": "///J/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1417, "atom1_serNum": 9502, "atom2_serNum": 10756, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///I/167/N3", "atom2_id": "///J/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1418, "atom1_serNum": 9504, "atom2_serNum": 10755, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/167/O4", "atom2_id": "///J/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1419, "atom1_serNum": 9521, "atom2_serNum": 10736, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///I/168/O2", "atom2_id": "///J/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1420, "atom1_serNum": 9522, "atom2_serNum": 10734, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/168/N3", "atom2_id": "///J/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1421, "atom1_serNum": 9524, "atom2_serNum": 10733, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/168/N4", "atom2_id": "///J/30/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1422, "atom1_serNum": 9540, "atom2_serNum": 10714, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///I/169/O2", "atom2_id": "///J/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1423, "atom1_serNum": 9541, "atom2_serNum": 10712, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/169/N3", "atom2_id": "///J/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1424, "atom1_serNum": 9543, "atom2_serNum": 10711, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///I/169/N4", "atom2_id": "///J/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1425, "atom1_serNum": 9560, "atom2_serNum": 10691, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///I/170/N3", "atom2_id": "///J/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1426, "atom1_serNum": 9562, "atom2_serNum": 10690, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///I/170/O4", "atom2_id": "///J/28/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1427, "atom1_serNum": 9582, "atom2_serNum": 10671, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///I/171/O6", "atom2_id": "///J/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1428, "atom1_serNum": 9583, "atom2_serNum": 10669, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/171/N1", "atom2_id": "///J/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1429, "atom1_serNum": 9585, "atom2_serNum": 10668, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///I/171/N2", "atom2_id": "///J/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1430, "atom1_serNum": 9602, "atom2_serNum": 10651, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///I/172/N3", "atom2_id": "///J/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1431, "atom1_serNum": 9604, "atom2_serNum": 10631, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///I/172/O4", "atom2_id": "///J/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1432, "atom1_serNum": 9604, "atom2_serNum": 10650, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/172/O4", "atom2_id": "///J/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1433, "atom1_serNum": 9624, "atom2_serNum": 10631, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/173/O6", "atom2_id": "///J/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1434, "atom1_serNum": 9625, "atom2_serNum": 10629, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/173/N1", "atom2_id": "///J/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1435, "atom1_serNum": 9627, "atom2_serNum": 10628, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///I/173/N2", "atom2_id": "///J/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1436, "atom1_serNum": 9643, "atom2_serNum": 10612, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///I/174/O2", "atom2_id": "///J/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1437, "atom1_serNum": 9644, "atom2_serNum": 10610, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/174/N3", "atom2_id": "///J/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1438, "atom1_serNum": 9646, "atom2_serNum": 10609, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///I/174/N4", "atom2_id": "///J/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1439, "atom1_serNum": 9665, "atom2_serNum": 10589, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///I/175/N6", "atom2_id": "///J/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1440, "atom1_serNum": 9666, "atom2_serNum": 10587, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///I/175/N1", "atom2_id": "///J/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1441, "atom1_serNum": 9684, "atom2_serNum": 10569, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///I/176/N3", "atom2_id": "///J/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1442, "atom1_serNum": 9686, "atom2_serNum": 10568, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///I/176/O4", "atom2_id": "///J/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1443, "atom1_serNum": 9706, "atom2_serNum": 10549, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/177/O6", "atom2_id": "///J/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1444, "atom1_serNum": 9707, "atom2_serNum": 10547, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///I/177/N1", "atom2_id": "///J/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1445, "atom1_serNum": 9709, "atom2_serNum": 10546, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///I/177/N2", "atom2_id": "///J/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1446, "atom1_serNum": 9713, "atom2_serNum": 17765, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///I/178/OP1", "atom2_id": "///U/47/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1447, "atom1_serNum": 9713, "atom2_serNum": 17777, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///I/178/OP1", "atom2_id": "///U/48/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1448, "atom1_serNum": 9726, "atom2_serNum": 10529, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/178/N3", "atom2_id": "///J/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1449, "atom1_serNum": 9728, "atom2_serNum": 10528, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///I/178/O4", "atom2_id": "///J/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1450, "atom1_serNum": 9733, "atom2_serNum": 17782, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///I/179/OP1", "atom2_id": "///U/48/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 1451, "atom1_serNum": 9734, "atom2_serNum": 17752, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///I/179/OP2", "atom2_id": "///U/45/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1452, "atom1_serNum": 9740, "atom2_serNum": 18192, "donAcc_type": "standard", "distance": 3.858, "atom1_id": "///I/179/O3'", "atom2_id": "///U/98/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1453, "atom1_serNum": 9748, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/179/N6", "atom2_id": "///J/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1454, "atom1_serNum": 9749, "atom2_serNum": 10506, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///I/179/N1", "atom2_id": "///J/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1455, "atom1_serNum": 9767, "atom2_serNum": 10488, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///I/180/N3", "atom2_id": "///J/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1456, "atom1_serNum": 9769, "atom2_serNum": 10487, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/180/O4", "atom2_id": "///J/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1457, "atom1_serNum": 9787, "atom2_serNum": 10467, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/181/N3", "atom2_id": "///J/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1458, "atom1_serNum": 9789, "atom2_serNum": 10466, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///I/181/O4", "atom2_id": "///J/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1459, "atom1_serNum": 9809, "atom2_serNum": 10447, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///I/182/O6", "atom2_id": "///J/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1460, "atom1_serNum": 9810, "atom2_serNum": 10445, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/182/N1", "atom2_id": "///J/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1461, "atom1_serNum": 9812, "atom2_serNum": 10444, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///I/182/N2", "atom2_id": "///J/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1462, "atom1_serNum": 9831, "atom2_serNum": 10427, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///I/183/N6", "atom2_id": "///J/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1463, "atom1_serNum": 9832, "atom2_serNum": 10425, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///I/183/N1", "atom2_id": "///J/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1464, "atom1_serNum": 9852, "atom2_serNum": 10407, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/184/N6", "atom2_id": "///J/14/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1465, "atom1_serNum": 9853, "atom2_serNum": 10405, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///I/184/N1", "atom2_id": "///J/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1466, "atom1_serNum": 9870, "atom2_serNum": 10388, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///I/185/O2", "atom2_id": "///J/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1467, "atom1_serNum": 9871, "atom2_serNum": 10386, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///I/185/N3", "atom2_id": "///J/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1468, "atom1_serNum": 9873, "atom2_serNum": 10385, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/185/N4", "atom2_id": "///J/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1469, "atom1_serNum": 9892, "atom2_serNum": 10365, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///I/186/N6", "atom2_id": "///J/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1470, "atom1_serNum": 9893, "atom2_serNum": 10363, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///I/186/N1", "atom2_id": "///J/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1471, "atom1_serNum": 9913, "atom2_serNum": 10346, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///I/187/O6", "atom2_id": "///J/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1472, "atom1_serNum": 9914, "atom2_serNum": 10344, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/187/N1", "atom2_id": "///J/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1473, "atom1_serNum": 9916, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///I/187/N2", "atom2_id": "///J/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1474, "atom1_serNum": 9932, "atom2_serNum": 10327, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///I/188/O2", "atom2_id": "///J/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1475, "atom1_serNum": 9933, "atom2_serNum": 10325, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/188/N3", "atom2_id": "///J/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1476, "atom1_serNum": 9935, "atom2_serNum": 10324, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///I/188/N4", "atom2_id": "///J/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1477, "atom1_serNum": 9954, "atom2_serNum": 10305, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/189/O6", "atom2_id": "///J/9/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1478, "atom1_serNum": 9955, "atom2_serNum": 10303, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/189/N1", "atom2_id": "///J/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1479, "atom1_serNum": 9957, "atom2_serNum": 10302, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/189/N2", "atom2_id": "///J/9/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1480, "atom1_serNum": 9976, "atom2_serNum": 10285, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///I/190/N6", "atom2_id": "///J/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1481, "atom1_serNum": 9977, "atom2_serNum": 10283, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///I/190/N1", "atom2_id": "///J/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1482, "atom1_serNum": 9994, "atom2_serNum": 10266, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/191/O2", "atom2_id": "///J/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1483, "atom1_serNum": 9995, "atom2_serNum": 10264, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/191/N3", "atom2_id": "///J/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1484, "atom1_serNum": 9997, "atom2_serNum": 10263, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/191/N4", "atom2_id": "///J/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1485, "atom1_serNum": 10013, "atom2_serNum": 10244, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///I/192/O2", "atom2_id": "///J/6/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1486, "atom1_serNum": 10014, "atom2_serNum": 10242, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/192/N3", "atom2_id": "///J/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1487, "atom1_serNum": 10016, "atom2_serNum": 10241, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/192/N4", "atom2_id": "///J/6/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1488, "atom1_serNum": 10035, "atom2_serNum": 10221, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///I/193/N6", "atom2_id": "///J/5/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1489, "atom1_serNum": 10036, "atom2_serNum": 10219, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///I/193/N1", "atom2_id": "///J/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1490, "atom1_serNum": 10053, "atom2_serNum": 10202, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///I/194/O2", "atom2_id": "///J/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1491, "atom1_serNum": 10054, "atom2_serNum": 10200, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/194/N3", "atom2_id": "///J/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1492, "atom1_serNum": 10056, "atom2_serNum": 10199, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///I/194/N4", "atom2_id": "///J/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1493, "atom1_serNum": 10072, "atom2_serNum": 10180, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///I/195/O2", "atom2_id": "///J/3/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1494, "atom1_serNum": 10073, "atom2_serNum": 10178, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/195/N3", "atom2_id": "///J/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1495, "atom1_serNum": 10075, "atom2_serNum": 10177, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/195/N4", "atom2_id": "///J/3/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1496, "atom1_serNum": 10091, "atom2_serNum": 10158, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/196/O2", "atom2_id": "///J/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1497, "atom1_serNum": 10092, "atom2_serNum": 10156, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/196/N3", "atom2_id": "///J/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1498, "atom1_serNum": 10094, "atom2_serNum": 10155, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/196/N4", "atom2_id": "///J/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1499, "atom1_serNum": 10110, "atom2_serNum": 10136, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///I/197/O2", "atom2_id": "///J/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1500, "atom1_serNum": 10111, "atom2_serNum": 10134, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///I/197/N3", "atom2_id": "///J/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1501, "atom1_serNum": 10113, "atom2_serNum": 10133, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///I/197/N4", "atom2_id": "///J/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1502, "atom1_serNum": 10466, "atom2_serNum": 17743, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///J/17/N6", "atom2_id": "///U/43/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 1503, "atom1_serNum": 10490, "atom2_serNum": 10498, "donAcc_type": "questionable", "distance": 2.993, "atom1_id": "///J/18/N3", "atom2_id": "///J/19/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1504, "atom1_serNum": 10579, "atom2_serNum": 18132, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///J/23/O4'", "atom2_id": "///U/90/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 1505, "atom1_serNum": 10616, "atom2_serNum": 18061, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///J/25/OP1", "atom2_id": "///U/82/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1506, "atom1_serNum": 12164, "atom2_serNum": 18275, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///J/99/N2", "atom2_id": "///U/110/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 1507, "atom1_serNum": 12168, "atom2_serNum": 18083, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///J/100/OP1", "atom2_id": "///U/85/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1508, "atom1_serNum": 12168, "atom2_serNum": 18120, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///J/100/OP1", "atom2_id": "///U/89/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1509, "atom1_serNum": 12180, "atom2_serNum": 18276, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///J/100/O2", "atom2_id": "///U/110/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1510, "atom1_serNum": 12187, "atom2_serNum": 18155, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///J/101/OP1", "atom2_id": "///U/93/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1511, "atom1_serNum": 12187, "atom2_serNum": 18264, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///J/101/OP1", "atom2_id": "///U/109/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1512, "atom1_serNum": 12192, "atom2_serNum": 18276, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///J/101/O4'", "atom2_id": "///U/110/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1513, "atom1_serNum": 14183, "atom2_serNum": 14386, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///M/19/O", "atom2_id": "///M/46/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 14191, "atom2_serNum": 14204, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///M/20/O", "atom2_id": "///M/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 14199, "atom2_serNum": 14944, "donAcc_type": "acceptable", "distance": 3.233, "atom1_id": "///M/21/O", "atom2_id": "///M/116/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 14207, "atom2_serNum": 14372, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///M/22/O", "atom2_id": "///M/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 14221, "atom2_serNum": 14361, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///M/24/N", "atom2_id": "///M/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 14224, "atom2_serNum": 14237, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///M/24/O", "atom2_id": "///M/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 14224, "atom2_serNum": 14358, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///M/24/O", "atom2_id": "///M/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 14231, "atom2_serNum": 14966, "donAcc_type": "acceptable", "distance": 3.936, "atom1_id": "///M/25/O", "atom2_id": "///M/119/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 14235, "atom2_serNum": 14967, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///M/25/OE1", "atom2_id": "///M/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 14236, "atom2_serNum": 14847, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///M/25/NE2", "atom2_id": "///M/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 14237, "atom2_serNum": 14348, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///M/26/N", "atom2_id": "///M/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 14240, "atom2_serNum": 14250, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///M/26/O", "atom2_id": "///M/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 14246, "atom2_serNum": 14976, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///M/27/O", "atom2_id": "///M/121/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 14253, "atom2_serNum": 14978, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///M/28/O", "atom2_id": "///M/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 14261, "atom2_serNum": 14981, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///M/29/OG", "atom2_id": "///M/122/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 14262, "atom2_serNum": 14981, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///M/30/N", "atom2_id": "///M/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 14265, "atom2_serNum": 14995, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///M/30/O", "atom2_id": "///M/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 14276, "atom2_serNum": 15002, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///M/31/ND1", "atom2_id": "///M/124/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 14280, "atom2_serNum": 14998, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///M/32/N", "atom2_id": "///M/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 14283, "atom2_serNum": 15012, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///M/32/O", "atom2_id": "///M/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 14285, "atom2_serNum": 14310, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///M/33/N", "atom2_id": "///M/36/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 14294, "atom2_serNum": 14303, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///M/34/O", "atom2_id": "///M/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 14299, "atom2_serNum": 14789, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///M/35/N", "atom2_id": "///M/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 14302, "atom2_serNum": 14773, "donAcc_type": "questionable", "distance": 2.732, "atom1_id": "///M/35/O", "atom2_id": "///M/95/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 14323, "atom2_serNum": 14765, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///M/38/N", "atom2_id": "///M/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 14326, "atom2_serNum": 14762, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///M/38/O", "atom2_id": "///M/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 14335, "atom2_serNum": 14750, "donAcc_type": "acceptable", "distance": 3.437, "atom1_id": "///M/39/OG1", "atom2_id": "///M/92/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 14337, "atom2_serNum": 14750, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///M/40/N", "atom2_id": "///M/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 14340, "atom2_serNum": 14747, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///M/40/O", "atom2_id": "///M/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 14352, "atom2_serNum": 14733, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///M/42/N", "atom2_id": "///M/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 14355, "atom2_serNum": 14730, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///M/42/O", "atom2_id": "///M/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 14367, "atom2_serNum": 14716, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///M/44/N", "atom2_id": "///M/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 14393, "atom2_serNum": 14403, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///M/47/OD1", "atom2_id": "///M/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 14395, "atom2_serNum": 14712, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///M/48/N", "atom2_id": "///M/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 14398, "atom2_serNum": 14420, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///M/48/O", "atom2_id": "///M/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 14417, "atom2_serNum": 14432, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///M/50/O", "atom2_id": "///M/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 14423, "atom2_serNum": 14891, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///M/51/O", "atom2_id": "///M/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 14435, "atom2_serNum": 14598, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///M/52/O", "atom2_id": "///M/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 14440, "atom2_serNum": 14877, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///M/53/N", "atom2_id": "///M/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 14443, "atom2_serNum": 14874, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///M/53/O", "atom2_id": "///M/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 14445, "atom2_serNum": 14900, "donAcc_type": "acceptable", "distance": 3.746, "atom1_id": "///M/53/OG", "atom2_id": "///M/110/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 14445, "atom2_serNum": 15856, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///M/53/OG", "atom2_id": "///M/255/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 14446, "atom2_serNum": 14569, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///M/54/N", "atom2_id": "///M/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 14449, "atom2_serNum": 14556, "donAcc_type": "acceptable", "distance": 3.664, "atom1_id": "///M/54/O", "atom2_id": "///M/65/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 14449, "atom2_serNum": 14558, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///M/54/O", "atom2_id": "///M/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 14449, "atom2_serNum": 14566, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///M/54/O", "atom2_id": "///M/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 14460, "atom2_serNum": 14859, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///M/55/N", "atom2_id": "///M/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 14463, "atom2_serNum": 14856, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///M/55/O", "atom2_id": "///M/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 14471, "atom2_serNum": 15856, "donAcc_type": "acceptable", "distance": 2.182, "atom1_id": "///M/55/OH", "atom2_id": "///M/255/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 14471, "atom2_serNum": 15858, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///M/55/OH", "atom2_id": "///M/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 14472, "atom2_serNum": 14545, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///M/56/N", "atom2_id": "///M/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 14475, "atom2_serNum": 14542, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///M/56/O", "atom2_id": "///M/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 14479, "atom2_serNum": 14498, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///M/56/OE1", "atom2_id": "///M/58/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 14480, "atom2_serNum": 14855, "donAcc_type": "acceptable", "distance": 3.219, "atom1_id": "///M/56/NE2", "atom2_id": "///M/105/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 14481, "atom2_serNum": 14840, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///M/57/N", "atom2_id": "///M/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 14484, "atom2_serNum": 14837, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///M/57/O", "atom2_id": "///M/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 14488, "atom2_serNum": 15324, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///M/57/OE1", "atom2_id": "///M/188/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 14489, "atom2_serNum": 15323, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///M/57/NE2", "atom2_id": "///M/188/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 14493, "atom2_serNum": 14520, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///M/58/O", "atom2_id": "///M/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 14561, "atom2_serNum": 14624, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///M/66/O", "atom2_id": "///M/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 14574, "atom2_serNum": 14613, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///M/68/N", "atom2_id": "///M/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 14577, "atom2_serNum": 14603, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///M/68/O", "atom2_id": "///M/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 14577, "atom2_serNum": 14610, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///M/68/O", "atom2_id": "///M/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 14601, "atom2_serNum": 14693, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///M/70/O", "atom2_id": "///M/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 14627, "atom2_serNum": 14641, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///M/74/O", "atom2_id": "///M/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 14651, "atom2_serNum": 14672, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///M/78/O", "atom2_id": "///M/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 14664, "atom2_serNum": 14770, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///M/80/O", "atom2_id": "///M/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 14671, "atom2_serNum": 14781, "donAcc_type": "standard", "distance": 2.449, "atom1_id": "///M/80/NH2", "atom2_id": "///M/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 14683, "atom2_serNum": 14758, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///M/82/N", "atom2_id": "///M/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 14686, "atom2_serNum": 14755, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///M/82/O", "atom2_id": "///M/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 14693, "atom2_serNum": 14744, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///M/84/N", "atom2_id": "///M/91/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 14696, "atom2_serNum": 14741, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///M/84/O", "atom2_id": "///M/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 14698, "atom2_serNum": 14746, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///M/84/OG", "atom2_id": "///M/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 14702, "atom2_serNum": 14708, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///M/85/O", "atom2_id": "///M/86/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 14703, "atom2_serNum": 14725, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///M/86/N", "atom2_id": "///M/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 14706, "atom2_serNum": 14713, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///M/86/O", "atom2_id": "///M/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 14794, "atom2_serNum": 14824, "donAcc_type": "standard", "distance": 2.387, "atom1_id": "///M/98/N", "atom2_id": "///M/101/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 14797, "atom2_serNum": 14817, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///M/98/O", "atom2_id": "///M/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 14806, "atom2_serNum": 14830, "donAcc_type": "acceptable", "distance": 3.582, "atom1_id": "///M/99/O", "atom2_id": "///M/102/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 14809, "atom2_serNum": 14815, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///M/100/N", "atom2_id": "///M/100/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 14820, "atom2_serNum": 14832, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///M/101/O", "atom2_id": "///M/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 14820, "atom2_serNum": 14855, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///M/101/O", "atom2_id": "///M/105/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 14832, "atom2_serNum": 14990, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///M/103/N", "atom2_id": "///M/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 14835, "atom2_serNum": 14987, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///M/103/O", "atom2_id": "///M/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 14844, "atom2_serNum": 14974, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///M/105/N", "atom2_id": "///M/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 14847, "atom2_serNum": 14971, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///M/105/O", "atom2_id": "///M/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 14871, "atom2_serNum": 14957, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///M/107/O", "atom2_id": "///M/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 14882, "atom2_serNum": 14942, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///M/109/N", "atom2_id": "///M/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 14889, "atom2_serNum": 14901, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///M/109/OE1", "atom2_id": "///M/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 14890, "atom2_serNum": 14923, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///M/109/NE2", "atom2_id": "///M/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 14890, "atom2_serNum": 14944, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///M/109/NE2", "atom2_id": "///M/116/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 14912, "atom2_serNum": 14919, "donAcc_type": "acceptable", "distance": 2.675, "atom1_id": "///M/112/OE1", "atom2_id": "///M/113/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 14917, "atom2_serNum": 14927, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///M/113/O", "atom2_id": "///M/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 14923, "atom2_serNum": 14944, "donAcc_type": "acceptable", "distance": 3.256, "atom1_id": "///M/114/O", "atom2_id": "///M/116/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 15028, "atom2_serNum": 15045, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///M/150/OE1", "atom2_id": "///M/152/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 15037, "atom2_serNum": 15200, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///M/152/N", "atom2_id": "///M/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 15040, "atom2_serNum": 15197, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///M/152/O", "atom2_id": "///M/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 15040, "atom2_serNum": 15202, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///M/152/O", "atom2_id": "///M/174/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 15054, "atom2_serNum": 15186, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///M/154/N", "atom2_id": "///M/172/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 15057, "atom2_serNum": 15183, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///M/154/O", "atom2_id": "///M/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 15070, "atom2_serNum": 15913, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///M/155/OE1", "atom2_id": "///M/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 15072, "atom2_serNum": 15173, "donAcc_type": "standard", "distance": 3.949, "atom1_id": "///M/156/N", "atom2_id": "///M/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 15075, "atom2_serNum": 15922, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///M/156/O", "atom2_id": "///M/263/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 15077, "atom2_serNum": 15922, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///M/156/OG", "atom2_id": "///M/263/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 15089, "atom2_serNum": 15927, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///M/159/N", "atom2_id": "///M/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 15092, "atom2_serNum": 15937, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///M/159/O", "atom2_id": "///M/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 15106, "atom2_serNum": 15940, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///M/161/N", "atom2_id": "///M/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 15109, "atom2_serNum": 15951, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///M/161/O", "atom2_id": "///M/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 15113, "atom2_serNum": 15121, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///M/162/N", "atom2_id": "///M/162/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 15116, "atom2_serNum": 15133, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///M/162/O", "atom2_id": "///M/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 15116, "atom2_serNum": 15138, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///M/162/O", "atom2_id": "///M/165/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 15129, "atom2_serNum": 15695, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///M/164/N", "atom2_id": "///M/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 15136, "atom2_serNum": 15686, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///M/165/O", "atom2_id": "///M/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 15136, "atom2_serNum": 15692, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///M/165/O", "atom2_id": "///M/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 15146, "atom2_serNum": 15675, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///M/167/N", "atom2_id": "///M/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 15149, "atom2_serNum": 15672, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///M/167/O", "atom2_id": "///M/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 15161, "atom2_serNum": 15670, "donAcc_type": "standard", "distance": 2.224, "atom1_id": "///M/168/NZ", "atom2_id": "///M/231/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1630, "atom1_serNum": 15162, "atom2_serNum": 15658, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///M/169/N", "atom2_id": "///M/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 15165, "atom2_serNum": 15655, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///M/169/O", "atom2_id": "///M/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 15177, "atom2_serNum": 15639, "donAcc_type": "standard", "distance": 2.506, "atom1_id": "///M/171/N", "atom2_id": "///M/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 15180, "atom2_serNum": 15636, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///M/171/O", "atom2_id": "///M/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 15191, "atom2_serNum": 15620, "donAcc_type": "standard", "distance": 2.266, "atom1_id": "///M/172/NZ", "atom2_id": "///M/225/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1635, "atom1_serNum": 15191, "atom2_serNum": 15634, "donAcc_type": "acceptable", "distance": 2.221, "atom1_id": "///M/172/NZ", "atom2_id": "///M/227/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 15192, "atom2_serNum": 15626, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///M/173/N", "atom2_id": "///M/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 15210, "atom2_serNum": 15226, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///M/176/O", "atom2_id": "///M/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 15240, "atom2_serNum": 15445, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///M/179/O", "atom2_id": "///M/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 15262, "atom2_serNum": 15797, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///M/182/N", "atom2_id": "///M/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1640, "atom1_serNum": 15265, "atom2_serNum": 15794, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///M/182/O", "atom2_id": "///M/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1641, "atom1_serNum": 15267, "atom2_serNum": 15285, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///M/182/OG1", "atom2_id": "///M/184/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 15267, "atom2_serNum": 15797, "donAcc_type": "acceptable", "distance": 2.502, "atom1_id": "///M/182/OG1", "atom2_id": "///M/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 15269, "atom2_serNum": 15421, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///M/183/N", "atom2_id": "///M/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 15272, "atom2_serNum": 15418, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///M/183/O", "atom2_id": "///M/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1645, "atom1_serNum": 15277, "atom2_serNum": 15781, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///M/184/N", "atom2_id": "///M/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 15280, "atom2_serNum": 15778, "donAcc_type": "standard", "distance": 2.491, "atom1_id": "///M/184/O", "atom2_id": "///M/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1647, "atom1_serNum": 15284, "atom2_serNum": 15388, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///M/184/OE1", "atom2_id": "///M/196/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 15286, "atom2_serNum": 15405, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///M/185/N", "atom2_id": "///M/198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 15289, "atom2_serNum": 15394, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///M/185/O", "atom2_id": "///M/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 15289, "atom2_serNum": 15402, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///M/185/O", "atom2_id": "///M/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 15300, "atom2_serNum": 15763, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///M/186/N", "atom2_id": "///M/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1652, "atom1_serNum": 15303, "atom2_serNum": 15760, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///M/186/O", "atom2_id": "///M/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 15307, "atom2_serNum": 15374, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///M/187/N", "atom2_id": "///M/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1654, "atom1_serNum": 15310, "atom2_serNum": 15371, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///M/187/O", "atom2_id": "///M/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 15315, "atom2_serNum": 15728, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///M/187/NZ", "atom2_id": "///M/239/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 15316, "atom2_serNum": 15744, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///M/188/N", "atom2_id": "///M/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 15319, "atom2_serNum": 15741, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///M/188/O", "atom2_id": "///M/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 15323, "atom2_serNum": 15771, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///M/188/OE1", "atom2_id": "///M/244/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 15325, "atom2_serNum": 15362, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///M/189/N", "atom2_id": "///M/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 15328, "atom2_serNum": 15359, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///M/189/O", "atom2_id": "///M/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 15330, "atom2_serNum": 15350, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///M/189/OG1", "atom2_id": "///M/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 15346, "atom2_serNum": 15357, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///M/191/NE", "atom2_id": "///M/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 15383, "atom2_serNum": 15509, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///M/196/O", "atom2_id": "///M/210/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 15397, "atom2_serNum": 15502, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///M/197/O", "atom2_id": "///M/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 15406, "atom2_serNum": 15484, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///M/199/N", "atom2_id": "///M/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 15409, "atom2_serNum": 15481, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///M/199/O", "atom2_id": "///M/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 15426, "atom2_serNum": 15473, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///M/201/N", "atom2_id": "///M/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 15429, "atom2_serNum": 15465, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///M/201/O", "atom2_id": "///M/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 15429, "atom2_serNum": 15470, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///M/201/O", "atom2_id": "///M/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 15463, "atom2_serNum": 15470, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///M/204/OD1", "atom2_id": "///M/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1671, "atom1_serNum": 15501, "atom2_serNum": 15573, "donAcc_type": "acceptable", "distance": 2.615, "atom1_id": "///M/209/OH", "atom2_id": "///M/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 15505, "atom2_serNum": 15528, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///M/210/O", "atom2_id": "///M/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 15505, "atom2_serNum": 15539, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///M/210/O", "atom2_id": "///M/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 15508, "atom2_serNum": 15510, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///M/210/OD1", "atom2_id": "///M/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1675, "atom1_serNum": 15531, "atom2_serNum": 15561, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///M/213/O", "atom2_id": "///M/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 15551, "atom2_serNum": 15685, "donAcc_type": "acceptable", "distance": 3.358, "atom1_id": "///M/215/O", "atom2_id": "///M/233/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 15555, "atom2_serNum": 15680, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///M/216/O", "atom2_id": "///M/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 15560, "atom2_serNum": 15728, "donAcc_type": "standard", "distance": 2.398, "atom1_id": "///M/216/NZ", "atom2_id": "///M/239/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 15560, "atom2_serNum": 15729, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///M/216/NZ", "atom2_id": "///M/239/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 15566, "atom2_serNum": 15666, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///M/218/N", "atom2_id": "///M/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 15569, "atom2_serNum": 15663, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///M/218/O", "atom2_id": "///M/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 15581, "atom2_serNum": 15646, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///M/220/N", "atom2_id": "///M/229/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 15584, "atom2_serNum": 15643, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///M/220/O", "atom2_id": "///M/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 15594, "atom2_serNum": 15632, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///M/222/N", "atom2_id": "///M/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 15597, "atom2_serNum": 15623, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///M/222/O", "atom2_id": "///M/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 15597, "atom2_serNum": 15629, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///M/222/O", "atom2_id": "///M/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 15600, "atom2_serNum": 15611, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///M/222/OD1", "atom2_id": "///M/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 15600, "atom2_serNum": 15616, "donAcc_type": "acceptable", "distance": 2.454, "atom1_id": "///M/222/OD1", "atom2_id": "///M/224/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 15601, "atom2_serNum": 15654, "donAcc_type": "acceptable", "distance": 3.775, "atom1_id": "///M/222/OD2", "atom2_id": "///M/229/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 15622, "atom2_serNum": 15634, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///M/225/OG", "atom2_id": "///M/227/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 15683, "atom2_serNum": 15691, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///M/233/O", "atom2_id": "///M/234/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 15689, "atom2_serNum": 15691, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///M/234/O", "atom2_id": "///M/234/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 15689, "atom2_serNum": 15705, "donAcc_type": "acceptable", "distance": 3.304, "atom1_id": "///M/234/O", "atom2_id": "///M/236/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 15700, "atom2_serNum": 15729, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///M/236/N", "atom2_id": "///M/239/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 15703, "atom2_serNum": 15722, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///M/236/O", "atom2_id": "///M/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 15710, "atom2_serNum": 15730, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///M/237/O", "atom2_id": "///M/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 15710, "atom2_serNum": 15735, "donAcc_type": "acceptable", "distance": 3.331, "atom1_id": "///M/237/O", "atom2_id": "///M/240/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 15725, "atom2_serNum": 15736, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///M/239/O", "atom2_id": "///M/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 15725, "atom2_serNum": 15759, "donAcc_type": "acceptable", "distance": 3.520, "atom1_id": "///M/239/O", "atom2_id": "///M/243/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 15735, "atom2_serNum": 15944, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///M/240/OG", "atom2_id": "///M/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 15736, "atom2_serNum": 15933, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///M/241/N", "atom2_id": "///M/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 15739, "atom2_serNum": 15930, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///M/241/O", "atom2_id": "///M/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 15748, "atom2_serNum": 15920, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///M/243/N", "atom2_id": "///M/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 15751, "atom2_serNum": 15917, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///M/243/O", "atom2_id": "///M/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 15775, "atom2_serNum": 15900, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///M/245/O", "atom2_id": "///M/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 15783, "atom2_serNum": 15877, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///M/247/N", "atom2_id": "///M/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 15786, "atom2_serNum": 15866, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///M/247/O", "atom2_id": "///M/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 15790, "atom2_serNum": 15872, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///M/247/NE", "atom2_id": "///M/257/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 15790, "atom2_serNum": 15873, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///M/247/NE", "atom2_id": "///M/257/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 15793, "atom2_serNum": 15873, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///M/247/NH2", "atom2_id": "///M/257/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 15802, "atom2_serNum": 15806, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///M/248/NZ", "atom2_id": "///M/249/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1712, "atom1_serNum": 15803, "atom2_serNum": 15850, "donAcc_type": "acceptable", "distance": 3.571, "atom1_id": "///M/249/N", "atom2_id": "///M/254/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 15818, "atom2_serNum": 15845, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///M/251/O", "atom2_id": "///M/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 15854, "atom2_serNum": 15866, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///M/255/O", "atom2_id": "///M/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 15872, "atom2_serNum": 15874, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///M/257/OD1", "atom2_id": "///M/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 15920, "atom2_serNum": 15930, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///M/263/O", "atom2_id": "///M/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 15969, "atom2_serNum": 15982, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///N/20/O", "atom2_id": "///N/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1718, "atom1_serNum": 15972, "atom2_serNum": 15974, "donAcc_type": "standard", "distance": 2.464, "atom1_id": "///N/20/OD1", "atom2_id": "///N/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 15972, "atom2_serNum": 16722, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///N/20/OD1", "atom2_id": "///N/116/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 15977, "atom2_serNum": 16722, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///N/21/O", "atom2_id": "///N/116/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 15982, "atom2_serNum": 16155, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///N/22/N", "atom2_id": "///N/45/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 15985, "atom2_serNum": 16150, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///N/22/O", "atom2_id": "///N/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1723, "atom1_serNum": 15990, "atom2_serNum": 15994, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///N/22/NZ", "atom2_id": "///N/23/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1724, "atom1_serNum": 15999, "atom2_serNum": 16139, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///N/24/N", "atom2_id": "///N/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1725, "atom1_serNum": 16002, "atom2_serNum": 16136, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///N/24/O", "atom2_id": "///N/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 16009, "atom2_serNum": 16744, "donAcc_type": "acceptable", "distance": 3.941, "atom1_id": "///N/25/O", "atom2_id": "///N/119/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 16013, "atom2_serNum": 16745, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///N/25/OE1", "atom2_id": "///N/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1728, "atom1_serNum": 16014, "atom2_serNum": 16625, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///N/25/NE2", "atom2_id": "///N/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 16018, "atom2_serNum": 16028, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///N/26/O", "atom2_id": "///N/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 16020, "atom2_serNum": 16128, "donAcc_type": "acceptable", "distance": 3.363, "atom1_id": "///N/26/OG", "atom2_id": "///N/41/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 16024, "atom2_serNum": 16754, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///N/27/O", "atom2_id": "///N/121/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 16031, "atom2_serNum": 16756, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///N/28/O", "atom2_id": "///N/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1733, "atom1_serNum": 16040, "atom2_serNum": 16759, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///N/30/N", "atom2_id": "///N/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1734, "atom1_serNum": 16043, "atom2_serNum": 16773, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///N/30/O", "atom2_id": "///N/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1735, "atom1_serNum": 16054, "atom2_serNum": 16780, "donAcc_type": "acceptable", "distance": 3.489, "atom1_id": "///N/31/ND1", "atom2_id": "///N/124/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 16058, "atom2_serNum": 16776, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///N/32/N", "atom2_id": "///N/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 16061, "atom2_serNum": 16790, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///N/32/O", "atom2_id": "///N/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 16063, "atom2_serNum": 16088, "donAcc_type": "standard", "distance": 2.392, "atom1_id": "///N/33/N", "atom2_id": "///N/36/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 16077, "atom2_serNum": 16567, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///N/35/N", "atom2_id": "///N/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 16084, "atom2_serNum": 16564, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///N/36/O", "atom2_id": "///N/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 16099, "atom2_serNum": 16113, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///N/37/NH1", "atom2_id": "///N/39/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 16101, "atom2_serNum": 16543, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///N/38/N", "atom2_id": "///N/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 16104, "atom2_serNum": 16540, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///N/38/O", "atom2_id": "///N/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 16115, "atom2_serNum": 16528, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///N/40/N", "atom2_id": "///N/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 16118, "atom2_serNum": 16524, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///N/40/O", "atom2_id": "///N/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 16118, "atom2_serNum": 16525, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///N/40/O", "atom2_id": "///N/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 16130, "atom2_serNum": 16511, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///N/42/N", "atom2_id": "///N/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 16133, "atom2_serNum": 16508, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///N/42/O", "atom2_id": "///N/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 16144, "atom2_serNum": 16498, "donAcc_type": "standard", "distance": 3.573, "atom1_id": "///N/43/NZ", "atom2_id": "///N/88/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 16145, "atom2_serNum": 16494, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///N/44/N", "atom2_id": "///N/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 16155, "atom2_serNum": 16163, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///N/45/OG", "atom2_id": "///N/46/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 16168, "atom2_serNum": 16190, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///N/47/O", "atom2_id": "///N/49/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 16171, "atom2_serNum": 16181, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///N/47/OD1", "atom2_id": "///N/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 16173, "atom2_serNum": 16490, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///N/48/N", "atom2_id": "///N/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 16176, "atom2_serNum": 16198, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///N/48/O", "atom2_id": "///N/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 16191, "atom2_serNum": 16682, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///N/49/NH2", "atom2_id": "///N/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 16195, "atom2_serNum": 16210, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///N/50/O", "atom2_id": "///N/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 16201, "atom2_serNum": 16669, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///N/51/O", "atom2_id": "///N/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 16213, "atom2_serNum": 16376, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///N/52/O", "atom2_id": "///N/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 16218, "atom2_serNum": 16655, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///N/53/N", "atom2_id": "///N/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 16221, "atom2_serNum": 16652, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///N/53/O", "atom2_id": "///N/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 16223, "atom2_serNum": 17634, "donAcc_type": "acceptable", "distance": 2.585, "atom1_id": "///N/53/OG", "atom2_id": "///N/255/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 16224, "atom2_serNum": 16347, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///N/54/N", "atom2_id": "///N/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 16227, "atom2_serNum": 16334, "donAcc_type": "acceptable", "distance": 3.657, "atom1_id": "///N/54/O", "atom2_id": "///N/65/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 16227, "atom2_serNum": 16336, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///N/54/O", "atom2_id": "///N/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 16227, "atom2_serNum": 16344, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///N/54/O", "atom2_id": "///N/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 16238, "atom2_serNum": 16637, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///N/55/N", "atom2_id": "///N/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 16241, "atom2_serNum": 16634, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///N/55/O", "atom2_id": "///N/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 16249, "atom2_serNum": 17634, "donAcc_type": "acceptable", "distance": 2.615, "atom1_id": "///N/55/OH", "atom2_id": "///N/255/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1770, "atom1_serNum": 16249, "atom2_serNum": 17636, "donAcc_type": "acceptable", "distance": 3.218, "atom1_id": "///N/55/OH", "atom2_id": "///N/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1771, "atom1_serNum": 16249, "atom2_serNum": 17639, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///N/55/OH", "atom2_id": "///N/256/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1772, "atom1_serNum": 16250, "atom2_serNum": 16323, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///N/56/N", "atom2_id": "///N/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 16253, "atom2_serNum": 16320, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///N/56/O", "atom2_id": "///N/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1774, "atom1_serNum": 16259, "atom2_serNum": 16618, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///N/57/N", "atom2_id": "///N/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1775, "atom1_serNum": 16262, "atom2_serNum": 16615, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///N/57/O", "atom2_id": "///N/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 16266, "atom2_serNum": 17102, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///N/57/OE1", "atom2_id": "///N/188/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1777, "atom1_serNum": 16267, "atom2_serNum": 17101, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///N/57/NE2", "atom2_id": "///N/188/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 16271, "atom2_serNum": 16298, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///N/58/O", "atom2_id": "///N/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1779, "atom1_serNum": 16339, "atom2_serNum": 16402, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///N/66/O", "atom2_id": "///N/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 16352, "atom2_serNum": 16391, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///N/68/N", "atom2_id": "///N/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1781, "atom1_serNum": 16355, "atom2_serNum": 16388, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///N/68/O", "atom2_id": "///N/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 16405, "atom2_serNum": 16419, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///N/74/O", "atom2_id": "///N/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 16429, "atom2_serNum": 16450, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///N/78/O", "atom2_id": "///N/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 16442, "atom2_serNum": 16548, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///N/80/O", "atom2_id": "///N/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 16448, "atom2_serNum": 16559, "donAcc_type": "standard", "distance": 2.175, "atom1_id": "///N/80/NH1", "atom2_id": "///N/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 16448, "atom2_serNum": 16601, "donAcc_type": "standard", "distance": 2.333, "atom1_id": "///N/80/NH1", "atom2_id": "///N/101/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 16449, "atom2_serNum": 16601, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///N/80/NH2", "atom2_id": "///N/101/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 16449, "atom2_serNum": 16602, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///N/80/NH2", "atom2_id": "///N/101/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 16461, "atom2_serNum": 16536, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///N/82/N", "atom2_id": "///N/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 16464, "atom2_serNum": 16533, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///N/82/O", "atom2_id": "///N/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 16471, "atom2_serNum": 16522, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///N/84/N", "atom2_id": "///N/91/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 16474, "atom2_serNum": 16519, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///N/84/O", "atom2_id": "///N/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1793, "atom1_serNum": 16481, "atom2_serNum": 16503, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///N/86/N", "atom2_id": "///N/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 16484, "atom2_serNum": 16491, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///N/86/O", "atom2_id": "///N/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 16548, "atom2_serNum": 16554, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///N/95/N", "atom2_id": "///N/95/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 16572, "atom2_serNum": 16601, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///N/98/N", "atom2_id": "///N/101/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 16575, "atom2_serNum": 16595, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///N/98/O", "atom2_id": "///N/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 16584, "atom2_serNum": 16603, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///N/99/O", "atom2_id": "///N/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 16598, "atom2_serNum": 16610, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///N/101/O", "atom2_id": "///N/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 16598, "atom2_serNum": 16633, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///N/101/O", "atom2_id": "///N/105/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 16608, "atom2_serNum": 16782, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///N/102/OG1", "atom2_id": "///N/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1802, "atom1_serNum": 16610, "atom2_serNum": 16768, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///N/103/N", "atom2_id": "///N/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1803, "atom1_serNum": 16613, "atom2_serNum": 16765, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///N/103/O", "atom2_id": "///N/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 16622, "atom2_serNum": 16752, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///N/105/N", "atom2_id": "///N/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1805, "atom1_serNum": 16625, "atom2_serNum": 16749, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///N/105/O", "atom2_id": "///N/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 16649, "atom2_serNum": 16735, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///N/107/O", "atom2_id": "///N/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 16660, "atom2_serNum": 16720, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///N/109/N", "atom2_id": "///N/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 16663, "atom2_serNum": 16717, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///N/109/O", "atom2_id": "///N/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 16667, "atom2_serNum": 16679, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///N/109/OE1", "atom2_id": "///N/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 16667, "atom2_serNum": 16683, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///N/109/OE1", "atom2_id": "///N/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 16668, "atom2_serNum": 16701, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///N/109/NE2", "atom2_id": "///N/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 16668, "atom2_serNum": 16722, "donAcc_type": "acceptable", "distance": 3.348, "atom1_id": "///N/109/NE2", "atom2_id": "///N/116/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 16678, "atom2_serNum": 17607, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///N/110/NE2", "atom2_id": "///N/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 16695, "atom2_serNum": 16705, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///N/113/O", "atom2_id": "///N/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 16799, "atom2_serNum": 16806, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///N/150/N", "atom2_id": "///N/150/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 16802, "atom2_serNum": 16815, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///N/150/O", "atom2_id": "///N/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 16815, "atom2_serNum": 16978, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///N/152/N", "atom2_id": "///N/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 16818, "atom2_serNum": 16975, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///N/152/O", "atom2_id": "///N/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 16827, "atom2_serNum": 17689, "donAcc_type": "questionable", "distance": 3.151, "atom1_id": "///N/153/O", "atom2_id": "///N/261/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 16832, "atom2_serNum": 16964, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///N/154/N", "atom2_id": "///N/172/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 16835, "atom2_serNum": 16961, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///N/154/O", "atom2_id": "///N/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 16839, "atom2_serNum": 17690, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///N/154/OE1", "atom2_id": "///N/261/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1823, "atom1_serNum": 16841, "atom2_serNum": 17689, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///N/155/N", "atom2_id": "///N/261/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 16848, "atom2_serNum": 17691, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///N/155/OE1", "atom2_id": "///N/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 16849, "atom2_serNum": 17529, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///N/155/NE2", "atom2_id": "///N/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1826, "atom1_serNum": 16850, "atom2_serNum": 16951, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///N/156/N", "atom2_id": "///N/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 16853, "atom2_serNum": 17700, "donAcc_type": "acceptable", "distance": 2.326, "atom1_id": "///N/156/O", "atom2_id": "///N/263/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 16855, "atom2_serNum": 16874, "donAcc_type": "acceptable", "distance": 3.603, "atom1_id": "///N/156/OG", "atom2_id": "///N/159/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1829, "atom1_serNum": 16867, "atom2_serNum": 17705, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///N/159/N", "atom2_id": "///N/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 16870, "atom2_serNum": 17715, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///N/159/O", "atom2_id": "///N/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 16884, "atom2_serNum": 17718, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///N/161/N", "atom2_id": "///N/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 16887, "atom2_serNum": 17729, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///N/161/O", "atom2_id": "///N/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1833, "atom1_serNum": 16894, "atom2_serNum": 16916, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///N/162/O", "atom2_id": "///N/165/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 16899, "atom2_serNum": 17734, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///N/162/OE2", "atom2_id": "///N/268/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 16907, "atom2_serNum": 17473, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///N/164/N", "atom2_id": "///N/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 16914, "atom2_serNum": 17464, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///N/165/O", "atom2_id": "///N/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 16914, "atom2_serNum": 17470, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///N/165/O", "atom2_id": "///N/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 16923, "atom2_serNum": 17449, "donAcc_type": "acceptable", "distance": 3.539, "atom1_id": "///N/166/OG", "atom2_id": "///N/231/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1839, "atom1_serNum": 16924, "atom2_serNum": 17453, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///N/167/N", "atom2_id": "///N/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1840, "atom1_serNum": 16927, "atom2_serNum": 17450, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///N/167/O", "atom2_id": "///N/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 16940, "atom2_serNum": 17436, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///N/169/N", "atom2_id": "///N/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1842, "atom1_serNum": 16943, "atom2_serNum": 17433, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///N/169/O", "atom2_id": "///N/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1843, "atom1_serNum": 16955, "atom2_serNum": 17417, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///N/171/N", "atom2_id": "///N/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 16958, "atom2_serNum": 17414, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///N/171/O", "atom2_id": "///N/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 16970, "atom2_serNum": 17404, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///N/173/N", "atom2_id": "///N/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 16988, "atom2_serNum": 17004, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///N/176/O", "atom2_id": "///N/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 17018, "atom2_serNum": 17223, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///N/179/O", "atom2_id": "///N/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 17040, "atom2_serNum": 17575, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///N/182/N", "atom2_id": "///N/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 17043, "atom2_serNum": 17572, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///N/182/O", "atom2_id": "///N/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1850, "atom1_serNum": 17045, "atom2_serNum": 17063, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///N/182/OG1", "atom2_id": "///N/184/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1851, "atom1_serNum": 17045, "atom2_serNum": 17575, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///N/182/OG1", "atom2_id": "///N/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 17047, "atom2_serNum": 17199, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///N/183/N", "atom2_id": "///N/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 17050, "atom2_serNum": 17196, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///N/183/O", "atom2_id": "///N/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 17055, "atom2_serNum": 17559, "donAcc_type": "standard", "distance": 2.416, "atom1_id": "///N/184/N", "atom2_id": "///N/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 17058, "atom2_serNum": 17556, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///N/184/O", "atom2_id": "///N/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 17062, "atom2_serNum": 17166, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///N/184/OE1", "atom2_id": "///N/196/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 17064, "atom2_serNum": 17183, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///N/185/N", "atom2_id": "///N/198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 17067, "atom2_serNum": 17172, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///N/185/O", "atom2_id": "///N/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 17067, "atom2_serNum": 17180, "donAcc_type": "standard", "distance": 3.566, "atom1_id": "///N/185/O", "atom2_id": "///N/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 17078, "atom2_serNum": 17541, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///N/186/N", "atom2_id": "///N/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 17081, "atom2_serNum": 17538, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///N/186/O", "atom2_id": "///N/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1862, "atom1_serNum": 17085, "atom2_serNum": 17152, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///N/187/N", "atom2_id": "///N/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 17088, "atom2_serNum": 17149, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///N/187/O", "atom2_id": "///N/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 17094, "atom2_serNum": 17522, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///N/188/N", "atom2_id": "///N/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 17097, "atom2_serNum": 17519, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///N/188/O", "atom2_id": "///N/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 17102, "atom2_serNum": 17549, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///N/188/NE2", "atom2_id": "///N/244/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 17103, "atom2_serNum": 17140, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///N/189/N", "atom2_id": "///N/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 17108, "atom2_serNum": 17128, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///N/189/OG1", "atom2_id": "///N/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 17156, "atom2_serNum": 17158, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///N/195/OE1", "atom2_id": "///N/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 17157, "atom2_serNum": 17305, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///N/195/OE2", "atom2_id": "///N/212/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 17161, "atom2_serNum": 17287, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///N/196/O", "atom2_id": "///N/210/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 17175, "atom2_serNum": 17280, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///N/197/O", "atom2_id": "///N/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 17184, "atom2_serNum": 17262, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///N/199/N", "atom2_id": "///N/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 17187, "atom2_serNum": 17259, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///N/199/O", "atom2_id": "///N/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 17204, "atom2_serNum": 17251, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///N/201/N", "atom2_id": "///N/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 17207, "atom2_serNum": 17235, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///N/201/O", "atom2_id": "///N/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 17207, "atom2_serNum": 17243, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///N/201/O", "atom2_id": "///N/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 17207, "atom2_serNum": 17248, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///N/201/O", "atom2_id": "///N/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 17235, "atom2_serNum": 17241, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///N/204/N", "atom2_id": "///N/204/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 17241, "atom2_serNum": 17248, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///N/204/OD1", "atom2_id": "///N/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 17279, "atom2_serNum": 17351, "donAcc_type": "acceptable", "distance": 3.286, "atom1_id": "///N/209/OH", "atom2_id": "///N/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 17283, "atom2_serNum": 17306, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///N/210/O", "atom2_id": "///N/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 17283, "atom2_serNum": 17317, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///N/210/O", "atom2_id": "///N/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 17286, "atom2_serNum": 17288, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///N/210/OD1", "atom2_id": "///N/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 17296, "atom2_serNum": 17325, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///N/211/OE2", "atom2_id": "///N/214/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 17309, "atom2_serNum": 17339, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///N/213/O", "atom2_id": "///N/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1887, "atom1_serNum": 17320, "atom2_serNum": 17330, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///N/214/O", "atom2_id": "///N/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 17329, "atom2_serNum": 17463, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///N/215/O", "atom2_id": "///N/233/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 17333, "atom2_serNum": 17458, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///N/216/O", "atom2_id": "///N/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 17338, "atom2_serNum": 17461, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///N/216/NZ", "atom2_id": "///N/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 17338, "atom2_serNum": 17467, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///N/216/NZ", "atom2_id": "///N/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 17338, "atom2_serNum": 17469, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///N/216/NZ", "atom2_id": "///N/234/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 17338, "atom2_serNum": 17506, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///N/216/NZ", "atom2_id": "///N/239/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 17342, "atom2_serNum": 17349, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///N/217/O", "atom2_id": "///N/218/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 17344, "atom2_serNum": 17444, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///N/218/N", "atom2_id": "///N/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 17347, "atom2_serNum": 17441, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///N/218/O", "atom2_id": "///N/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 17359, "atom2_serNum": 17424, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///N/220/N", "atom2_id": "///N/229/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 17362, "atom2_serNum": 17421, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///N/220/O", "atom2_id": "///N/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 17372, "atom2_serNum": 17410, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///N/222/N", "atom2_id": "///N/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 17375, "atom2_serNum": 17401, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///N/222/O", "atom2_id": "///N/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 17375, "atom2_serNum": 17407, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///N/222/O", "atom2_id": "///N/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 17379, "atom2_serNum": 17394, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///N/222/OD2", "atom2_id": "///N/224/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 17379, "atom2_serNum": 17395, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///N/222/OD2", "atom2_id": "///N/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 17383, "atom2_serNum": 17401, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///N/223/O", "atom2_id": "///N/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 17461, "atom2_serNum": 17469, "donAcc_type": "acceptable", "distance": 2.536, "atom1_id": "///N/233/O", "atom2_id": "///N/234/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 17467, "atom2_serNum": 17469, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///N/234/O", "atom2_id": "///N/234/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 17467, "atom2_serNum": 17483, "donAcc_type": "acceptable", "distance": 3.291, "atom1_id": "///N/234/O", "atom2_id": "///N/236/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 17481, "atom2_serNum": 17500, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///N/236/O", "atom2_id": "///N/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 17488, "atom2_serNum": 17508, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///N/237/O", "atom2_id": "///N/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 17488, "atom2_serNum": 17513, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///N/237/O", "atom2_id": "///N/240/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 17503, "atom2_serNum": 17514, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///N/239/O", "atom2_id": "///N/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 17503, "atom2_serNum": 17537, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///N/239/O", "atom2_id": "///N/243/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 17513, "atom2_serNum": 17722, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///N/240/OG", "atom2_id": "///N/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 17514, "atom2_serNum": 17711, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///N/241/N", "atom2_id": "///N/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 17517, "atom2_serNum": 17708, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///N/241/O", "atom2_id": "///N/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1916, "atom1_serNum": 17526, "atom2_serNum": 17698, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///N/243/N", "atom2_id": "///N/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 17529, "atom2_serNum": 17695, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///N/243/O", "atom2_id": "///N/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 17553, "atom2_serNum": 17678, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///N/245/O", "atom2_id": "///N/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 17561, "atom2_serNum": 17655, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///N/247/N", "atom2_id": "///N/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 17564, "atom2_serNum": 17644, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///N/247/O", "atom2_id": "///N/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 17568, "atom2_serNum": 17650, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///N/247/NE", "atom2_id": "///N/257/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 17568, "atom2_serNum": 17651, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///N/247/NE", "atom2_id": "///N/257/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 17571, "atom2_serNum": 17651, "donAcc_type": "standard", "distance": 2.334, "atom1_id": "///N/247/NH2", "atom2_id": "///N/257/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 17580, "atom2_serNum": 17584, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///N/248/NZ", "atom2_id": "///N/249/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 17580, "atom2_serNum": 17626, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///N/248/NZ", "atom2_id": "///N/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 17581, "atom2_serNum": 17628, "donAcc_type": "acceptable", "distance": 3.678, "atom1_id": "///N/249/N", "atom2_id": "///N/254/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 17596, "atom2_serNum": 17623, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///N/251/O", "atom2_id": "///N/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 17632, "atom2_serNum": 17644, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///N/255/O", "atom2_id": "///N/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 17644, "atom2_serNum": 17650, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///N/257/N", "atom2_id": "///N/257/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 17650, "atom2_serNum": 17652, "donAcc_type": "standard", "distance": 2.417, "atom1_id": "///N/257/OD1", "atom2_id": "///N/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1931, "atom1_serNum": 17682, "atom2_serNum": 17689, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///N/261/N", "atom2_id": "///N/261/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 17748, "atom2_serNum": 17791, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///U/44/O", "atom2_id": "///U/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 17755, "atom2_serNum": 17783, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///U/45/O", "atom2_id": "///U/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1934, "atom1_serNum": 17759, "atom2_serNum": 17792, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///U/46/O", "atom2_id": "///U/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 17768, "atom2_serNum": 17800, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///U/47/O", "atom2_id": "///U/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 17776, "atom2_serNum": 18014, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///U/47/OH", "atom2_id": "///U/78/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 17776, "atom2_serNum": 18036, "donAcc_type": "acceptable", "distance": 2.955, "atom1_id": "///U/47/OH", "atom2_id": "///U/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 17780, "atom2_serNum": 17807, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///U/48/O", "atom2_id": "///U/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 17782, "atom2_serNum": 18138, "donAcc_type": "acceptable", "distance": 3.514, "atom1_id": "///U/48/OG", "atom2_id": "///U/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1940, "atom1_serNum": 17786, "atom2_serNum": 17814, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///U/49/O", "atom2_id": "///U/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 17795, "atom2_serNum": 17823, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///U/50/O", "atom2_id": "///U/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 17795, "atom2_serNum": 17828, "donAcc_type": "acceptable", "distance": 2.475, "atom1_id": "///U/50/O", "atom2_id": "///U/54/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 17803, "atom2_serNum": 17830, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///U/51/O", "atom2_id": "///U/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 17817, "atom2_serNum": 17849, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///U/53/O", "atom2_id": "///U/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 17826, "atom2_serNum": 17860, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///U/54/O", "atom2_id": "///U/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 17833, "atom2_serNum": 17868, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///U/55/O", "atom2_id": "///U/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1947, "atom1_serNum": 17859, "atom2_serNum": 17972, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///U/57/NH2", "atom2_id": "///U/72/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 17875, "atom2_serNum": 17900, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///U/60/O", "atom2_id": "///U/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 17884, "atom2_serNum": 18306, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///U/61/O", "atom2_id": "///U/114/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 17904, "atom2_serNum": 18290, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///U/64/N", "atom2_id": "///U/113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 17907, "atom2_serNum": 18287, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///U/64/O", "atom2_id": "///U/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 17913, "atom2_serNum": 17938, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///U/65/O", "atom2_id": "///U/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 17915, "atom2_serNum": 18280, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///U/65/OG", "atom2_id": "///U/111/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 17919, "atom2_serNum": 17946, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///U/66/O", "atom2_id": "///U/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 17927, "atom2_serNum": 17958, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///U/67/O", "atom2_id": "///U/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1956, "atom1_serNum": 17932, "atom2_serNum": 17963, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///U/68/O", "atom2_id": "///U/71/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 17932, "atom2_serNum": 17965, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///U/68/O", "atom2_id": "///U/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 17941, "atom2_serNum": 17974, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///U/69/O", "atom2_id": "///U/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 17949, "atom2_serNum": 17979, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///U/70/O", "atom2_id": "///U/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 17977, "atom2_serNum": 17997, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///U/73/O", "atom2_id": "///U/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 17982, "atom2_serNum": 18052, "donAcc_type": "standard", "distance": 3.877, "atom1_id": "///U/74/O", "atom2_id": "///U/81/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 18000, "atom2_serNum": 18025, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///U/76/O", "atom2_id": "///U/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 18028, "atom2_serNum": 18052, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///U/79/O", "atom2_id": "///U/81/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 18039, "atom2_serNum": 18070, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///U/80/O", "atom2_id": "///U/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 18043, "atom2_serNum": 18062, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///U/80/OD2", "atom2_id": "///U/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 18065, "atom2_serNum": 18092, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///U/83/O", "atom2_id": "///U/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 18069, "atom2_serNum": 18090, "donAcc_type": "acceptable", "distance": 3.908, "atom1_id": "///U/83/ND2", "atom2_id": "///U/86/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 18073, "atom2_serNum": 18104, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///U/84/O", "atom2_id": "///U/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 18077, "atom2_serNum": 18112, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///U/85/O", "atom2_id": "///U/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 18088, "atom2_serNum": 18121, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///U/86/O", "atom2_id": "///U/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 18095, "atom2_serNum": 18133, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///U/87/O", "atom2_id": "///U/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 18107, "atom2_serNum": 18139, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///U/88/O", "atom2_id": "///U/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 18115, "atom2_serNum": 18147, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///U/89/O", "atom2_id": "///U/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 18124, "atom2_serNum": 18156, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///U/90/O", "atom2_id": "///U/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 18136, "atom2_serNum": 18161, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///U/91/O", "atom2_id": "///U/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 18142, "atom2_serNum": 18169, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///U/92/O", "atom2_id": "///U/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 18150, "atom2_serNum": 18176, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///U/93/O", "atom2_id": "///U/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 18159, "atom2_serNum": 18185, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///U/94/O", "atom2_id": "///U/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 18159, "atom2_serNum": 18192, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///U/94/O", "atom2_id": "///U/98/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1980, "atom1_serNum": 18164, "atom2_serNum": 18193, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///U/95/O", "atom2_id": "///U/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1981, "atom1_serNum": 18164, "atom2_serNum": 18201, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///U/95/O", "atom2_id": "///U/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1982, "atom1_serNum": 18172, "atom2_serNum": 18193, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///U/96/O", "atom2_id": "///U/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1983, "atom1_serNum": 18196, "atom2_serNum": 18322, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///U/99/O", "atom2_id": "///U/116/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1984, "atom1_serNum": 18204, "atom2_serNum": 18315, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///U/100/O", "atom2_id": "///U/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1985, "atom1_serNum": 18216, "atom2_serNum": 18301, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///U/102/N", "atom2_id": "///U/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1986, "atom1_serNum": 18219, "atom2_serNum": 18298, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///U/102/O", "atom2_id": "///U/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1987, "atom1_serNum": 18231, "atom2_serNum": 18260, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///U/103/OE1", "atom2_id": "///U/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1988, "atom1_serNum": 18232, "atom2_serNum": 18243, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///U/103/NE2", "atom2_id": "///U/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1989, "atom1_serNum": 18232, "atom2_serNum": 18272, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///U/103/NE2", "atom2_id": "///U/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1990, "atom1_serNum": 18233, "atom2_serNum": 18284, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///U/104/N", "atom2_id": "///U/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1991, "atom1_serNum": 18243, "atom2_serNum": 18281, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///U/105/O", "atom2_id": "///U/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1992, "atom1_serNum": 18252, "atom2_serNum": 18258, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///U/106/O", "atom2_id": "///U/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1993, "atom1_serNum": 18253, "atom2_serNum": 18272, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///U/107/N", "atom2_id": "///U/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1994, "atom1_serNum": 18256, "atom2_serNum": 18269, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///U/107/O", "atom2_id": "///U/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1995, "atom1_serNum": 18310, "atom2_serNum": 18332, "donAcc_type": "standard", "distance": 2.441, "atom1_id": "///U/115/O", "atom2_id": "///U/117/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1996, "atom1_serNum": 18318, "atom2_serNum": 18334, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///U/116/O", "atom2_id": "///U/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1997, "atom1_serNum": 18321, "atom2_serNum": 18323, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///U/116/OD1", "atom2_id": "///U/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "7k60", "num_aaChains": 11, "aaChains": "A=97,B=83,C=109,D=95,E=97,F=83,G=109,H=95,M=227,N=227,U=76", "num_naChains": 2, "naChains": "I=197,J=197", "num_atoms": 18330, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 11, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 9, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 10, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }