{ "num_pairs": 31, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.172, "chi2": -162.521, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.318, "C1C1_dist": 10.611, "N1N9_dist": 8.864, "C6C8_dist": 9.776, "CNNC_torsion": 11.312, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 6.159, "planarity": 0.208, "simple_Shear": -0.133, "simple_Stretch": -0.298, "simple_Buckle": -5.919, "simple_Propeller": 1.703, "bp_simpleParams": [ -0.133, -0.298, -1.074, -5.919, 1.703, -0.840 ], "bp_params": [ -0.130, -0.299, -1.074, -5.935, 1.647, -0.839 ], "frame": { "rmsd": null, "origin": [ 84.958, 44.939, 77.843 ], "x_axis": [ -0.086, 0.274, -0.958 ], "y_axis": [ -0.893, 0.406, 0.196 ], "z_axis": [ 0.443, 0.872, 0.210 ], "quaternion": [ 0.618, -0.273, 0.566, 0.472 ] } }, { "index": 2, "nt1": "///C/2", "nt2": "///C/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.619, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.421, "chi2": -171.000, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.741, "C1C1_dist": 10.630, "N1N9_dist": 8.877, "C6C8_dist": 9.793, "CNNC_torsion": 12.209, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 7.840, "planarity": 0.228, "simple_Shear": 0.158, "simple_Stretch": -0.258, "simple_Buckle": -4.943, "simple_Propeller": 6.085, "bp_simpleParams": [ 0.158, -0.258, -0.797, -4.943, 6.085, -1.151 ], "bp_params": [ 0.155, -0.260, -0.797, -4.879, 6.136, -1.151 ], "frame": { "rmsd": null, "origin": [ 88.009, 47.417, 77.765 ], "x_axis": [ -0.593, 0.415, -0.690 ], "y_axis": [ -0.704, 0.151, 0.695 ], "z_axis": [ 0.392, 0.897, 0.203 ], "quaternion": [ 0.436, -0.116, 0.621, 0.641 ] } }, { "index": 3, "nt1": "///C/3", "nt2": "///C/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.979, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.803, "chi2": -171.438, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.410, "C1C1_dist": 10.643, "N1N9_dist": 8.932, "C6C8_dist": 9.885, "CNNC_torsion": 10.461, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 11.221, "planarity": 0.146, "simple_Shear": 0.202, "simple_Stretch": -0.141, "simple_Buckle": -3.501, "simple_Propeller": 10.660, "bp_simpleParams": [ 0.202, -0.141, -0.209, -3.501, 10.660, 0.689 ], "bp_params": [ 0.200, -0.144, -0.209, -3.340, 10.712, 0.691 ], "frame": { "rmsd": null, "origin": [ 90.008, 50.442, 76.696 ], "x_axis": [ -0.897, 0.364, -0.252 ], "y_axis": [ -0.303, -0.091, 0.949 ], "z_axis": [ 0.322, 0.927, 0.192 ], "quaternion": [ 0.226, 0.024, 0.635, 0.738 ] } }, { "index": 4, "nt1": "///C/4", "nt2": "///C/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.810, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.827, "chi2": -173.765, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.152, "C1C1_dist": 10.594, "N1N9_dist": 8.900, "C6C8_dist": 9.882, "CNNC_torsion": 8.680, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 13.286, "planarity": 0.187, "simple_Shear": 0.229, "simple_Stretch": -0.141, "simple_Buckle": 0.749, "simple_Propeller": 13.265, "bp_simpleParams": [ 0.229, -0.141, 0.203, 0.749, 13.265, 2.834 ], "bp_params": [ 0.226, -0.145, 0.203, 0.989, 13.250, 2.853 ], "frame": { "rmsd": null, "origin": [ 90.847, 53.794, 75.326 ], "x_axis": [ -0.957, 0.166, 0.236 ], "y_axis": [ 0.190, -0.254, 0.948 ], "z_axis": [ 0.217, 0.953, 0.212 ], "quaternion": [ -0.008, 0.146, 0.611, 0.778 ] } }, { "index": 5, "nt1": "///C/5", "nt2": "///C/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.160, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.366, "chi2": -162.048, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.487, "C1C1_dist": 10.682, "N1N9_dist": 8.942, "C6C8_dist": 9.877, "CNNC_torsion": -2.028, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 11.175, "planarity": 0.124, "simple_Shear": -0.198, "simple_Stretch": -0.128, "simple_Buckle": -8.690, "simple_Propeller": -7.026, "bp_simpleParams": [ -0.198, -0.128, -0.416, -8.690, -7.026, 0.911 ], "bp_params": [ -0.197, -0.131, -0.416, -8.603, -7.132, 0.910 ], "frame": { "rmsd": null, "origin": [ 90.086, 57.200, 74.789 ], "x_axis": [ -0.694, -0.294, 0.657 ], "y_axis": [ 0.704, -0.087, 0.705 ], "z_axis": [ -0.150, 0.952, 0.267 ], "quaternion": [ -0.349, 0.177, 0.579, 0.715 ] } }, { "index": 6, "nt1": "///C/6", "nt2": "///C/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.234, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.448, "chi2": -163.508, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.633, "C1C1_dist": 10.492, "N1N9_dist": 8.602, "C6C8_dist": 9.362, "CNNC_torsion": 7.925, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.85],O6(carbonyl)*O4(carbonyl)[2.56],N2(amino)-O2(carbonyl)[2.84]", "unusual_base2base_hbonds": 1, "interBase_angle": 3.892, "planarity": 0.142, "simple_Shear": -0.822, "simple_Stretch": -0.611, "simple_Buckle": -3.166, "simple_Propeller": 2.264, "bp_simpleParams": [ -0.822, -0.611, -0.702, -3.166, 2.264, -8.213 ], "bp_params": [ -0.772, -0.673, -0.702, -3.333, 2.009, -8.211 ], "frame": { "rmsd": null, "origin": [ 87.792, 60.434, 74.482 ], "x_axis": [ -0.293, -0.352, 0.889 ], "y_axis": [ 0.930, 0.110, 0.350 ], "z_axis": [ -0.221, 0.930, 0.295 ], "quaternion": [ 0.527, -0.275, -0.526, -0.608 ] } }, { "index": 7, "nt1": "///C/7", "nt2": "///C/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -142.858, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.667, "chi2": -163.665, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.409, "C1C1_dist": 10.653, "N1N9_dist": 8.902, "C6C8_dist": 9.833, "CNNC_torsion": 5.525, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.86]", "interBase_angle": 3.115, "planarity": 0.119, "simple_Shear": 0.063, "simple_Stretch": -0.122, "simple_Buckle": 2.234, "simple_Propeller": 2.171, "bp_simpleParams": [ 0.063, -0.122, -0.457, 2.234, 2.171, -0.484 ], "bp_params": [ 0.062, -0.123, -0.457, 2.259, 2.145, -0.484 ], "frame": { "rmsd": null, "origin": [ 85.801, 63.175, 75.678 ], "x_axis": [ 0.318, -0.258, 0.912 ], "y_axis": [ 0.923, 0.302, -0.236 ], "z_axis": [ -0.215, 0.918, 0.334 ], "quaternion": [ 0.699, -0.413, -0.403, -0.423 ] } }, { "index": 8, "nt1": "///C/8", "nt2": "///C/14", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -152.709, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.467, "chi2": 179.584, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.167, "C1C1_dist": 9.941, "N1N9_dist": 7.374, "C6C8_dist": 6.370, "CNNC_torsion": 176.554, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.94],N3(imino)-N7[2.95]", "interBase_angle": 1.999, "planarity": 0.055, "simple_Shear": 4.197, "simple_Stretch": 1.360, "simple_Buckle": -1.981, "simple_Propeller": -0.265, "bp_simpleParams": [ 4.197, 1.360, -0.206, -1.981, -0.265, -97.942 ], "bp_params": [ 4.068, -1.708, -0.206, -1.674, 1.093, -97.938 ], "frame": { "rmsd": null, "origin": [ 100.504, 73.144, 70.976 ], "x_axis": [ -0.564, -0.796, -0.219 ], "y_axis": [ -0.822, 0.565, 0.065 ], "z_axis": [ 0.072, 0.217, -0.974 ], "quaternion": [ 0.083, -0.459, 0.881, 0.080 ] } }, { "index": 9, "nt1": "///C/8", "nt2": "///C/21", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -152.709, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.307, "chi2": -160.344, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.544, "C1C1_dist": 8.444, "N1N9_dist": 8.243, "C6C8_dist": 10.500, "CNNC_torsion": 169.252, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.86]", "interBase_angle": 12.189, "planarity": 0.167, "simple_Shear": 6.770, "simple_Stretch": 4.197, "simple_Buckle": -5.245, "simple_Propeller": -11.003, "bp_simpleParams": [ 6.770, 4.197, -0.181, -5.245, -11.003, -138.617 ], "bp_params": [ -2.064, -7.693, -0.181, -3.718, 11.608, -138.791 ], "frame": { "rmsd": null, "origin": [ 97.038, 73.623, 70.659 ], "x_axis": [ -0.806, -0.528, -0.267 ], "y_axis": [ -0.571, 0.813, 0.116 ], "z_axis": [ 0.156, 0.246, -0.957 ], "quaternion": [ 0.112, -0.291, 0.945, 0.096 ] } }, { "index": 10, "nt1": "///C/10", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.102, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.583, "chi2": -167.981, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.739, "C1C1_dist": 10.603, "N1N9_dist": 8.814, "C6C8_dist": 9.709, "CNNC_torsion": 12.454, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 2.854, "planarity": 0.264, "simple_Shear": -0.144, "simple_Stretch": -0.392, "simple_Buckle": -2.816, "simple_Propeller": 0.462, "bp_simpleParams": [ -0.144, -0.392, -1.251, -2.816, 0.462, -1.090 ], "bp_params": [ -0.140, -0.393, -1.251, -2.820, 0.435, -1.090 ], "frame": { "rmsd": null, "origin": [ 96.498, 74.122, 58.021 ], "x_axis": [ 0.320, 0.805, 0.499 ], "y_axis": [ -0.914, 0.123, 0.387 ], "z_axis": [ 0.250, -0.580, 0.775 ], "quaternion": [ 0.745, 0.325, -0.084, 0.577 ] } }, { "index": 11, "nt1": "///C/10", "nt2": "///C/45", "bp": "G+G", "name": "--", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "intra_chain": true, "chi1": -171.102, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.039, "chi2": -153.995, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 112.666, "C1C1_dist": 8.874, "N1N9_dist": 8.340, "C6C8_dist": 8.365, "CNNC_torsion": -30.093, "hbonds_num": 2, "hbonds_desc": "OP1-O2'(hydroxyl)[3.41],O6(carbonyl)-N2(amino)[2.30]", "interBase_angle": 36.372, "planarity": 0.550, "simple_Shear": -0.237, "simple_Stretch": 6.583, "simple_Buckle": 7.369, "simple_Propeller": -35.618, "bp_simpleParams": [ -0.237, 6.583, -0.692, 7.369, -35.618, 18.436 ], "bp_params": [ -6.448, -1.344, -0.692, 33.945, 13.064, 17.769 ], "frame": { "rmsd": null, "origin": [ 97.407, 76.792, 59.532 ], "x_axis": [ 0.474, 0.709, 0.522 ], "y_axis": [ -0.877, 0.436, 0.203 ], "z_axis": [ -0.084, -0.554, 0.828 ], "quaternion": [ 0.827, 0.229, -0.183, 0.479 ] } }, { "index": 12, "nt1": "///C/11", "nt2": "///C/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.227, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.396, "chi2": -171.712, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.570, "C1C1_dist": 10.645, "N1N9_dist": 8.866, "C6C8_dist": 9.776, "CNNC_torsion": 8.933, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 0.670, "planarity": 0.205, "simple_Shear": 0.155, "simple_Stretch": -0.288, "simple_Buckle": 0.430, "simple_Propeller": 0.514, "bp_simpleParams": [ 0.155, -0.288, -0.924, 0.430, 0.514, -0.589 ], "bp_params": [ 0.152, -0.290, -0.924, 0.436, 0.509, -0.589 ], "frame": { "rmsd": null, "origin": [ 98.889, 72.446, 60.226 ], "x_axis": [ -0.250, 0.741, 0.623 ], "y_axis": [ -0.938, -0.344, 0.033 ], "z_axis": [ 0.239, -0.577, 0.781 ], "quaternion": [ 0.545, 0.280, -0.177, 0.771 ] } }, { "index": 13, "nt1": "///C/12", "nt2": "///C/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.243, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.345, "chi2": -175.732, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.774, "C1C1_dist": 10.649, "N1N9_dist": 8.895, "C6C8_dist": 9.831, "CNNC_torsion": 6.115, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 3.103, "planarity": 0.094, "simple_Shear": -0.033, "simple_Stretch": -0.124, "simple_Buckle": 1.089, "simple_Propeller": 2.905, "bp_simpleParams": [ -0.033, -0.124, -0.424, 1.089, 2.905, -0.238 ], "bp_params": [ -0.032, -0.124, -0.424, 1.065, 2.914, -0.238 ], "frame": { "rmsd": null, "origin": [ 100.715, 71.684, 63.411 ], "x_axis": [ -0.728, 0.480, 0.489 ], "y_axis": [ -0.653, -0.703, -0.283 ], "z_axis": [ 0.208, -0.525, 0.825 ], "quaternion": [ 0.314, 0.193, -0.224, 0.902 ] } }, { "index": 14, "nt1": "///C/13", "nt2": "///C/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.609, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.905, "chi2": -173.989, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.134, "C1C1_dist": 10.579, "N1N9_dist": 8.884, "C6C8_dist": 9.848, "CNNC_torsion": 3.873, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 1.924, "planarity": 0.155, "simple_Shear": 0.195, "simple_Stretch": -0.200, "simple_Buckle": -0.336, "simple_Propeller": -1.894, "bp_simpleParams": [ 0.195, -0.200, -0.654, -0.336, -1.894, 1.524 ], "bp_params": [ 0.192, -0.203, -0.654, -0.364, -1.889, 1.524 ], "frame": { "rmsd": null, "origin": [ 99.919, 73.039, 67.274 ], "x_axis": [ -0.988, 0.148, -0.050 ], "y_axis": [ -0.136, -0.972, -0.191 ], "z_axis": [ -0.077, -0.181, 0.980 ], "quaternion": [ 0.071, -0.032, -0.094, 0.993 ] } }, { "index": 15, "nt1": "///C/14", "nt2": "///C/21", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": 179.584, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.768, "chi2": -160.344, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 117.697, "C1C1_dist": 10.218, "N1N9_dist": 9.651, "C6C8_dist": 10.847, "CNNC_torsion": -7.735, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.40],N1-O2'(hydroxyl)[3.50]", "interBase_angle": 10.315, "planarity": 0.167, "simple_Shear": -5.902, "simple_Stretch": 3.800, "simple_Buckle": -0.965, "simple_Propeller": -10.270, "bp_simpleParams": [ -5.902, 3.800, -0.360, -0.965, -10.270, 40.867 ], "bp_params": [ -6.962, -0.896, -0.360, 5.880, -8.475, 40.921 ], "frame": { "rmsd": null, "origin": [ 97.490, 75.747, 71.060 ], "x_axis": [ -0.957, 0.270, -0.104 ], "y_axis": [ -0.232, -0.931, -0.281 ], "z_axis": [ -0.173, -0.245, 0.954 ], "quaternion": [ 0.128, -0.071, -0.134, 0.980 ] } }, { "index": 16, "nt1": "///C/15", "nt2": "///C/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -171.018, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.704, "chi2": -127.208, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.017, "C1C1_dist": 10.339, "N1N9_dist": 8.957, "C6C8_dist": 10.765, "CNNC_torsion": -179.217, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O2(carbonyl)[3.02],N2(amino)-O2(carbonyl)[2.59],N2(amino)-N3[2.83]", "interBase_angle": 5.767, "planarity": 0.068, "simple_Shear": 4.667, "simple_Stretch": 2.028, "simple_Buckle": 5.765, "simple_Propeller": -0.167, "bp_simpleParams": [ 4.667, 2.028, 0.074, 5.765, -0.167, 163.467 ], "bp_params": [ 0.400, 5.073, 0.074, 2.854, 5.012, 163.477 ], "frame": { "rmsd": null, "origin": [ 97.268, 74.540, 74.142 ], "x_axis": [ -0.992, 0.108, -0.057 ], "y_axis": [ -0.089, -0.959, -0.269 ], "z_axis": [ -0.084, -0.262, 0.961 ], "quaternion": [ 0.050, -0.036, -0.134, 0.989 ] } }, { "index": 17, "nt1": "///C/18", "nt2": "///C/55", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -105.724, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 34.169, "chi2": -162.284, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 101.280, "C1C1_dist": 9.069, "N1N9_dist": 8.446, "C6C8_dist": 10.148, "CNNC_torsion": -158.339, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.93],N2(amino)-O2(carbonyl)[2.48]", "interBase_angle": 19.421, "planarity": 0.290, "simple_Shear": 4.951, "simple_Stretch": 3.606, "simple_Buckle": -15.631, "simple_Propeller": 11.525, "bp_simpleParams": [ 4.951, 3.606, -0.246, -15.631, 11.525, 110.343 ], "bp_params": [ 0.079, 6.124, -0.246, -18.586, -5.635, 109.697 ], "frame": { "rmsd": null, "origin": [ 93.725, 78.811, 89.384 ], "x_axis": [ -0.573, -0.050, 0.818 ], "y_axis": [ 0.768, -0.379, 0.515 ], "z_axis": [ 0.284, 0.924, 0.256 ], "quaternion": [ -0.275, 0.371, 0.484, 0.743 ] } }, { "index": 18, "nt1": "///C/19", "nt2": "///C/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -78.718, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.566, "chi2": -177.555, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.203, "C1C1_dist": 10.694, "N1N9_dist": 8.936, "C6C8_dist": 9.879, "CNNC_torsion": -3.990, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 5.447, "planarity": 0.069, "simple_Shear": -0.160, "simple_Stretch": -0.137, "simple_Buckle": -4.268, "simple_Propeller": -3.385, "bp_simpleParams": [ -0.160, -0.137, 0.023, -4.268, -3.385, 0.548 ], "bp_params": [ -0.159, -0.139, 0.023, -4.230, -3.432, 0.548 ], "frame": { "rmsd": null, "origin": [ 100.157, 83.186, 90.214 ], "x_axis": [ 0.498, -0.629, 0.597 ], "y_axis": [ 0.604, -0.242, -0.759 ], "z_axis": [ 0.622, 0.739, 0.260 ], "quaternion": [ 0.615, -0.608, 0.010, -0.501 ] } }, { "index": 19, "nt1": "///C/22", "nt2": "///C/46", "bp": "G-G", "name": "~rHoogsteen", "Saenger": "07-VII", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -173.989, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.286, "chi2": -105.226, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 24.377, "C1C1_dist": 11.407, "N1N9_dist": 8.902, "C6C8_dist": 7.534, "CNNC_torsion": -175.873, "hbonds_num": 2, "hbonds_desc": "N7-N1(imino)[2.95],O6(carbonyl)-N2(amino)[2.88]", "interBase_angle": 1.738, "planarity": 0.026, "simple_Shear": -3.627, "simple_Stretch": 3.723, "simple_Buckle": -1.088, "simple_Propeller": 1.356, "bp_simpleParams": [ -3.627, 3.723, -0.026, -1.088, 1.356, -115.474 ], "bp_params": [ -5.194, 0.195, -0.026, -1.723, 0.231, -115.468 ], "frame": { "rmsd": null, "origin": [ 98.850, 75.191, 67.873 ], "x_axis": [ -0.399, 0.909, 0.123 ], "y_axis": [ 0.913, 0.382, 0.140 ], "z_axis": [ 0.080, 0.168, -0.982 ], "quaternion": [ -0.013, 0.548, 0.831, 0.093 ] } }, { "index": 20, "nt1": "///C/26", "nt2": "///C/44", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 172.563, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.413, "chi2": -164.385, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.011, "C1C1_dist": 12.606, "N1N9_dist": 10.522, "C6C8_dist": 10.891, "CNNC_torsion": 7.326, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.89],N1-N1(imino)[2.90]", "interBase_angle": 3.424, "planarity": 0.168, "simple_Shear": 1.243, "simple_Stretch": 1.227, "simple_Buckle": -3.226, "simple_Propeller": -1.147, "bp_simpleParams": [ 1.243, 1.227, -0.721, -3.226, -1.147, -18.195 ], "bp_params": [ 1.389, 1.059, -0.721, -3.346, -0.726, -18.188 ], "frame": { "rmsd": null, "origin": [ 96.830, 80.365, 56.309 ], "x_axis": [ 0.914, -0.156, 0.374 ], "y_axis": [ 0.037, -0.887, -0.460 ], "z_axis": [ 0.403, 0.435, -0.805 ], "quaternion": [ -0.236, 0.950, -0.031, 0.205 ] } }, { "index": 21, "nt1": "///C/27", "nt2": "///C/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.859, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.652, "chi2": -164.113, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.233, "C1C1_dist": 10.595, "N1N9_dist": 8.857, "C6C8_dist": 9.795, "CNNC_torsion": 7.646, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 6.709, "planarity": 0.180, "simple_Shear": -0.048, "simple_Stretch": -0.159, "simple_Buckle": -5.615, "simple_Propeller": 3.673, "bp_simpleParams": [ -0.048, -0.159, -0.584, -5.615, 3.673, -0.334 ], "bp_params": [ -0.046, -0.160, -0.584, -5.654, 3.611, -0.334 ], "frame": { "rmsd": null, "origin": [ 99.253, 83.217, 54.610 ], "x_axis": [ 0.803, -0.579, 0.139 ], "y_axis": [ -0.428, -0.723, -0.542 ], "z_axis": [ 0.414, 0.376, -0.829 ], "quaternion": [ -0.251, 0.916, -0.275, 0.151 ] } }, { "index": 22, "nt1": "///C/28", "nt2": "///C/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.055, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.442, "chi2": -169.453, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.092, "C1C1_dist": 10.715, "N1N9_dist": 8.948, "C6C8_dist": 9.877, "CNNC_torsion": 7.210, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 9.048, "planarity": 0.112, "simple_Shear": 0.183, "simple_Stretch": -0.145, "simple_Buckle": -1.544, "simple_Propeller": 8.915, "bp_simpleParams": [ 0.183, -0.145, -0.072, -1.544, 8.915, 0.097 ], "bp_params": [ 0.181, -0.147, -0.072, -1.424, 8.935, 0.097 ], "frame": { "rmsd": null, "origin": [ 101.628, 85.180, 52.792 ], "x_axis": [ 0.406, -0.907, -0.113 ], "y_axis": [ -0.810, -0.300, -0.503 ], "z_axis": [ 0.423, 0.296, -0.857 ], "quaternion": [ -0.250, 0.800, -0.536, 0.097 ] } }, { "index": 23, "nt1": "///C/29", "nt2": "///C/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.269, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.705, "chi2": -162.677, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.509, "C1C1_dist": 10.801, "N1N9_dist": 8.986, "C6C8_dist": 9.812, "CNNC_torsion": 0.651, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.72],N1-N3(imino)[2.86]", "interBase_angle": 5.362, "planarity": 0.063, "simple_Shear": 0.298, "simple_Stretch": -0.114, "simple_Buckle": -4.679, "simple_Propeller": -2.619, "bp_simpleParams": [ 0.298, -0.114, -0.271, -4.679, -2.619, -5.292 ], "bp_params": [ 0.294, -0.124, -0.271, -4.767, -2.455, -5.288 ], "frame": { "rmsd": null, "origin": [ 104.404, 85.906, 50.822 ], "x_axis": [ -0.212, -0.958, -0.192 ], "y_axis": [ -0.844, 0.279, -0.458 ], "z_axis": [ 0.492, 0.065, -0.868 ], "quaternion": [ 0.223, -0.587, 0.768, -0.128 ] } }, { "index": 24, "nt1": "///C/30", "nt2": "///C/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.860, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.288, "chi2": -161.766, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.828, "C1C1_dist": 10.638, "N1N9_dist": 8.885, "C6C8_dist": 9.802, "CNNC_torsion": 8.271, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 1.567, "planarity": 0.178, "simple_Shear": -0.156, "simple_Stretch": -0.257, "simple_Buckle": -1.425, "simple_Propeller": 0.650, "bp_simpleParams": [ -0.156, -0.257, -0.840, -1.425, 0.650, -0.457 ], "bp_params": [ -0.154, -0.259, -0.840, -1.433, 0.634, -0.457 ], "frame": { "rmsd": null, "origin": [ 107.243, 85.207, 48.442 ], "x_axis": [ -0.603, -0.698, -0.385 ], "y_axis": [ -0.617, 0.715, -0.329 ], "z_axis": [ 0.505, 0.039, -0.862 ], "quaternion": [ 0.249, -0.369, 0.892, -0.081 ] } }, { "index": 25, "nt1": "///C/31", "nt2": "///C/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.146, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.740, "chi2": -162.689, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.632, "C1C1_dist": 10.416, "N1N9_dist": 8.772, "C6C8_dist": 9.773, "CNNC_torsion": 6.697, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.81]", "interBase_angle": 0.666, "planarity": 0.159, "simple_Shear": 0.068, "simple_Stretch": -0.203, "simple_Buckle": -0.244, "simple_Propeller": 0.619, "bp_simpleParams": [ 0.068, -0.203, -0.748, -0.244, 0.619, 2.320 ], "bp_params": [ 0.065, -0.203, -0.748, -0.237, 0.622, 2.320 ], "frame": { "rmsd": null, "origin": [ 109.429, 83.884, 45.336 ], "x_axis": [ -0.840, -0.234, -0.490 ], "y_axis": [ -0.222, 0.972, -0.084 ], "z_axis": [ 0.496, 0.038, -0.867 ], "quaternion": [ 0.257, -0.119, 0.959, -0.012 ] } }, { "index": 26, "nt1": "///C/49", "nt2": "///C/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.347, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.388, "chi2": -174.386, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.485, "C1C1_dist": 10.674, "N1N9_dist": 8.913, "C6C8_dist": 9.873, "CNNC_torsion": 7.404, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 13.450, "planarity": 0.196, "simple_Shear": 0.204, "simple_Stretch": -0.147, "simple_Buckle": 1.465, "simple_Propeller": 13.370, "bp_simpleParams": [ 0.204, -0.147, 0.251, 1.465, 13.370, 2.366 ], "bp_params": [ 0.202, -0.151, 0.251, 1.676, 13.345, 2.382 ], "frame": { "rmsd": null, "origin": [ 84.035, 65.506, 78.347 ], "x_axis": [ 0.775, -0.223, 0.591 ], "y_axis": [ 0.629, 0.364, -0.687 ], "z_axis": [ -0.062, 0.904, 0.423 ], "quaternion": [ 0.800, -0.497, -0.204, -0.266 ] } }, { "index": 27, "nt1": "///C/50", "nt2": "///C/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.834, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.173, "chi2": -163.070, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.357, "C1C1_dist": 10.600, "N1N9_dist": 8.874, "C6C8_dist": 9.824, "CNNC_torsion": 3.554, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.84]", "interBase_angle": 5.218, "planarity": 0.093, "simple_Shear": 0.059, "simple_Stretch": -0.122, "simple_Buckle": -5.146, "simple_Propeller": -0.864, "bp_simpleParams": [ 0.059, -0.122, -0.503, -5.146, -0.864, 0.550 ], "bp_params": [ 0.057, -0.123, -0.503, -5.155, -0.805, 0.549 ], "frame": { "rmsd": null, "origin": [ 83.385, 67.440, 81.223 ], "x_axis": [ 0.984, -0.168, -0.060 ], "y_axis": [ 0.053, 0.598, -0.800 ], "z_axis": [ 0.171, 0.784, 0.597 ], "quaternion": [ 0.891, -0.444, 0.065, -0.062 ] } }, { "index": 28, "nt1": "///C/51", "nt2": "///C/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.087, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.162, "chi2": -164.956, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.696, "C1C1_dist": 10.737, "N1N9_dist": 8.935, "C6C8_dist": 9.827, "CNNC_torsion": 9.807, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 3.599, "planarity": 0.177, "simple_Shear": -0.139, "simple_Stretch": -0.232, "simple_Buckle": -0.947, "simple_Propeller": 3.472, "bp_simpleParams": [ -0.139, -0.232, -0.814, -0.947, 3.472, -1.621 ], "bp_params": [ -0.137, -0.233, -0.814, -0.979, 3.463, -1.621 ], "frame": { "rmsd": null, "origin": [ 84.163, 69.114, 84.473 ], "x_axis": [ 0.869, 0.136, -0.476 ], "y_axis": [ -0.448, 0.625, -0.639 ], "z_axis": [ 0.211, 0.768, 0.604 ], "quaternion": [ 0.880, -0.400, 0.195, 0.166 ] } }, { "index": 29, "nt1": "///C/52", "nt2": "///C/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.807, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.300, "chi2": -170.978, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.427, "C1C1_dist": 10.697, "N1N9_dist": 8.933, "C6C8_dist": 9.870, "CNNC_torsion": 2.887, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 3.370, "planarity": 0.060, "simple_Shear": -0.176, "simple_Stretch": -0.152, "simple_Buckle": 2.644, "simple_Propeller": 2.089, "bp_simpleParams": [ -0.176, -0.152, -0.131, 2.644, 2.089, 0.238 ], "bp_params": [ -0.174, -0.155, -0.131, 2.617, 2.123, 0.238 ], "frame": { "rmsd": null, "origin": [ 86.985, 70.849, 87.015 ], "x_axis": [ 0.546, 0.383, -0.745 ], "y_axis": [ -0.796, 0.514, -0.318 ], "z_axis": [ 0.261, 0.767, 0.586 ], "quaternion": [ 0.813, -0.334, 0.309, 0.363 ] } }, { "index": 30, "nt1": "///C/53", "nt2": "///C/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.414, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.588, "chi2": -177.876, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.887, "C1C1_dist": 10.624, "N1N9_dist": 8.919, "C6C8_dist": 9.895, "CNNC_torsion": 9.804, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 13.189, "planarity": 0.172, "simple_Shear": -0.177, "simple_Stretch": -0.129, "simple_Buckle": -0.423, "simple_Propeller": 13.182, "bp_simpleParams": [ -0.177, -0.129, 0.033, -0.423, 13.182, 2.230 ], "bp_params": [ -0.175, -0.131, 0.033, -0.600, 13.175, 2.245 ], "frame": { "rmsd": null, "origin": [ 90.037, 72.901, 88.543 ], "x_axis": [ -0.015, 0.495, -0.869 ], "y_axis": [ -0.957, 0.244, 0.156 ], "z_axis": [ 0.289, 0.834, 0.470 ], "quaternion": [ 0.652, -0.260, 0.444, 0.557 ] } }, { "index": 31, "nt1": "///C/54", "nt2": "///C/58", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -162.036, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.743, "chi2": -84.075, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 22.164, "C1C1_dist": 9.482, "N1N9_dist": 6.978, "C6C8_dist": 6.032, "CNNC_torsion": -178.783, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.96],N3(imino)-N7[2.79]", "interBase_angle": 11.434, "planarity": 0.211, "simple_Shear": 4.454, "simple_Stretch": 1.469, "simple_Buckle": -5.846, "simple_Propeller": 9.826, "bp_simpleParams": [ 4.454, 1.469, -0.327, -5.846, 9.826, -100.999 ], "bp_params": [ 4.160, -2.166, -0.327, 2.967, 11.042, -101.241 ], "frame": { "rmsd": null, "origin": [ 94.116, 75.023, 89.148 ], "x_axis": [ -0.931, 0.317, 0.182 ], "y_axis": [ 0.085, -0.296, 0.951 ], "z_axis": [ 0.355, 0.901, 0.249 ], "quaternion": [ 0.074, 0.171, 0.589, 0.787 ] } } ], "num_multiplets": 3, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAA", "nts_long": "///C/8,///C/14,///C/21", "planarity": 0.221 }, { "index": 2, "num_nts": 3, "nts_short": "GCG", "nts_long": "///C/10,///C/25,///C/45", "planarity": 0.513 }, { "index": 3, "num_nts": 3, "nts_short": "CGG", "nts_long": "///C/13,///C/22,///C/46", "planarity": 0.155 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCCCGGACAGGGUUC", "strand2": "CGGGCUUGUCCCAGG", "bp_type": "||||||||||||..|", "helix_form": "AAAAAAxAAAAxx.", "helical_rise": 2.955, "helical_rise_std": 0.902, "helical_radius": 8.931, "helical_radius_std": 2.004, "helical_axis": [ 0.131, 0.878, 0.460 ], "point1": [ 85.829, 47.901, 72.503 ], "point2": [ 91.246, 84.241, 91.562 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.299, -1.074, -5.935, 1.647, -0.839 ], "step_params": [ -0.098, -1.881, 3.450, -2.656, 1.903, 34.287 ], "heli_params": [ -3.485, -0.264, 3.342, 3.218, 4.493, 34.438 ], "bp2_params": [ 0.155, -0.260, -0.797, -4.879, 6.136, -1.151 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.450, "simple_Twist": 32.602, "simple_hRise": 3.335, "simple_hTwist": 32.761 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.260, -0.797, -4.879, 6.136, -1.151 ], "step_params": [ 0.213, -1.893, 3.265, -1.601, 4.094, 30.824 ], "heli_params": [ -4.279, -0.690, 2.980, 7.654, 2.993, 31.128 ], "bp2_params": [ 0.200, -0.144, -0.209, -3.340, 10.712, 0.691 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 30.611, "simple_hRise": 2.978, "simple_hTwist": 30.917 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, -0.144, -0.209, -3.340, 10.712, 0.691 ], "step_params": [ 0.133, -2.039, 3.105, -1.248, 6.196, 30.156 ], "heli_params": [ -4.913, -0.466, 2.636, 11.747, 2.366, 30.797 ], "bp2_params": [ 0.226, -0.145, 0.203, 0.989, 13.250, 2.853 ], "groove_widths": [ 17.741, null, 15.541, null ], "simple_Rise": 3.105, "simple_Twist": 29.985, "simple_hRise": 2.633, "simple_hTwist": 30.629 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.145, 0.203, 0.989, 13.250, 2.853 ], "step_params": [ 0.128, -1.601, 3.144, 7.287, 20.123, 34.310 ], "heli_params": [ -4.254, 0.513, 1.940, 30.696, -11.116, 40.267 ], "bp2_params": [ -0.197, -0.131, -0.416, -8.603, -7.132, 0.910 ], "groove_widths": [ 17.902, 15.865, 15.522, 12.427 ], "simple_Rise": 3.144, "simple_Twist": 36.565, "simple_hRise": 2.024, "simple_hTwist": 42.182 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.131, -0.416, -8.603, -7.132, 0.910 ], "step_params": [ -0.170, -2.082, 3.384, 2.548, 3.753, 26.699 ], "heli_params": [ -5.387, 1.001, 3.039, 8.054, -5.467, 27.075 ], "bp2_params": [ -0.772, -0.673, -0.702, -3.333, 2.009, -8.211 ], "groove_widths": [ 18.053, 15.710, 16.221, 13.654 ], "simple_Rise": 3.384, "simple_Twist": 29.876, "simple_hRise": 3.081, "simple_hTwist": 30.211 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.772, -0.673, -0.702, -3.333, 2.009, -8.211 ], "step_params": [ 0.230, -1.296, 3.342, -0.322, 2.361, 35.973 ], "heli_params": [ -2.432, -0.418, 3.251, 3.817, 0.520, 36.050 ], "bp2_params": [ 0.062, -0.123, -0.457, 2.259, 2.145, -0.484 ], "groove_widths": [ 18.068, 16.207, 16.857, 14.117 ], "simple_Rise": 3.342, "simple_Twist": 31.390, "simple_hRise": 3.236, "simple_hTwist": 31.478 }, { "index": 7, "nt1": "///C/7", "nt2": "///C/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.062, -0.123, -0.457, 2.259, 2.145, -0.484 ], "step_params": [ 0.534, -1.973, 3.391, -4.403, 9.155, 31.252 ], "heli_params": [ -4.975, -1.658, 2.627, 16.458, 7.915, 32.822 ], "bp2_params": [ 0.202, -0.151, 0.251, 1.676, 13.345, 2.382 ], "groove_widths": [ 17.945, 16.275, 15.978, 13.474 ], "simple_Rise": 3.391, "simple_Twist": 30.390, "simple_hRise": 2.602, "simple_hTwist": 32.005 }, { "index": 8, "nt1": "///C/49", "nt2": "///C/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.151, 0.251, 1.676, 13.345, 2.382 ], "step_params": [ -0.252, -1.658, 3.102, 6.650, 16.845, 36.642 ], "heli_params": [ -3.950, 0.981, 2.100, 25.006, -9.873, 40.735 ], "bp2_params": [ 0.057, -0.123, -0.503, -5.155, -0.805, 0.549 ], "groove_widths": [ 17.861, 16.044, 15.230, 13.170 ], "simple_Rise": 3.102, "simple_Twist": 37.539, "simple_hRise": 2.128, "simple_hTwist": 41.537 }, { "index": 9, "nt1": "///C/50", "nt2": "///C/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.057, -0.123, -0.503, -5.155, -0.805, 0.549 ], "step_params": [ -0.196, -1.539, 3.401, 1.333, 2.112, 30.543 ], "heli_params": [ -3.338, 0.639, 3.278, 4.000, -2.525, 30.643 ], "bp2_params": [ -0.137, -0.233, -0.814, -0.979, 3.463, -1.621 ], "groove_widths": [ 17.647, 15.742, 14.873, 11.756 ], "simple_Rise": 3.401, "simple_Twist": 31.772, "simple_hRise": 3.284, "simple_hTwist": 31.867 }, { "index": 10, "nt1": "///C/51", "nt2": "///C/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.137, -0.233, -0.814, -0.979, 3.463, -1.621 ], "step_params": [ 0.911, -2.066, 3.512, 1.378, 2.749, 28.108 ], "heli_params": [ -4.900, -1.529, 3.338, 5.639, -2.826, 28.272 ], "bp2_params": [ -0.174, -0.155, -0.131, 2.617, 2.123, 0.238 ], "groove_widths": [ 17.528, 15.537, 16.602, 13.678 ], "simple_Rise": 3.512, "simple_Twist": 28.353, "simple_hRise": 3.340, "simple_hTwist": 28.515 }, { "index": 11, "nt1": "///C/52", "nt2": "///C/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.174, -0.155, -0.131, 2.617, 2.123, 0.238 ], "step_params": [ 0.504, -2.176, 3.298, -0.616, 7.822, 33.132 ], "heli_params": [ -4.882, -0.952, 2.719, 13.483, 1.062, 34.023 ], "bp2_params": [ -0.175, -0.131, 0.033, -0.600, 13.175, 2.245 ], "groove_widths": [ 17.687, 15.562, 14.282, 8.627 ], "simple_Rise": 3.298, "simple_Twist": 33.354, "simple_hRise": 2.724, "simple_hTwist": 34.238 }, { "index": 12, "nt1": "///C/53", "nt2": "///C/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.175, -0.131, 0.033, -0.600, 13.175, 2.245 ], "step_params": [ -2.166, -2.297, 3.397, 12.475, 5.892, 89.773 ], "heli_params": [ -1.731, 1.769, 3.020, 4.154, -8.796, 90.603 ], "bp2_params": [ 4.160, -2.166, -0.327, 2.967, 11.042, -101.241 ], "groove_widths": [ 18.272, null, 24.652, null ], "simple_Rise": 3.397, "simple_Twist": 62.145, "simple_hRise": 2.756, "simple_hTwist": 63.508 }, { "index": 13, "nt1": "///C/54", "nt2": "///C/58", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.160, -2.166, -0.327, 2.967, 11.042, -101.241 ], "step_params": [ 0.978, -1.444, 3.394, 2.050, 3.752, 48.082 ], "heli_params": [ -2.067, -1.032, 3.315, 4.595, -2.510, 48.260 ], "bp2_params": [ -0.079, -6.124, 0.246, 18.586, 5.635, -109.697 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.394, "simple_Twist": -29.076, "simple_hRise": 3.473, "simple_hTwist": -29.382 }, { "index": 14, "nt1": "///C/55", "nt2": "///C/18", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "bp1_params": [ -0.079, -6.124, 0.246, 18.586, 5.635, -109.697 ], "step_params": [ -3.675, -0.398, 6.895, -3.994, -21.834, -101.974 ], "heli_params": [ 0.909, -2.457, 6.650, 13.937, -2.550, -103.700 ], "bp2_params": [ 0.159, -0.139, 0.023, 4.230, -3.432, 0.548 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 6.895, "simple_Twist": 2.640, "simple_hRise": 1.865, "simple_hTwist": 22.351 }, { "index": 15, "nt1": "///C/56", "nt2": "///C/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "UCUGAGGCUCAG", "strand2": "AGACUACGAGUC", "bp_type": "|||||.||||..", "helix_form": "AAAA.xAA.xx", "helical_rise": 2.817, "helical_rise_std": 0.860, "helical_radius": 9.137, "helical_radius_std": 2.351, "helical_axis": [ -0.114, -0.266, 0.957 ], "point1": [ 102.472, 81.152, 44.602 ], "point2": [ 98.949, 72.953, 74.082 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///C/39", "nt2": "///C/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.065, -0.203, -0.748, 0.237, 0.622, 2.320 ], "step_params": [ -0.416, -1.448, 3.730, 0.216, 0.538, 30.825 ], "heli_params": [ -2.844, 0.830, 3.702, 1.012, -0.407, 30.831 ], "bp2_params": [ 0.154, -0.259, -0.840, 1.433, 0.634, -0.457 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.730, "simple_Twist": 29.592, "simple_hRise": 3.701, "simple_hTwist": 29.598 }, { "index": 2, "nt1": "///C/40", "nt2": "///C/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.259, -0.840, 1.433, 0.634, -0.457 ], "step_params": [ -0.101, -1.543, 3.438, -1.439, 0.871, 29.418 ], "heli_params": [ -3.229, -0.123, 3.392, 1.714, 2.831, 29.465 ], "bp2_params": [ -0.294, -0.124, -0.271, 4.767, -2.455, -5.288 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 31.917, "simple_hRise": 3.397, "simple_hTwist": 31.960 }, { "index": 3, "nt1": "///C/41", "nt2": "///C/29", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.294, -0.124, -0.271, 4.767, -2.455, -5.288 ], "step_params": [ 0.136, -1.532, 3.122, -2.998, 13.511, 33.894 ], "heli_params": [ -4.065, -0.576, 2.343, 22.068, 4.896, 36.533 ], "bp2_params": [ -0.181, -0.147, -0.072, 1.424, 8.935, 0.097 ], "groove_widths": [ 17.580, null, 15.071, null ], "simple_Rise": 3.122, "simple_Twist": 33.350, "simple_hRise": 2.328, "simple_hTwist": 36.032 }, { "index": 4, "nt1": "///C/42", "nt2": "///C/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.181, -0.147, -0.072, 1.424, 8.935, 0.097 ], "step_params": [ 0.025, -1.623, 3.188, 3.008, 3.855, 33.117 ], "heli_params": [ -3.420, 0.427, 2.976, 6.718, -5.242, 33.466 ], "bp2_params": [ 0.046, -0.160, -0.584, 5.654, 3.611, -0.334 ], "groove_widths": [ 19.125, 15.555, 14.087, 8.927 ], "simple_Rise": 3.188, "simple_Twist": 31.756, "simple_hRise": 2.965, "simple_hTwist": 32.121 }, { "index": 5, "nt1": "///C/43", "nt2": "///C/27", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, -0.160, -0.584, 5.654, 3.611, -0.334 ], "step_params": [ -0.643, -1.993, 3.537, 3.364, 1.476, 28.766 ], "heli_params": [ -4.324, 2.068, 3.337, 2.956, -6.736, 28.995 ], "bp2_params": [ -1.389, 1.059, -0.721, 3.346, -0.726, -18.188 ], "groove_widths": [ 19.985, 14.682, 12.750, 8.898 ], "simple_Rise": 3.537, "simple_Twist": 35.496, "simple_hRise": 3.381, "simple_hTwist": 35.680 }, { "index": 6, "nt1": "///C/44", "nt2": "///C/26", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.389, 1.059, -0.721, 3.346, -0.726, -18.188 ], "step_params": [ -2.573, -3.483, 4.824, 29.631, 25.586, 67.663 ], "heli_params": [ -3.696, 3.107, 2.427, 21.283, -24.648, 76.989 ], "bp2_params": [ -0.140, -0.393, -1.251, -2.820, 0.435, -1.090 ], "groove_widths": [ 18.183, 14.435, 11.679, 10.021 ], "simple_Rise": 4.824, "simple_Twist": 61.941, "simple_hRise": 2.154, "simple_hTwist": 72.222 }, { "index": 7, "nt1": "///C/10", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.393, -1.251, -2.820, 0.435, -1.090 ], "step_params": [ 0.033, -1.642, 3.270, -0.691, 0.326, 34.111 ], "heli_params": [ -2.850, -0.166, 3.253, 0.555, 1.179, 34.119 ], "bp2_params": [ 0.152, -0.290, -0.924, 0.436, 0.509, -0.589 ], "groove_widths": [ 16.853, 14.346, 11.237, 11.000 ], "simple_Rise": 3.270, "simple_Twist": 32.553, "simple_hRise": 3.252, "simple_hTwist": 32.562 }, { "index": 8, "nt1": "///C/11", "nt2": "///C/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.290, -0.924, 0.436, 0.509, -0.589 ], "step_params": [ 0.427, -1.548, 3.389, 0.467, 4.236, 32.317 ], "heli_params": [ -3.501, -0.679, 3.171, 7.569, -0.835, 32.590 ], "bp2_params": [ -0.032, -0.124, -0.424, 1.065, 2.914, -0.238 ], "groove_widths": [ 17.422, 15.462, 15.259, 11.215 ], "simple_Rise": 3.389, "simple_Twist": 33.542, "simple_hRise": 3.181, "simple_hTwist": 33.804 }, { "index": 9, "nt1": "///C/12", "nt2": "///C/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.124, -0.424, 1.065, 2.914, -0.238 ], "step_params": [ 2.004, -2.029, 3.042, 13.174, 23.976, 32.566 ], "heli_params": [ -4.917, -1.621, 1.853, 35.897, -19.724, 42.292 ], "bp2_params": [ 0.192, -0.203, -0.654, -0.364, -1.889, 1.524 ], "groove_widths": [ 17.796, null, 7.118, null ], "simple_Rise": 3.042, "simple_Twist": 31.127, "simple_hRise": 1.793, "simple_hTwist": 41.216 }, { "index": 10, "nt1": "///C/13", "nt2": "///C/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.192, -0.203, -0.654, -0.364, -1.889, 1.524 ], "step_params": [ -1.122, -0.425, 3.553, -2.006, 0.585, 63.225 ], "heli_params": [ -0.434, 0.973, 3.580, 0.558, 1.913, 63.256 ], "bp2_params": [ -4.068, -1.708, -0.206, 1.674, 1.093, -97.938 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.553, "simple_Twist": 88.201, "simple_hRise": 3.570, "simple_hTwist": 88.220 }, { "index": 11, "nt1": "///C/14", "nt2": "///C/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.068, -1.708, -0.206, 1.674, 1.093, -97.938 ], "step_params": [ 1.825, -3.196, 2.982, -2.112, 1.744, -60.895 ], "heli_params": [ 3.073, 1.705, 3.120, -1.720, -2.082, -60.951 ], "bp2_params": [ 0.400, 5.073, 0.074, 2.854, 5.012, 163.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.982, "simple_Twist": 4.198, "simple_hRise": 0.618, "simple_hTwist": 5.012 }, { "index": 12, "nt1": "///C/15", "nt2": "///C/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCCCGGA", "strand2": "CGGGCUU", "bp_type": "|||||||", "helix_form": "AAAAAA", "helical_rise": 2.550, "helical_rise_std": 0.224, "helical_radius": 8.998, "helical_radius_std": 0.393, "helical_axis": [ 0.152, 0.898, 0.412 ], "point1": [ 84.941, 47.122, 73.397 ], "point2": [ 87.244, 60.712, 79.626 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///C/1", "nt2": "///C/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.299, -1.074, -5.935, 1.647, -0.839 ], "step_params": [ -0.098, -1.881, 3.450, -2.656, 1.903, 34.287 ], "heli_params": [ -3.485, -0.264, 3.342, 3.218, 4.493, 34.438 ], "bp2_params": [ 0.155, -0.260, -0.797, -4.879, 6.136, -1.151 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.450, "simple_Twist": 32.602, "simple_hRise": 3.335, "simple_hTwist": 32.761 }, { "index": 2, "nt1": "///C/2", "nt2": "///C/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.260, -0.797, -4.879, 6.136, -1.151 ], "step_params": [ 0.213, -1.893, 3.265, -1.601, 4.094, 30.824 ], "heli_params": [ -4.279, -0.690, 2.980, 7.654, 2.993, 31.128 ], "bp2_params": [ 0.200, -0.144, -0.209, -3.340, 10.712, 0.691 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 30.611, "simple_hRise": 2.978, "simple_hTwist": 30.917 }, { "index": 3, "nt1": "///C/3", "nt2": "///C/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, -0.144, -0.209, -3.340, 10.712, 0.691 ], "step_params": [ 0.133, -2.039, 3.105, -1.248, 6.196, 30.156 ], "heli_params": [ -4.913, -0.466, 2.636, 11.747, 2.366, 30.797 ], "bp2_params": [ 0.226, -0.145, 0.203, 0.989, 13.250, 2.853 ], "groove_widths": [ 17.741, null, 15.541, null ], "simple_Rise": 3.105, "simple_Twist": 29.985, "simple_hRise": 2.633, "simple_hTwist": 30.629 }, { "index": 4, "nt1": "///C/4", "nt2": "///C/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.145, 0.203, 0.989, 13.250, 2.853 ], "step_params": [ 0.128, -1.601, 3.144, 7.287, 20.123, 34.310 ], "heli_params": [ -4.254, 0.513, 1.940, 30.696, -11.116, 40.267 ], "bp2_params": [ -0.197, -0.131, -0.416, -8.603, -7.132, 0.910 ], "groove_widths": [ 17.902, null, 15.522, null ], "simple_Rise": 3.144, "simple_Twist": 36.565, "simple_hRise": 2.024, "simple_hTwist": 42.182 }, { "index": 5, "nt1": "///C/5", "nt2": "///C/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.131, -0.416, -8.603, -7.132, 0.910 ], "step_params": [ -0.170, -2.082, 3.384, 2.548, 3.753, 26.699 ], "heli_params": [ -5.387, 1.001, 3.039, 8.054, -5.467, 27.075 ], "bp2_params": [ -0.772, -0.673, -0.702, -3.333, 2.009, -8.211 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 29.876, "simple_hRise": 3.081, "simple_hTwist": 30.211 }, { "index": 6, "nt1": "///C/6", "nt2": "///C/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.772, -0.673, -0.702, -3.333, 2.009, -8.211 ], "step_params": [ 0.230, -1.296, 3.342, -0.322, 2.361, 35.973 ], "heli_params": [ -2.432, -0.418, 3.251, 3.817, 0.520, 36.050 ], "bp2_params": [ 0.062, -0.123, -0.457, 2.259, 2.145, -0.484 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.342, "simple_Twist": 31.390, "simple_hRise": 3.236, "simple_hTwist": 31.478 }, { "index": 7, "nt1": "///C/7", "nt2": "///C/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GCUC", "strand2": "CGAG", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.036, "helical_rise_std": 0.429, "helical_radius": 8.356, "helical_radius_std": 1.143, "helical_axis": [ -0.235, -0.644, 0.728 ], "point1": [ 97.640, 76.507, 61.097 ], "point2": [ 96.246, 72.693, 65.413 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/10", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.393, -1.251, -2.820, 0.435, -1.090 ], "step_params": [ 0.033, -1.642, 3.270, -0.691, 0.326, 34.111 ], "heli_params": [ -2.850, -0.166, 3.253, 0.555, 1.179, 34.119 ], "bp2_params": [ 0.152, -0.290, -0.924, 0.436, 0.509, -0.589 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.270, "simple_Twist": 32.553, "simple_hRise": 3.252, "simple_hTwist": 32.562 }, { "index": 2, "nt1": "///C/11", "nt2": "///C/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.290, -0.924, 0.436, 0.509, -0.589 ], "step_params": [ 0.427, -1.548, 3.389, 0.467, 4.236, 32.317 ], "heli_params": [ -3.501, -0.679, 3.171, 7.569, -0.835, 32.590 ], "bp2_params": [ -0.032, -0.124, -0.424, 1.065, 2.914, -0.238 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.389, "simple_Twist": 33.542, "simple_hRise": 3.181, "simple_hTwist": 33.804 }, { "index": 3, "nt1": "///C/12", "nt2": "///C/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.124, -0.424, 1.065, 2.914, -0.238 ], "step_params": [ 2.004, -2.029, 3.042, 13.174, 23.976, 32.566 ], "heli_params": [ -4.917, -1.621, 1.853, 35.897, -19.724, 42.292 ], "bp2_params": [ 0.192, -0.203, -0.654, -0.364, -1.889, 1.524 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.042, "simple_Twist": 31.127, "simple_hRise": 1.793, "simple_hTwist": 41.216 }, { "index": 4, "nt1": "///C/13", "nt2": "///C/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "UCAGA", "strand2": "AGUCU", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 3.113, "helical_rise_std": 0.100, "helical_radius": 8.870, "helical_radius_std": 0.424, "helical_axis": [ 0.371, 0.214, -0.904 ], "point1": [ 101.474, 81.107, 55.443 ], "point2": [ 106.090, 83.774, 44.187 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///C/27", "nt2": "///C/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, -0.160, -0.584, -5.654, 3.611, -0.334 ], "step_params": [ -0.025, -1.623, 3.188, -3.008, 3.855, 33.117 ], "heli_params": [ -3.420, -0.427, 2.976, 6.718, 5.242, 33.466 ], "bp2_params": [ 0.181, -0.147, -0.072, -1.424, 8.935, 0.097 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 31.756, "simple_hRise": 2.965, "simple_hTwist": 32.121 }, { "index": 2, "nt1": "///C/28", "nt2": "///C/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.147, -0.072, -1.424, 8.935, 0.097 ], "step_params": [ -0.136, -1.532, 3.122, 2.998, 13.511, 33.894 ], "heli_params": [ -4.065, 0.576, 2.343, 22.068, -4.896, 36.533 ], "bp2_params": [ 0.294, -0.124, -0.271, -4.767, -2.455, -5.288 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.122, "simple_Twist": 33.350, "simple_hRise": 2.328, "simple_hTwist": 36.032 }, { "index": 3, "nt1": "///C/29", "nt2": "///C/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.294, -0.124, -0.271, -4.767, -2.455, -5.288 ], "step_params": [ 0.101, -1.543, 3.438, 1.439, 0.871, 29.418 ], "heli_params": [ -3.229, 0.123, 3.392, 1.714, -2.831, 29.465 ], "bp2_params": [ -0.154, -0.259, -0.840, -1.433, 0.634, -0.457 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 31.917, "simple_hRise": 3.397, "simple_hTwist": 31.960 }, { "index": 4, "nt1": "///C/30", "nt2": "///C/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.259, -0.840, -1.433, 0.634, -0.457 ], "step_params": [ 0.416, -1.448, 3.730, -0.216, 0.538, 30.825 ], "heli_params": [ -2.844, -0.830, 3.702, 1.012, 0.407, 30.831 ], "bp2_params": [ 0.065, -0.203, -0.748, -0.237, 0.622, 2.320 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.730, "simple_Twist": 29.592, "simple_hRise": 3.701, "simple_hTwist": 29.598 }, { "index": 5, "nt1": "///C/31", "nt2": "///C/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "CAGGG", "strand2": "GUCCC", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.779, "helical_rise_std": 0.170, "helical_radius": 9.056, "helical_radius_std": 0.523, "helical_axis": [ 0.123, 0.923, 0.364 ], "point1": [ 87.499, 64.189, 79.995 ], "point2": [ 88.862, 74.420, 84.035 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///C/49", "nt2": "///C/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.151, 0.251, 1.676, 13.345, 2.382 ], "step_params": [ -0.252, -1.658, 3.102, 6.650, 16.845, 36.642 ], "heli_params": [ -3.950, 0.981, 2.100, 25.006, -9.873, 40.735 ], "bp2_params": [ 0.057, -0.123, -0.503, -5.155, -0.805, 0.549 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.102, "simple_Twist": 37.539, "simple_hRise": 2.128, "simple_hTwist": 41.537 }, { "index": 2, "nt1": "///C/50", "nt2": "///C/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.057, -0.123, -0.503, -5.155, -0.805, 0.549 ], "step_params": [ -0.196, -1.539, 3.401, 1.333, 2.112, 30.543 ], "heli_params": [ -3.338, 0.639, 3.278, 4.000, -2.525, 30.643 ], "bp2_params": [ -0.137, -0.233, -0.814, -0.979, 3.463, -1.621 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.401, "simple_Twist": 31.772, "simple_hRise": 3.284, "simple_hTwist": 31.867 }, { "index": 3, "nt1": "///C/51", "nt2": "///C/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.137, -0.233, -0.814, -0.979, 3.463, -1.621 ], "step_params": [ 0.911, -2.066, 3.512, 1.378, 2.749, 28.108 ], "heli_params": [ -4.900, -1.529, 3.338, 5.639, -2.826, 28.272 ], "bp2_params": [ -0.174, -0.155, -0.131, 2.617, 2.123, 0.238 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.512, "simple_Twist": 28.353, "simple_hRise": 3.340, "simple_hTwist": 28.515 }, { "index": 4, "nt1": "///C/52", "nt2": "///C/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.174, -0.155, -0.131, 2.617, 2.123, 0.238 ], "step_params": [ 0.504, -2.176, 3.298, -0.616, 7.822, 33.132 ], "heli_params": [ -4.882, -0.952, 2.719, 13.483, 1.062, 34.023 ], "bp2_params": [ -0.175, -0.131, 0.033, -0.600, 13.175, 2.245 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.298, "simple_Twist": 33.354, "simple_hRise": 2.724, "simple_hTwist": 34.238 }, { "index": 5, "nt1": "///C/53", "nt2": "///C/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///C/19", "nt2": "///C/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 4 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 2 ] } ], "num_stacks": 9, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///C/7,///C/49" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///C/8,///C/13" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/43,///C/44" }, { "index": 4, "num_nts": 2, "nts_short": "GU", "nts_long": "///C/65,///C/66" }, { "index": 5, "num_nts": 3, "nts_short": "GAU", "nts_long": "///C/10,///C/26,///C/27" }, { "index": 6, "num_nts": 3, "nts_short": "GUU", "nts_long": "///C/53,///C/54,///C/55" }, { "index": 7, "num_nts": 5, "nts_short": "GAGAC", "nts_long": "///C/19,///C/57,///C/18,///C/58,///C/61" }, { "index": 8, "num_nts": 5, "nts_short": "GAGGU", "nts_long": "///C/22,///C/14,///C/15,///C/59,///C/60" }, { "index": 9, "num_nts": 5, "nts_short": "GAGAC", "nts_long": "///C/45,///C/9,///C/46,///C/21,///C/48" } ], "nonStack": { "num_nts": 6, "nts_short": "UCUCUC", "nts_long": "///C/16,///C/17,///C/20,///C/28,///C/47,///C/56" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///C/50/OP1", "nt": "///C/47", "vert_dist": 3.486 }, { "index": 2, "type": "phosphate", "atom": "///C/57/OP2", "nt": "///C/55", "vert_dist": 3.023 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 8 ], "stem_indices": [ 2 ], "summary": "[1] 8 [C.13 C.22] 4", "num_nts": 10, "nts_short": "CAGUCGGUAG", "nts_long": "///C/13,///C/14,///C/15,///C/16,///C/17,///C/18,///C/19,///C/20,///C/21,///C/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 8, "nts_short": "AGUCGGUA", "nts_long": "///C/14,///C/15,///C/16,///C/17,///C/18,///C/19,///C/20,///C/21" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [C.53 C.61] 5", "num_nts": 9, "nts_short": "GUUCAAGUC", "nts_long": "///C/53,///C/54,///C/55,///C/56,///C/57,///C/58,///C/59,///C/60,///C/61", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAAGU", "nts_long": "///C/54,///C/55,///C/56,///C/57,///C/58,///C/59,///C/60" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "4-way junction", "bridging_nts": [ 2, 1, 5, 0 ], "stem_indices": [ 1, 2, 3, 4 ], "summary": "[4] 2 1 5 0 [C.7 C.66 C.10 C.25 C.27 C.43 C.49 C.65] 7 4 5 5", "num_nts": 16, "nts_short": "AUAGCAUAGGGUCCGU", "nts_long": "///C/7,///C/8,///C/9,///C/10,///C/25,///C/26,///C/27,///C/43,///C/44,///C/45,///C/46,///C/47,///C/48,///C/49,///C/65,///C/66", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///C/8,///C/9" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///C/26" }, { "index": 3, "num_nts": 5, "nts_short": "GGGUC", "nts_long": "///C/44,///C/45,///C/46,///C/47,///C/48" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_kissingLoops": 1, "kissingLoops": [ { "index": 1, "stem_index": -1, "is_isoCanonPair": true, "hairpin_indices": [ 1, 2 ] } ], "num_splayUnits": 7, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///C/7,///C/8" }, { "index": 2, "num_nts": 2, "nts_short": "GU", "nts_long": "///C/15,///C/16" }, { "index": 3, "num_nts": 2, "nts_short": "CG", "nts_long": "///C/17,///C/18" }, { "index": 4, "num_nts": 3, "nts_short": "GUA", "nts_long": "///C/19,///C/20,///C/21" }, { "index": 5, "num_nts": 4, "nts_short": "GUCC", "nts_long": "///C/46,///C/47,///C/48,///C/49" }, { "index": 6, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/58,///C/59" }, { "index": 7, "num_nts": 2, "nts_short": "UC", "nts_long": "///C/60,///C/61" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 2, "nts_short": "GC", "nts_long": "///C/19,///C/56" } ], "dbn": { "all_chains": { "num_nts": 65, "num_chars": 66, "bseq": "GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGA&UCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGC", "sstr": "(((((((..((((.....[..)))).(((((&))))).....(((((..]....))))))))))))", "form": "AAAA.A...AA...........AA.AAAAA-&AAAAA.....AA.AA..A....AAAAAAAAAAA-" }, "chain_C": { "num_nts": 65, "num_chars": 66, "bseq": "GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGA&UCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGC", "sstr": "(((((((..((((.....[..)))).(((((&))))).....(((((..]....))))))))))))", "form": "AAAA.A...AA...........AA.AAAAA-&AAAAA.....AA.AA..A....AAAAAAAAAAA-" } }, "chains": { "chain_C": { "num_nts": 65, "bseq": "GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGA&UCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGC", "sstr": "(((((((..((((.....[..)))).(((((&))))).....(((((..]....))))))))))))", "form": "AAAA.A...AA...........AA.AAAAA-&AAAAA.....AA.AA..A....AAAAAAAAAAA-", "helical_rise": 0.115, "helical_rise_std": 3.398, "helical_axis": [ 0.540, -0.841, 0.023 ], "point1": [ 103.586, 60.594, 74.791 ], "point2": [ 107.967, 53.766, 74.977 ], "num_chars": 193, "suite": "G1aC1aC1aC1aG1cG1bA2aU1bA2gG1aC1aU1cC1cA1aG9aU1gC!!G!!G!!U!!A!!G1aA1aG1aC1aA1aU1aC1aA1aG1aA..U1aC1aU1aG1aA1aG1aG1tG2hU!!C6dC1aA1aG1cG1aG1aU1aU1gC1aA1[A4dG1bU2aC1aC1aC1aU1aG1aU1aU1aC1aG1aG1aG1aC" } }, "num_nts": 65, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 166.225, "gamma": 54.247, "delta": 81.455, "epsilon": -148.414, "zeta": -74.328, "epsilon_zeta": -74.086, "bb_type": "BI", "chi": -173.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.400, 8.556, 1.329 ], "P_xyz": [ 1.183, 8.803, 1.707 ], "form": "A", "ssZp": 4.641, "Dp": 4.654, "splay_angle": 26.101, "splay_distance": 4.058, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": null, "theta": -144.588, "eta_prime": null, "theta_prime": -143.820, "eta_base": null, "theta_base": -120.040, "v0": 3.486, "v1": -25.246, "v2": 36.193, "v3": -35.172, "v4": 19.992, "amplitude": 37.198, "phase_angle": 13.349, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 84.859, 44.393, 77.764 ], "x_axis": [ -0.085, 0.259, -0.962 ], "y_axis": [ -0.915, 0.362, 0.178 ], "z_axis": [ 0.395, 0.896, 0.206 ], "quaternion": [ 0.609, -0.294, 0.557, 0.482 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.132, "beta": 176.809, "gamma": 52.701, "delta": 80.598, "epsilon": -148.982, "zeta": -73.626, "epsilon_zeta": -75.357, "bb_type": "BI", "chi": -168.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.296, 8.663, 1.036 ], "P_xyz": [ 1.255, 8.979, 1.550 ], "form": "A", "ssZp": 4.599, "Dp": 4.650, "splay_angle": 25.378, "splay_distance": 3.994, "splay_ratio": 0.222, "d22": 4.408, "d64": 4.664, "eta": 171.610, "theta": -146.699, "eta_prime": -176.430, "theta_prime": -144.755, "eta_base": -137.772, "theta_base": -120.888, "v0": 2.962, "v1": -25.113, "v2": 36.506, "v3": -35.797, "v4": 20.685, "amplitude": 37.655, "phase_angle": 14.189, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.985, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 87.898, 47.072, 77.541 ], "x_axis": [ -0.605, 0.365, -0.708 ], "y_axis": [ -0.725, 0.115, 0.679 ], "z_axis": [ 0.330, 0.924, 0.195 ], "quaternion": [ 0.420, -0.146, 0.618, 0.649 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.155, "beta": 173.737, "gamma": 54.794, "delta": 79.690, "epsilon": -151.773, "zeta": -72.508, "epsilon_zeta": -79.264, "bb_type": "BI", "chi": -168.979, "glyco_bond": "anti", "C5prime_xyz": [ -1.389, 8.692, 1.043 ], "P_xyz": [ 1.170, 9.105, 1.436 ], "form": "A", "ssZp": 4.599, "Dp": 4.633, "splay_angle": 24.324, "splay_distance": 3.856, "splay_ratio": 0.214, "d22": 4.429, "d64": 4.637, "eta": 169.489, "theta": -148.455, "eta_prime": -177.560, "theta_prime": -147.429, "eta_base": -139.284, "theta_base": -125.323, "v0": 2.081, "v1": -24.766, "v2": 36.794, "v3": -36.588, "v4": 21.752, "amplitude": 38.191, "phase_angle": 15.542, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.988, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 89.906, 50.388, 76.582 ], "x_axis": [ -0.924, 0.275, -0.264 ], "y_axis": [ -0.306, -0.120, 0.945 ], "z_axis": [ 0.228, 0.954, 0.195 ], "quaternion": [ 0.194, -0.012, 0.634, 0.748 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.707, "beta": 177.268, "gamma": 54.367, "delta": 79.951, "epsilon": -152.160, "zeta": -72.613, "epsilon_zeta": -79.547, "bb_type": "BI", "chi": -167.810, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.720, 0.974 ], "P_xyz": [ 1.127, 9.173, 1.463 ], "form": "A", "ssZp": 4.565, "Dp": 4.615, "splay_angle": 20.494, "splay_distance": 3.240, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 169.594, "theta": -149.109, "eta_prime": -178.957, "theta_prime": -148.169, "eta_base": -143.266, "theta_base": -122.502, "v0": 1.520, "v1": -24.051, "v2": 36.171, "v3": -36.309, "v4": 21.931, "amplitude": 37.696, "phase_angle": 16.355, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.980, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 90.747, 53.928, 75.305 ], "x_axis": [ -0.971, 0.048, 0.234 ], "y_axis": [ 0.216, -0.247, 0.945 ], "z_axis": [ 0.104, 0.968, 0.230 ], "quaternion": [ -0.054, 0.108, 0.611, 0.782 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.202, "beta": 176.689, "gamma": 51.698, "delta": 80.917, "epsilon": -161.144, "zeta": -76.901, "epsilon_zeta": -84.243, "bb_type": "BI", "chi": -165.160, "glyco_bond": "anti", "C5prime_xyz": [ -1.310, 8.707, 0.825 ], "P_xyz": [ 1.251, 9.081, 1.257 ], "form": ".", "ssZp": 4.504, "Dp": 4.563, "splay_angle": 22.974, "splay_distance": 4.080, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 163.549, "theta": -130.866, "eta_prime": 176.296, "theta_prime": -139.199, "eta_base": -142.876, "theta_base": -130.767, "v0": 3.055, "v1": -24.979, "v2": 36.197, "v3": -35.416, "v4": 20.406, "amplitude": 37.306, "phase_angle": 14.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.975, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 90.139, 57.037, 74.623 ], "x_axis": [ -0.694, -0.236, 0.680 ], "y_axis": [ 0.718, -0.156, 0.679 ], "z_axis": [ -0.054, 0.959, 0.278 ], "quaternion": [ -0.327, 0.215, 0.561, 0.729 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 167.293, "beta": -163.981, "gamma": 168.788, "delta": 82.181, "epsilon": -146.824, "zeta": -80.792, "epsilon_zeta": -66.032, "bb_type": "BI", "chi": -175.234, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.583, 1.412 ], "P_xyz": [ 0.175, 10.260, 0.348 ], "form": "A", "ssZp": 4.557, "Dp": 4.588, "splay_angle": 24.568, "splay_distance": 3.732, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 165.863, "theta": -170.661, "eta_prime": -179.858, "theta_prime": -159.752, "eta_base": -153.410, "theta_base": -120.597, "v0": 1.225, "v1": -22.731, "v2": 34.357, "v3": -34.616, "v4": 21.080, "amplitude": 35.871, "phase_angle": 16.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.694, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 87.669, 60.206, 73.918 ], "x_axis": [ -0.356, -0.373, 0.857 ], "y_axis": [ 0.913, 0.056, 0.404 ], "z_axis": [ -0.199, 0.926, 0.321 ], "quaternion": [ 0.505, -0.258, -0.522, -0.636 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -49.215, "beta": 162.829, "gamma": 69.521, "delta": 146.706, "epsilon": -94.847, "zeta": -28.872, "epsilon_zeta": -65.974, "bb_type": "--", "chi": -142.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.679, 0.061 ], "P_xyz": [ 0.931, 8.733, 0.778 ], "form": ".", "ssZp": 0.937, "Dp": 0.948, "splay_angle": 121.591, "splay_distance": 17.147, "splay_ratio": 0.873, "d22": null, "d64": null, "eta": -151.700, "theta": -10.772, "eta_prime": -122.581, "theta_prime": -31.167, "eta_base": -86.805, "theta_base": -4.687, "v0": -18.891, "v1": 33.339, "v2": -34.296, "v3": 24.259, "v4": -3.562, "amplitude": 35.201, "phase_angle": 166.979, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.678, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 85.804, 62.938, 75.644 ], "x_axis": [ 0.318, -0.276, 0.907 ], "y_axis": [ 0.920, 0.319, -0.226 ], "z_axis": [ -0.227, 0.907, 0.356 ], "quaternion": [ 0.706, -0.401, -0.402, -0.424 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart", "alpha": -83.704, "beta": -152.363, "gamma": 59.151, "delta": 79.978, "epsilon": -143.900, "zeta": -123.036, "epsilon_zeta": -20.864, "bb_type": "--", "chi": -152.709, "glyco_bond": "anti", "C5prime_xyz": [ -1.508, 8.796, 0.069 ], "P_xyz": [ 0.977, 9.407, 0.654 ], "form": ".", "ssZp": 4.172, "Dp": 4.642, "splay_angle": 63.080, "splay_distance": 9.810, "splay_ratio": 0.523, "d22": null, "d64": null, "eta": 158.955, "theta": 158.910, "eta_prime": -160.944, "theta_prime": -174.644, "eta_base": -148.106, "theta_base": 173.310, "v0": 0.734, "v1": -23.307, "v2": 35.765, "v3": -36.344, "v4": 22.454, "amplitude": 37.505, "phase_angle": 17.524, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.106, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 100.052, 71.020, 70.575 ], "x_axis": [ 0.250, -0.948, -0.197 ], "y_axis": [ -0.967, -0.233, -0.107 ], "z_axis": [ 0.055, 0.218, -0.975 ], "quaternion": [ -0.103, 0.784, -0.611, -0.045 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,junction-loop", "alpha": -56.137, "beta": -159.374, "gamma": 48.740, "delta": 144.998, "epsilon": -110.437, "zeta": -30.869, "epsilon_zeta": -79.568, "bb_type": "--", "chi": -84.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.795, 7.518, -2.652 ], "P_xyz": [ -0.691, 9.005, -3.139 ], "form": ".", "ssZp": 0.848, "Dp": 1.213, "splay_angle": 63.100, "splay_distance": 9.875, "splay_ratio": 0.531, "d22": null, "d64": null, "eta": -140.478, "theta": -14.794, "eta_prime": -154.068, "theta_prime": -83.160, "eta_base": 170.332, "theta_base": -96.711, "v0": -22.720, "v1": 36.071, "v2": -34.906, "v3": 22.701, "v4": -0.201, "amplitude": 36.802, "phase_angle": 161.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.001, "origin": [ 98.694, 79.398, 65.656 ], "x_axis": [ 0.772, -0.621, 0.136 ], "y_axis": [ -0.576, -0.773, -0.265 ], "z_axis": [ 0.270, 0.127, -0.955 ], "quaternion": [ -0.105, 0.935, -0.320, 0.108 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate", "alpha": 175.355, "beta": 133.997, "gamma": 54.407, "delta": 83.753, "epsilon": -146.829, "zeta": -75.059, "epsilon_zeta": -71.770, "bb_type": "BI", "chi": -171.102, "glyco_bond": "anti", "C5prime_xyz": [ -1.101, 8.506, 1.213 ], "P_xyz": [ 1.467, 8.162, 0.794 ], "form": "A", "ssZp": 4.635, "Dp": 4.674, "splay_angle": 24.644, "splay_distance": 3.798, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 5.911, "theta": -134.213, "eta_prime": 77.432, "theta_prime": -139.882, "eta_base": 111.880, "theta_base": -121.291, "v0": 6.122, "v1": -26.547, "v2": 35.767, "v3": -33.232, "v4": 17.136, "amplitude": 36.227, "phase_angle": 9.134, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2g", "suiteness": 0.073, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 96.499, 74.404, 57.425 ], "x_axis": [ 0.328, 0.806, 0.493 ], "y_axis": [ -0.917, 0.145, 0.372 ], "z_axis": [ 0.229, -0.574, 0.786 ], "quaternion": [ 0.751, 0.315, -0.088, 0.573 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.421, "beta": 170.909, "gamma": 53.995, "delta": 82.021, "epsilon": -143.559, "zeta": -77.911, "epsilon_zeta": -65.648, "bb_type": "BI", "chi": -165.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.188, 8.672, 0.854 ], "P_xyz": [ 1.416, 8.871, 1.112 ], "form": "A", "ssZp": 4.542, "Dp": 4.674, "splay_angle": 25.120, "splay_distance": 3.932, "splay_ratio": 0.218, "d22": 4.423, "d64": 4.440, "eta": 172.509, "theta": -143.837, "eta_prime": -173.366, "theta_prime": -142.033, "eta_base": -133.040, "theta_base": -117.702, "v0": 3.680, "v1": -25.149, "v2": 35.885, "v3": -34.751, "v4": 19.604, "amplitude": 36.831, "phase_angle": 13.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.956, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 98.896, 72.819, 59.907 ], "x_axis": [ -0.246, 0.745, 0.620 ], "y_axis": [ -0.939, -0.343, 0.039 ], "z_axis": [ 0.241, -0.572, 0.784 ], "quaternion": [ 0.547, 0.279, -0.173, 0.770 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.152, "beta": 169.120, "gamma": 53.247, "delta": 80.550, "epsilon": -142.934, "zeta": -58.253, "epsilon_zeta": -84.680, "bb_type": "BI", "chi": -162.243, "glyco_bond": "anti", "C5prime_xyz": [ -1.338, 8.686, 0.658 ], "P_xyz": [ 1.258, 9.044, 0.750 ], "form": ".", "ssZp": 4.491, "Dp": 4.690, "splay_angle": 22.020, "splay_distance": 4.061, "splay_ratio": 0.209, "d22": 4.118, "d64": 4.532, "eta": 170.074, "theta": -103.641, "eta_prime": -176.703, "theta_prime": -117.471, "eta_base": -138.410, "theta_base": -91.715, "v0": 3.230, "v1": -25.362, "v2": 36.647, "v3": -35.785, "v4": 20.514, "amplitude": 37.736, "phase_angle": 13.802, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.938, "filter_rmsd": 0.103, "frame": { "rmsd": 0.002, "origin": [ 100.723, 71.831, 63.246 ], "x_axis": [ -0.732, 0.495, 0.468 ], "y_axis": [ -0.653, -0.706, -0.274 ], "z_axis": [ 0.195, -0.506, 0.840 ], "quaternion": [ 0.317, 0.183, -0.216, 0.905 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": 165.841, "beta": 176.269, "gamma": 167.343, "delta": 80.967, "epsilon": -171.893, "zeta": -81.739, "epsilon_zeta": -90.153, "bb_type": "BI", "chi": -159.609, "glyco_bond": "anti", "C5prime_xyz": [ -1.356, 8.781, 0.491 ], "P_xyz": [ -0.222, 10.481, -1.157 ], "form": ".", "ssZp": 4.365, "Dp": 4.448, "splay_angle": 29.317, "splay_distance": 4.987, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": 151.696, "theta": -173.672, "eta_prime": 175.313, "theta_prime": -176.233, "eta_base": -134.419, "theta_base": -169.571, "v0": 1.884, "v1": -23.943, "v2": 35.634, "v3": -35.549, "v4": 21.237, "amplitude": 37.027, "phase_angle": 15.764, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.513, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 99.863, 73.211, 66.968 ], "x_axis": [ -0.991, 0.132, -0.037 ], "y_axis": [ -0.122, -0.973, -0.193 ], "z_axis": [ -0.061, -0.187, 0.980 ], "quaternion": [ 0.064, -0.025, -0.096, 0.993 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 168.076, "beta": -160.881, "gamma": 171.874, "delta": 81.706, "epsilon": -124.757, "zeta": -61.119, "epsilon_zeta": -63.638, "bb_type": "--", "chi": 179.584, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.394, 1.687 ], "P_xyz": [ 0.160, 10.153, 0.772 ], "form": ".", "ssZp": 4.690, "Dp": 4.714, "splay_angle": 37.020, "splay_distance": 5.595, "splay_ratio": 0.318, "d22": null, "d64": null, "eta": 175.467, "theta": -138.211, "eta_prime": -177.960, "theta_prime": -131.401, "eta_base": -162.789, "theta_base": -69.061, "v0": 2.478, "v1": -24.104, "v2": 35.349, "v3": -34.896, "v4": 20.449, "amplitude": 36.564, "phase_angle": 14.809, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.692, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 100.957, 75.268, 71.377 ], "x_axis": [ -0.989, -0.093, -0.112 ], "y_axis": [ 0.114, -0.972, -0.206 ], "z_axis": [ -0.090, -0.216, 0.972 ], "quaternion": [ -0.052, -0.051, -0.106, 0.992 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,splayed-apart", "alpha": -61.364, "beta": 160.554, "gamma": 52.448, "delta": 81.901, "epsilon": -126.996, "zeta": 133.609, "epsilon_zeta": 99.395, "bb_type": "--", "chi": -171.018, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.576, 1.182 ], "P_xyz": [ 1.331, 8.700, 1.362 ], "form": ".", "ssZp": 4.647, "Dp": 4.758, "splay_angle": 120.682, "splay_distance": 15.334, "splay_ratio": 0.869, "d22": null, "d64": null, "eta": 157.513, "theta": 82.418, "eta_prime": -172.412, "theta_prime": 91.074, "eta_base": -86.744, "theta_base": 126.051, "v0": 4.377, "v1": -25.847, "v2": 36.329, "v3": -34.806, "v4": 19.215, "amplitude": 37.142, "phase_angle": 12.015, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.637, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 96.840, 72.119, 73.484 ], "x_axis": [ -0.233, -0.938, -0.257 ], "y_axis": [ 0.964, -0.257, 0.063 ], "z_axis": [ -0.125, -0.233, 0.964 ], "quaternion": [ 0.607, 0.122, 0.054, -0.783 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -63.551, "beta": 140.792, "gamma": 52.483, "delta": 82.449, "epsilon": -109.949, "zeta": -62.108, "epsilon_zeta": -47.841, "bb_type": "--", "chi": -157.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.379, 8.725, 0.403 ], "P_xyz": [ 1.202, 8.706, -0.070 ], "form": ".", "ssZp": 4.088, "Dp": 4.721, "splay_angle": 36.568, "splay_distance": 5.915, "splay_ratio": 0.314, "d22": 6.178, "d64": 7.505, "eta": -160.210, "theta": -70.315, "eta_prime": -154.003, "theta_prime": -113.160, "eta_base": 177.885, "theta_base": 178.404, "v0": 2.357, "v1": -23.852, "v2": 35.033, "v3": -34.656, "v4": 20.389, "amplitude": 36.264, "phase_angle": 14.973, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "9a", "suiteness": 0.601, "filter_rmsd": 0.105, "frame": { "rmsd": 0.001, "origin": [ 107.843, 79.285, 81.404 ], "x_axis": [ -0.936, 0.328, 0.130 ], "y_axis": [ -0.351, -0.896, -0.271 ], "z_axis": [ 0.028, -0.299, 0.954 ], "quaternion": [ 0.174, 0.040, -0.147, 0.973 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": 179.140, "beta": -177.222, "gamma": 50.309, "delta": 80.512, "epsilon": -141.426, "zeta": 179.858, "epsilon_zeta": 38.715, "bb_type": "--", "chi": -159.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.774, 0.510 ], "P_xyz": [ 1.231, 9.254, 0.958 ], "form": ".", "ssZp": 4.406, "Dp": 4.678, "splay_angle": 113.854, "splay_distance": 17.050, "splay_ratio": 0.840, "d22": null, "d64": null, "eta": 33.413, "theta": 153.533, "eta_prime": 69.230, "theta_prime": 157.025, "eta_base": 43.370, "theta_base": 141.520, "v0": 2.289, "v1": -24.526, "v2": 36.221, "v3": -35.913, "v4": 21.186, "amplitude": 37.534, "phase_angle": 15.199, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.368, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 112.071, 77.674, 85.213 ], "x_axis": [ 0.574, -0.262, -0.776 ], "y_axis": [ -0.519, -0.849, -0.097 ], "z_axis": [ -0.633, 0.458, -0.624 ], "quaternion": [ -0.159, 0.873, -0.224, -0.404 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,splayed-apart", "alpha": 49.290, "beta": 108.565, "gamma": -87.321, "delta": 146.242, "epsilon": -120.829, "zeta": -130.754, "epsilon_zeta": 9.925, "bb_type": "--", "chi": -105.724, "glyco_bond": "anti", "C5prime_xyz": [ -2.202, 8.248, -1.889 ], "P_xyz": [ -2.665, 10.826, -1.676 ], "form": ".", "ssZp": 1.265, "Dp": 1.396, "splay_angle": 42.825, "splay_distance": 7.060, "splay_ratio": 0.371, "d22": null, "d64": null, "eta": 131.428, "theta": -175.232, "eta_prime": 108.787, "theta_prime": -152.091, "eta_base": 74.601, "theta_base": -132.187, "v0": -21.530, "v1": 35.564, "v2": -35.233, "v3": 23.746, "v4": -1.596, "amplitude": 36.712, "phase_angle": 163.679, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 96.020, 77.534, 90.963 ], "x_axis": [ 0.261, -0.432, 0.864 ], "y_axis": [ 0.863, -0.296, -0.409 ], "z_axis": [ 0.432, 0.852, 0.295 ], "quaternion": [ 0.561, -0.562, -0.192, -0.577 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,splayed-apart", "alpha": -89.828, "beta": -176.596, "gamma": 56.335, "delta": 146.993, "epsilon": -101.227, "zeta": 111.588, "epsilon_zeta": 147.186, "bb_type": "--", "chi": -78.718, "glyco_bond": "anti", "C5prime_xyz": [ -2.710, 7.276, -2.853 ], "P_xyz": [ -0.337, 8.079, -3.641 ], "form": ".", "ssZp": 0.285, "Dp": 0.968, "splay_angle": 156.568, "splay_distance": 18.525, "splay_ratio": 0.979, "d22": null, "d64": null, "eta": -167.755, "theta": 104.225, "eta_prime": -155.069, "theta_prime": 142.393, "eta_base": -141.203, "theta_base": -83.203, "v0": -19.417, "v1": 33.971, "v2": -34.826, "v3": 24.524, "v4": -3.408, "amplitude": 35.795, "phase_angle": 166.640, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 100.083, 83.261, 90.222 ], "x_axis": [ 0.519, -0.608, 0.601 ], "y_axis": [ 0.579, -0.267, -0.771 ], "z_axis": [ 0.629, 0.748, 0.213 ], "quaternion": [ 0.605, -0.627, 0.012, -0.490 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -140.327, "beta": -94.123, "gamma": 160.460, "delta": 82.005, "epsilon": -104.525, "zeta": -41.163, "epsilon_zeta": -63.363, "bb_type": "--", "chi": -159.407, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.708, 0.501 ], "P_xyz": [ 0.144, 8.420, -1.631 ], "form": ".", "ssZp": 4.095, "Dp": 4.729, "splay_angle": 120.662, "splay_distance": 16.509, "splay_ratio": 0.869, "d22": null, "d64": null, "eta": -39.014, "theta": -74.820, "eta_prime": -87.338, "theta_prime": -103.002, "eta_base": 161.416, "theta_base": -140.559, "v0": 3.040, "v1": -24.495, "v2": 35.448, "v3": -34.683, "v4": 19.963, "amplitude": 36.526, "phase_angle": 13.955, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 107.387, 85.561, 73.354 ], "x_axis": [ 0.552, -0.771, 0.318 ], "y_axis": [ -0.697, -0.217, 0.683 ], "z_axis": [ -0.458, -0.599, -0.657 ], "quaternion": [ 0.411, 0.779, -0.471, -0.045 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": -86.237, "beta": -136.794, "gamma": 166.692, "delta": 81.899, "epsilon": -110.566, "zeta": -170.232, "epsilon_zeta": 59.666, "bb_type": "BII", "chi": -160.344, "glyco_bond": "anti", "C5prime_xyz": [ -1.310, 8.682, 0.542 ], "P_xyz": [ 0.327, 9.428, -1.368 ], "form": ".", "ssZp": 4.204, "Dp": 4.754, "splay_angle": 47.047, "splay_distance": 7.531, "splay_ratio": 0.399, "d22": null, "d64": null, "eta": -80.248, "theta": 163.342, "eta_prime": -45.632, "theta_prime": 155.029, "eta_base": -19.564, "theta_base": 141.087, "v0": 3.347, "v1": -24.948, "v2": 35.834, "v3": -34.914, "v4": 19.924, "amplitude": 36.857, "phase_angle": 13.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 94.023, 76.227, 70.743 ], "x_axis": [ -0.805, 0.592, -0.048 ], "y_axis": [ 0.536, 0.759, 0.370 ], "z_axis": [ 0.255, 0.272, -0.928 ], "quaternion": [ 0.081, 0.302, 0.934, 0.172 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": 92.587, "beta": -111.799, "gamma": 178.911, "delta": 82.035, "epsilon": -145.550, "zeta": -85.997, "epsilon_zeta": -59.553, "bb_type": "BI", "chi": -173.989, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.568, 1.348 ], "P_xyz": [ 0.055, 9.517, -0.546 ], "form": ".", "ssZp": 4.614, "Dp": 4.635, "splay_angle": 28.235, "splay_distance": 4.281, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": 155.752, "theta": -167.954, "eta_prime": 159.118, "theta_prime": -173.201, "eta_base": 150.205, "theta_base": -158.327, "v0": 2.569, "v1": -24.088, "v2": 35.225, "v3": -34.739, "v4": 20.301, "amplitude": 36.412, "phase_angle": 14.671, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 99.974, 72.866, 67.580 ], "x_axis": [ -0.984, 0.164, -0.064 ], "y_axis": [ 0.149, 0.971, 0.188 ], "z_axis": [ 0.093, 0.176, -0.980 ], "quaternion": [ 0.040, 0.079, 0.992, 0.092 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.086, "beta": -169.448, "gamma": 48.247, "delta": 83.365, "epsilon": -142.314, "zeta": -83.482, "epsilon_zeta": -58.832, "bb_type": "BI", "chi": -175.732, "glyco_bond": "anti", "C5prime_xyz": [ -1.206, 8.393, 1.472 ], "P_xyz": [ 1.155, 8.402, 2.617 ], "form": "A", "ssZp": 4.666, "Dp": 4.684, "splay_angle": 23.606, "splay_distance": 3.579, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 167.172, "theta": -149.715, "eta_prime": 168.377, "theta_prime": -144.826, "eta_base": -169.109, "theta_base": -120.141, "v0": 5.390, "v1": -25.948, "v2": 35.529, "v3": -33.433, "v4": 17.715, "amplitude": 36.108, "phase_angle": 10.269, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.697, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 100.707, 71.537, 63.577 ], "x_axis": [ -0.724, 0.465, 0.509 ], "y_axis": [ 0.653, 0.699, 0.292 ], "z_axis": [ -0.220, 0.544, -0.810 ], "quaternion": [ -0.203, 0.311, 0.899, 0.232 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.188, "beta": 167.088, "gamma": 53.059, "delta": 82.570, "epsilon": -146.635, "zeta": -75.709, "epsilon_zeta": -70.927, "bb_type": "BI", "chi": -171.712, "glyco_bond": "anti", "C5prime_xyz": [ -1.222, 8.528, 1.233 ], "P_xyz": [ 1.379, 8.622, 1.564 ], "form": "A", "ssZp": 4.643, "Dp": 4.678, "splay_angle": 22.865, "splay_distance": 3.539, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 167.452, "theta": -143.149, "eta_prime": 179.361, "theta_prime": -142.875, "eta_base": -144.068, "theta_base": -118.128, "v0": 5.424, "v1": -26.492, "v2": 36.369, "v3": -34.256, "v4": 18.198, "amplitude": 36.976, "phase_angle": 10.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.864, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 98.883, 72.074, 60.544 ], "x_axis": [ -0.254, 0.736, 0.627 ], "y_axis": [ 0.938, 0.346, -0.026 ], "z_axis": [ -0.236, 0.581, -0.779 ], "quaternion": [ -0.280, 0.543, 0.771, 0.180 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -61.677, "beta": 168.662, "gamma": 55.406, "delta": 80.717, "epsilon": -139.017, "zeta": -55.830, "epsilon_zeta": -83.187, "bb_type": "BI", "chi": -167.981, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.651, 1.010 ], "P_xyz": [ 1.341, 8.908, 1.211 ], "form": ".", "ssZp": 4.611, "Dp": 4.714, "splay_angle": 40.856, "splay_distance": 6.185, "splay_ratio": 0.349, "d22": null, "d64": null, "eta": 170.143, "theta": -120.755, "eta_prime": -176.695, "theta_prime": -119.061, "eta_base": -135.467, "theta_base": -80.646, "v0": 3.700, "v1": -25.868, "v2": 36.993, "v3": -35.843, "v4": 20.264, "amplitude": 37.985, "phase_angle": 13.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.968, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 96.497, 73.840, 58.617 ], "x_axis": [ 0.312, 0.804, 0.506 ], "y_axis": [ 0.910, -0.101, -0.401 ], "z_axis": [ -0.271, 0.586, -0.764 ], "quaternion": [ -0.335, 0.738, 0.581, 0.080 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -72.210, "beta": -169.401, "gamma": 47.518, "delta": 80.895, "epsilon": -138.518, "zeta": -73.545, "epsilon_zeta": -64.973, "bb_type": "BI", "chi": 172.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.586, 8.197, 2.056 ], "P_xyz": [ 0.580, 8.197, 3.538 ], "form": "A", "ssZp": 4.660, "Dp": 4.699, "splay_angle": 27.830, "splay_distance": 4.339, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 164.330, "theta": -140.805, "eta_prime": -175.929, "theta_prime": -134.124, "eta_base": -115.463, "theta_base": -105.635, "v0": 3.284, "v1": -25.157, "v2": 36.289, "v3": -35.368, "v4": 20.223, "amplitude": 37.346, "phase_angle": 13.663, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.714, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 97.340, 79.631, 56.616 ], "x_axis": [ 0.901, -0.009, 0.433 ], "y_axis": [ 0.170, -0.912, -0.373 ], "z_axis": [ 0.398, 0.409, -0.821 ], "quaternion": [ -0.205, 0.953, 0.042, 0.218 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -63.405, "beta": -174.123, "gamma": 47.805, "delta": 81.329, "epsilon": -152.154, "zeta": -74.490, "epsilon_zeta": -77.664, "bb_type": "BI", "chi": -166.859, "glyco_bond": "anti", "C5prime_xyz": [ -1.371, 8.644, 0.938 ], "P_xyz": [ 1.074, 9.056, 1.792 ], "form": "A", "ssZp": 4.536, "Dp": 4.607, "splay_angle": 24.385, "splay_distance": 3.803, "splay_ratio": 0.213, "d22": 4.415, "d64": 4.479, "eta": 170.255, "theta": -150.712, "eta_prime": -177.471, "theta_prime": -147.247, "eta_base": -138.744, "theta_base": -119.779, "v0": 2.690, "v1": -24.510, "v2": 35.789, "v3": -35.237, "v4": 20.527, "amplitude": 36.973, "phase_angle": 14.537, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.869, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 99.148, 83.179, 54.892 ], "x_axis": [ 0.791, -0.588, 0.167 ], "y_axis": [ -0.446, -0.742, -0.500 ], "z_axis": [ 0.418, 0.321, -0.850 ], "quaternion": [ -0.223, 0.920, -0.281, 0.159 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack", "alpha": -61.710, "beta": 174.294, "gamma": 51.719, "delta": 80.970, "epsilon": -148.133, "zeta": -75.930, "epsilon_zeta": -72.203, "bb_type": "BI", "chi": -167.055, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.681, 0.956 ], "P_xyz": [ 1.320, 8.956, 1.428 ], "form": "A", "ssZp": 4.564, "Dp": 4.644, "splay_angle": 21.278, "splay_distance": 3.326, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 170.242, "theta": -147.358, "eta_prime": -178.232, "theta_prime": -146.478, "eta_base": -139.455, "theta_base": -122.115, "v0": 2.950, "v1": -24.909, "v2": 36.193, "v3": -35.467, "v4": 20.505, "amplitude": 37.328, "phase_angle": 14.165, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.975, "filter_rmsd": 0.066, "frame": { "rmsd": 0.004, "origin": [ 101.709, 85.110, 52.849 ], "x_axis": [ 0.371, -0.927, -0.046 ], "y_axis": [ -0.816, -0.302, -0.493 ], "z_axis": [ 0.443, 0.220, -0.869 ], "quaternion": [ -0.224, 0.797, -0.547, 0.124 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///C/29", "linked_nts": [ "///C/28", "///C/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.143, "beta": 168.359, "gamma": 52.033, "delta": 80.497, "epsilon": -149.383, "zeta": -77.820, "epsilon_zeta": -71.564, "bb_type": "BI", "chi": -169.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.597, 1.062 ], "P_xyz": [ 1.164, 8.952, 1.396 ], "form": "A", "ssZp": 4.609, "Dp": 4.656, "splay_angle": 22.657, "splay_distance": 3.526, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 164.876, "theta": -149.627, "eta_prime": 178.036, "theta_prime": -148.704, "eta_base": -141.715, "theta_base": -124.985, "v0": 3.103, "v1": -25.288, "v2": 36.635, "v3": -35.866, "v4": 20.670, "amplitude": 37.760, "phase_angle": 14.016, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.969, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 104.358, 85.739, 50.940 ], "x_axis": [ -0.162, -0.968, -0.191 ], "y_axis": [ -0.873, 0.231, -0.431 ], "z_axis": [ 0.461, 0.097, -0.882 ], "quaternion": [ 0.216, -0.610, 0.754, -0.110 ] } }, { "index": 30, "index_chain": 30, "chain_name": "C", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///C/30", "linked_nts": [ "///C/29", "///C/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.494, "beta": 168.632, "gamma": 54.802, "delta": 80.915, "epsilon": -144.326, "zeta": -80.328, "epsilon_zeta": -63.998, "bb_type": "BI", "chi": -165.860, "glyco_bond": "anti", "C5prime_xyz": [ -1.309, 8.681, 0.868 ], "P_xyz": [ 1.289, 8.995, 1.014 ], "form": "A", "ssZp": 4.568, "Dp": 4.689, "splay_angle": 26.356, "splay_distance": 4.081, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 170.654, "theta": -147.058, "eta_prime": -177.626, "theta_prime": -144.925, "eta_base": -140.116, "theta_base": -119.477, "v0": 3.521, "v1": -25.501, "v2": 36.588, "v3": -35.566, "v4": 20.204, "amplitude": 37.606, "phase_angle": 13.362, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 107.157, 85.152, 48.877 ], "x_axis": [ -0.604, -0.701, -0.379 ], "y_axis": [ -0.626, 0.711, -0.319 ], "z_axis": [ 0.494, 0.044, -0.869 ], "quaternion": [ 0.245, -0.372, 0.892, -0.077 ] } }, { "index": 31, "index_chain": 31, "chain_name": "C", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///C/31", "linked_nts": [ "///C/30", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -56.913, "beta": 162.121, "gamma": 59.660, "delta": 81.181, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -166.146, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.631, 0.882 ], "P_xyz": [ 1.201, 8.961, 0.764 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.197, "v1": -25.177, "v2": 36.364, "v3": -35.534, "v4": 20.393, "amplitude": 37.450, "phase_angle": 13.830, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.833, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 109.239, 83.764, 45.653 ], "x_axis": [ -0.847, -0.214, -0.487 ], "y_axis": [ -0.205, 0.976, -0.072 ], "z_axis": [ 0.491, 0.039, -0.870 ], "quaternion": [ 0.255, -0.109, 0.961, -0.009 ] } }, { "index": 32, "index_chain": 32, "chain_name": "C", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///C/39", "linked_nts": [ null, "///C/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 153.940, "gamma": 55.411, "delta": 82.074, "epsilon": -152.608, "zeta": -80.733, "epsilon_zeta": -71.875, "bb_type": "BI", "chi": -162.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.682, 0.696 ], "P_xyz": [ 1.242, 8.876, 0.502 ], "form": "A", "ssZp": 4.472, "Dp": 4.601, "splay_angle": 25.564, "splay_distance": 3.971, "splay_ratio": 0.222, "d22": 4.745, "d64": 4.828, "eta": null, "theta": -150.183, "eta_prime": null, "theta_prime": -152.269, "eta_base": null, "theta_base": -133.376, "v0": 2.788, "v1": -24.320, "v2": 35.411, "v3": -34.789, "v4": 20.184, "amplitude": 36.550, "phase_angle": 14.342, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 109.620, 84.005, 45.019 ], "x_axis": [ -0.832, -0.253, -0.493 ], "y_axis": [ 0.237, -0.967, 0.096 ], "z_axis": [ -0.501, -0.037, 0.865 ], "quaternion": [ -0.128, -0.260, 0.015, 0.957 ] } }, { "index": 33, "index_chain": 33, "chain_name": "C", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///C/40", "linked_nts": [ "///C/39", "///C/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.053, "beta": 168.072, "gamma": 56.557, "delta": 82.076, "epsilon": -151.183, "zeta": -79.722, "epsilon_zeta": -71.462, "bb_type": "BI", "chi": -161.766, "glyco_bond": "anti", "C5prime_xyz": [ -1.204, 8.719, 0.643 ], "P_xyz": [ 1.411, 8.938, 0.675 ], "form": "A", "ssZp": 4.464, "Dp": 4.620, "splay_angle": 25.804, "splay_distance": 4.027, "splay_ratio": 0.224, "d22": 4.633, "d64": 4.800, "eta": 173.420, "theta": -150.319, "eta_prime": -175.161, "theta_prime": -150.147, "eta_base": -142.035, "theta_base": -131.745, "v0": 3.336, "v1": -24.778, "v2": 35.597, "v3": -34.638, "v4": 19.762, "amplitude": 36.607, "phase_angle": 13.492, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 107.329, 85.263, 48.008 ], "x_axis": [ -0.603, -0.695, -0.391 ], "y_axis": [ 0.609, -0.718, 0.338 ], "z_axis": [ -0.516, -0.034, 0.856 ], "quaternion": [ -0.366, -0.254, 0.085, 0.891 ] } }, { "index": 34, "index_chain": 34, "chain_name": "C", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///C/41", "linked_nts": [ "///C/40", "///C/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.192, "beta": 165.794, "gamma": 57.768, "delta": 81.429, "epsilon": -145.129, "zeta": -75.235, "epsilon_zeta": -69.894, "bb_type": "BI", "chi": -162.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.350, 8.681, 0.687 ], "P_xyz": [ 1.253, 9.000, 0.632 ], "form": "A", "ssZp": 4.488, "Dp": 4.663, "splay_angle": 23.127, "splay_distance": 3.636, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 174.107, "theta": -143.058, "eta_prime": -173.698, "theta_prime": -144.126, "eta_base": -142.187, "theta_base": -117.348, "v0": 3.125, "v1": -24.961, "v2": 36.098, "v3": -35.276, "v4": 20.286, "amplitude": 37.185, "phase_angle": 13.891, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.891, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 104.449, 86.073, 50.704 ], "x_axis": [ -0.260, -0.945, -0.196 ], "y_axis": [ 0.812, -0.325, 0.485 ], "z_axis": [ -0.522, -0.033, 0.852 ], "quaternion": [ 0.563, 0.230, -0.145, -0.781 ] } }, { "index": 35, "index_chain": 35, "chain_name": "C", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///C/42", "linked_nts": [ "///C/41", "///C/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.937, "beta": 174.251, "gamma": 49.914, "delta": 81.357, "epsilon": -150.815, "zeta": -75.459, "epsilon_zeta": -75.357, "bb_type": "BI", "chi": -169.453, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.643, 1.081 ], "P_xyz": [ 1.162, 8.973, 1.659 ], "form": "A", "ssZp": 4.585, "Dp": 4.627, "splay_angle": 21.580, "splay_distance": 3.363, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 162.184, "theta": -148.561, "eta_prime": 174.622, "theta_prime": -146.885, "eta_base": -141.804, "theta_base": -121.130, "v0": 2.914, "v1": -24.671, "v2": 35.830, "v3": -35.149, "v4": 20.338, "amplitude": 36.959, "phase_angle": 14.199, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.966, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 101.547, 85.251, 52.734 ], "x_axis": [ 0.438, -0.881, -0.179 ], "y_axis": [ 0.805, 0.296, 0.514 ], "z_axis": [ -0.400, -0.369, 0.839 ], "quaternion": [ 0.802, 0.275, -0.069, -0.525 ] } }, { "index": 36, "index_chain": 36, "chain_name": "C", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///C/43", "linked_nts": [ "///C/42", "///C/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -60.215, "beta": 171.185, "gamma": 51.844, "delta": 81.468, "epsilon": -147.593, "zeta": -94.132, "epsilon_zeta": -53.462, "bb_type": "BI", "chi": -164.113, "glyco_bond": "anti", "C5prime_xyz": [ -1.290, 8.660, 0.777 ], "P_xyz": [ 1.296, 8.970, 1.080 ], "form": "A", "ssZp": 4.511, "Dp": 4.646, "splay_angle": 26.362, "splay_distance": 4.085, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 169.949, "theta": -161.342, "eta_prime": -177.744, "theta_prime": -159.397, "eta_base": -138.523, "theta_base": -147.819, "v0": 2.970, "v1": -24.662, "v2": 35.771, "v3": -35.069, "v4": 20.263, "amplitude": 36.886, "phase_angle": 14.123, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.965, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 99.359, 83.256, 54.328 ], "x_axis": [ 0.815, -0.569, 0.111 ], "y_axis": [ 0.410, 0.702, 0.583 ], "z_axis": [ -0.409, -0.429, 0.805 ], "quaternion": [ 0.911, 0.278, -0.143, -0.268 ] } }, { "index": 37, "index_chain": 37, "chain_name": "C", "nt_resnum": 44, "nt_name": "G", "nt_code": "G", "nt_id": "///C/44", "linked_nts": [ "///C/43", "///C/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -50.605, "beta": 156.224, "gamma": 55.298, "delta": 81.967, "epsilon": -125.603, "zeta": -74.659, "epsilon_zeta": -50.944, "bb_type": "--", "chi": -164.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.716, 0.792 ], "P_xyz": [ 1.244, 8.938, 0.700 ], "form": ".", "ssZp": 4.447, "Dp": 4.719, "splay_angle": 40.459, "splay_distance": 6.279, "splay_ratio": 0.346, "d22": null, "d64": null, "eta": 179.374, "theta": -122.634, "eta_prime": -174.616, "theta_prime": -117.325, "eta_base": -157.532, "theta_base": -79.241, "v0": 2.408, "v1": -24.076, "v2": 35.372, "v3": -34.965, "v4": 20.564, "amplitude": 36.609, "phase_angle": 14.939, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.525, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 96.321, 81.100, 56.003 ], "x_axis": [ 0.908, -0.295, 0.298 ], "y_axis": [ 0.096, 0.838, 0.537 ], "z_axis": [ -0.408, -0.459, 0.789 ], "quaternion": [ 0.940, 0.265, -0.188, -0.104 ] } }, { "index": 38, "index_chain": 38, "chain_name": "C", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///C/45", "linked_nts": [ "///C/44", "///C/46" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -48.376, "beta": 160.182, "gamma": 58.966, "delta": 81.635, "epsilon": -110.244, "zeta": -85.510, "epsilon_zeta": -24.734, "bb_type": "--", "chi": -153.995, "glyco_bond": "anti", "C5prime_xyz": [ -1.224, 8.751, 0.168 ], "P_xyz": [ 1.349, 8.900, -0.317 ], "form": ".", "ssZp": 3.921, "Dp": 4.764, "splay_angle": 39.921, "splay_distance": 6.762, "splay_ratio": 0.343, "d22": null, "d64": null, "eta": -177.016, "theta": -104.679, "eta_prime": -154.672, "theta_prime": -110.426, "eta_base": -101.681, "theta_base": -114.346, "v0": 3.756, "v1": -25.338, "v2": 36.145, "v3": -34.988, "v4": 19.704, "amplitude": 37.089, "phase_angle": 12.959, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.559, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 98.315, 79.180, 61.639 ], "x_axis": [ 0.566, 0.551, 0.614 ], "y_axis": [ -0.728, 0.684, 0.057 ], "z_axis": [ -0.388, -0.479, 0.787 ], "quaternion": [ 0.871, 0.154, -0.287, 0.367 ] } }, { "index": 39, "index_chain": 39, "chain_name": "C", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///C/46", "linked_nts": [ "///C/45", "///C/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -174.586, "beta": 164.623, "gamma": -174.109, "delta": 146.476, "epsilon": -114.278, "zeta": -47.792, "epsilon_zeta": -66.486, "bb_type": "--", "chi": -105.226, "glyco_bond": "anti", "C5prime_xyz": [ -2.316, 8.242, -1.892 ], "P_xyz": [ -1.725, 9.104, -4.297 ], "form": ".", "ssZp": 1.195, "Dp": 1.268, "splay_angle": 150.354, "splay_distance": 18.963, "splay_ratio": 0.967, "d22": null, "d64": null, "eta": -147.365, "theta": -98.627, "eta_prime": -141.703, "theta_prime": -106.305, "eta_base": -145.899, "theta_base": -152.732, "v0": -22.470, "v1": 36.349, "v2": -35.604, "v3": 23.537, "v4": -0.864, "amplitude": 37.319, "phase_angle": 162.562, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.029, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 97.725, 77.516, 68.166 ], "x_axis": [ 0.560, 0.811, 0.170 ], "y_axis": [ -0.826, 0.563, 0.036 ], "z_axis": [ -0.067, -0.161, 0.985 ], "quaternion": [ 0.881, 0.056, -0.067, 0.464 ] } }, { "index": 40, "index_chain": 40, "chain_name": "C", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///C/47", "linked_nts": [ "///C/46", "///C/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,junction-loop,cap-acceptor,splayed-apart", "alpha": -74.802, "beta": -156.370, "gamma": 143.745, "delta": 82.488, "epsilon": -131.399, "zeta": 85.179, "epsilon_zeta": 143.421, "bb_type": "--", "chi": -161.519, "glyco_bond": "anti", "C5prime_xyz": [ -1.281, 8.662, 0.634 ], "P_xyz": [ 0.785, 9.382, -0.807 ], "form": ".", "ssZp": 4.411, "Dp": 4.717, "splay_angle": 167.122, "splay_distance": 18.170, "splay_ratio": 0.994, "d22": 9.926, "d64": 13.231, "eta": -104.849, "theta": 2.358, "eta_prime": -54.982, "theta_prime": -5.915, "eta_base": 13.561, "theta_base": -29.640, "v0": 3.665, "v1": -24.838, "v2": 35.400, "v3": -34.286, "v4": 19.329, "amplitude": 36.329, "phase_angle": 12.980, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 79.614, 75.737, 73.496 ], "x_axis": [ -0.101, -0.802, -0.589 ], "y_axis": [ 0.894, 0.186, -0.407 ], "z_axis": [ 0.436, -0.568, 0.698 ], "quaternion": [ 0.668, 0.060, 0.384, -0.635 ] } }, { "index": 41, "index_chain": 41, "chain_name": "C", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///C/48", "linked_nts": [ "///C/47", "///C/49" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart", "alpha": -92.823, "beta": -134.056, "gamma": 69.106, "delta": 147.368, "epsilon": -148.419, "zeta": 74.170, "epsilon_zeta": 137.411, "bb_type": "--", "chi": -127.208, "glyco_bond": "anti", "C5prime_xyz": [ -1.666, 8.653, -0.825 ], "P_xyz": [ 0.390, 9.163, 0.730 ], "form": ".", "ssZp": 1.856, "Dp": 1.859, "splay_angle": 151.519, "splay_distance": 18.153, "splay_ratio": 0.969, "d22": 11.594, "d64": 14.104, "eta": -143.425, "theta": 88.869, "eta_prime": -94.619, "theta_prime": 45.465, "eta_base": -61.895, "theta_base": -83.076, "v0": -19.955, "v1": 34.432, "v2": -35.001, "v3": 24.375, "v4": -2.979, "amplitude": 36.086, "phase_angle": 165.912, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 97.696, 76.961, 74.799 ], "x_axis": [ -0.056, 0.956, 0.287 ], "y_axis": [ -0.997, -0.042, -0.057 ], "z_axis": [ -0.043, -0.290, 0.956 ], "quaternion": [ 0.682, 0.085, -0.121, 0.717 ] } }, { "index": 42, "index_chain": 42, "chain_name": "C", "nt_resnum": 49, "nt_name": "C", "nt_code": "C", "nt_id": "///C/49", "linked_nts": [ "///C/48", "///C/50" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": 48.500, "beta": 170.438, "gamma": 42.522, "delta": 81.950, "epsilon": -143.404, "zeta": -76.182, "epsilon_zeta": -67.222, "bb_type": "BI", "chi": -177.347, "glyco_bond": "anti", "C5prime_xyz": [ -1.268, 8.476, 1.556 ], "P_xyz": [ 1.176, 8.519, 2.516 ], "form": "A", "ssZp": 4.653, "Dp": 4.663, "splay_angle": 20.446, "splay_distance": 3.154, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": -60.686, "theta": -144.024, "eta_prime": -39.448, "theta_prime": -141.261, "eta_base": 97.815, "theta_base": -116.841, "v0": 3.588, "v1": -24.971, "v2": 35.661, "v3": -34.599, "v4": 19.548, "amplitude": 36.618, "phase_angle": 13.123, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.408, "filter_rmsd": 0.067, "frame": { "rmsd": 0.005, "origin": [ 84.058, 65.570, 78.511 ], "x_axis": [ 0.790, -0.319, 0.523 ], "y_axis": [ 0.612, 0.384, -0.691 ], "z_axis": [ 0.020, 0.867, 0.498 ], "quaternion": [ 0.817, -0.477, -0.154, -0.285 ] } }, { "index": 43, "index_chain": 43, "chain_name": "C", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///C/50", "linked_nts": [ "///C/49", "///C/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate", "alpha": -72.059, "beta": 179.107, "gamma": 51.044, "delta": 82.585, "epsilon": -151.219, "zeta": -75.558, "epsilon_zeta": -75.660, "bb_type": "BI", "chi": -166.834, "glyco_bond": "anti", "C5prime_xyz": [ -1.199, 8.574, 0.945 ], "P_xyz": [ 1.357, 8.789, 1.499 ], "form": "A", "ssZp": 4.559, "Dp": 4.636, "splay_angle": 23.053, "splay_distance": 3.623, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 161.992, "theta": -148.292, "eta_prime": 173.701, "theta_prime": -146.354, "eta_base": -148.007, "theta_base": -126.429, "v0": 4.615, "v1": -25.720, "v2": 35.914, "v3": -34.241, "v4": 18.712, "amplitude": 36.658, "phase_angle": 11.564, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 83.367, 67.202, 81.121 ], "x_axis": [ 0.985, -0.160, -0.060 ], "y_axis": [ 0.041, 0.563, -0.826 ], "z_axis": [ 0.166, 0.811, 0.561 ], "quaternion": [ 0.882, -0.464, 0.064, -0.057 ] } }, { "index": 44, "index_chain": 44, "chain_name": "C", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///C/51", "linked_nts": [ "///C/50", "///C/52" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.815, "beta": 173.045, "gamma": 52.149, "delta": 81.436, "epsilon": -158.306, "zeta": -80.865, "epsilon_zeta": -77.442, "bb_type": "BI", "chi": -161.087, "glyco_bond": "anti", "C5prime_xyz": [ -1.285, 8.756, 0.601 ], "P_xyz": [ 1.300, 9.106, 0.874 ], "form": ".", "ssZp": 4.427, "Dp": 4.559, "splay_angle": 26.668, "splay_distance": 4.468, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 170.432, "theta": -127.968, "eta_prime": -176.606, "theta_prime": -135.165, "eta_base": -143.357, "theta_base": -116.079, "v0": 2.458, "v1": -24.153, "v2": 35.490, "v3": -35.065, "v4": 20.577, "amplitude": 36.722, "phase_angle": 14.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.962, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 84.070, 68.719, 84.335 ], "x_axis": [ 0.868, 0.104, -0.485 ], "y_axis": [ -0.438, 0.620, -0.651 ], "z_axis": [ 0.233, 0.778, 0.584 ], "quaternion": [ 0.876, -0.407, 0.205, 0.154 ] } }, { "index": 45, "index_chain": 45, "chain_name": "C", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///C/52", "linked_nts": [ "///C/51", "///C/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 164.284, "beta": -156.339, "gamma": 167.134, "delta": 81.013, "epsilon": -132.712, "zeta": -79.502, "epsilon_zeta": -53.210, "bb_type": "BI", "chi": -174.807, "glyco_bond": "anti", "C5prime_xyz": [ -1.285, 8.479, 1.389 ], "P_xyz": [ 0.461, 9.944, 0.097 ], "form": "A", "ssZp": 4.736, "Dp": 4.770, "splay_angle": 25.685, "splay_distance": 4.087, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 163.100, "theta": -158.122, "eta_prime": -179.905, "theta_prime": -156.735, "eta_base": -140.797, "theta_base": -131.053, "v0": 5.500, "v1": -27.250, "v2": 37.488, "v3": -35.355, "v4": 18.841, "amplitude": 38.130, "phase_angle": 10.530, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.650, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 86.982, 70.726, 87.066 ], "x_axis": [ 0.539, 0.370, -0.757 ], "y_axis": [ -0.791, 0.531, -0.304 ], "z_axis": [ 0.290, 0.762, 0.579 ], "quaternion": [ 0.814, -0.327, 0.321, 0.357 ] } }, { "index": 46, "index_chain": 46, "chain_name": "C", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///C/53", "linked_nts": [ "///C/52", "///C/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -60.797, "beta": 170.536, "gamma": 52.768, "delta": 79.528, "epsilon": -144.136, "zeta": -78.007, "epsilon_zeta": -66.129, "bb_type": "BI", "chi": -170.414, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.685, 1.109 ], "P_xyz": [ 0.846, 9.257, 1.572 ], "form": "A", "ssZp": 4.608, "Dp": 4.653, "splay_angle": 22.907, "splay_distance": 3.566, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.806, "theta": -147.566, "eta_prime": -179.838, "theta_prime": -144.773, "eta_base": -141.074, "theta_base": -111.343, "v0": 0.785, "v1": -23.580, "v2": 36.109, "v3": -36.684, "v4": 22.632, "amplitude": 37.853, "phase_angle": 17.458, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 90.106, 72.856, 88.617 ], "x_axis": [ -0.067, 0.400, -0.914 ], "y_axis": [ -0.957, 0.232, 0.172 ], "z_axis": [ 0.281, 0.887, 0.368 ], "quaternion": [ 0.619, -0.289, 0.482, 0.548 ] } }, { "index": 47, "index_chain": 47, "chain_name": "C", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///C/54", "linked_nts": [ "///C/53", "///C/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -63.623, "beta": 172.159, "gamma": 53.592, "delta": 82.510, "epsilon": -138.403, "zeta": -75.538, "epsilon_zeta": -62.865, "bb_type": "BI", "chi": -162.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.673, 0.664 ], "P_xyz": [ 1.277, 8.992, 0.904 ], "form": ".", "ssZp": 4.446, "Dp": 4.678, "splay_angle": 27.768, "splay_distance": 4.325, "splay_ratio": 0.240, "d22": 4.006, "d64": 3.952, "eta": 170.117, "theta": -136.804, "eta_prime": -178.392, "theta_prime": -133.241, "eta_base": -133.593, "theta_base": -94.522, "v0": 3.168, "v1": -24.441, "v2": 35.211, "v3": -34.388, "v4": 19.696, "amplitude": 36.247, "phase_angle": 13.729, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 92.029, 75.855, 88.455 ], "x_axis": [ -0.681, 0.355, -0.640 ], "y_axis": [ -0.684, 0.004, 0.730 ], "z_axis": [ 0.262, 0.935, 0.240 ], "quaternion": [ 0.375, -0.137, 0.601, 0.692 ] } }, { "index": 48, "index_chain": 48, "chain_name": "C", "nt_resnum": 55, "nt_name": "U", "nt_code": "U", "nt_id": "///C/55", "linked_nts": [ "///C/54", "///C/56" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor,phosphate", "alpha": -57.673, "beta": 163.273, "gamma": 55.178, "delta": 82.583, "epsilon": -114.383, "zeta": -57.943, "epsilon_zeta": -56.439, "bb_type": "--", "chi": -162.284, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.664, 0.681 ], "P_xyz": [ 1.297, 8.894, 0.666 ], "form": ".", "ssZp": 4.309, "Dp": 4.738, "splay_angle": 65.409, "splay_distance": 9.611, "splay_ratio": 0.542, "d22": 8.300, "d64": 10.051, "eta": 175.537, "theta": -87.234, "eta_prime": -168.436, "theta_prime": -134.590, "eta_base": -117.183, "theta_base": 157.877, "v0": 3.397, "v1": -24.689, "v2": 35.426, "v3": -34.456, "v4": 19.589, "amplitude": 36.416, "phase_angle": 13.392, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.880, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 91.429, 80.088, 87.805 ], "x_axis": [ -0.992, 0.129, 0.012 ], "y_axis": [ -0.015, -0.209, 0.978 ], "z_axis": [ 0.128, 0.969, 0.209 ], "quaternion": [ 0.046, 0.045, 0.627, 0.776 ] } }, { "index": 49, "index_chain": 49, "chain_name": "C", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///C/56", "linked_nts": [ "///C/55", "///C/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,non-stack,isolated-canonical,helix-end,hairpin-loop,kissing-loop,phosphate", "alpha": -176.034, "beta": 149.805, "gamma": 35.002, "delta": 83.047, "epsilon": -137.486, "zeta": -73.258, "epsilon_zeta": -64.227, "bb_type": "BI", "chi": -177.555, "glyco_bond": "anti", "C5prime_xyz": [ -1.151, 8.397, 1.591 ], "P_xyz": [ 1.352, 8.043, 2.304 ], "form": "A", "ssZp": 4.692, "Dp": 4.707, "splay_angle": 23.862, "splay_distance": 3.666, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 10.913, "theta": -130.297, "eta_prime": 46.716, "theta_prime": -128.824, "eta_base": 26.602, "theta_base": -96.791, "v0": 5.438, "v1": -26.262, "v2": 35.980, "v3": -33.836, "v4": 17.899, "amplitude": 36.564, "phase_angle": 10.255, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.313, "filter_rmsd": 0.067, "frame": { "rmsd": 0.005, "origin": [ 100.231, 83.111, 90.206 ], "x_axis": [ 0.476, -0.650, 0.592 ], "y_axis": [ -0.630, 0.218, 0.746 ], "z_axis": [ -0.614, -0.728, -0.305 ], "quaternion": [ 0.589, 0.625, -0.512, -0.009 ] } }, { "index": 50, "index_chain": 50, "chain_name": "C", "nt_resnum": 57, "nt_name": "A", "nt_code": "A", "nt_id": "///C/57", "linked_nts": [ "///C/56", "///C/58" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -62.238, "beta": 166.400, "gamma": 54.978, "delta": 82.070, "epsilon": -128.703, "zeta": -69.823, "epsilon_zeta": -58.879, "bb_type": "BI", "chi": -173.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.437, 8.516, 1.295 ], "P_xyz": [ 1.145, 8.782, 1.675 ], "form": ".", "ssZp": 4.647, "Dp": 4.724, "splay_angle": 41.982, "splay_distance": 6.460, "splay_ratio": 0.359, "d22": null, "d64": null, "eta": 168.424, "theta": -128.414, "eta_prime": -174.718, "theta_prime": -118.668, "eta_base": -122.743, "theta_base": -99.123, "v0": 3.194, "v1": -24.824, "v2": 35.783, "v3": -34.952, "v4": 20.034, "amplitude": 36.840, "phase_angle": 13.759, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.914, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 99.634, 79.629, 89.227 ], "x_axis": [ -0.012, -0.330, 0.944 ], "y_axis": [ -0.779, 0.595, 0.198 ], "z_axis": [ -0.627, -0.733, -0.264 ], "quaternion": [ 0.574, 0.405, -0.684, 0.195 ] } }, { "index": 51, "index_chain": 51, "chain_name": "C", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///C/58", "linked_nts": [ "///C/57", "///C/59" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -54.295, "beta": -152.426, "gamma": 68.197, "delta": 147.021, "epsilon": -89.376, "zeta": -157.543, "epsilon_zeta": 68.168, "bb_type": "BII", "chi": -84.075, "glyco_bond": "anti", "C5prime_xyz": [ -2.844, 7.515, -2.633 ], "P_xyz": [ -0.522, 8.647, -3.111 ], "form": ".", "ssZp": 0.489, "Dp": 0.653, "splay_angle": 86.881, "splay_distance": 13.310, "splay_ratio": 0.688, "d22": null, "d64": null, "eta": -131.675, "theta": -121.006, "eta_prime": -108.963, "theta_prime": -171.407, "eta_base": -100.155, "theta_base": 153.966, "v0": -22.944, "v1": 36.926, "v2": -36.042, "v3": 23.765, "v4": -0.721, "amplitude": 37.832, "phase_angle": 162.308, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.595, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 96.202, 74.191, 89.841 ], "x_axis": [ -0.509, 0.008, 0.861 ], "y_axis": [ -0.737, 0.513, -0.440 ], "z_axis": [ -0.445, -0.859, -0.255 ], "quaternion": [ -0.433, -0.242, 0.754, -0.431 ] } }, { "index": 52, "index_chain": 52, "chain_name": "C", "nt_resnum": 59, "nt_name": "G", "nt_code": "G", "nt_id": "///C/59", "linked_nts": [ "///C/58", "///C/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": 55.729, "beta": -145.338, "gamma": 60.982, "delta": 82.193, "epsilon": -132.253, "zeta": -98.582, "epsilon_zeta": -33.671, "bb_type": "--", "chi": -179.286, "glyco_bond": "anti", "C5prime_xyz": [ -1.763, 8.545, 1.608 ], "P_xyz": [ 0.284, 8.603, 3.245 ], "form": ".", "ssZp": 4.514, "Dp": 4.576, "splay_angle": 19.993, "splay_distance": 3.065, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -8.758, "theta": -143.834, "eta_prime": 7.538, "theta_prime": -128.549, "eta_base": 33.022, "theta_base": -79.254, "v0": -0.804, "v1": -21.001, "v2": 33.524, "v3": -34.979, "v4": 22.531, "amplitude": 35.649, "phase_angle": 19.882, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.351, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 99.905, 73.484, 77.076 ], "x_axis": [ 0.316, 0.878, -0.360 ], "y_axis": [ -0.917, 0.380, 0.122 ], "z_axis": [ 0.244, 0.291, 0.925 ], "quaternion": [ 0.809, -0.052, 0.187, 0.554 ] } }, { "index": 53, "index_chain": 53, "chain_name": "C", "nt_resnum": 60, "nt_name": "U", "nt_code": "U", "nt_id": "///C/60", "linked_nts": [ "///C/59", "///C/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -25.846, "beta": 144.572, "gamma": 53.616, "delta": 146.699, "epsilon": -89.700, "zeta": -39.272, "epsilon_zeta": -50.428, "bb_type": "--", "chi": -130.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.832, 8.658, -0.652 ], "P_xyz": [ 0.726, 8.772, -0.052 ], "form": ".", "ssZp": 0.678, "Dp": 0.717, "splay_angle": 98.852, "splay_distance": 14.887, "splay_ratio": 0.760, "d22": 7.104, "d64": 7.885, "eta": -159.579, "theta": -4.704, "eta_prime": -126.079, "theta_prime": -40.268, "eta_base": -78.636, "theta_base": -13.560, "v0": -20.906, "v1": 35.067, "v2": -35.080, "v3": 23.908, "v4": -2.090, "amplitude": 36.407, "phase_angle": 164.483, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.080, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 101.220, 75.431, 79.045 ], "x_axis": [ -0.403, 0.898, -0.176 ], "y_axis": [ -0.811, -0.260, 0.525 ], "z_axis": [ 0.425, 0.354, 0.833 ], "quaternion": [ 0.541, 0.079, 0.278, 0.790 ] } }, { "index": 54, "index_chain": 54, "chain_name": "C", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///C/61", "linked_nts": [ "///C/60", "///C/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -98.953, "beta": -154.429, "gamma": 28.895, "delta": 80.883, "epsilon": -151.267, "zeta": -73.786, "epsilon_zeta": -77.480, "bb_type": "BI", "chi": -177.876, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.500, 1.573 ], "P_xyz": [ 0.376, 8.796, 3.516 ], "form": "A", "ssZp": 4.611, "Dp": 4.619, "splay_angle": 25.143, "splay_distance": 3.879, "splay_ratio": 0.220, "d22": 4.742, "d64": 4.814, "eta": 108.230, "theta": -158.316, "eta_prime": 150.345, "theta_prime": -148.883, "eta_base": 177.366, "theta_base": -119.161, "v0": 2.800, "v1": -24.741, "v2": 36.054, "v3": -35.436, "v4": 20.563, "amplitude": 37.221, "phase_angle": 14.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.030, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 89.968, 72.947, 88.470 ], "x_axis": [ 0.037, 0.582, -0.812 ], "y_axis": [ 0.955, -0.260, -0.143 ], "z_axis": [ -0.294, -0.770, -0.566 ], "quaternion": [ 0.230, 0.682, 0.563, -0.405 ] } }, { "index": 55, "index_chain": 55, "chain_name": "C", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///C/62", "linked_nts": [ "///C/61", "///C/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.848, "beta": -178.840, "gamma": 56.672, "delta": 81.949, "epsilon": -157.562, "zeta": -71.229, "epsilon_zeta": -86.333, "bb_type": "BI", "chi": -170.978, "glyco_bond": "anti", "C5prime_xyz": [ -1.253, 8.611, 1.178 ], "P_xyz": [ 1.289, 8.840, 1.793 ], "form": "A", "ssZp": 4.556, "Dp": 4.575, "splay_angle": 24.623, "splay_distance": 3.890, "splay_ratio": 0.217, "d22": 4.783, "d64": 4.969, "eta": 169.397, "theta": -150.107, "eta_prime": -179.095, "theta_prime": -149.228, "eta_base": -144.337, "theta_base": -134.299, "v0": 3.360, "v1": -25.009, "v2": 35.910, "v3": -34.921, "v4": 19.902, "amplitude": 36.924, "phase_angle": 13.461, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.942, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 86.988, 70.972, 86.964 ], "x_axis": [ 0.552, 0.396, -0.734 ], "y_axis": [ 0.801, -0.498, 0.333 ], "z_axis": [ -0.233, -0.771, -0.592 ], "quaternion": [ 0.340, 0.813, 0.368, -0.297 ] } }, { "index": 56, "index_chain": 56, "chain_name": "C", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///C/63", "linked_nts": [ "///C/62", "///C/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.274, "beta": -177.319, "gamma": 54.551, "delta": 81.186, "epsilon": -151.064, "zeta": -76.261, "epsilon_zeta": -74.803, "bb_type": "BI", "chi": -164.956, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.746, 0.817 ], "P_xyz": [ 1.224, 9.144, 1.401 ], "form": "A", "ssZp": 4.492, "Dp": 4.592, "splay_angle": 24.714, "splay_distance": 3.858, "splay_ratio": 0.214, "d22": 4.501, "d64": 4.530, "eta": 172.902, "theta": -150.281, "eta_prime": -177.652, "theta_prime": -147.353, "eta_base": -151.513, "theta_base": -121.119, "v0": 1.451, "v1": -23.337, "v2": 35.118, "v3": -35.253, "v4": 21.327, "amplitude": 36.606, "phase_angle": 16.391, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 84.256, 69.510, 84.612 ], "x_axis": [ 0.868, 0.168, -0.467 ], "y_axis": [ 0.459, -0.630, 0.627 ], "z_axis": [ -0.188, -0.759, -0.624 ], "quaternion": [ 0.392, 0.883, 0.177, -0.185 ] } }, { "index": 57, "index_chain": 57, "chain_name": "C", "nt_resnum": 64, "nt_name": "U", "nt_code": "U", "nt_id": "///C/64", "linked_nts": [ "///C/63", "///C/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.627, "beta": 169.766, "gamma": 55.810, "delta": 81.477, "epsilon": -142.754, "zeta": -76.293, "epsilon_zeta": -66.461, "bb_type": "BI", "chi": -163.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.310, 8.668, 0.719 ], "P_xyz": [ 1.294, 8.976, 0.823 ], "form": "A", "ssZp": 4.500, "Dp": 4.679, "splay_angle": 24.986, "splay_distance": 3.906, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 171.935, "theta": -142.858, "eta_prime": -175.547, "theta_prime": -142.887, "eta_base": -137.778, "theta_base": -115.709, "v0": 3.431, "v1": -25.165, "v2": 36.122, "v3": -35.146, "v4": 20.007, "amplitude": 37.138, "phase_angle": 13.435, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 83.403, 67.679, 81.326 ], "x_axis": [ 0.982, -0.177, -0.061 ], "y_axis": [ -0.066, -0.632, 0.773 ], "z_axis": [ -0.175, -0.755, -0.632 ], "quaternion": [ 0.424, 0.901, -0.067, -0.066 ] } }, { "index": 58, "index_chain": 58, "chain_name": "C", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///C/65", "linked_nts": [ "///C/64", "///C/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -69.143, "beta": 175.757, "gamma": 49.941, "delta": 81.399, "epsilon": -151.026, "zeta": -75.443, "epsilon_zeta": -75.583, "bb_type": "BI", "chi": -174.386, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.551, 1.365 ], "P_xyz": [ 1.088, 8.824, 2.119 ], "form": "A", "ssZp": 4.621, "Dp": 4.630, "splay_angle": 23.358, "splay_distance": 3.664, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 160.874, "theta": -149.744, "eta_prime": 172.759, "theta_prime": -147.342, "eta_base": -143.840, "theta_base": -128.749, "v0": 3.172, "v1": -24.897, "v2": 35.935, "v3": -35.100, "v4": 20.143, "amplitude": 37.003, "phase_angle": 13.805, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 84.012, 65.442, 78.182 ], "x_axis": [ 0.750, -0.124, 0.650 ], "y_axis": [ -0.646, -0.348, 0.679 ], "z_axis": [ 0.142, -0.929, -0.341 ], "quaternion": [ 0.515, 0.781, -0.246, 0.254 ] } }, { "index": 59, "index_chain": 59, "chain_name": "C", "nt_resnum": 66, "nt_name": "U", "nt_code": "U", "nt_id": "///C/66", "linked_nts": [ "///C/65", "///C/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -64.657, "beta": 179.233, "gamma": 52.091, "delta": 81.535, "epsilon": -151.963, "zeta": -73.995, "epsilon_zeta": -77.968, "bb_type": "BI", "chi": -163.665, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.682, 0.754 ], "P_xyz": [ 1.206, 9.076, 1.248 ], "form": "A", "ssZp": 4.487, "Dp": 4.607, "splay_angle": 22.487, "splay_distance": 3.532, "splay_ratio": 0.196, "d22": 4.259, "d64": 4.313, "eta": 170.896, "theta": -148.175, "eta_prime": -178.974, "theta_prime": -146.342, "eta_base": -149.101, "theta_base": -119.553, "v0": 2.774, "v1": -24.528, "v2": 35.760, "v3": -35.124, "v4": 20.402, "amplitude": 36.917, "phase_angle": 14.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.973, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 85.799, 63.411, 75.711 ], "x_axis": [ 0.318, -0.240, 0.917 ], "y_axis": [ -0.926, -0.285, 0.246 ], "z_axis": [ 0.202, -0.928, -0.313 ], "quaternion": [ 0.424, 0.692, -0.421, 0.405 ] } }, { "index": 60, "index_chain": 60, "chain_name": "C", "nt_resnum": 67, "nt_name": "U", "nt_code": "U", "nt_id": "///C/67", "linked_nts": [ "///C/66", "///C/68" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.794, "beta": 168.154, "gamma": 55.388, "delta": 81.145, "epsilon": -151.050, "zeta": -78.781, "epsilon_zeta": -72.269, "bb_type": "BI", "chi": -163.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.700, 0.737 ], "P_xyz": [ 1.194, 9.076, 0.886 ], "form": "A", "ssZp": 4.481, "Dp": 4.608, "splay_angle": 25.027, "splay_distance": 3.921, "splay_ratio": 0.217, "d22": 4.576, "d64": 4.727, "eta": 169.607, "theta": -150.066, "eta_prime": -175.895, "theta_prime": -149.540, "eta_base": -134.753, "theta_base": -126.026, "v0": 2.109, "v1": -24.083, "v2": 35.708, "v3": -35.447, "v4": 21.036, "amplitude": 37.040, "phase_angle": 15.410, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 87.914, 60.661, 75.047 ], "x_axis": [ -0.231, -0.325, 0.917 ], "y_axis": [ -0.942, -0.160, -0.294 ], "z_axis": [ 0.243, -0.932, -0.269 ], "quaternion": [ -0.291, -0.547, 0.579, -0.530 ] } }, { "index": 61, "index_chain": 61, "chain_name": "C", "nt_resnum": 68, "nt_name": "C", "nt_code": "C", "nt_id": "///C/68", "linked_nts": [ "///C/67", "///C/69" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.245, "beta": 167.360, "gamma": 53.252, "delta": 80.412, "epsilon": -134.884, "zeta": -83.508, "epsilon_zeta": -51.376, "bb_type": "BI", "chi": -162.048, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.752, 0.653 ], "P_xyz": [ 1.330, 9.057, 0.762 ], "form": "A", "ssZp": 4.439, "Dp": 4.706, "splay_angle": 24.287, "splay_distance": 3.834, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 175.736, "theta": -144.316, "eta_prime": -173.652, "theta_prime": -143.813, "eta_base": -138.721, "theta_base": -119.771, "v0": 2.424, "v1": -24.650, "v2": 36.305, "v3": -35.888, "v4": 21.108, "amplitude": 37.585, "phase_angle": 14.992, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 90.033, 57.363, 74.956 ], "x_axis": [ -0.687, -0.353, 0.635 ], "y_axis": [ -0.684, 0.018, -0.729 ], "z_axis": [ 0.245, -0.936, -0.254 ], "quaternion": [ -0.139, -0.370, 0.700, -0.595 ] } }, { "index": 62, "index_chain": 62, "chain_name": "C", "nt_resnum": 69, "nt_name": "G", "nt_code": "G", "nt_id": "///C/69", "linked_nts": [ "///C/68", "///C/70" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.573, "beta": 171.986, "gamma": 41.564, "delta": 80.019, "epsilon": -145.569, "zeta": -79.883, "epsilon_zeta": -65.686, "bb_type": "BI", "chi": -173.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.400, 8.559, 1.321 ], "P_xyz": [ 1.073, 8.853, 2.129 ], "form": "A", "ssZp": 4.679, "Dp": 4.691, "splay_angle": 22.746, "splay_distance": 3.585, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 157.412, "theta": -150.656, "eta_prime": 166.877, "theta_prime": -147.587, "eta_base": -154.762, "theta_base": -126.749, "v0": 3.586, "v1": -25.813, "v2": 37.021, "v3": -35.982, "v4": 20.434, "amplitude": 38.047, "phase_angle": 13.340, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.662, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 90.947, 53.661, 75.346 ], "x_axis": [ -0.930, 0.281, 0.236 ], "y_axis": [ -0.165, 0.256, -0.953 ], "z_axis": [ -0.328, -0.925, -0.192 ], "quaternion": [ -0.183, 0.038, 0.771, -0.609 ] } }, { "index": 63, "index_chain": 63, "chain_name": "C", "nt_resnum": 70, "nt_name": "G", "nt_code": "G", "nt_id": "///C/70", "linked_nts": [ "///C/69", "///C/71" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.267, "beta": 168.244, "gamma": 52.275, "delta": 79.923, "epsilon": -149.477, "zeta": -79.720, "epsilon_zeta": -69.757, "bb_type": "BI", "chi": -171.438, "glyco_bond": "anti", "C5prime_xyz": [ -1.536, 8.645, 1.172 ], "P_xyz": [ 1.012, 9.078, 1.596 ], "form": "A", "ssZp": 4.615, "Dp": 4.642, "splay_angle": 22.885, "splay_distance": 3.582, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 168.766, "theta": -152.042, "eta_prime": -179.767, "theta_prime": -151.290, "eta_base": -146.240, "theta_base": -129.727, "v0": 1.966, "v1": -24.494, "v2": 36.454, "v3": -36.315, "v4": 21.650, "amplitude": 37.864, "phase_angle": 15.685, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 90.109, 50.496, 76.809 ], "x_axis": [ -0.861, 0.449, -0.240 ], "y_axis": [ 0.298, 0.061, -0.953 ], "z_axis": [ -0.413, -0.891, -0.187 ], "quaternion": [ -0.060, 0.257, 0.726, -0.635 ] } }, { "index": 64, "index_chain": 64, "chain_name": "C", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///C/71", "linked_nts": [ "///C/70", "///C/72" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.877, "beta": 167.385, "gamma": 54.560, "delta": 80.800, "epsilon": -147.558, "zeta": -76.976, "epsilon_zeta": -70.582, "bb_type": "BI", "chi": -171.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.638, 1.158 ], "P_xyz": [ 1.089, 9.016, 1.496 ], "form": "A", "ssZp": 4.611, "Dp": 4.647, "splay_angle": 24.429, "splay_distance": 3.816, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 169.901, "theta": -147.123, "eta_prime": -178.990, "theta_prime": -145.694, "eta_base": -143.694, "theta_base": -119.807, "v0": 2.351, "v1": -24.507, "v2": 36.109, "v3": -35.770, "v4": 21.070, "amplitude": 37.400, "phase_angle": 15.099, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 88.120, 47.762, 77.990 ], "x_axis": [ -0.577, 0.464, -0.672 ], "y_axis": [ 0.680, -0.183, -0.710 ], "z_axis": [ -0.453, -0.867, -0.210 ], "quaternion": [ 0.087, 0.452, 0.633, -0.623 ] } }, { "index": 65, "index_chain": 65, "chain_name": "C", "nt_resnum": 72, "nt_name": "C", "nt_code": "C", "nt_id": "///C/72", "linked_nts": [ "///C/71", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -61.038, "beta": 172.737, "gamma": 54.421, "delta": 81.329, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -162.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.731, 0.685 ], "P_xyz": [ 1.319, 9.063, 0.889 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.759, "v1": -24.644, "v2": 35.930, "v3": -35.328, "v4": 20.543, "amplitude": 37.101, "phase_angle": 14.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.965, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 85.057, 45.486, 77.923 ], "x_axis": [ -0.085, 0.290, -0.953 ], "y_axis": [ 0.868, -0.448, -0.214 ], "z_axis": [ -0.489, -0.846, -0.213 ], "quaternion": [ 0.252, 0.628, 0.461, -0.575 ] } } ], "num_hbonds": 545, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 18, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/33/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 14, "atom2_serNum": 16, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///A/34/O", "atom2_id": "///A/34/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 48, "atom2_serNum": 2839, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///A/37/OH", "atom2_id": "///B/167/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 66, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 105, "atom2_serNum": 111, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/45/N", "atom2_id": "///A/45/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 116, "atom2_serNum": 150, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 132, "atom2_serNum": 203, "donAcc_type": "acceptable", "distance": 3.405, "atom1_id": "///A/47/OG", "atom2_id": "///A/55/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 145, "atom2_serNum": 593, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/49/O", "atom2_id": "///A/124/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 145, "atom2_serNum": 594, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/49/O", "atom2_id": "///A/124/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 153, "atom2_serNum": 178, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/50/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 153, "atom2_serNum": 189, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 161, "atom2_serNum": 415, "donAcc_type": "acceptable", "distance": 2.503, "atom1_id": "///A/50/OH", "atom2_id": "///A/103/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 238, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.368, "atom1_id": "///A/79/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 238, "atom2_serNum": 831, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/79/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 244, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///A/80/N", "atom2_id": "///A/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 247, "atom2_serNum": 420, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///A/80/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 255, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/81/N", "atom2_id": "///A/156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 258, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/81/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 260, "atom2_serNum": 423, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///A/82/N", "atom2_id": "///A/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 263, "atom2_serNum": 432, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/82/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 266, "atom2_serNum": 268, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/82/OD1", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 268, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/83/N", "atom2_id": "///A/158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 276, "atom2_serNum": 435, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/84/N", "atom2_id": "///A/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 283, "atom2_serNum": 302, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/85/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 286, "atom2_serNum": 447, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/86/N", "atom2_id": "///A/107/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 293, "atom2_serNum": 550, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/87/O", "atom2_id": "///A/119/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 305, "atom2_serNum": 326, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 309, "atom2_serNum": 333, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 313, "atom2_serNum": 342, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 341, "atom2_serNum": 1486, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/93/OE2", "atom2_id": "///A/233/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 345, "atom2_serNum": 371, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 353, "atom2_serNum": 371, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/95/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 355, "atom2_serNum": 651, "donAcc_type": "acceptable", "distance": 3.317, "atom1_id": "///A/95/OG", "atom2_id": "///A/133/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 374, "atom2_serNum": 652, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/98/O", "atom2_id": "///A/133/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 385, "atom2_serNum": 652, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/99/O", "atom2_id": "///A/133/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 389, "atom2_serNum": 395, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/100/N", "atom2_id": "///A/100/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 395, "atom2_serNum": 397, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/100/OD1", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 412, "atom2_serNum": 648, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/103/N", "atom2_id": "///A/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 415, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/103/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 428, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/105/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 431, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/105/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 440, "atom2_serNum": 675, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/107/N", "atom2_id": "///A/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 443, "atom2_serNum": 691, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/107/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 452, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/108/O", "atom2_id": "///A/138/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 460, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 460, "atom2_serNum": 496, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///A/109/O", "atom2_id": "///A/113/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 471, "atom2_serNum": 496, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///A/110/O", "atom2_id": "///A/113/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 471, "atom2_serNum": 497, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 478, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 487, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 494, "atom2_serNum": 524, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 500, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 508, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 516, "atom2_serNum": 551, "donAcc_type": "acceptable", "distance": 3.940, "atom1_id": "///A/115/OH", "atom2_id": "///A/119/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 520, "atom2_serNum": 552, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 527, "atom2_serNum": 560, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 532, "atom2_serNum": 669, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/117/NE2", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 536, "atom2_serNum": 571, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 539, "atom2_serNum": 569, "donAcc_type": "standard", "distance": 2.423, "atom1_id": "///A/118/OD1", "atom2_id": "///A/121/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 544, "atom2_serNum": 576, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 555, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 563, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 574, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 587, "atom2_serNum": 644, "donAcc_type": "standard", "distance": 3.739, "atom1_id": "///A/124/O", "atom2_id": "///A/132/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 591, "atom2_serNum": 628, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/124/NE", "atom2_id": "///A/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 594, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///A/124/NH2", "atom2_id": "///A/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 603, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/126/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 700, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/140/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 700, "atom2_serNum": 727, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 703, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/140/OD1", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 721, "atom2_serNum": 758, "donAcc_type": "questionable", "distance": 3.251, "atom1_id": "///A/143/O", "atom2_id": "///A/147/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 730, "atom2_serNum": 752, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/144/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 730, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 740, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 740, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 782, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/150/N", "atom2_id": "///A/153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 802, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/151/NZ", "atom2_id": "///B/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 803, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/152/N", "atom2_id": "///A/186/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 816, "atom2_serNum": 1110, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/154/N", "atom2_id": "///A/187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 819, "atom2_serNum": 1122, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/154/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 827, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/155/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 839, "atom2_serNum": 1174, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/156/NZ", "atom2_id": "///A/195/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 840, "atom2_serNum": 1151, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/157/N", "atom2_id": "///A/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 843, "atom2_serNum": 1163, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/157/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 859, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/159/N", "atom2_id": "///A/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 862, "atom2_serNum": 1180, "donAcc_type": "acceptable", "distance": 3.455, "atom1_id": "///A/159/O", "atom2_id": "///A/196/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 862, "atom2_serNum": 1182, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/159/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 878, "atom2_serNum": 1185, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/161/N", "atom2_id": "///A/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 892, "atom2_serNum": 904, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/162/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 903, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///A/163/OD2", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 911, "atom2_serNum": 917, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///A/165/N", "atom2_id": "///A/165/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 924, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///A/166/O", "atom2_id": "///A/174/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 955, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/169/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 955, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 968, "atom2_serNum": 974, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///A/171/N", "atom2_id": "///A/171/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 986, "atom2_serNum": 2511, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///A/172/NZ", "atom2_id": "///B/125/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 1010, "atom2_serNum": 1263, "donAcc_type": "questionable", "distance": 3.310, "atom1_id": "///A/174/NH1", "atom2_id": "///A/206/NE1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 1015, "atom2_serNum": 1089, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///A/175/O", "atom2_id": "///A/184/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 1031, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 1044, "atom2_serNum": 1069, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 1051, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1059, "atom2_serNum": 1090, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1067, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1072, "atom2_serNum": 1107, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1081, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1093, "atom2_serNum": 1117, "donAcc_type": "questionable", "distance": 2.821, "atom1_id": "///A/185/O", "atom2_id": "///A/188/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1093, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/185/O", "atom2_id": "///A/258/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1125, "atom2_serNum": 1144, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/189/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1140, "atom2_serNum": 1677, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///A/191/N", "atom2_id": "///A/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1147, "atom2_serNum": 1674, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/192/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1156, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/194/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1159, "atom2_serNum": 1652, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/194/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1174, "atom2_serNum": 1454, "donAcc_type": "acceptable", "distance": 3.535, "atom1_id": "///A/195/OH", "atom2_id": "///A/228/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1175, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/196/N", "atom2_id": "///A/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1178, "atom2_serNum": 1639, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/196/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1193, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/198/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1195, "atom2_serNum": 1205, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///A/198/OG1", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1208, "atom2_serNum": 1237, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1215, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/201/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1223, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1232, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/203/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1240, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/204/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1243, "atom2_serNum": 1253, "donAcc_type": "acceptable", "distance": 3.453, "atom1_id": "///A/204/ND1", "atom2_id": "///A/205/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1247, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/205/N", "atom2_id": "///A/205/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1250, "atom2_serNum": 1283, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/205/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1258, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/206/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1272, "atom2_serNum": 1300, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/207/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1280, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/208/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1286, "atom2_serNum": 1320, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1288, "atom2_serNum": 1319, "donAcc_type": "acceptable", "distance": 3.746, "atom1_id": "///A/209/OG1", "atom2_id": "///A/212/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1293, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1335, "atom2_serNum": 1346, "donAcc_type": "acceptable", "distance": 3.170, "atom1_id": "///A/214/ND1", "atom2_id": "///A/216/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1365, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/218/N", "atom2_id": "///A/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1368, "atom2_serNum": 1663, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/218/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1381, "atom2_serNum": 1388, "donAcc_type": "standard", "distance": 3.937, "atom1_id": "///A/219/NE", "atom2_id": "///A/220/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1385, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/220/N", "atom2_id": "///A/255/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1395, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1402, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/222/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1453, "atom2_serNum": 1455, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/228/OD1", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1453, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/228/OD1", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1458, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 3.728, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1465, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/230/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1465, "atom2_serNum": 1490, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1479, "atom2_serNum": 1507, "donAcc_type": "acceptable", "distance": 3.777, "atom1_id": "///A/232/O", "atom2_id": "///A/236/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1483, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1483, "atom2_serNum": 1514, "donAcc_type": "acceptable", "distance": 2.988, "atom1_id": "///A/233/O", "atom2_id": "///A/237/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1518, "atom2_serNum": 1544, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1520, "atom2_serNum": 1531, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///A/238/OG1", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1525, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1534, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1543, "atom2_serNum": 1569, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1547, "atom2_serNum": 1577, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1556, "atom2_serNum": 1588, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1565, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1565, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/244/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1701, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/260/NE2", "atom2_id": "///A/261/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1701, "atom2_serNum": 1727, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///A/260/NE2", "atom2_id": "///A/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1709, "atom2_serNum": 1724, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/261/OD2", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1713, "atom2_serNum": 1735, "donAcc_type": "questionable", "distance": 2.898, "atom1_id": "///A/262/O", "atom2_id": "///A/265/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1720, "atom2_serNum": 1732, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/263/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1747, "atom2_serNum": 2032, "donAcc_type": "acceptable", "distance": 3.408, "atom1_id": "///B/4/OG", "atom2_id": "///B/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1751, "atom2_serNum": 3795, "donAcc_type": "questionable", "distance": 3.148, "atom1_id": "///B/5/O", "atom2_id": "///B/294/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1755, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/6/N", "atom2_id": "///B/17/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1758, "atom2_serNum": 1828, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/6/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1759, "atom2_serNum": 3795, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/7/N", "atom2_id": "///B/294/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1767, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/8/N", "atom2_id": "///B/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1770, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/8/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1780, "atom2_serNum": 1802, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/10/N", "atom2_id": "///B/13/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1783, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/10/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1783, "atom2_serNum": 1799, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/10/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1793, "atom2_serNum": 1900, "donAcc_type": "acceptable", "distance": 3.613, "atom1_id": "///B/12/O", "atom2_id": "///B/26/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1793, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///B/12/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1806, "atom2_serNum": 1891, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/14/N", "atom2_id": "///B/25/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1809, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/14/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1821, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/16/N", "atom2_id": "///B/23/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1824, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/16/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1837, "atom2_serNum": 2055, "donAcc_type": "acceptable", "distance": 2.428, "atom1_id": "///B/17/NH1", "atom2_id": "///B/67/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1839, "atom2_serNum": 1856, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/18/N", "atom2_id": "///B/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1842, "atom2_serNum": 1847, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/18/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1842, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/18/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1846, "atom2_serNum": 2029, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/19/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1850, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/20/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1852, "atom2_serNum": 1987, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///B/20/OG", "atom2_id": "///B/39/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1852, "atom2_serNum": 1989, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///B/20/OG", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1852, "atom2_serNum": 2023, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///B/20/OG", "atom2_id": "///B/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1864, "atom2_serNum": 1972, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/22/N", "atom2_id": "///B/38/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1867, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/22/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1883, "atom2_serNum": 1953, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/24/N", "atom2_id": "///B/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1886, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/24/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1895, "atom2_serNum": 1939, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///B/26/N", "atom2_id": "///B/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1900, "atom2_serNum": 1912, "donAcc_type": "acceptable", "distance": 3.625, "atom1_id": "///B/26/OG", "atom2_id": "///B/28/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1917, "atom2_serNum": 1926, "donAcc_type": "questionable", "distance": 2.910, "atom1_id": "///B/29/O", "atom2_id": "///B/32/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1923, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/32/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1934, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 3.944, "atom1_id": "///B/33/OD1", "atom2_id": "///B/335/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1987, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/39/OD1", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1987, "atom2_serNum": 2000, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///B/39/OD1", "atom2_id": "///B/41/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1988, "atom2_serNum": 2000, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///B/39/OD2", "atom2_id": "///B/41/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 2019, "atom2_serNum": 2163, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///B/61/OG", "atom2_id": "///B/81/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 2027, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///B/63/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 2037, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/65/N", "atom2_id": "///B/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 2048, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///B/66/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 2056, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///B/68/N", "atom2_id": "///B/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 2059, "atom2_serNum": 2128, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///B/68/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 2074, "atom2_serNum": 2108, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/70/N", "atom2_id": "///B/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2079, "atom2_serNum": 2095, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///B/70/OG", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2079, "atom2_serNum": 2099, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///B/70/OG", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2079, "atom2_serNum": 2105, "donAcc_type": "acceptable", "distance": 3.136, "atom1_id": "///B/70/OG", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2079, "atom2_serNum": 2431, "donAcc_type": "acceptable", "distance": 3.541, "atom1_id": "///B/70/OG", "atom2_id": "///B/114/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2094, "atom2_serNum": 2104, "donAcc_type": "acceptable", "distance": 3.245, "atom1_id": "///B/72/OG", "atom2_id": "///B/74/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2094, "atom2_serNum": 2431, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///B/72/OG", "atom2_id": "///B/114/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2094, "atom2_serNum": 2432, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/72/OG", "atom2_id": "///B/114/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2098, "atom2_serNum": 2241, "donAcc_type": "acceptable", "distance": 3.033, "atom1_id": "///B/73/O", "atom2_id": "///B/90/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2102, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/74/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2102, "atom2_serNum": 2241, "donAcc_type": "acceptable", "distance": 2.593, "atom1_id": "///B/74/O", "atom2_id": "///B/90/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2117, "atom2_serNum": 2217, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/76/N", "atom2_id": "///B/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2120, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/76/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2133, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/78/N", "atom2_id": "///B/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2136, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/78/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2148, "atom2_serNum": 2182, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/80/N", "atom2_id": "///B/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2154, "atom2_serNum": 2179, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///B/80/OD1", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2155, "atom2_serNum": 2169, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///B/80/OD2", "atom2_id": "///B/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2155, "atom2_serNum": 2186, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/80/OD2", "atom2_id": "///B/84/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2155, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/80/OD2", "atom2_id": "///B/84/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2159, "atom2_serNum": 2357, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/81/O", "atom2_id": "///B/104/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2162, "atom2_serNum": 2357, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///B/81/OD1", "atom2_id": "///B/104/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2169, "atom2_serNum": 2186, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///B/82/OG", "atom2_id": "///B/84/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2173, "atom2_serNum": 2327, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/83/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2178, "atom2_serNum": 5297, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/83/NZ", "atom2_id": "///C/53/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 229, "atom1_serNum": 2178, "atom2_serNum": 5313, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///B/83/NZ", "atom2_id": "///C/54/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 230, "atom1_serNum": 2190, "atom2_serNum": 2312, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/85/N", "atom2_id": "///B/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2193, "atom2_serNum": 2309, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/85/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2206, "atom2_serNum": 2299, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/87/N", "atom2_id": "///B/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2209, "atom2_serNum": 2288, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/87/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2209, "atom2_serNum": 2296, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///B/87/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2225, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/89/N", "atom2_id": "///B/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2228, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/89/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2235, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///B/89/NH2", "atom2_id": "///B/94/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2255, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/92/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2301, "atom2_serNum": 2582, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///B/97/OG", "atom2_id": "///B/134/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2318, "atom2_serNum": 2552, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///B/99/NH1", "atom2_id": "///B/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2318, "atom2_serNum": 2599, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/99/NH1", "atom2_id": "///B/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2337, "atom2_serNum": 5313, "donAcc_type": "questionable", "distance": 2.967, "atom1_id": "///B/102/O", "atom2_id": "///C/54/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 243, "atom1_serNum": 2346, "atom2_serNum": 5334, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///B/103/NE", "atom2_id": "///C/55/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 244, "atom1_serNum": 2348, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/103/NH1", "atom2_id": "///C/57/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 245, "atom1_serNum": 2349, "atom2_serNum": 5334, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/103/NH2", "atom2_id": "///C/55/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 246, "atom1_serNum": 2349, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/103/NH2", "atom2_id": "///C/57/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 247, "atom1_serNum": 2349, "atom2_serNum": 5374, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/103/NH2", "atom2_id": "///C/57/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 248, "atom1_serNum": 2353, "atom2_serNum": 2486, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/104/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2359, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///B/104/NH1", "atom2_id": "///C/54/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 250, "atom1_serNum": 2359, "atom2_serNum": 5333, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/104/NH1", "atom2_id": "///C/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 251, "atom1_serNum": 2367, "atom2_serNum": 2476, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/106/N", "atom2_id": "///B/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2372, "atom2_serNum": 2685, "donAcc_type": "acceptable", "distance": 3.240, "atom1_id": "///B/106/OG1", "atom2_id": "///B/148/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2377, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/107/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2387, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/109/N", "atom2_id": "///B/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2390, "atom2_serNum": 2458, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/109/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2405, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 3.655, "atom1_id": "///B/111/N", "atom2_id": "///B/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2408, "atom2_serNum": 2424, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/111/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2413, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///B/112/N", "atom2_id": "///B/157/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2436, "atom2_serNum": 2555, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/115/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2450, "atom2_serNum": 2537, "donAcc_type": "acceptable", "distance": 3.494, "atom1_id": "///B/116/NZ", "atom2_id": "///B/128/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2451, "atom2_serNum": 2541, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/117/N", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2454, "atom2_serNum": 2523, "donAcc_type": "questionable", "distance": 3.363, "atom1_id": "///B/117/O", "atom2_id": "///B/127/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2454, "atom2_serNum": 2538, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/117/O", "atom2_id": "///B/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2466, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/119/N", "atom2_id": "///B/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2469, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/119/O", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2478, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/121/N", "atom2_id": "///B/121/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2478, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/121/N", "atom2_id": "///B/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2481, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/121/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2481, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 3.927, "atom1_id": "///B/121/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2484, "atom2_serNum": 2505, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///B/121/OD1", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2494, "atom2_serNum": 5333, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///B/122/NZ", "atom2_id": "///C/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 272, "atom1_serNum": 2494, "atom2_serNum": 5354, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///B/122/NZ", "atom2_id": "///C/56/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 273, "atom1_serNum": 2504, "atom2_serNum": 2650, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/124/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2512, "atom2_serNum": 2531, "donAcc_type": "acceptable", "distance": 3.506, "atom1_id": "///B/125/OD2", "atom2_id": "///B/127/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2513, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/126/N", "atom2_id": "///B/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2516, "atom2_serNum": 2629, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/126/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2516, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 3.730, "atom1_id": "///B/126/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2532, "atom2_serNum": 2613, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/128/N", "atom2_id": "///B/139/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2535, "atom2_serNum": 2610, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/128/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2537, "atom2_serNum": 2637, "donAcc_type": "acceptable", "distance": 2.533, "atom1_id": "///B/128/OG", "atom2_id": "///B/141/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2554, "atom2_serNum": 2570, "donAcc_type": "acceptable", "distance": 3.087, "atom1_id": "///B/130/OG", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2573, "atom2_serNum": 2596, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/133/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2620, "atom2_serNum": 2637, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/139/NH2", "atom2_id": "///B/141/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2649, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///B/143/O", "atom2_id": "///B/170/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2673, "atom2_serNum": 2830, "donAcc_type": "acceptable", "distance": 2.275, "atom1_id": "///B/146/OG", "atom2_id": "///B/166/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2677, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/147/O", "atom2_id": "///B/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2690, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/149/N", "atom2_id": "///B/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2701, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/150/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2704, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/150/OD1", "atom2_id": "///B/193/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2705, "atom2_serNum": 3032, "donAcc_type": "questionable", "distance": 2.777, "atom1_id": "///B/150/OD2", "atom2_id": "///B/192/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2705, "atom2_serNum": 3046, "donAcc_type": "standard", "distance": 3.786, "atom1_id": "///B/150/OD2", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2713, "atom2_serNum": 2787, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///B/152/N", "atom2_id": "///B/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2716, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///B/152/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2725, "atom2_serNum": 2768, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/154/N", "atom2_id": "///B/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2728, "atom2_serNum": 2746, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/154/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2730, "atom2_serNum": 2744, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///B/154/OG", "atom2_id": "///B/156/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2730, "atom2_serNum": 2745, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///B/154/OG", "atom2_id": "///B/156/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2730, "atom2_serNum": 3234, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///B/154/OG", "atom2_id": "///B/218/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2744, "atom2_serNum": 2754, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///B/156/OD1", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2757, "atom2_serNum": 2895, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/158/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2776, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/160/N", "atom2_id": "///B/172/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2779, "atom2_serNum": 2875, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/160/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2792, "atom2_serNum": 2860, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/162/N", "atom2_id": "///B/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2795, "atom2_serNum": 2857, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/162/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2804, "atom2_serNum": 2843, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///B/164/N", "atom2_id": "///B/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2807, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 3.737, "atom1_id": "///B/164/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2810, "atom2_serNum": 2823, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/164/OD1", "atom2_id": "///B/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2810, "atom2_serNum": 2840, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/164/OD1", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2849, "atom2_serNum": 2970, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///B/169/N", "atom2_id": "///B/184/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2852, "atom2_serNum": 2967, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/169/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2864, "atom2_serNum": 2880, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/170/NE", "atom2_id": "///B/172/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2867, "atom2_serNum": 2913, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/170/NH2", "atom2_id": "///B/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2868, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/171/N", "atom2_id": "///B/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2871, "atom2_serNum": 2941, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/171/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2871, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/171/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2881, "atom2_serNum": 2930, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///B/173/N", "atom2_id": "///B/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2889, "atom2_serNum": 2948, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/173/NE1", "atom2_id": "///B/181/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2908, "atom2_serNum": 2927, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/176/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2923, "atom2_serNum": 2932, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///B/178/ND1", "atom2_id": "///B/179/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2991, "atom2_serNum": 3149, "donAcc_type": "acceptable", "distance": 2.270, "atom1_id": "///B/187/ND1", "atom2_id": "///B/208/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2991, "atom2_serNum": 3188, "donAcc_type": "acceptable", "distance": 3.541, "atom1_id": "///B/187/ND1", "atom2_id": "///B/214/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2994, "atom2_serNum": 3137, "donAcc_type": "acceptable", "distance": 3.227, "atom1_id": "///B/187/NE2", "atom2_id": "///B/206/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 3000, "atom2_serNum": 3161, "donAcc_type": "acceptable", "distance": 2.311, "atom1_id": "///B/188/OG1", "atom2_id": "///B/210/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 3014, "atom2_serNum": 3150, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///B/190/O", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 3029, "atom2_serNum": 3141, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/192/N", "atom2_id": "///B/207/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 3038, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/193/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3045, "atom2_serNum": 3394, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///B/193/NH2", "atom2_id": "///B/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3054, "atom2_serNum": 3127, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/195/N", "atom2_id": "///B/205/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3057, "atom2_serNum": 3124, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/195/O", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3067, "atom2_serNum": 3111, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/197/N", "atom2_id": "///B/203/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3091, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///B/200/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3100, "atom2_serNum": 3234, "donAcc_type": "acceptable", "distance": 2.444, "atom1_id": "///B/201/O", "atom2_id": "///B/218/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3116, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/204/N", "atom2_id": "///B/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3119, "atom2_serNum": 3200, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/204/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3132, "atom2_serNum": 3184, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/206/N", "atom2_id": "///B/214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3135, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/206/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3137, "atom2_serNum": 3208, "donAcc_type": "acceptable", "distance": 2.456, "atom1_id": "///B/206/OG", "atom2_id": "///B/216/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3144, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/208/N", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3147, "atom2_serNum": 3162, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///B/208/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3149, "atom2_serNum": 3171, "donAcc_type": "acceptable", "distance": 3.340, "atom1_id": "///B/208/OG", "atom2_id": "///B/212/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3154, "atom2_serNum": 3160, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/210/N", "atom2_id": "///B/210/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3160, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///B/210/OD1", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3160, "atom2_serNum": 3171, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///B/210/OD1", "atom2_id": "///B/212/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3165, "atom2_serNum": 3316, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/211/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3173, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/213/N", "atom2_id": "///B/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3176, "atom2_serNum": 3300, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/213/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3190, "atom2_serNum": 3274, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///B/214/NH1", "atom2_id": "///B/223/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3192, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/215/N", "atom2_id": "///B/225/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3195, "atom2_serNum": 3276, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/215/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3195, "atom2_serNum": 3284, "donAcc_type": "standard", "distance": 3.636, "atom1_id": "///B/215/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3214, "atom2_serNum": 3259, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///B/217/N", "atom2_id": "///B/222/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3217, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/217/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3217, "atom2_serNum": 3252, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3217, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///B/217/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3221, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///B/217/OE1", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3221, "atom2_serNum": 3251, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///B/217/OE1", "atom2_id": "///B/220/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3290, "atom2_serNum": 3658, "donAcc_type": "acceptable", "distance": 3.326, "atom1_id": "///B/225/ND1", "atom2_id": "///B/279/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3293, "atom2_serNum": 3662, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/225/NE2", "atom2_id": "///B/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3309, "atom2_serNum": 3335, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///B/228/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3319, "atom2_serNum": 3335, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///B/229/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3384, "atom2_serNum": 3518, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///B/245/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3391, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/247/N", "atom2_id": "///B/261/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3400, "atom2_serNum": 3504, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///B/248/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3416, "atom2_serNum": 3494, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/250/N", "atom2_id": "///B/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3419, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///B/250/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3432, "atom2_serNum": 3481, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/252/N", "atom2_id": "///B/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3435, "atom2_serNum": 3470, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/252/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3435, "atom2_serNum": 3478, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///B/252/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3459, "atom2_serNum": 3831, "donAcc_type": "questionable", "distance": 2.967, "atom1_id": "///B/254/OE1", "atom2_id": "///B/299/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3464, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/255/O", "atom2_id": "///B/272/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3473, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///B/256/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3484, "atom2_serNum": 3581, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/258/N", "atom2_id": "///B/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3487, "atom2_serNum": 3578, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/258/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3496, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/260/N", "atom2_id": "///B/269/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3499, "atom2_serNum": 3558, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/260/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3515, "atom2_serNum": 3530, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///B/262/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3515, "atom2_serNum": 3533, "donAcc_type": "questionable", "distance": 3.133, "atom1_id": "///B/262/O", "atom2_id": "///B/265/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3524, "atom2_serNum": 3526, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/263/OD1", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3525, "atom2_serNum": 4244, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///B/263/OD2", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3533, "atom2_serNum": 3544, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/265/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3540, "atom2_serNum": 3728, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/266/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3551, "atom2_serNum": 3718, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/268/N", "atom2_id": "///B/286/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3554, "atom2_serNum": 3715, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/268/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3570, "atom2_serNum": 3700, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/270/N", "atom2_id": "///B/284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3573, "atom2_serNum": 3686, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///B/270/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3573, "atom2_serNum": 3697, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/270/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3589, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/272/N", "atom2_id": "///B/281/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3592, "atom2_serNum": 3667, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/272/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3606, "atom2_serNum": 3653, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/274/N", "atom2_id": "///B/279/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3609, "atom2_serNum": 3641, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/274/O", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3612, "atom2_serNum": 3614, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/274/OD1", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3617, "atom2_serNum": 3649, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/275/O", "atom2_id": "///B/278/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3704, "atom2_serNum": 4028, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/284/OE1", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3761, "atom2_serNum": 3903, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/291/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3774, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/293/N", "atom2_id": "///B/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3791, "atom2_serNum": 3886, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/294/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3803, "atom2_serNum": 3868, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/296/N", "atom2_id": "///B/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3806, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/296/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3819, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/298/N", "atom2_id": "///B/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3822, "atom2_serNum": 3853, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3826, "atom2_serNum": 3873, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///B/298/OE1", "atom2_id": "///B/304/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3827, "atom2_serNum": 3842, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///B/298/OE2", "atom2_id": "///B/300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3828, "atom2_serNum": 3835, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/299/N", "atom2_id": "///B/299/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3847, "atom2_serNum": 3989, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///B/301/O", "atom2_id": "///B/318/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3847, "atom2_serNum": 3992, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/301/O", "atom2_id": "///B/318/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3851, "atom2_serNum": 3992, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/301/OE1", "atom2_id": "///B/318/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3857, "atom2_serNum": 3973, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/303/N", "atom2_id": "///B/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3860, "atom2_serNum": 3970, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/303/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3879, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/305/N", "atom2_id": "///B/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3882, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/305/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3894, "atom2_serNum": 3943, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/307/N", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3920, "atom2_serNum": 4167, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///B/310/O", "atom2_id": "///B/341/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3926, "atom2_serNum": 3933, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/311/N", "atom2_id": "///B/311/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3965, "atom2_serNum": 4057, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///B/316/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3982, "atom2_serNum": 4045, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/318/N", "atom2_id": "///B/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3985, "atom2_serNum": 4000, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///B/318/O", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3985, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/318/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 4000, "atom2_serNum": 4022, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/320/N", "atom2_id": "///B/323/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 4003, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///B/320/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 4011, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///B/322/N", "atom2_id": "///B/322/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 4054, "atom2_serNum": 4056, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///B/326/O", "atom2_id": "///B/326/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 4083, "atom2_serNum": 4108, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 4089, "atom2_serNum": 4117, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 4096, "atom2_serNum": 4126, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 4103, "atom2_serNum": 4133, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 4103, "atom2_serNum": 4138, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///B/333/O", "atom2_id": "///B/337/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 4111, "atom2_serNum": 4139, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 4120, "atom2_serNum": 4143, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4129, "atom2_serNum": 4150, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/336/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4136, "atom2_serNum": 4158, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/337/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 4142, "atom2_serNum": 4169, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/338/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4146, "atom2_serNum": 4173, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/339/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4146, "atom2_serNum": 4180, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/339/O", "atom2_id": "///B/343/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4153, "atom2_serNum": 4173, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/340/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4153, "atom2_serNum": 4181, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/340/O", "atom2_id": "///B/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4184, "atom2_serNum": 4216, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/344/O", "atom2_id": "///B/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4189, "atom2_serNum": 4224, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///B/344/NE1", "atom2_id": "///B/348/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4211, "atom2_serNum": 4234, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///B/347/O", "atom2_id": "///B/350/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4232, "atom2_serNum": 4234, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///B/350/O", "atom2_id": "///B/350/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4247, "atom2_serNum": 4267, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///B/353/O", "atom2_id": "///B/356/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4247, "atom2_serNum": 4268, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/353/O", "atom2_id": "///B/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4249, "atom2_serNum": 4255, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///B/354/N", "atom2_id": "///B/354/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4252, "atom2_serNum": 4279, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/354/O", "atom2_id": "///B/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4260, "atom2_serNum": 4284, "donAcc_type": "acceptable", "distance": 2.391, "atom1_id": "///B/355/O", "atom2_id": "///B/358/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4265, "atom2_serNum": 4290, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///B/356/O", "atom2_id": "///B/359/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4271, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/357/O", "atom2_id": "///B/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4338, "atom2_serNum": 5708, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/1/O6", "atom2_id": "///C/72/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 448, "atom1_serNum": 4339, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/1/N1", "atom2_id": "///C/72/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 4341, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/1/N2", "atom2_id": "///C/72/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 4358, "atom2_serNum": 5688, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/2/O2", "atom2_id": "///C/71/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 4359, "atom2_serNum": 5686, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/2/N3", "atom2_id": "///C/71/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 4361, "atom2_serNum": 5685, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/2/N4", "atom2_id": "///C/71/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 4378, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///C/3/O2", "atom2_id": "///C/70/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 4379, "atom2_serNum": 5663, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/3/N3", "atom2_id": "///C/70/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 4381, "atom2_serNum": 5662, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/3/N4", "atom2_id": "///C/70/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 4398, "atom2_serNum": 5642, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///C/4/O2", "atom2_id": "///C/69/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 4399, "atom2_serNum": 5640, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/4/N3", "atom2_id": "///C/69/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 4401, "atom2_serNum": 5639, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/4/N4", "atom2_id": "///C/69/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 4421, "atom2_serNum": 5619, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/5/O6", "atom2_id": "///C/68/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 4422, "atom2_serNum": 5617, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/5/N1", "atom2_id": "///C/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 4424, "atom2_serNum": 5616, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///C/5/N2", "atom2_id": "///C/68/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 4444, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/6/O6", "atom2_id": "///C/67/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 4444, "atom2_serNum": 5599, "donAcc_type": "questionable", "distance": 2.562, "atom1_id": "///C/6/O6", "atom2_id": "///C/67/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 4447, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/6/N2", "atom2_id": "///C/67/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 4460, "atom2_serNum": 5207, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///C/7/O2'", "atom2_id": "///C/49/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 4467, "atom2_serNum": 5579, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/7/N6", "atom2_id": "///C/66/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 4468, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/7/N1", "atom2_id": "///C/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 4482, "atom2_serNum": 4766, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///C/8/O2'", "atom2_id": "///C/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 4482, "atom2_serNum": 5158, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///C/8/O2'", "atom2_id": "///C/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 4486, "atom2_serNum": 4614, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/8/O2", "atom2_id": "///C/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 4487, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/8/N3", "atom2_id": "///C/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 4493, "atom2_serNum": 4539, "donAcc_type": "questionable", "distance": 2.917, "atom1_id": "///C/9/OP1", "atom2_id": "///C/11/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 4498, "atom2_serNum": 5144, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///C/9/O4'", "atom2_id": "///C/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 4502, "atom2_serNum": 4528, "donAcc_type": "acceptable", "distance": 2.402, "atom1_id": "///C/9/O2'", "atom2_id": "///C/10/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 4502, "atom2_serNum": 4554, "donAcc_type": "acceptable", "distance": 3.779, "atom1_id": "///C/9/O2'", "atom2_id": "///C/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 4515, "atom2_serNum": 5125, "donAcc_type": "acceptable", "distance": 3.407, "atom1_id": "///C/10/OP1", "atom2_id": "///C/45/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 4531, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/10/O6", "atom2_id": "///C/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 4531, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 2.303, "atom1_id": "///C/10/O6", "atom2_id": "///C/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 4532, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/10/N1", "atom2_id": "///C/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 4534, "atom2_serNum": 4852, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///C/10/N2", "atom2_id": "///C/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 4551, "atom2_serNum": 4835, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/11/O2", "atom2_id": "///C/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 4552, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/11/N3", "atom2_id": "///C/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 4554, "atom2_serNum": 4832, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/11/N4", "atom2_id": "///C/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 4572, "atom2_serNum": 4811, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/12/N3", "atom2_id": "///C/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 4574, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/12/O4", "atom2_id": "///C/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 4591, "atom2_serNum": 4790, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///C/13/O2", "atom2_id": "///C/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 4592, "atom2_serNum": 4788, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/13/N3", "atom2_id": "///C/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 4594, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/13/N4", "atom2_id": "///C/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 4614, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///C/14/N6", "atom2_id": "///C/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 4615, "atom2_serNum": 4758, "donAcc_type": "acceptable", "distance": 3.500, "atom1_id": "///C/14/N1", "atom2_id": "///C/21/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 4637, "atom2_serNum": 5195, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///C/15/N1", "atom2_id": "///C/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 4639, "atom2_serNum": 5195, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///C/15/N2", "atom2_id": "///C/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 493, "atom1_serNum": 4639, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///C/15/N2", "atom2_id": "///C/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 494, "atom1_serNum": 4644, "atom2_serNum": 4683, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///C/16/OP2", "atom2_id": "///C/18/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 4644, "atom2_serNum": 5453, "donAcc_type": "questionable", "distance": 2.845, "atom1_id": "///C/16/OP2", "atom2_id": "///C/60/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 4700, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/18/N1", "atom2_id": "///C/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 497, "atom1_serNum": 4702, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 2.477, "atom1_id": "///C/18/N2", "atom2_id": "///C/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 498, "atom1_serNum": 4702, "atom2_serNum": 5400, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///C/18/N2", "atom2_id": "///C/58/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 4722, "atom2_serNum": 5369, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/19/O6", "atom2_id": "///C/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 4723, "atom2_serNum": 5367, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/19/N1", "atom2_id": "///C/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 4725, "atom2_serNum": 5366, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///C/19/N2", "atom2_id": "///C/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 502, "atom1_serNum": 4765, "atom2_serNum": 5148, "donAcc_type": "acceptable", "distance": 2.508, "atom1_id": "///C/21/N6", "atom2_id": "///C/46/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 503, "atom1_serNum": 4784, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/22/N7", "atom2_id": "///C/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 4787, "atom2_serNum": 5158, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/22/O6", "atom2_id": "///C/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 4875, "atom2_serNum": 5109, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/26/N6", "atom2_id": "///C/44/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 4876, "atom2_serNum": 5110, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/26/N1", "atom2_id": "///C/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 507, "atom1_serNum": 4895, "atom2_serNum": 5088, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/27/N3", "atom2_id": "///C/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 4897, "atom2_serNum": 5087, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/27/O4", "atom2_id": "///C/43/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 4914, "atom2_serNum": 5067, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///C/28/O2", "atom2_id": "///C/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 510, "atom1_serNum": 4915, "atom2_serNum": 5065, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/28/N3", "atom2_id": "///C/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 4917, "atom2_serNum": 5064, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/28/N4", "atom2_id": "///C/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 4937, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///C/29/N6", "atom2_id": "///C/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 4938, "atom2_serNum": 5042, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/29/N1", "atom2_id": "///C/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 4959, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/30/O6", "atom2_id": "///C/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 4960, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/30/N1", "atom2_id": "///C/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 4962, "atom2_serNum": 5021, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/30/N2", "atom2_id": "///C/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 4982, "atom2_serNum": 5004, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/31/N6", "atom2_id": "///C/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 4983, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/31/N1", "atom2_id": "///C/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 4997, "atom2_serNum": 5013, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///C/39/O2'", "atom2_id": "///C/40/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 520, "atom1_serNum": 5017, "atom2_serNum": 5033, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///C/40/O2'", "atom2_id": "///C/41/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 521, "atom1_serNum": 5080, "atom2_serNum": 5098, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///C/43/O2'", "atom2_id": "///C/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 5182, "atom2_serNum": 5222, "donAcc_type": "questionable", "distance": 2.865, "atom1_id": "///C/48/OP1", "atom2_id": "///C/50/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 5191, "atom2_serNum": 5202, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///C/48/O2'", "atom2_id": "///C/49/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 524, "atom1_serNum": 5191, "atom2_serNum": 5422, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///C/48/O2'", "atom2_id": "///C/59/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 5215, "atom2_serNum": 5559, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///C/49/O2", "atom2_id": "///C/65/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 5216, "atom2_serNum": 5557, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/49/N3", "atom2_id": "///C/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 5218, "atom2_serNum": 5556, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/49/N4", "atom2_id": "///C/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 528, "atom1_serNum": 5238, "atom2_serNum": 5536, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/50/N6", "atom2_id": "///C/64/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 5239, "atom2_serNum": 5534, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/50/N1", "atom2_id": "///C/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 5260, "atom2_serNum": 5516, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/51/O6", "atom2_id": "///C/63/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 5261, "atom2_serNum": 5514, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/51/N1", "atom2_id": "///C/63/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 532, "atom1_serNum": 5263, "atom2_serNum": 5513, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/51/N2", "atom2_id": "///C/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 533, "atom1_serNum": 5283, "atom2_serNum": 5496, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/52/O6", "atom2_id": "///C/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 5284, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/52/N1", "atom2_id": "///C/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 5286, "atom2_serNum": 5493, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///C/52/N2", "atom2_id": "///C/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 5306, "atom2_serNum": 5476, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/53/O6", "atom2_id": "///C/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 5307, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/53/N1", "atom2_id": "///C/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 5309, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///C/53/N2", "atom2_id": "///C/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 5326, "atom2_serNum": 5411, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/54/O2", "atom2_id": "///C/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 5327, "atom2_serNum": 5408, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///C/54/N3", "atom2_id": "///C/58/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 541, "atom1_serNum": 5347, "atom2_serNum": 5396, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/55/N3", "atom2_id": "///C/58/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 542, "atom1_serNum": 5402, "atom2_serNum": 5441, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///C/58/O3'", "atom2_id": "///C/60/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 543, "atom1_serNum": 5404, "atom2_serNum": 5440, "donAcc_type": "acceptable", "distance": 2.520, "atom1_id": "///C/58/O2'", "atom2_id": "///C/60/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 544, "atom1_serNum": 5404, "atom2_serNum": 5476, "donAcc_type": "acceptable", "distance": 3.390, "atom1_id": "///C/58/O2'", "atom2_id": "///C/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 545, "atom1_serNum": 5440, "atom2_serNum": 5476, "donAcc_type": "standard", "distance": 2.296, "atom1_id": "///C/60/OP1", "atom2_id": "///C/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "8d9k", "num_aaChains": 2, "aaChains": "A=214,B=332", "num_naChains": 1, "naChains": "C=65", "num_atoms": 5708, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }