{ "num_pairs": 29, "pairs": [ { "index": 1, "nt1": "///S/5", "nt2": "///S/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.522, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.845, "chi2": -171.522, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.096, "C1C1_dist": 10.550, "N1N9_dist": 8.764, "C6C8_dist": 9.675, "CNNC_torsion": 14.008, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 5.877, "planarity": 0.149, "simple_Shear": -0.214, "simple_Stretch": -0.354, "simple_Buckle": -2.066, "simple_Propeller": 5.501, "bp_simpleParams": [ -0.214, -0.354, -0.648, -2.066, 5.501, -2.112 ], "bp_params": [ -0.208, -0.358, -0.648, -2.161, 5.465, -2.114 ], "frame": { "rmsd": null, "origin": [ 125.229, 107.110, 108.142 ], "x_axis": [ -0.242, -0.937, -0.252 ], "y_axis": [ -0.665, 0.349, -0.660 ], "z_axis": [ 0.706, 0.007, -0.708 ], "quaternion": [ 0.316, -0.528, 0.758, -0.215 ] } }, { "index": 2, "nt1": "///S/6", "nt2": "///S/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.496, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.316, "chi2": 154.975, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 48.147, "C1C1_dist": 10.889, "N1N9_dist": 8.961, "C6C8_dist": 9.804, "CNNC_torsion": 2.382, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 3.205, "planarity": 0.065, "simple_Shear": -0.050, "simple_Stretch": -0.118, "simple_Buckle": 1.810, "simple_Propeller": -2.645, "bp_simpleParams": [ -0.050, -0.118, -0.322, 1.810, -2.645, -2.984 ], "bp_params": [ -0.049, -0.118, -0.322, 1.837, -2.626, -2.985 ], "frame": { "rmsd": null, "origin": [ 128.157, 104.643, 106.742 ], "x_axis": [ -0.773, -0.472, -0.423 ], "y_axis": [ -0.353, 0.875, -0.331 ], "z_axis": [ 0.526, -0.107, -0.843 ], "quaternion": [ 0.254, -0.221, 0.934, -0.117 ] } }, { "index": 3, "nt1": "///S/7", "nt2": "///S/65", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.154, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.482, "chi2": 167.645, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.004, "C1C1_dist": 10.722, "N1N9_dist": 8.840, "C6C8_dist": 9.717, "CNNC_torsion": 6.459, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 3.025, "planarity": 0.087, "simple_Shear": 0.092, "simple_Stretch": -0.207, "simple_Buckle": -1.709, "simple_Propeller": 2.497, "bp_simpleParams": [ 0.092, -0.207, -0.304, -1.709, 2.497, -1.971 ], "bp_params": [ 0.091, -0.207, -0.304, -1.700, 2.503, -1.971 ], "frame": { "rmsd": null, "origin": [ 129.082, 103.134, 103.803 ], "x_axis": [ -0.841, 0.296, -0.453 ], "y_axis": [ 0.342, 0.940, -0.020 ], "z_axis": [ 0.420, -0.172, -0.891 ], "quaternion": [ 0.228, 0.166, 0.958, -0.050 ] } }, { "index": 4, "nt1": "///S/8", "nt2": "///S/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.065, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 55.739, "chi2": -169.423, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.473, "C1C1_dist": 10.120, "N1N9_dist": 8.506, "C6C8_dist": 9.565, "CNNC_torsion": 3.140, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.87],N1-N3(imino)[2.61]", "interBase_angle": 2.412, "planarity": 0.046, "simple_Shear": -0.096, "simple_Stretch": -0.355, "simple_Buckle": -2.354, "simple_Propeller": -0.528, "bp_simpleParams": [ -0.096, -0.355, -0.235, -2.354, -0.528, 4.160 ], "bp_params": [ -0.095, -0.356, -0.235, -2.352, -0.537, 4.159 ], "frame": { "rmsd": null, "origin": [ 129.678, 101.513, 100.877 ], "x_axis": [ -0.595, 0.772, -0.223 ], "y_axis": [ 0.746, 0.634, 0.205 ], "z_axis": [ 0.300, -0.045, -0.953 ], "quaternion": [ 0.147, 0.425, 0.892, 0.045 ] } }, { "index": 5, "nt1": "///S/9", "nt2": "///S/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.064, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 54.797, "chi2": -170.985, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.072, "C1C1_dist": 10.266, "N1N9_dist": 8.636, "C6C8_dist": 9.633, "CNNC_torsion": 4.662, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.74],N2(amino)-O2(carbonyl)[2.54]", "interBase_angle": 1.903, "planarity": 0.131, "simple_Shear": -0.232, "simple_Stretch": -0.363, "simple_Buckle": -0.270, "simple_Propeller": -1.884, "bp_simpleParams": [ -0.232, -0.363, -0.557, -0.270, -1.884, 3.419 ], "bp_params": [ -0.225, -0.367, -0.557, -0.235, -1.889, 3.420 ], "frame": { "rmsd": null, "origin": [ 129.221, 100.792, 97.468 ], "x_axis": [ -0.135, 0.991, -0.023 ], "y_axis": [ 0.954, 0.136, 0.268 ], "z_axis": [ 0.269, 0.014, -0.963 ], "quaternion": [ 0.098, 0.650, 0.747, 0.095 ] } }, { "index": 6, "nt1": "///S/10", "nt2": "///S/62", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.233, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.396, "chi2": -169.702, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.021, "C1C1_dist": 8.215, "N1N9_dist": 6.728, "C6C8_dist": 8.046, "CNNC_torsion": -14.418, "hbonds_num": 5, "hbonds_desc": "O2(carbonyl)*O2(carbonyl)[2.75],O2(carbonyl)-N3(imino)[3.40],N3(imino)*N3(imino)[2.84],N3(imino)-O4(carbonyl)[3.43],O4(carbonyl)*O4(carbonyl)[2.79]", "unusual_base2base_hbonds": 3, "interBase_angle": 21.043, "planarity": 0.266, "simple_Shear": 0.372, "simple_Stretch": -1.886, "simple_Buckle": 18.682, "simple_Propeller": -9.686, "bp_simpleParams": [ 0.372, -1.886, 0.679, 18.682, -9.686, 10.802 ], "bp_params": [ 0.314, -1.897, 0.679, 18.407, -10.198, 10.707 ], "frame": { "rmsd": null, "origin": [ 128.903, 100.923, 94.496 ], "x_axis": [ 0.440, 0.896, 0.054 ], "y_axis": [ 0.779, -0.411, 0.472 ], "z_axis": [ 0.445, -0.166, -0.880 ], "quaternion": [ 0.193, 0.826, 0.507, 0.151 ] } }, { "index": 7, "nt1": "///S/11", "nt2": "///S/60", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -170.694, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.602, "chi2": 57.929, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 33.447, "C1C1_dist": 8.790, "N1N9_dist": 7.054, "C6C8_dist": 6.936, "CNNC_torsion": -1.317, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*N7[2.84],N4(amino)-O6(carbonyl)[2.83]", "unusual_base2base_hbonds": 1, "interBase_angle": 21.140, "planarity": 0.292, "simple_Shear": -1.834, "simple_Stretch": 1.209, "simple_Buckle": -6.161, "simple_Propeller": -20.223, "bp_simpleParams": [ -1.834, 1.209, 0.816, -6.161, -20.223, -74.831 ], "bp_params": [ 0.561, 2.124, 0.816, -21.130, -0.668, -73.888 ], "frame": { "rmsd": null, "origin": [ 130.181, 104.004, 90.937 ], "x_axis": [ 0.816, -0.473, 0.332 ], "y_axis": [ -0.458, -0.880, -0.128 ], "z_axis": [ 0.353, -0.048, -0.935 ], "quaternion": [ -0.021, 0.953, -0.244, 0.180 ] } }, { "index": 8, "nt1": "///S/12", "nt2": "///S/59", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.550, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.264, "chi2": 155.568, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.077, "C1C1_dist": 10.759, "N1N9_dist": 8.851, "C6C8_dist": 9.717, "CNNC_torsion": -5.742, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 3.078, "planarity": 0.073, "simple_Shear": 0.045, "simple_Stretch": -0.209, "simple_Buckle": -1.877, "simple_Propeller": -2.439, "bp_simpleParams": [ 0.045, -0.209, 0.335, -1.877, -2.439, -2.314 ], "bp_params": [ 0.045, -0.209, 0.335, -1.875, -2.441, -2.314 ], "frame": { "rmsd": null, "origin": [ 130.007, 104.957, 87.730 ], "x_axis": [ 0.837, -0.256, 0.483 ], "y_axis": [ -0.267, -0.963, -0.048 ], "z_axis": [ 0.478, -0.089, -0.874 ], "quaternion": [ 0.011, 0.958, -0.136, 0.251 ] } }, { "index": 9, "nt1": "///S/13", "nt2": "///S/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.949, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.293, "chi2": -164.258, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.846, "C1C1_dist": 10.215, "N1N9_dist": 8.724, "C6C8_dist": 9.762, "CNNC_torsion": 0.496, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 9.683, "planarity": 0.116, "simple_Shear": -0.242, "simple_Stretch": -0.232, "simple_Buckle": -7.419, "simple_Propeller": -6.223, "bp_simpleParams": [ -0.242, -0.232, -0.451, -7.419, -6.223, 4.226 ], "bp_params": [ -0.237, -0.236, -0.451, -7.301, -6.361, 4.224 ], "frame": { "rmsd": null, "origin": [ 132.456, 105.909, 85.798 ], "x_axis": [ 0.411, -0.669, 0.619 ], "y_axis": [ -0.545, -0.725, -0.421 ], "z_axis": [ 0.731, -0.164, -0.663 ], "quaternion": [ -0.077, 0.837, -0.363, 0.403 ] } }, { "index": 10, "nt1": "///S/14", "nt2": "///S/57", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.659, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.164, "chi2": -176.832, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.270, "C1C1_dist": 10.066, "N1N9_dist": 8.453, "C6C8_dist": 9.522, "CNNC_torsion": 0.955, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.57],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 1.597, "planarity": 0.023, "simple_Shear": 0.077, "simple_Stretch": -0.382, "simple_Buckle": 1.480, "simple_Propeller": 0.601, "bp_simpleParams": [ 0.077, -0.382, -0.117, 1.480, 0.601, 5.369 ], "bp_params": [ 0.076, -0.382, -0.117, 1.481, 0.598, 5.369 ], "frame": { "rmsd": null, "origin": [ 135.485, 106.031, 84.458 ], "x_axis": [ 0.035, -0.949, 0.313 ], "y_axis": [ -0.729, -0.238, -0.642 ], "z_axis": [ 0.684, -0.206, -0.700 ], "quaternion": [ -0.155, 0.702, -0.597, 0.355 ] } }, { "index": 11, "nt1": "///S/15", "nt2": "///S/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.015, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.806, "chi2": -169.248, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.290, "C1C1_dist": 10.502, "N1N9_dist": 8.857, "C6C8_dist": 9.827, "CNNC_torsion": 8.962, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 4.236, "planarity": 0.132, "simple_Shear": -0.196, "simple_Stretch": -0.218, "simple_Buckle": -4.077, "simple_Propeller": 1.151, "bp_simpleParams": [ -0.196, -0.218, -0.679, -4.077, 1.151, 0.927 ], "bp_params": [ -0.193, -0.221, -0.679, -4.094, 1.086, 0.927 ], "frame": { "rmsd": null, "origin": [ 139.036, 105.329, 83.233 ], "x_axis": [ -0.333, -0.941, -0.052 ], "y_axis": [ -0.573, 0.246, -0.782 ], "z_axis": [ 0.749, -0.231, -0.621 ], "quaternion": [ 0.270, -0.510, 0.742, -0.341 ] } }, { "index": 12, "nt1": "///S/16", "nt2": "///S/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.588, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.364, "chi2": -173.371, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.879, "C1C1_dist": 10.043, "N1N9_dist": 8.529, "C6C8_dist": 9.630, "CNNC_torsion": 3.120, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.65],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 1.460, "planarity": 0.042, "simple_Shear": 0.141, "simple_Stretch": -0.275, "simple_Buckle": 1.239, "simple_Propeller": -0.772, "bp_simpleParams": [ 0.141, -0.275, -0.207, 1.239, -0.772, 7.317 ], "bp_params": [ 0.138, -0.276, -0.207, 1.233, -0.783, 7.317 ], "frame": { "rmsd": null, "origin": [ 141.782, 103.545, 81.934 ], "x_axis": [ -0.686, -0.687, -0.240 ], "y_axis": [ -0.407, 0.636, -0.656 ], "z_axis": [ 0.603, -0.352, -0.716 ], "quaternion": [ 0.242, -0.314, 0.871, -0.289 ] } }, { "index": 13, "nt1": "///S/17", "nt2": "///S/54", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -179.097, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.608, "chi2": -174.347, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.367, "C1C1_dist": 9.174, "N1N9_dist": 8.109, "C6C8_dist": 8.677, "CNNC_torsion": -48.621, "hbonds_num": 4, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.63],O2'(hydroxyl)-N1[3.12],N2(amino)-N7[2.77],N3-N6(amino)[2.55]", "interBase_angle": 0.599, "planarity": 0.106, "simple_Shear": 7.269, "simple_Stretch": 2.033, "simple_Buckle": -0.449, "simple_Propeller": 0.396, "bp_simpleParams": [ 7.269, 2.033, 0.509, -0.449, 0.396, 4.013 ], "bp_params": [ 6.407, -3.991, 0.509, -0.011, 0.599, 4.013 ], "frame": { "rmsd": null, "origin": [ 143.364, 101.801, 79.689 ], "x_axis": [ -0.766, 0.196, -0.612 ], "y_axis": [ 0.369, 0.914, -0.169 ], "z_axis": [ 0.526, -0.356, -0.772 ], "quaternion": [ 0.306, 0.152, 0.929, -0.141 ] } }, { "index": 14, "nt1": "///S/18", "nt2": "///S/45", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -164.260, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 92.133, "chi2": -178.295, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 162.934, "C1C1_dist": 5.030, "N1N9_dist": 6.603, "C6C8_dist": 9.043, "CNNC_torsion": 25.174, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N3[2.33]", "interBase_angle": 29.586, "planarity": 0.386, "simple_Shear": -0.502, "simple_Stretch": 7.226, "simple_Buckle": -22.145, "simple_Propeller": 19.620, "bp_simpleParams": [ -0.502, 7.226, 0.175, -22.145, 19.620, 159.015 ], "bp_params": [ -2.812, 6.676, 0.175, -27.315, 11.369, 158.517 ], "frame": { "rmsd": null, "origin": [ 151.773, 94.729, 78.652 ], "x_axis": [ 0.246, -0.507, 0.826 ], "y_axis": [ -0.095, 0.836, 0.541 ], "z_axis": [ -0.965, -0.211, 0.158 ], "quaternion": [ 0.748, 0.251, -0.598, -0.138 ] } }, { "index": 15, "nt1": "///S/20", "nt2": "///S/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.216, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.618, "chi2": -177.528, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.745, "C1C1_dist": 10.563, "N1N9_dist": 8.818, "C6C8_dist": 9.755, "CNNC_torsion": 3.849, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 2.039, "planarity": 0.070, "simple_Shear": 0.113, "simple_Stretch": -0.266, "simple_Buckle": 1.954, "simple_Propeller": 0.582, "bp_simpleParams": [ 0.113, -0.266, -0.362, 1.954, 0.582, -0.810 ], "bp_params": [ 0.111, -0.266, -0.362, 1.958, 0.568, -0.810 ], "frame": { "rmsd": null, "origin": [ 146.247, 89.006, 74.563 ], "x_axis": [ 0.262, -0.385, 0.885 ], "y_axis": [ -0.521, 0.715, 0.466 ], "z_axis": [ -0.812, -0.583, -0.013 ], "quaternion": [ 0.701, 0.374, -0.605, 0.049 ] } }, { "index": 16, "nt1": "///S/21", "nt2": "///S/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.227, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.648, "chi2": -174.545, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.694, "C1C1_dist": 10.326, "N1N9_dist": 8.754, "C6C8_dist": 9.780, "CNNC_torsion": 3.146, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 1.815, "planarity": 0.023, "simple_Shear": 0.188, "simple_Stretch": -0.239, "simple_Buckle": -1.082, "simple_Propeller": 1.457, "bp_simpleParams": [ 0.188, -0.239, 0.021, -1.082, 1.457, 2.511 ], "bp_params": [ 0.184, -0.242, 0.021, -1.061, 1.473, 2.511 ], "frame": { "rmsd": null, "origin": [ 144.736, 85.620, 74.014 ], "x_axis": [ -0.024, 0.086, 0.996 ], "y_axis": [ -0.559, 0.825, -0.084 ], "z_axis": [ -0.829, -0.559, 0.028 ], "quaternion": [ 0.676, 0.176, -0.674, 0.238 ] } }, { "index": 17, "nt1": "///S/22", "nt2": "///S/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.373, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.038, "chi2": -167.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.096, "C1C1_dist": 10.489, "N1N9_dist": 8.782, "C6C8_dist": 9.736, "CNNC_torsion": 3.602, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.78],N2(amino)-O2(carbonyl)[2.63]", "interBase_angle": 1.270, "planarity": 0.082, "simple_Shear": -0.192, "simple_Stretch": -0.280, "simple_Buckle": 0.449, "simple_Propeller": -1.188, "bp_simpleParams": [ -0.192, -0.280, -0.323, 0.449, -1.188, 0.914 ], "bp_params": [ -0.188, -0.283, -0.323, 0.466, -1.182, 0.914 ], "frame": { "rmsd": null, "origin": [ 143.194, 82.696, 74.740 ], "x_axis": [ -0.188, 0.496, 0.848 ], "y_axis": [ -0.548, 0.663, -0.509 ], "z_axis": [ -0.815, -0.560, 0.147 ], "quaternion": [ 0.637, 0.020, -0.653, 0.410 ] } }, { "index": 18, "nt1": "///S/23", "nt2": "///S/40", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.694, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.442, "chi2": -168.093, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.606, "C1C1_dist": 10.030, "N1N9_dist": 8.558, "C6C8_dist": 9.678, "CNNC_torsion": 5.470, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.68]", "interBase_angle": 5.307, "planarity": 0.080, "simple_Shear": -0.063, "simple_Stretch": -0.236, "simple_Buckle": -5.089, "simple_Propeller": 1.503, "bp_simpleParams": [ -0.063, -0.236, -0.384, -5.089, 1.503, 7.106 ], "bp_params": [ -0.062, -0.236, -0.384, -5.092, 1.493, 7.099 ], "frame": { "rmsd": null, "origin": [ 141.359, 80.378, 76.916 ], "x_axis": [ -0.355, 0.857, 0.374 ], "y_axis": [ -0.357, 0.246, -0.901 ], "z_axis": [ -0.864, -0.453, 0.219 ], "quaternion": [ 0.527, -0.213, -0.588, 0.576 ] } }, { "index": 19, "nt1": "///S/24", "nt2": "///S/39", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.490, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 75.898, "chi2": 176.119, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.547, "C1C1_dist": 10.296, "N1N9_dist": 8.766, "C6C8_dist": 9.643, "CNNC_torsion": 15.027, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.72],N3-N6(amino)[2.85]", "interBase_angle": 13.891, "planarity": 0.177, "simple_Shear": 3.698, "simple_Stretch": 0.428, "simple_Buckle": 6.548, "simple_Propeller": 12.250, "bp_simpleParams": [ 3.698, 0.428, -0.667, 6.548, 12.250, 0.950 ], "bp_params": [ 3.591, -0.982, -0.667, 10.633, 8.939, 0.949 ], "frame": { "rmsd": null, "origin": [ 139.206, 79.135, 78.649 ], "x_axis": [ -0.495, 0.794, -0.354 ], "y_axis": [ -0.081, -0.448, -0.890 ], "z_axis": [ -0.865, -0.412, 0.286 ], "quaternion": [ 0.293, -0.409, -0.436, 0.746 ] } }, { "index": 20, "nt1": "///S/25", "nt2": "///S/38", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -139.441, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.222, "chi2": -167.416, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 5.185, "C1C1_dist": 9.158, "N1N9_dist": 7.847, "C6C8_dist": 8.131, "CNNC_torsion": -172.886, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.97],N3-N6(amino)[2.95]", "interBase_angle": 15.514, "planarity": 0.241, "simple_Shear": 7.510, "simple_Stretch": 2.066, "simple_Buckle": 15.051, "simple_Propeller": 3.762, "bp_simpleParams": [ 7.510, 2.066, -0.823, 15.051, 3.762, -13.369 ], "bp_params": [ 6.331, -4.538, -0.823, 12.382, -9.347, -13.336 ], "frame": { "rmsd": null, "origin": [ 136.317, 78.085, 80.925 ], "x_axis": [ -0.488, 0.186, -0.853 ], "y_axis": [ 0.121, -0.953, -0.277 ], "z_axis": [ -0.864, -0.239, 0.443 ], "quaternion": [ 0.019, -0.505, -0.152, 0.849 ] } }, { "index": 21, "nt1": "///S/26", "nt2": "///S/37", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -165.853, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 0.331, "chi2": -177.757, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 84.725, "C1C1_dist": 9.547, "N1N9_dist": 8.082, "C6C8_dist": 8.225, "CNNC_torsion": 178.475, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.57],N6(amino)-N3[3.08]", "interBase_angle": 8.557, "planarity": 0.102, "simple_Shear": -7.404, "simple_Stretch": 2.257, "simple_Buckle": -3.291, "simple_Propeller": -7.898, "bp_simpleParams": [ -7.404, 2.257, 0.042, -3.291, -7.898, -25.531 ], "bp_params": [ -6.399, -4.355, 0.042, 4.095, -7.513, -25.568 ], "frame": { "rmsd": null, "origin": [ 133.397, 78.084, 82.745 ], "x_axis": [ -0.409, 0.369, -0.835 ], "y_axis": [ 0.181, -0.864, -0.470 ], "z_axis": [ -0.894, -0.344, 0.287 ], "quaternion": [ 0.059, -0.540, -0.255, 0.800 ] } }, { "index": 22, "nt1": "///S/27", "nt2": "///S/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.905, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.890, "chi2": -179.827, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.262, "C1C1_dist": 10.688, "N1N9_dist": 8.883, "C6C8_dist": 9.826, "CNNC_torsion": -1.135, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 4.712, "planarity": 0.089, "simple_Shear": -0.179, "simple_Stretch": -0.167, "simple_Buckle": -4.691, "simple_Propeller": 0.440, "bp_simpleParams": [ -0.179, -0.167, 0.143, -4.691, 0.440, -0.243 ], "bp_params": [ -0.177, -0.169, 0.143, -4.697, 0.373, -0.243 ], "frame": { "rmsd": null, "origin": [ 129.490, 77.769, 82.121 ], "x_axis": [ 0.119, -0.493, -0.862 ], "y_axis": [ 0.412, -0.765, 0.495 ], "z_axis": [ -0.903, -0.414, 0.112 ], "quaternion": [ 0.341, 0.666, -0.031, -0.663 ] } }, { "index": 23, "nt1": "///S/28", "nt2": "///S/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.716, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.330, "chi2": -171.843, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.667, "C1C1_dist": 10.656, "N1N9_dist": 8.864, "C6C8_dist": 9.765, "CNNC_torsion": -5.521, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 4.080, "planarity": 0.140, "simple_Shear": -0.088, "simple_Stretch": -0.255, "simple_Buckle": 2.402, "simple_Propeller": 3.298, "bp_simpleParams": [ -0.088, -0.255, 0.657, 2.402, 3.298, -0.750 ], "bp_params": [ -0.087, -0.256, 0.657, 2.386, 3.309, -0.750 ], "frame": { "rmsd": null, "origin": [ 125.688, 78.094, 81.244 ], "x_axis": [ 0.152, -0.835, -0.529 ], "y_axis": [ 0.411, -0.434, 0.802 ], "z_axis": [ -0.899, -0.339, 0.277 ], "quaternion": [ -0.499, -0.572, 0.185, 0.624 ] } }, { "index": 24, "nt1": "///S/29", "nt2": "///S/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 168.765, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.651, "chi2": -141.667, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.559, "C1C1_dist": 9.876, "N1N9_dist": 8.502, "C6C8_dist": 9.698, "CNNC_torsion": -2.584, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.70]", "interBase_angle": 5.297, "planarity": 0.100, "simple_Shear": 0.038, "simple_Stretch": -0.181, "simple_Buckle": 4.813, "simple_Propeller": 2.212, "bp_simpleParams": [ 0.038, -0.181, 0.528, 4.813, 2.212, 11.048 ], "bp_params": [ 0.037, -0.182, 0.528, 4.834, 2.166, 11.040 ], "frame": { "rmsd": null, "origin": [ 122.571, 76.644, 80.294 ], "x_axis": [ 0.380, -0.915, -0.138 ], "y_axis": [ 0.309, -0.015, 0.951 ], "z_axis": [ -0.872, -0.404, 0.277 ], "quaternion": [ 0.641, 0.529, -0.286, -0.477 ] } }, { "index": 25, "nt1": "///S/30", "nt2": "///S/32", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -164.675, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 107.746, "chi2": 60.620, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 26.355, "C1C1_dist": 8.929, "N1N9_dist": 8.285, "C6C8_dist": 9.773, "CNNC_torsion": -143.941, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.65],O2(carbonyl)-N2(amino)[3.08]", "interBase_angle": 33.586, "planarity": 0.379, "simple_Shear": 4.023, "simple_Stretch": 3.763, "simple_Buckle": 15.780, "simple_Propeller": 29.648, "bp_simpleParams": [ 4.023, 3.763, -0.283, 15.780, 29.648, -95.982 ], "bp_params": [ 0.858, -5.441, -0.283, 15.893, -29.587, -97.347 ], "frame": { "rmsd": null, "origin": [ 119.341, 75.347, 79.594 ], "x_axis": [ 0.348, 0.332, 0.877 ], "y_axis": [ -0.342, 0.916, -0.211 ], "z_axis": [ -0.873, -0.226, 0.432 ], "quaternion": [ 0.821, 0.004, -0.533, 0.205 ] } }, { "index": 26, "nt1": "///S/44", "nt2": "///S/53", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.559, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.411, "chi2": -171.161, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.250, "C1C1_dist": 10.747, "N1N9_dist": 8.875, "C6C8_dist": 9.719, "CNNC_torsion": 10.118, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.81]", "interBase_angle": 7.502, "planarity": 0.107, "simple_Shear": 0.122, "simple_Stretch": -0.190, "simple_Buckle": -4.662, "simple_Propeller": 5.877, "bp_simpleParams": [ 0.122, -0.190, -0.358, -4.662, 5.877, -4.043 ], "bp_params": [ 0.119, -0.192, -0.358, -4.567, 5.951, -4.045 ], "frame": { "rmsd": null, "origin": [ 149.737, 90.234, 76.602 ], "x_axis": [ 0.540, -0.817, 0.202 ], "y_axis": [ 0.223, -0.092, -0.970 ], "z_axis": [ 0.811, 0.569, 0.132 ], "quaternion": [ 0.629, -0.612, 0.242, -0.414 ] } }, { "index": 27, "nt1": "///S/45", "nt2": "///S/52", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.295, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.281, "chi2": -173.078, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.934, "C1C1_dist": 10.376, "N1N9_dist": 8.651, "C6C8_dist": 9.654, "CNNC_torsion": -0.369, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.71]", "interBase_angle": 6.975, "planarity": 0.085, "simple_Shear": -0.062, "simple_Stretch": -0.248, "simple_Buckle": -6.171, "simple_Propeller": -3.252, "bp_simpleParams": [ -0.062, -0.248, -0.364, -6.171, -3.252, 3.354 ], "bp_params": [ -0.062, -0.248, -0.364, -6.170, -3.253, 3.350 ], "frame": { "rmsd": null, "origin": [ 152.698, 91.321, 77.887 ], "x_axis": [ 0.320, -0.875, -0.363 ], "y_axis": [ -0.028, 0.375, -0.927 ], "z_axis": [ 0.947, 0.307, 0.095 ], "quaternion": [ 0.669, -0.461, 0.490, -0.316 ] } }, { "index": 28, "nt1": "///S/46", "nt2": "///S/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.195, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.341, "chi2": -163.013, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.228, "C1C1_dist": 10.643, "N1N9_dist": 8.859, "C6C8_dist": 9.783, "CNNC_torsion": -7.138, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 6.301, "planarity": 0.082, "simple_Shear": -0.168, "simple_Stretch": -0.223, "simple_Buckle": -0.370, "simple_Propeller": -6.290, "bp_simpleParams": [ -0.168, -0.223, 0.003, -0.370, -6.290, 0.199 ], "bp_params": [ -0.166, -0.225, 0.003, -0.291, -6.294, 0.199 ], "frame": { "rmsd": null, "origin": [ 155.629, 91.593, 78.800 ], "x_axis": [ 0.085, -0.555, -0.827 ], "y_axis": [ -0.191, 0.806, -0.560 ], "z_axis": [ 0.978, 0.206, -0.038 ], "quaternion": [ 0.681, -0.281, 0.663, -0.134 ] } }, { "index": 29, "nt1": "///S/47", "nt2": "///S/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.230, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.337, "chi2": -74.320, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 59.425, "C1C1_dist": 10.378, "N1N9_dist": 8.777, "C6C8_dist": 9.763, "CNNC_torsion": 3.267, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 7.173, "planarity": 0.093, "simple_Shear": 0.118, "simple_Stretch": -0.232, "simple_Buckle": 6.665, "simple_Propeller": 2.650, "bp_simpleParams": [ 0.118, -0.232, -0.147, 6.665, 2.650, 1.791 ], "bp_params": [ 0.116, -0.233, -0.147, 6.690, 2.588, 1.788 ], "frame": { "rmsd": null, "origin": [ 158.826, 91.652, 77.996 ], "x_axis": [ -0.004, -0.020, -1.000 ], "y_axis": [ -0.108, 0.994, -0.019 ], "z_axis": [ 0.994, 0.108, -0.007 ], "quaternion": [ 0.704, -0.045, 0.708, 0.032 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GAU", "nts_long": "///S/18,///S/45,///S/52", "planarity": 0.379 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GUUAGUCUGUGUG", "strand2": "CAAUCUGACACAA", "bp_type": "|||||..|||||.", "helix_form": ".AAA.x.AAAA.", "helical_rise": 2.846, "helical_rise_std": 0.544, "helical_radius": 8.708, "helical_radius_std": 1.082, "helical_axis": [ 0.484, -0.092, -0.870 ], "point1": [ 123.364, 105.041, 107.934 ], "point2": [ 139.892, 101.907, 78.192 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///S/5", "nt2": "///S/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.358, -0.648, -2.161, 5.465, -2.114 ], "step_params": [ 0.824, -2.592, 3.038, -5.493, 13.440, 40.548 ], "heli_params": [ -4.597, -1.557, 1.997, 18.684, 7.637, 42.965 ], "bp2_params": [ -0.049, -0.118, -0.322, 1.837, -2.626, -2.985 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.038, "simple_Twist": 39.953, "simple_hRise": 1.979, "simple_hTwist": 42.408 }, { "index": 2, "nt1": "///S/6", "nt2": "///S/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.049, -0.118, -0.322, 1.837, -2.626, -2.985 ], "step_params": [ 0.695, -1.010, 3.204, 3.105, 7.024, 44.907 ], "heli_params": [ -1.901, -0.635, 3.060, 9.116, -4.030, 45.525 ], "bp2_params": [ 0.091, -0.207, -0.304, -1.700, 2.503, -1.971 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.204, "simple_Twist": 44.086, "simple_hRise": 3.056, "simple_hTwist": 44.717 }, { "index": 3, "nt1": "///S/7", "nt2": "///S/65", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.207, -0.304, -1.700, 2.503, -1.971 ], "step_params": [ -0.306, -1.354, 3.102, -1.750, 10.484, 32.258 ], "heli_params": [ -3.816, 0.275, 2.562, 18.262, 3.048, 33.920 ], "bp2_params": [ -0.095, -0.356, -0.235, -2.352, -0.537, 4.159 ], "groove_widths": [ 16.296, null, 13.542, null ], "simple_Rise": 3.102, "simple_Twist": 32.795, "simple_hRise": 2.573, "simple_hTwist": 34.429 }, { "index": 4, "nt1": "///S/8", "nt2": "///S/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.356, -0.235, -2.352, -0.537, 4.159 ], "step_params": [ -0.053, -1.560, 3.148, 0.351, 3.843, 31.557 ], "heli_params": [ -3.506, 0.157, 2.942, 7.033, -0.643, 31.786 ], "bp2_params": [ -0.225, -0.367, -0.557, -0.235, -1.889, 3.420 ], "groove_widths": [ 16.049, 14.984, 15.851, 14.013 ], "simple_Rise": 3.148, "simple_Twist": 32.330, "simple_hRise": 2.947, "simple_hTwist": 32.554 }, { "index": 5, "nt1": "///S/9", "nt2": "///S/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.225, -0.367, -0.557, -0.235, -1.889, 3.420 ], "step_params": [ 0.123, -1.405, 2.638, -12.636, -8.588, 33.348 ], "heli_params": [ -1.226, -1.684, 2.690, -14.083, 20.721, 36.591 ], "bp2_params": [ 0.314, -1.897, 0.679, 18.407, -10.198, 10.707 ], "groove_widths": [ 14.904, 13.248, 15.377, 14.410 ], "simple_Rise": 2.638, "simple_Twist": 30.522, "simple_hRise": 2.673, "simple_hTwist": 34.051 }, { "index": 6, "nt1": "///S/10", "nt2": "///S/62", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.314, -1.897, 0.679, 18.407, -10.198, 10.707 ], "step_params": [ 0.848, -3.373, 3.420, 8.412, -3.667, 92.929 ], "heli_params": [ -2.247, -0.416, 3.572, -2.525, -5.791, 93.277 ], "bp2_params": [ 0.561, 2.124, 0.816, -21.130, -0.668, -73.888 ], "groove_widths": [ 14.603, 12.061, 14.011, 12.085 ], "simple_Rise": 3.420, "simple_Twist": 40.283, "simple_hRise": 3.795, "simple_hTwist": 41.273 }, { "index": 7, "nt1": "///S/11", "nt2": "///S/60", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 0.561, 2.124, 0.816, -21.130, -0.668, -73.888 ], "step_params": [ -1.813, -0.514, 2.771, 0.737, 8.270, -12.821 ], "heli_params": [ -4.094, -6.288, 2.693, -32.895, 2.931, -15.265 ], "bp2_params": [ 0.045, -0.209, 0.335, -1.875, -2.441, -2.314 ], "groove_widths": [ 15.518, 12.513, 14.522, 10.018 ], "simple_Rise": 2.771, "simple_Twist": 41.529, "simple_hRise": 2.595, "simple_hTwist": 42.315 }, { "index": 8, "nt1": "///S/12", "nt2": "///S/59", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.209, 0.335, -1.875, -2.441, -2.314 ], "step_params": [ -0.006, -1.521, 2.885, 5.392, 18.701, 30.260 ], "heli_params": [ -4.510, 0.599, 1.671, 32.003, -9.227, 35.856 ], "bp2_params": [ -0.237, -0.236, -0.451, -7.301, -6.361, 4.224 ], "groove_widths": [ 16.404, 14.054, 15.213, 10.301 ], "simple_Rise": 2.885, "simple_Twist": 31.715, "simple_hRise": 1.731, "simple_hTwist": 37.080 }, { "index": 9, "nt1": "///S/13", "nt2": "///S/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.237, -0.236, -0.451, -7.301, -6.361, 4.224 ], "step_params": [ -0.016, -1.332, 3.034, -4.181, 0.367, 32.556 ], "heli_params": [ -2.416, -0.636, 2.998, 0.652, 7.419, 32.818 ], "bp2_params": [ 0.076, -0.382, -0.117, 1.481, 0.598, 5.369 ], "groove_widths": [ 16.700, 15.340, 16.826, 15.178 ], "simple_Rise": 3.034, "simple_Twist": 30.685, "simple_hRise": 2.994, "simple_hTwist": 30.964 }, { "index": 10, "nt1": "///S/14", "nt2": "///S/57", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.076, -0.382, -0.117, 1.481, 0.598, 5.369 ], "step_params": [ -0.075, -1.507, 3.511, 5.879, 1.443, 30.038 ], "heli_params": [ -3.154, 1.374, 3.362, 2.750, -11.200, 30.628 ], "bp2_params": [ -0.193, -0.221, -0.679, -4.094, 1.086, 0.927 ], "groove_widths": [ 17.255, null, 17.259, null ], "simple_Rise": 3.511, "simple_Twist": 31.615, "simple_hRise": 3.372, "simple_hTwist": 32.175 }, { "index": 11, "nt1": "///S/15", "nt2": "///S/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.221, -0.679, -4.094, 1.086, 0.927 ], "step_params": [ 0.279, -1.298, 3.263, -5.105, 11.083, 25.157 ], "heli_params": [ -5.095, -1.686, 2.389, 23.744, 10.938, 27.917 ], "bp2_params": [ 0.138, -0.276, -0.207, 1.233, -0.783, 7.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 23.332, "simple_hRise": 2.308, "simple_hTwist": 26.290 }, { "index": 12, "nt1": "///S/16", "nt2": "///S/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.138, -0.276, -0.207, 1.233, -0.783, 7.317 ], "step_params": [ 0.291, -0.598, 3.185, -1.451, 5.252, 57.279 ], "heli_params": [ -0.896, -0.378, 3.116, 5.466, 1.510, 57.515 ], "bp2_params": [ 6.407, -3.991, 0.509, -0.011, 0.599, 4.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.185, "simple_Twist": 13.886, "simple_hRise": 2.729, "simple_hTwist": 14.912 }, { "index": 13, "nt1": "///S/17", "nt2": "///S/54", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 2, "num_stems": 3, "strand1": "GUCCAAAUCGGAAGC", "strand2": "CAGGAACAGCCUUCG", "bp_type": ".|||...||||||||", "helix_form": "x.A....AAAxAA.", "helical_rise": 3.070, "helical_rise_std": 0.595, "helical_radius": 8.570, "helical_radius_std": 1.826, "helical_axis": [ 0.870, 0.457, -0.183 ], "point1": [ 120.387, 72.057, 82.461 ], "point2": [ 157.908, 91.759, 74.554 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///S/32", "nt2": "///S/30", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "bp1_params": [ -0.858, 5.441, 0.283, -15.893, 29.587, 97.347 ], "step_params": [ -1.373, -1.311, 3.000, 0.494, -13.544, -71.885 ], "heli_params": [ 1.494, -1.140, 2.758, 11.436, 0.417, -72.982 ], "bp2_params": [ -0.037, -0.182, 0.528, -4.834, 2.166, 11.040 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.000, "simple_Twist": 5.334, "simple_hRise": 2.274, "simple_hTwist": 14.560 }, { "index": 2, "nt1": "///S/34", "nt2": "///S/29", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, -0.182, 0.528, -4.834, 2.166, 11.040 ], "step_params": [ -0.786, -1.695, 3.038, 1.433, 3.756, 26.340 ], "heli_params": [ -4.551, 2.038, 2.728, 8.183, -3.121, 26.639 ], "bp2_params": [ 0.087, -0.256, 0.657, -2.386, 3.309, -0.750 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.038, "simple_Twist": 25.234, "simple_hRise": 2.712, "simple_hTwist": 25.547 }, { "index": 3, "nt1": "///S/35", "nt2": "///S/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.256, 0.657, -2.386, 3.309, -0.750 ], "step_params": [ 0.097, -2.329, 3.147, 3.777, -9.651, 25.934 ], "heli_params": [ -2.317, 0.784, 3.734, -20.493, -8.021, 27.895 ], "bp2_params": [ 0.177, -0.169, 0.143, 4.697, 0.373, -0.243 ], "groove_widths": [ 16.391, null, 16.960, null ], "simple_Rise": 3.147, "simple_Twist": 25.470, "simple_hRise": 3.740, "simple_hTwist": 27.465 }, { "index": 4, "nt1": "///S/36", "nt2": "///S/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.169, 0.143, 4.697, 0.373, -0.243 ], "step_params": [ -1.354, -1.231, 3.521, 3.461, 10.223, 59.990 ], "heli_params": [ -1.725, 1.509, 3.218, 10.136, -3.431, 60.864 ], "bp2_params": [ 6.399, -4.355, 0.042, -4.095, -7.513, -25.568 ], "groove_widths": [ 16.612, 15.129, 15.135, 15.128 ], "simple_Rise": 3.521, "simple_Twist": 19.335, "simple_hRise": 2.310, "simple_hTwist": 22.118 }, { "index": 5, "nt1": "///S/37", "nt2": "///S/26", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.399, -4.355, 0.042, -4.095, -7.513, -25.568 ], "step_params": [ 0.248, -1.114, 3.247, 8.626, 6.725, -9.341 ], "heli_params": [ -2.025, 9.299, 2.484, -30.506, 39.132, -14.374 ], "bp2_params": [ -6.331, -4.538, -0.823, -12.382, -9.347, -13.336 ], "groove_widths": [ 16.855, 15.166, 14.188, 14.176 ], "simple_Rise": 3.247, "simple_Twist": 76.556, "simple_hRise": 3.165, "simple_hTwist": 77.215 }, { "index": 6, "nt1": "///S/38", "nt2": "///S/25", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.331, -4.538, -0.823, -12.382, -9.347, -13.336 ], "step_params": [ 0.696, -0.706, 3.694, -13.399, -0.690, 46.614 ], "heli_params": [ -0.802, -1.998, 3.393, -0.852, 16.535, 48.403 ], "bp2_params": [ -3.591, -0.982, -0.667, -10.633, 8.939, 0.949 ], "groove_widths": [ 16.766, 15.145, 13.214, 12.525 ], "simple_Rise": 3.694, "simple_Twist": 23.499, "simple_hRise": 2.899, "simple_hTwist": 27.012 }, { "index": 7, "nt1": "///S/39", "nt2": "///S/24", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.591, -0.982, -0.667, -10.633, 8.939, 0.949 ], "step_params": [ 0.140, -1.052, 2.838, -3.926, 2.184, 43.684 ], "heli_params": [ -1.584, -0.507, 2.763, 2.925, 5.259, 43.903 ], "bp2_params": [ 0.062, -0.236, -0.384, 5.092, 1.493, 7.099 ], "groove_widths": [ 17.061, 15.556, 13.596, 12.753 ], "simple_Rise": 2.838, "simple_Twist": 22.491, "simple_hRise": 2.662, "simple_hTwist": 22.930 }, { "index": 8, "nt1": "///S/40", "nt2": "///S/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.062, -0.236, -0.384, 5.092, 1.493, 7.099 ], "step_params": [ -0.283, -1.912, 3.121, 1.219, 7.829, 35.197 ], "heli_params": [ -4.079, 0.611, 2.638, 12.748, -1.985, 36.050 ], "bp2_params": [ 0.188, -0.283, -0.323, -0.466, -1.182, 0.914 ], "groove_widths": [ 16.936, 15.408, 15.589, 14.543 ], "simple_Rise": 3.121, "simple_Twist": 34.516, "simple_hRise": 2.627, "simple_hTwist": 35.387 }, { "index": 9, "nt1": "///S/41", "nt2": "///S/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.283, -0.323, -0.466, -1.182, 0.914 ], "step_params": [ 0.033, -1.617, 2.974, -2.568, 6.342, 26.211 ], "heli_params": [ -4.823, -0.624, 2.505, 13.689, 5.544, 27.075 ], "bp2_params": [ -0.184, -0.242, 0.021, 1.061, 1.473, 2.511 ], "groove_widths": [ 16.603, 14.833, 19.437, 15.347 ], "simple_Rise": 2.974, "simple_Twist": 28.539, "simple_hRise": 2.550, "simple_hTwist": 29.331 }, { "index": 10, "nt1": "///S/42", "nt2": "///S/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.242, 0.021, 1.061, 1.473, 2.511 ], "step_params": [ 0.182, -1.991, 3.171, 2.109, 1.995, 32.564 ], "heli_params": [ -3.866, 0.025, 3.052, 3.549, -3.751, 32.690 ], "bp2_params": [ -0.111, -0.266, -0.362, -1.958, 0.568, -0.810 ], "groove_widths": [ 16.975, 15.188, 13.152, 10.805 ], "simple_Rise": 3.171, "simple_Twist": 32.382, "simple_hRise": 3.052, "simple_hTwist": 32.508 }, { "index": 11, "nt1": "///S/43", "nt2": "///S/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.111, -0.266, -0.362, -1.958, 0.568, -0.810 ], "step_params": [ 1.882, -0.803, 3.695, 5.106, 4.635, 50.440 ], "heli_params": [ -1.306, -1.781, 3.774, 5.410, -5.959, 50.878 ], "bp2_params": [ 0.119, -0.192, -0.358, -4.567, 5.951, -4.045 ], "groove_widths": [ 17.624, 15.534, 12.749, 11.554 ], "simple_Rise": 3.695, "simple_Twist": 48.982, "simple_hRise": 3.775, "simple_hTwist": 49.436 }, { "index": 12, "nt1": "///S/44", "nt2": "///S/53", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.192, -0.358, -4.567, 5.951, -4.045 ], "step_params": [ 0.269, -0.942, 3.262, -0.689, 17.085, 31.218 ], "heli_params": [ -3.874, -0.536, 2.433, 29.169, 1.177, 35.492 ], "bp2_params": [ -0.062, -0.248, -0.364, -6.170, -3.253, 3.350 ], "groove_widths": [ 17.768, null, 13.979, null ], "simple_Rise": 3.262, "simple_Twist": 31.812, "simple_hRise": 2.452, "simple_hTwist": 36.011 }, { "index": 13, "nt1": "///S/45", "nt2": "///S/52", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.062, -0.248, -0.364, -6.170, -3.253, 3.350 ], "step_params": [ -0.135, -0.955, 2.927, -2.147, 9.543, 34.310 ], "heli_params": [ -2.750, -0.046, 2.582, 15.784, 3.551, 35.636 ], "bp2_params": [ -0.166, -0.225, 0.003, -0.291, -6.294, 0.199 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.927, "simple_Twist": 35.111, "simple_hRise": 2.592, "simple_hTwist": 36.407 }, { "index": 14, "nt1": "///S/46", "nt2": "///S/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, -0.225, 0.003, -0.291, -6.294, 0.199 ], "step_params": [ 0.833, -0.201, 3.183, 5.926, -0.002, 33.139 ], "heli_params": [ -0.347, -0.477, 3.279, -0.004, -10.287, 33.650 ], "bp2_params": [ 0.116, -0.233, -0.147, 6.690, 2.588, 1.788 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.183, "simple_Twist": 30.876, "simple_hRise": 3.282, "simple_hTwist": 31.426 }, { "index": 15, "nt1": "///S/47", "nt2": "///S/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GUUAG", "strand2": "CAAUC", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.644, "helical_rise_std": 0.332, "helical_radius": 8.498, "helical_radius_std": 1.145, "helical_axis": [ 0.478, 0.100, -0.873 ], "point1": [ 123.801, 103.448, 107.074 ], "point2": [ 128.842, 104.500, 97.868 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///S/5", "nt2": "///S/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.358, -0.648, -2.161, 5.465, -2.114 ], "step_params": [ 0.824, -2.592, 3.038, -5.493, 13.440, 40.548 ], "heli_params": [ -4.597, -1.557, 1.997, 18.684, 7.637, 42.965 ], "bp2_params": [ -0.049, -0.118, -0.322, 1.837, -2.626, -2.985 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.038, "simple_Twist": 39.953, "simple_hRise": 1.979, "simple_hTwist": 42.408 }, { "index": 2, "nt1": "///S/6", "nt2": "///S/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.049, -0.118, -0.322, 1.837, -2.626, -2.985 ], "step_params": [ 0.695, -1.010, 3.204, 3.105, 7.024, 44.907 ], "heli_params": [ -1.901, -0.635, 3.060, 9.116, -4.030, 45.525 ], "bp2_params": [ 0.091, -0.207, -0.304, -1.700, 2.503, -1.971 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.204, "simple_Twist": 44.086, "simple_hRise": 3.056, "simple_hTwist": 44.717 }, { "index": 3, "nt1": "///S/7", "nt2": "///S/65", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.207, -0.304, -1.700, 2.503, -1.971 ], "step_params": [ -0.306, -1.354, 3.102, -1.750, 10.484, 32.258 ], "heli_params": [ -3.816, 0.275, 2.562, 18.262, 3.048, 33.920 ], "bp2_params": [ -0.095, -0.356, -0.235, -2.352, -0.537, 4.159 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.102, "simple_Twist": 32.795, "simple_hRise": 2.573, "simple_hTwist": 34.429 }, { "index": 4, "nt1": "///S/8", "nt2": "///S/64", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.356, -0.235, -2.352, -0.537, 4.159 ], "step_params": [ -0.053, -1.560, 3.148, 0.351, 3.843, 31.557 ], "heli_params": [ -3.506, 0.157, 2.942, 7.033, -0.643, 31.786 ], "bp2_params": [ -0.225, -0.367, -0.557, -0.235, -1.889, 3.420 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.148, "simple_Twist": 32.330, "simple_hRise": 2.947, "simple_hTwist": 32.554 }, { "index": 5, "nt1": "///S/9", "nt2": "///S/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "UGUGU", "strand2": "ACACA", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 3.204, "helical_rise_std": 0.305, "helical_radius": 8.923, "helical_radius_std": 0.550, "helical_axis": [ 0.629, -0.182, -0.756 ], "point1": [ 131.565, 104.185, 89.963 ], "point2": [ 139.755, 101.820, 80.130 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///S/12", "nt2": "///S/59", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.209, 0.335, -1.875, -2.441, -2.314 ], "step_params": [ -0.006, -1.521, 2.885, 5.392, 18.701, 30.260 ], "heli_params": [ -4.510, 0.599, 1.671, 32.003, -9.227, 35.856 ], "bp2_params": [ -0.237, -0.236, -0.451, -7.301, -6.361, 4.224 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.885, "simple_Twist": 31.715, "simple_hRise": 1.731, "simple_hTwist": 37.080 }, { "index": 2, "nt1": "///S/13", "nt2": "///S/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.237, -0.236, -0.451, -7.301, -6.361, 4.224 ], "step_params": [ -0.016, -1.332, 3.034, -4.181, 0.367, 32.556 ], "heli_params": [ -2.416, -0.636, 2.998, 0.652, 7.419, 32.818 ], "bp2_params": [ 0.076, -0.382, -0.117, 1.481, 0.598, 5.369 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.034, "simple_Twist": 30.685, "simple_hRise": 2.994, "simple_hTwist": 30.964 }, { "index": 3, "nt1": "///S/14", "nt2": "///S/57", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.076, -0.382, -0.117, 1.481, 0.598, 5.369 ], "step_params": [ -0.075, -1.507, 3.511, 5.879, 1.443, 30.038 ], "heli_params": [ -3.154, 1.374, 3.362, 2.750, -11.200, 30.628 ], "bp2_params": [ -0.193, -0.221, -0.679, -4.094, 1.086, 0.927 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.511, "simple_Twist": 31.615, "simple_hRise": 3.372, "simple_hTwist": 32.175 }, { "index": 4, "nt1": "///S/15", "nt2": "///S/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.221, -0.679, -4.094, 1.086, 0.927 ], "step_params": [ 0.279, -1.298, 3.263, -5.105, 11.083, 25.157 ], "heli_params": [ -5.095, -1.686, 2.389, 23.744, 10.938, 27.917 ], "bp2_params": [ 0.138, -0.276, -0.207, 1.233, -0.783, 7.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 23.332, "simple_hRise": 2.308, "simple_hTwist": 26.290 }, { "index": 5, "nt1": "///S/16", "nt2": "///S/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCGA", "strand2": "GGCU", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.729, "helical_rise_std": 0.127, "helical_radius": 9.206, "helical_radius_std": 1.207, "helical_axis": [ -0.889, -0.456, 0.047 ], "point1": [ 147.221, 87.160, 77.778 ], "point2": [ 139.942, 83.426, 78.162 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///S/20", "nt2": "///S/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, -0.266, -0.362, 1.958, 0.568, -0.810 ], "step_params": [ -0.182, -1.991, 3.171, -2.109, 1.995, 32.564 ], "heli_params": [ -3.866, -0.025, 3.052, 3.549, 3.751, 32.690 ], "bp2_params": [ 0.184, -0.242, 0.021, -1.061, 1.473, 2.511 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.171, "simple_Twist": 32.382, "simple_hRise": 3.052, "simple_hTwist": 32.508 }, { "index": 2, "nt1": "///S/21", "nt2": "///S/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.184, -0.242, 0.021, -1.061, 1.473, 2.511 ], "step_params": [ -0.033, -1.617, 2.974, 2.568, 6.342, 26.211 ], "heli_params": [ -4.823, 0.624, 2.505, 13.689, -5.544, 27.075 ], "bp2_params": [ -0.188, -0.283, -0.323, 0.466, -1.182, 0.914 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.974, "simple_Twist": 28.539, "simple_hRise": 2.550, "simple_hTwist": 29.331 }, { "index": 3, "nt1": "///S/22", "nt2": "///S/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.188, -0.283, -0.323, 0.466, -1.182, 0.914 ], "step_params": [ 0.283, -1.912, 3.121, -1.219, 7.829, 35.197 ], "heli_params": [ -4.079, -0.611, 2.638, 12.748, 1.985, 36.050 ], "bp2_params": [ -0.062, -0.236, -0.384, -5.092, 1.493, 7.099 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.121, "simple_Twist": 34.516, "simple_hRise": 2.627, "simple_hTwist": 35.387 }, { "index": 4, "nt1": "///S/23", "nt2": "///S/40", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "GGA", "strand2": "CCU", "bp_type": "|||", "helix_form": "A.", "helical_rise": 3.719, "helical_rise_std": 0.090, "helical_radius": 9.545, "helical_radius_std": 1.019, "helical_axis": [ -0.965, -0.250, 0.083 ], "point1": [ 129.736, 76.341, 79.981 ], "point2": [ 122.471, 74.461, 80.603 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///S/27", "nt2": "///S/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.169, 0.143, -4.697, 0.373, -0.243 ], "step_params": [ -0.097, -2.329, 3.147, -3.777, -9.651, 25.934 ], "heli_params": [ -2.317, -0.784, 3.734, -20.493, 8.021, 27.895 ], "bp2_params": [ -0.087, -0.256, 0.657, 2.386, 3.309, -0.750 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.147, "simple_Twist": 25.470, "simple_hRise": 3.740, "simple_hTwist": 27.465 }, { "index": 2, "nt1": "///S/28", "nt2": "///S/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.256, 0.657, 2.386, 3.309, -0.750 ], "step_params": [ 0.786, -1.695, 3.038, -1.433, 3.756, 26.340 ], "heli_params": [ -4.551, -2.038, 2.728, 8.183, 3.121, 26.639 ], "bp2_params": [ 0.037, -0.182, 0.528, 4.834, 2.166, 11.040 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.038, "simple_Twist": 25.234, "simple_hRise": 2.712, "simple_hTwist": 25.547 }, { "index": 3, "nt1": "///S/29", "nt2": "///S/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 2, "strand1": "AAGC", "strand2": "UUCG", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.504, "helical_rise_std": 0.228, "helical_radius": 8.024, "helical_radius_std": 1.007, "helical_axis": [ 0.811, 0.504, -0.297 ], "point1": [ 151.645, 87.458, 77.515 ], "point2": [ 157.628, 91.175, 75.328 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///S/44", "nt2": "///S/53", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.192, -0.358, -4.567, 5.951, -4.045 ], "step_params": [ 0.269, -0.942, 3.262, -0.689, 17.085, 31.218 ], "heli_params": [ -3.874, -0.536, 2.433, 29.169, 1.177, 35.492 ], "bp2_params": [ -0.062, -0.248, -0.364, -6.170, -3.253, 3.350 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.262, "simple_Twist": 31.812, "simple_hRise": 2.452, "simple_hTwist": 36.011 }, { "index": 2, "nt1": "///S/45", "nt2": "///S/52", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.062, -0.248, -0.364, -6.170, -3.253, 3.350 ], "step_params": [ -0.135, -0.955, 2.927, -2.147, 9.543, 34.310 ], "heli_params": [ -2.750, -0.046, 2.582, 15.784, 3.551, 35.636 ], "bp2_params": [ -0.166, -0.225, 0.003, -0.291, -6.294, 0.199 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.927, "simple_Twist": 35.111, "simple_hRise": 2.592, "simple_hTwist": 36.407 }, { "index": 3, "nt1": "///S/46", "nt2": "///S/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, -0.225, 0.003, -0.291, -6.294, 0.199 ], "step_params": [ 0.833, -0.201, 3.183, 5.926, -0.002, 33.139 ], "heli_params": [ -0.347, -0.477, 3.279, -0.004, -10.287, 33.650 ], "bp2_params": [ 0.116, -0.233, -0.147, 6.690, 2.588, 1.788 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.183, "simple_Twist": 30.876, "simple_hRise": 3.282, "simple_hTwist": 31.426 }, { "index": 4, "nt1": "///S/47", "nt2": "///S/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 2, "num_stems": 3, "stem_indices": [ 4, 3, 5 ] } ], "num_stacks": 13, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "Fg", "nts_long": "///A/25,///S/201" }, { "index": 2, "num_nts": 2, "nts_short": "UG", "nts_long": "///S/16,///S/17" }, { "index": 3, "num_nts": 2, "nts_short": "GU", "nts_long": "///S/32,///S/34" }, { "index": 4, "num_nts": 2, "nts_short": "GA", "nts_long": "///S/43,///S/44" }, { "index": 5, "num_nts": 2, "nts_short": "CU", "nts_long": "///S/47,///S/49" }, { "index": 6, "num_nts": 2, "nts_short": "AG", "nts_long": "///S/59,///S/60" }, { "index": 7, "num_nts": 2, "nts_short": "UC", "nts_long": "///S/62,///S/63" }, { "index": 8, "num_nts": 3, "nts_short": "GUC", "nts_long": "///S/9,///S/10,///S/11" }, { "index": 9, "num_nts": 3, "nts_short": "ACA", "nts_long": "///S/29,///S/30,///S/31" }, { "index": 10, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///S/18,///S/19,///S/54,///S/55" }, { "index": 11, "num_nts": 5, "nts_short": "EAGUU", "nts_long": "///A/149,///S/1,///S/2,///S/3,///S/4" }, { "index": 12, "num_nts": 5, "nts_short": "ACAAC", "nts_long": "///S/23,///S/24,///S/25,///S/37,///S/36" }, { "index": 13, "num_nts": 5, "nts_short": "GAAAU", "nts_long": "///S/27,///S/26,///S/38,///S/39,///S/40" } ], "nonStack": { "num_nts": 2, "nts_short": "CU", "nts_long": "///S/20,///S/33" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///S/49/O4'", "nt": "///S/50", "vert_dist": 2.825 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 4 ], "summary": "[1] 4 [S.29 S.34] 3", "num_nts": 6, "nts_short": "ACAGUU", "nts_long": "///S/29,///S/30,///S/31,///S/32,///S/33,///S/34", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "CAGU", "nts_long": "///S/30,///S/31,///S/32,///S/33" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 2, 3 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 3 [S.9 S.63 S.12 S.59] 5 5", "num_nts": 9, "nts_short": "GUCUAGUUC", "nts_long": "///S/9,///S/10,///S/11,///S/12,///S/59,///S/60,///S/61,///S/62,///S/63", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///S/10,///S/11" }, { "index": 2, "num_nts": 3, "nts_short": "GUU", "nts_long": "///S/60,///S/61,///S/62" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 3, 3 ], "stem_indices": [ 3, 4 ], "summary": "[2] 3 3 [S.23 S.40 S.27 S.36] 4 3", "num_nts": 10, "nts_short": "ACAAGCAAAU", "nts_long": "///S/23,///S/24,///S/25,///S/26,///S/27,///S/36,///S/37,///S/38,///S/39,///S/40", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "CAA", "nts_long": "///S/24,///S/25,///S/26" }, { "index": 2, "num_nts": 3, "nts_short": "AAA", "nts_long": "///S/37,///S/38,///S/39" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 3, 0, 1 ], "stem_indices": [ 2, 3, 5 ], "summary": "[3] 3 0 1 [S.16 S.55 S.20 S.43 S.44 S.53] 5 4 4", "num_nts": 10, "nts_short": "UGGACGAUAA", "nts_long": "///S/16,///S/17,///S/18,///S/19,///S/20,///S/43,///S/44,///S/53,///S/54,///S/55", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "GGA", "nts_long": "///S/17,///S/18,///S/19" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 3, "num_nts": 1, "nts_short": "A", "nts_long": "///S/54" } ] } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 4, "nts_short": "AGUU", "nts_long": "///S/1,///S/2,///S/3,///S/4" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///S/49" }, { "index": 3, "num_nts": 1, "nts_short": "g", "nts_long": "///S/201" } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///S/19,///S/20" }, { "index": 2, "num_nts": 3, "nts_short": "GUU", "nts_long": "///S/32,///S/33,///S/34" }, { "index": 3, "num_nts": 2, "nts_short": "UA", "nts_long": "///S/53,///S/54" }, { "index": 4, "num_nts": 3, "nts_short": "GUU", "nts_long": "///S/60,///S/61,///S/62" } ], "dbn": { "all_chains": { "num_nts": 67, "num_chars": 69, "bseq": "AGUUGUUAGUCUGUGUGGACCGACAAGGACAGUUCCAAAUCGGAAGC&UGCUUAACACAGUUCUAAC&g", "bseqUP": "AGUUGUUAGUCUGUGUGGACCGACAAGGACAGUUCCAAAUCGGAAGC&UGCUUAACACAGUUCUAAC&G", "sstr": "....(((((..(((((...((((...(((....)))...))))((((&.)))).)))))...)))))&.", "form": "....AAAAAA.AAAA....AAAA...AA.A...AA...AAAA.AA.-&.BA...AAAA....AA..-&-" }, "chain_S": { "num_nts": 67, "num_chars": 69, "bseq": "AGUUGUUAGUCUGUGUGGACCGACAAGGACAGUUCCAAAUCGGAAGC&UGCUUAACACAGUUCUAAC&g", "bseqUP": "AGUUGUUAGUCUGUGUGGACCGACAAGGACAGUUCCAAAUCGGAAGC&UGCUUAACACAGUUCUAAC&G", "sstr": "....(((((..(((((...((((...(((....)))...))))((((&.)))).)))))...)))))&.", "form": "....AAAAAA.AAAA....AAAA...AA.A...AA...AAAA.AA.-&.BA...AAAA....AA..-&-" } }, "chains": { "chain_S": { "num_nts": 67, "bseq": "AGUUGUUAGUCUGUGUGGACCGACAAGGACAGUUCCAAAUCGGAAGC&UGCUUAACACAGUUCUAAC&g", "sstr": "....(((((..(((((...((((...(((....)))...))))((((&.)))).)))))...)))))&.", "form": "....AAAAAA.AAAA....AAAA...AA.A...AA...AAAA.AA.-&.BA...AAAA....AA..-&-", "helical_rise": 0.141, "helical_rise_std": 2.777, "helical_axis": [ 0.136, -0.455, 0.880 ], "point1": [ 128.753, 90.201, 97.192 ], "point2": [ 130.044, 85.896, 105.519 ], "num_chars": 199, "suite": "A1LG1aU!!U!!G1aU!!U1aA1aG1aU1aC1cU1aG1aU1aG!!U1LG1gG1LA!!C1aC!!G!!A1aC!!A&aA1aG1aG1LA!!C1bA4nG7dU!!U1cC1cC1LA7aA1aA!!U1aC1aG1aG1LA1aA1LG!!C..U!!G4nC!!U!!U!!A1aA1LC1aA1LC!!A!!G!!U!!U!!C1aU!!A!!A!!C..g" } }, "num_nts": 67, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "S", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///S/1", "linked_nts": [ null, "///S/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": null, "beta": 127.274, "gamma": 51.611, "delta": 81.260, "epsilon": -100.942, "zeta": -96.717, "epsilon_zeta": -4.225, "bb_type": "--", "chi": -164.666, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.583, 0.788 ], "P_xyz": [ 1.238, 8.309, 0.097 ], "form": ".", "ssZp": 4.300, "Dp": 4.802, "splay_angle": 29.588, "splay_distance": 4.599, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": null, "theta": -119.060, "eta_prime": null, "theta_prime": -117.737, "eta_base": null, "theta_base": -71.953, "v0": 5.018, "v1": -27.331, "v2": 37.919, "v3": -36.071, "v4": 19.599, "amplitude": 38.669, "phase_angle": 11.301, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 113.520, 121.917, 113.158 ], "x_axis": [ 0.939, -0.329, 0.101 ], "y_axis": [ -0.344, -0.883, 0.318 ], "z_axis": [ -0.015, -0.333, -0.943 ], "quaternion": [ 0.168, 0.970, -0.174, 0.022 ] } }, { "index": 2, "index_chain": 2, "chain_name": "S", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///S/2", "linked_nts": [ "///S/1", "///S/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -49.278, "beta": 128.967, "gamma": 63.197, "delta": 81.151, "epsilon": -136.213, "zeta": -68.313, "epsilon_zeta": -67.899, "bb_type": "BI", "chi": -166.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.515, 8.688, 0.890 ], "P_xyz": [ 0.956, 8.677, 0.079 ], "form": ".", "ssZp": 4.518, "Dp": 4.673, "splay_angle": 27.308, "splay_distance": 4.244, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 155.386, "theta": -121.597, "eta_prime": -176.088, "theta_prime": -127.573, "eta_base": -104.332, "theta_base": -79.172, "v0": 0.278, "v1": -23.310, "v2": 36.218, "v3": -36.959, "v4": 23.162, "amplitude": 38.114, "phase_angle": 18.146, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.816, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 116.284, 118.556, 111.673 ], "x_axis": [ 0.283, -0.778, 0.561 ], "y_axis": [ -0.913, -0.397, -0.091 ], "z_axis": [ 0.293, -0.486, -0.823 ], "quaternion": [ 0.125, 0.791, -0.535, 0.270 ] } }, { "index": 3, "index_chain": 3, "chain_name": "S", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///S/3", "linked_nts": [ "///S/2", "///S/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -58.216, "beta": 158.765, "gamma": 52.975, "delta": 79.219, "epsilon": -106.758, "zeta": -85.998, "epsilon_zeta": -20.759, "bb_type": "--", "chi": -165.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.380, 8.655, 0.832 ], "P_xyz": [ 1.224, 8.958, 0.744 ], "form": ".", "ssZp": 4.363, "Dp": 4.794, "splay_angle": 16.434, "splay_distance": 3.530, "splay_ratio": 0.174, "d22": 4.229, "d64": 5.268, "eta": 168.560, "theta": -104.450, "eta_prime": -171.151, "theta_prime": -116.961, "eta_base": -97.922, "theta_base": -106.560, "v0": 4.016, "v1": -26.404, "v2": 37.675, "v3": -36.342, "v4": 20.399, "amplitude": 38.634, "phase_angle": 12.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 117.275, 114.445, 111.319 ], "x_axis": [ -0.580, -0.753, 0.311 ], "y_axis": [ -0.727, 0.308, -0.614 ], "z_axis": [ 0.366, -0.582, -0.726 ], "quaternion": [ 0.017, -0.458, 0.808, -0.370 ] } }, { "index": 4, "index_chain": 4, "chain_name": "S", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///S/4", "linked_nts": [ "///S/3", "///S/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 75.574, "beta": -126.810, "gamma": -113.925, "delta": 79.836, "epsilon": -106.636, "zeta": -102.816, "epsilon_zeta": -3.820, "bb_type": "--", "chi": -153.695, "glyco_bond": "anti", "C5prime_xyz": [ -1.419, 8.769, 0.144 ], "P_xyz": [ -1.797, 10.964, -1.247 ], "form": ".", "ssZp": 3.837, "Dp": 4.723, "splay_angle": 51.571, "splay_distance": 8.620, "splay_ratio": 0.436, "d22": null, "d64": null, "eta": 171.341, "theta": 145.261, "eta_prime": -179.987, "theta_prime": 158.571, "eta_base": -151.334, "theta_base": 162.165, "v0": 0.998, "v1": -23.584, "v2": 35.916, "v3": -36.353, "v4": 22.306, "amplitude": 37.584, "phase_angle": 17.133, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 118.386, 111.172, 112.037 ], "x_axis": [ -0.784, -0.588, 0.200 ], "y_axis": [ -0.418, 0.261, -0.870 ], "z_axis": [ 0.459, -0.766, -0.450 ], "quaternion": [ 0.082, -0.318, 0.790, -0.518 ] } }, { "index": 5, "index_chain": 5, "chain_name": "S", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///S/5", "linked_nts": [ "///S/4", "///S/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -68.282, "beta": 78.896, "gamma": 152.990, "delta": 80.425, "epsilon": -143.674, "zeta": -67.400, "epsilon_zeta": -76.274, "bb_type": "BI", "chi": -177.522, "glyco_bond": "anti", "C5prime_xyz": [ -0.940, 8.282, 1.447 ], "P_xyz": [ -1.282, 10.117, -0.395 ], "form": "A", "ssZp": 4.800, "Dp": 4.776, "splay_angle": 27.834, "splay_distance": 4.214, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -137.325, "theta": 165.790, "eta_prime": -144.800, "theta_prime": -177.002, "eta_base": -144.232, "theta_base": -141.950, "v0": 8.941, "v1": -30.557, "v2": 39.461, "v3": -35.417, "v4": 16.731, "amplitude": 39.674, "phase_angle": 5.947, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 125.144, 107.143, 108.515 ], "x_axis": [ -0.263, -0.943, -0.205 ], "y_axis": [ -0.683, 0.332, -0.650 ], "z_axis": [ 0.681, -0.031, -0.731 ], "quaternion": [ 0.291, -0.533, 0.763, -0.223 ] } }, { "index": 6, "index_chain": 6, "chain_name": "S", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///S/6", "linked_nts": [ "///S/5", "///S/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.935, "beta": -174.496, "gamma": 49.692, "delta": 81.648, "epsilon": -164.404, "zeta": -72.900, "epsilon_zeta": -91.504, "bb_type": "BI", "chi": -169.496, "glyco_bond": "anti", "C5prime_xyz": [ -1.159, 8.537, 1.113 ], "P_xyz": [ 1.328, 8.719, 1.920 ], "form": "A", "ssZp": 4.541, "Dp": 4.553, "splay_angle": 23.356, "splay_distance": 3.465, "splay_ratio": 0.202, "d22": 4.280, "d64": 3.611, "eta": 174.582, "theta": -135.969, "eta_prime": -169.687, "theta_prime": -136.178, "eta_base": -125.014, "theta_base": -95.375, "v0": 4.798, "v1": -26.381, "v2": 36.774, "v3": -35.000, "v4": 19.092, "amplitude": 37.520, "phase_angle": 11.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 128.112, 104.619, 106.908 ], "x_axis": [ -0.752, -0.497, -0.433 ], "y_axis": [ -0.364, 0.861, -0.356 ], "z_axis": [ 0.550, -0.110, -0.828 ], "quaternion": [ 0.265, -0.232, 0.927, -0.126 ] } }, { "index": 7, "index_chain": 7, "chain_name": "S", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///S/7", "linked_nts": [ "///S/6", "///S/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -150.364, "beta": -149.837, "gamma": 106.051, "delta": 79.677, "epsilon": -142.355, "zeta": -84.892, "epsilon_zeta": -57.463, "bb_type": "BI", "chi": -175.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.098, 8.373, 1.394 ], "P_xyz": [ 1.484, 8.393, 0.958 ], "form": "A", "ssZp": 4.745, "Dp": 4.749, "splay_angle": 24.246, "splay_distance": 3.465, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 150.222, "theta": -148.850, "eta_prime": 167.830, "theta_prime": -151.781, "eta_base": -132.015, "theta_base": -130.089, "v0": 6.212, "v1": -28.559, "v2": 39.000, "v3": -36.439, "v4": 19.074, "amplitude": 39.578, "phase_angle": 9.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.099, "frame": { "rmsd": 0.010, "origin": [ 128.944, 103.076, 103.919 ], "x_axis": [ -0.856, 0.283, -0.433 ], "y_axis": [ 0.321, 0.947, -0.014 ], "z_axis": [ 0.406, -0.151, -0.901 ], "quaternion": [ 0.218, 0.157, 0.962, -0.043 ] } }, { "index": 8, "index_chain": 8, "chain_name": "S", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///S/8", "linked_nts": [ "///S/7", "///S/9" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.294, "beta": 171.267, "gamma": 53.269, "delta": 81.414, "epsilon": -129.954, "zeta": -103.711, "epsilon_zeta": -26.242, "bb_type": "--", "chi": 179.065, "glyco_bond": "--", "C5prime_xyz": [ -0.889, 8.051, 1.656 ], "P_xyz": [ 1.715, 7.885, 1.803 ], "form": "A", "ssZp": 4.847, "Dp": 4.834, "splay_angle": 24.365, "splay_distance": 3.396, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 166.018, "theta": -153.100, "eta_prime": 172.594, "theta_prime": -147.632, "eta_base": -148.524, "theta_base": -123.398, "v0": 11.339, "v1": -32.577, "v2": 40.342, "v3": -34.927, "v4": 14.902, "amplitude": 40.388, "phase_angle": 2.726, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.038, "frame": { "rmsd": 0.021, "origin": [ 129.539, 101.369, 100.963 ], "x_axis": [ -0.567, 0.794, -0.220 ], "y_axis": [ 0.760, 0.607, 0.232 ], "z_axis": [ 0.318, -0.035, -0.948 ], "quaternion": [ 0.152, 0.440, 0.883, 0.056 ] } }, { "index": 9, "index_chain": 9, "chain_name": "S", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///S/9", "linked_nts": [ "///S/8", "///S/10" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -41.286, "beta": 142.068, "gamma": 53.395, "delta": 84.947, "epsilon": -142.950, "zeta": -78.630, "epsilon_zeta": -64.320, "bb_type": "BI", "chi": 178.064, "glyco_bond": "--", "C5prime_xyz": [ -1.208, 8.161, 1.778 ], "P_xyz": [ 1.379, 7.866, 1.612 ], "form": "A", "ssZp": 4.727, "Dp": 4.721, "splay_angle": 27.762, "splay_distance": 4.047, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 171.301, "theta": -133.852, "eta_prime": -174.798, "theta_prime": -136.124, "eta_base": -135.219, "theta_base": -113.139, "v0": 8.377, "v1": -28.408, "v2": 36.579, "v3": -32.774, "v4": 15.392, "amplitude": 36.766, "phase_angle": 5.773, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.136, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 128.986, 100.652, 97.689 ], "x_axis": [ -0.102, 0.994, -0.031 ], "y_axis": [ 0.957, 0.106, 0.271 ], "z_axis": [ 0.273, -0.002, -0.962 ], "quaternion": [ 0.103, 0.662, 0.737, 0.091 ] } }, { "index": 10, "index_chain": 10, "chain_name": "S", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///S/10", "linked_nts": [ "///S/9", "///S/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -53.106, "beta": 163.103, "gamma": 56.715, "delta": 84.308, "epsilon": -147.939, "zeta": -61.790, "epsilon_zeta": -86.150, "bb_type": "BI", "chi": -176.233, "glyco_bond": "anti", "C5prime_xyz": [ -1.219, 8.334, 1.515 ], "P_xyz": [ 1.396, 8.295, 1.744 ], "form": "A", "ssZp": 4.675, "Dp": 4.674, "splay_angle": 26.529, "splay_distance": 3.959, "splay_ratio": 0.230, "d22": 3.955, "d64": 3.926, "eta": 174.016, "theta": -128.658, "eta_prime": -167.691, "theta_prime": -129.286, "eta_base": -119.048, "theta_base": -87.873, "v0": 6.735, "v1": -27.155, "v2": 36.091, "v3": -33.193, "v4": 16.698, "amplitude": 36.463, "phase_angle": 8.197, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 128.384, 101.398, 93.758 ], "x_axis": [ 0.549, 0.836, 0.003 ], "y_axis": [ 0.790, -0.519, 0.327 ], "z_axis": [ 0.275, -0.177, -0.945 ], "quaternion": [ 0.145, 0.868, 0.468, 0.080 ] } }, { "index": 11, "index_chain": 11, "chain_name": "S", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///S/11", "linked_nts": [ "///S/10", "///S/12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -71.402, "beta": 177.277, "gamma": 56.819, "delta": 84.378, "epsilon": -161.595, "zeta": -71.544, "epsilon_zeta": -90.051, "bb_type": "BI", "chi": -170.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.032, 8.494, 1.175 ], "P_xyz": [ 1.544, 8.485, 1.613 ], "form": ".", "ssZp": 4.555, "Dp": 4.562, "splay_angle": 20.919, "splay_distance": 3.604, "splay_ratio": 0.195, "d22": 4.695, "d64": 4.906, "eta": 164.402, "theta": -128.495, "eta_prime": -173.247, "theta_prime": -139.492, "eta_base": -105.275, "theta_base": -139.104, "v0": 5.224, "v1": -25.964, "v2": 35.544, "v3": -33.593, "v4": 17.876, "amplitude": 36.150, "phase_angle": 10.503, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.885, "filter_rmsd": 0.066, "frame": { "rmsd": 0.010, "origin": [ 130.068, 102.918, 90.513 ], "x_axis": [ 0.963, 0.136, 0.233 ], "y_axis": [ 0.081, -0.969, 0.233 ], "z_axis": [ 0.258, -0.206, -0.944 ], "quaternion": [ 0.111, 0.984, 0.055, 0.125 ] } }, { "index": 12, "index_chain": 12, "chain_name": "S", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///S/12", "linked_nts": [ "///S/11", "///S/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -177.619, "beta": -173.130, "gamma": 147.956, "delta": 82.690, "epsilon": -125.882, "zeta": -81.979, "epsilon_zeta": -43.903, "bb_type": "--", "chi": -178.550, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.444, 1.599 ], "P_xyz": [ 0.669, 9.853, 0.831 ], "form": "A", "ssZp": 4.641, "Dp": 4.657, "splay_angle": 17.908, "splay_distance": 2.947, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 158.456, "theta": -152.112, "eta_prime": 171.102, "theta_prime": -152.110, "eta_base": -169.518, "theta_base": -125.993, "v0": 1.133, "v1": -21.962, "v2": 33.335, "v3": -33.592, "v4": 20.459, "amplitude": 34.820, "phase_angle": 16.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.100, "frame": { "rmsd": 0.007, "origin": [ 130.134, 105.037, 87.599 ], "x_axis": [ 0.852, -0.238, 0.465 ], "y_axis": [ -0.257, -0.966, -0.024 ], "z_axis": [ 0.455, -0.099, -0.885 ], "quaternion": [ 0.020, 0.962, -0.129, 0.239 ] } }, { "index": 13, "index_chain": 13, "chain_name": "S", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///S/13", "linked_nts": [ "///S/12", "///S/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.269, "beta": 164.701, "gamma": 38.871, "delta": 77.798, "epsilon": -157.932, "zeta": -80.321, "epsilon_zeta": -77.611, "bb_type": "BI", "chi": -163.949, "glyco_bond": "anti", "C5prime_xyz": [ -1.803, 8.727, 0.726 ], "P_xyz": [ 0.674, 9.460, 1.105 ], "form": "A", "ssZp": 4.525, "Dp": 4.600, "splay_angle": 23.107, "splay_distance": 3.523, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 147.671, "theta": -159.493, "eta_prime": 164.213, "theta_prime": -156.676, "eta_base": -152.108, "theta_base": -126.878, "v0": 1.105, "v1": -25.239, "v2": 38.474, "v3": -38.824, "v4": 23.744, "amplitude": 40.234, "phase_angle": 17.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.479, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 132.307, 106.111, 85.923 ], "x_axis": [ 0.428, -0.704, 0.566 ], "y_axis": [ -0.606, -0.689, -0.398 ], "z_axis": [ 0.671, -0.172, -0.722 ], "quaternion": [ -0.067, 0.842, -0.389, 0.367 ] } }, { "index": 14, "index_chain": 14, "chain_name": "S", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///S/14", "linked_nts": [ "///S/13", "///S/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.329, "beta": 166.093, "gamma": 53.662, "delta": 83.985, "epsilon": -142.458, "zeta": -84.341, "epsilon_zeta": -58.118, "bb_type": "BI", "chi": -165.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.317, 8.602, 0.892 ], "P_xyz": [ 1.280, 8.773, 1.176 ], "form": "A", "ssZp": 4.484, "Dp": 4.620, "splay_angle": 21.994, "splay_distance": 3.518, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 179.576, "theta": -144.007, "eta_prime": -170.640, "theta_prime": -145.456, "eta_base": -132.683, "theta_base": -126.747, "v0": 2.135, "v1": -22.929, "v2": 33.877, "v3": -33.605, "v4": 19.890, "amplitude": 35.114, "phase_angle": 15.253, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.758, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 135.586, 106.052, 84.634 ], "x_axis": [ -0.003, -0.958, 0.286 ], "y_axis": [ -0.721, -0.196, -0.665 ], "z_axis": [ 0.693, -0.208, -0.690 ], "quaternion": [ -0.167, 0.686, -0.612, 0.357 ] } }, { "index": 15, "index_chain": 15, "chain_name": "S", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///S/15", "linked_nts": [ "///S/14", "///S/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.745, "beta": 159.767, "gamma": 36.182, "delta": 73.140, "epsilon": -141.098, "zeta": -108.733, "epsilon_zeta": -32.366, "bb_type": "BI", "chi": -164.015, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.745, 0.694 ], "P_xyz": [ 1.048, 9.269, 0.814 ], "form": "A", "ssZp": 4.508, "Dp": 4.756, "splay_angle": 25.489, "splay_distance": 3.787, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 160.350, "theta": -163.462, "eta_prime": 171.494, "theta_prime": -156.810, "eta_base": -152.120, "theta_base": -128.168, "v0": 1.911, "v1": -27.401, "v2": 41.445, "v3": -41.320, "v4": 24.775, "amplitude": 43.134, "phase_angle": 16.086, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.333, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 138.877, 105.471, 83.536 ], "x_axis": [ -0.345, -0.937, -0.052 ], "y_axis": [ -0.596, 0.262, -0.759 ], "z_axis": [ 0.725, -0.231, -0.649 ], "quaternion": [ 0.259, -0.511, 0.751, -0.330 ] } }, { "index": 16, "index_chain": 16, "chain_name": "S", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///S/16", "linked_nts": [ "///S/15", "///S/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -16.355, "beta": 135.125, "gamma": 38.995, "delta": 77.826, "epsilon": -116.506, "zeta": -82.211, "epsilon_zeta": -34.295, "bb_type": "--", "chi": -170.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.567, 1.158 ], "P_xyz": [ 1.093, 8.495, 1.196 ], "form": ".", "ssZp": 4.588, "Dp": 4.795, "splay_angle": 34.925, "splay_distance": 5.326, "splay_ratio": 0.300, "d22": null, "d64": null, "eta": -177.000, "theta": -118.917, "eta_prime": -170.029, "theta_prime": -114.023, "eta_base": -138.137, "theta_base": -70.184, "v0": 3.995, "v1": -27.447, "v2": 39.351, "v3": -38.110, "v4": 21.432, "amplitude": 40.396, "phase_angle": 13.062, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ 141.728, 103.446, 82.082 ], "x_axis": [ -0.706, -0.647, -0.286 ], "y_axis": [ -0.356, 0.675, -0.646 ], "z_axis": [ 0.612, -0.355, -0.707 ], "quaternion": [ 0.256, -0.286, 0.879, -0.285 ] } }, { "index": 17, "index_chain": 17, "chain_name": "S", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///S/17", "linked_nts": [ "///S/16", "///S/18" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop", "alpha": -43.211, "beta": 139.675, "gamma": 61.197, "delta": 81.243, "epsilon": -101.702, "zeta": -68.697, "epsilon_zeta": -33.005, "bb_type": "--", "chi": -179.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.698, 8.495, 1.571 ], "P_xyz": [ 0.880, 8.805, 1.320 ], "form": ".", "ssZp": 4.638, "Dp": 4.718, "splay_angle": 80.345, "splay_distance": 11.058, "splay_ratio": 0.647, "d22": null, "d64": null, "eta": 175.468, "theta": -77.472, "eta_prime": -160.156, "theta_prime": -135.481, "eta_base": -92.295, "theta_base": 160.056, "v0": 0.705, "v1": -23.525, "v2": 35.966, "v3": -36.472, "v4": 22.582, "amplitude": 37.703, "phase_angle": 17.464, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.720, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 140.307, 100.516, 77.868 ], "x_axis": [ -0.755, 0.230, -0.614 ], "y_axis": [ 0.396, 0.906, -0.148 ], "z_axis": [ 0.522, -0.355, -0.776 ], "quaternion": [ 0.306, 0.169, 0.927, -0.135 ] } }, { "index": 18, "index_chain": 18, "chain_name": "S", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///S/18", "linked_nts": [ "///S/17", "///S/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": 170.927, "beta": 143.216, "gamma": 40.481, "delta": 85.326, "epsilon": -102.563, "zeta": -102.459, "epsilon_zeta": -0.104, "bb_type": "--", "chi": -164.260, "glyco_bond": "anti", "C5prime_xyz": [ -0.865, 8.436, 0.882 ], "P_xyz": [ 1.676, 7.819, 0.992 ], "form": ".", "ssZp": 4.284, "Dp": 4.796, "splay_angle": 24.402, "splay_distance": 3.833, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 2.302, "theta": -120.069, "eta_prime": 48.545, "theta_prime": -115.534, "eta_base": 33.662, "theta_base": -65.603, "v0": 9.433, "v1": -28.558, "v2": 35.952, "v3": -31.514, "v4": 14.028, "amplitude": 36.036, "phase_angle": 3.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.216, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 151.027, 98.213, 79.309 ], "x_axis": [ 0.194, 0.761, 0.619 ], "y_axis": [ -0.310, 0.646, -0.697 ], "z_axis": [ -0.931, -0.057, 0.361 ], "quaternion": [ 0.742, -0.216, -0.522, 0.361 ] } }, { "index": 19, "index_chain": 19, "chain_name": "S", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///S/19", "linked_nts": [ "///S/18", "///S/20" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart", "alpha": -39.988, "beta": 133.123, "gamma": 50.495, "delta": 84.591, "epsilon": 165.821, "zeta": -152.107, "epsilon_zeta": -42.072, "bb_type": "--", "chi": -154.297, "glyco_bond": "anti", "C5prime_xyz": [ -1.048, 8.611, 0.251 ], "P_xyz": [ 1.465, 8.129, -0.191 ], "form": ".", "ssZp": 3.996, "Dp": 4.147, "splay_angle": 86.207, "splay_distance": 13.653, "splay_ratio": 0.686, "d22": null, "d64": null, "eta": 153.712, "theta": 141.025, "eta_prime": -172.471, "theta_prime": 101.863, "eta_base": -98.070, "theta_base": 90.761, "v0": 3.414, "v1": -23.046, "v2": 32.716, "v3": -31.785, "v4": 18.002, "amplitude": 33.583, "phase_angle": 13.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.577, "filter_rmsd": 0.039, "frame": { "rmsd": 0.019, "origin": [ 148.756, 100.934, 80.771 ], "x_axis": [ 0.108, 0.966, -0.234 ], "y_axis": [ -0.605, -0.123, -0.786 ], "z_axis": [ -0.789, 0.226, 0.572 ], "quaternion": [ 0.624, -0.406, -0.222, 0.630 ] } }, { "index": 20, "index_chain": 20, "chain_name": "S", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///S/20", "linked_nts": [ "///S/19", "///S/21" ], "nt_type": "RNA", "dbn": "(", "summary": "u-turn,anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": 63.723, "beta": -84.141, "gamma": -126.593, "delta": 84.108, "epsilon": -160.402, "zeta": -59.582, "epsilon_zeta": -100.821, "bb_type": "BI", "chi": -172.216, "glyco_bond": "anti", "C5prime_xyz": [ -1.313, 8.651, 1.233 ], "P_xyz": [ -1.630, 10.626, -0.476 ], "form": "A", "ssZp": 4.389, "Dp": 4.437, "splay_angle": 24.295, "splay_distance": 3.885, "splay_ratio": 0.213, "d22": 4.486, "d64": 4.605, "eta": -137.517, "theta": 151.958, "eta_prime": -167.602, "theta_prime": 175.264, "eta_base": -168.309, "theta_base": -150.385, "v0": 0.338, "v1": -20.841, "v2": 32.265, "v3": -32.904, "v4": 20.564, "amplitude": 33.928, "phase_angle": 18.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 146.478, 88.995, 74.553 ], "x_axis": [ 0.270, -0.387, 0.882 ], "y_axis": [ -0.533, 0.702, 0.472 ], "z_axis": [ -0.802, -0.597, -0.017 ], "quaternion": [ 0.699, 0.382, -0.602, 0.052 ] } }, { "index": 21, "index_chain": 21, "chain_name": "S", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///S/21", "linked_nts": [ "///S/20", "///S/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.148, "beta": -167.003, "gamma": 51.530, "delta": 78.581, "epsilon": -147.771, "zeta": -73.118, "epsilon_zeta": -74.653, "bb_type": "BI", "chi": -165.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.726, 0.793 ], "P_xyz": [ 1.000, 9.259, 1.490 ], "form": "A", "ssZp": 4.575, "Dp": 4.679, "splay_angle": 20.573, "splay_distance": 3.242, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 161.147, "theta": -153.498, "eta_prime": 173.925, "theta_prime": -153.985, "eta_base": -144.981, "theta_base": -131.774, "v0": 0.818, "v1": -24.618, "v2": 37.738, "v3": -38.307, "v4": 23.563, "amplitude": 39.551, "phase_angle": 17.416, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.565, "filter_rmsd": 0.057, "frame": { "rmsd": 0.013, "origin": [ 144.792, 85.523, 74.116 ], "x_axis": [ -0.025, 0.111, 0.994 ], "y_axis": [ -0.551, 0.827, -0.106 ], "z_axis": [ -0.834, -0.550, 0.040 ], "quaternion": [ 0.679, 0.164, -0.673, 0.244 ] } }, { "index": 22, "index_chain": 22, "chain_name": "S", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///S/22", "linked_nts": [ "///S/21", "///S/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -92.623, "beta": 150.428, "gamma": 89.444, "delta": 78.858, "epsilon": -143.381, "zeta": -122.181, "epsilon_zeta": -21.200, "bb_type": "--", "chi": 175.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.470, 8.262, 1.897 ], "P_xyz": [ 0.891, 9.103, 1.203 ], "form": "A", "ssZp": 4.759, "Dp": 4.738, "splay_angle": 25.170, "splay_distance": 3.675, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 159.293, "theta": -151.185, "eta_prime": 173.762, "theta_prime": -148.975, "eta_base": -146.462, "theta_base": -119.624, "v0": 4.611, "v1": -27.988, "v2": 39.613, "v3": -37.919, "v4": 21.003, "amplitude": 40.526, "phase_angle": 12.183, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 143.421, 82.646, 74.708 ], "x_axis": [ -0.201, 0.495, 0.845 ], "y_axis": [ -0.550, 0.657, -0.516 ], "z_axis": [ -0.811, -0.568, 0.140 ], "quaternion": [ 0.632, 0.021, -0.655, 0.413 ] } }, { "index": 23, "index_chain": 23, "chain_name": "S", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///S/23", "linked_nts": [ "///S/22", "///S/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 35.530, "beta": 114.279, "gamma": 4.548, "delta": 78.988, "epsilon": -136.015, "zeta": -82.971, "epsilon_zeta": -53.044, "bb_type": "BI", "chi": -164.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.584, 8.664, 0.783 ], "P_xyz": [ 0.745, 8.379, 1.908 ], "form": "A", "ssZp": 4.488, "Dp": 4.691, "splay_angle": 21.138, "splay_distance": 3.282, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": -179.988, "theta": -134.911, "eta_prime": -173.774, "theta_prime": -131.330, "eta_base": -136.834, "theta_base": -88.611, "v0": 0.472, "v1": -23.879, "v2": 36.919, "v3": -37.712, "v4": 23.444, "amplitude": 38.807, "phase_angle": 17.948, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ 141.578, 80.409, 76.969 ], "x_axis": [ -0.362, 0.877, 0.315 ], "y_axis": [ -0.297, 0.211, -0.931 ], "z_axis": [ -0.884, -0.431, 0.184 ], "quaternion": [ 0.508, -0.246, -0.589, 0.578 ] } }, { "index": 24, "index_chain": 24, "chain_name": "S", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///S/24", "linked_nts": [ "///S/23", "///S/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -53.545, "beta": 152.579, "gamma": 56.282, "delta": 81.814, "epsilon": -138.059, "zeta": -106.786, "epsilon_zeta": -31.273, "bb_type": "--", "chi": -160.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.725, 0.543 ], "P_xyz": [ 1.272, 8.917, 0.205 ], "form": ".", "ssZp": 4.394, "Dp": 4.685, "splay_angle": 24.774, "splay_distance": 3.809, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 167.536, "theta": -149.673, "eta_prime": -175.489, "theta_prime": -145.395, "eta_base": -115.753, "theta_base": -105.401, "v0": 1.769, "v1": -23.689, "v2": 35.312, "v3": -35.262, "v4": 21.181, "amplitude": 36.719, "phase_angle": 15.913, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.669, "filter_rmsd": 0.060, "frame": { "rmsd": 0.012, "origin": [ 138.646, 80.917, 78.355 ], "x_axis": [ -0.427, 0.818, -0.386 ], "y_axis": [ -0.159, -0.488, -0.858 ], "z_axis": [ -0.890, -0.306, 0.338 ], "quaternion": [ 0.325, -0.425, -0.388, 0.751 ] } }, { "index": 25, "index_chain": 25, "chain_name": "S", "nt_resnum": 25, "nt_name": "A", "nt_code": "A", "nt_id": "///S/25", "linked_nts": [ "///S/24", "///S/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -16.092, "beta": 135.696, "gamma": 40.243, "delta": 84.300, "epsilon": 175.237, "zeta": -94.474, "epsilon_zeta": -90.289, "bb_type": "BI", "chi": -139.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.169, 8.591, -0.659 ], "P_xyz": [ 1.382, 8.164, -1.067 ], "form": ".", "ssZp": 3.725, "Dp": 4.263, "splay_angle": 51.767, "splay_distance": 8.086, "splay_ratio": 0.437, "d22": null, "d64": null, "eta": 173.745, "theta": 179.385, "eta_prime": -162.939, "theta_prime": 168.988, "eta_base": -109.607, "theta_base": 167.938, "v0": 3.633, "v1": -23.840, "v2": 33.816, "v3": -32.730, "v4": 18.424, "amplitude": 34.680, "phase_angle": 12.819, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 134.851, 80.934, 78.673 ], "x_axis": [ -0.557, 0.282, -0.781 ], "y_axis": [ -0.035, -0.948, -0.317 ], "z_axis": [ -0.830, -0.149, 0.538 ], "quaternion": [ 0.091, -0.462, -0.134, 0.872 ] } }, { "index": 26, "index_chain": 26, "chain_name": "S", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///S/26", "linked_nts": [ "///S/25", "///S/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -63.958, "beta": 179.966, "gamma": 54.521, "delta": 80.269, "epsilon": -123.136, "zeta": -65.514, "epsilon_zeta": -57.623, "bb_type": "--", "chi": -165.853, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.623, 0.831 ], "P_xyz": [ 1.232, 9.076, 1.189 ], "form": ".", "ssZp": 4.473, "Dp": 4.756, "splay_angle": 44.293, "splay_distance": 6.583, "splay_ratio": 0.378, "d22": null, "d64": null, "eta": -176.288, "theta": -118.052, "eta_prime": 173.977, "theta_prime": -108.740, "eta_base": 171.613, "theta_base": -56.181, "v0": 2.103, "v1": -24.719, "v2": 36.741, "v3": -36.525, "v4": 21.698, "amplitude": 38.132, "phase_angle": 15.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.838, "filter_rmsd": 0.043, "frame": { "rmsd": 0.015, "origin": [ 134.293, 78.777, 86.446 ], "x_axis": [ -0.489, 0.532, -0.692 ], "y_axis": [ 0.043, -0.777, -0.628 ], "z_axis": [ -0.871, -0.336, 0.357 ], "quaternion": [ 0.151, -0.483, -0.298, 0.810 ] } }, { "index": 27, "index_chain": 27, "chain_name": "S", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///S/27", "linked_nts": [ "///S/26", "///S/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -55.280, "beta": 158.933, "gamma": 53.836, "delta": 85.026, "epsilon": -149.224, "zeta": -70.812, "epsilon_zeta": -78.411, "bb_type": "BI", "chi": -174.905, "glyco_bond": "anti", "C5prime_xyz": [ -1.148, 8.338, 1.413 ], "P_xyz": [ 1.460, 8.237, 1.534 ], "form": "A", "ssZp": 4.651, "Dp": 4.655, "splay_angle": 26.313, "splay_distance": 4.154, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 158.724, "theta": -137.334, "eta_prime": -167.674, "theta_prime": -140.006, "eta_base": -88.470, "theta_base": -128.496, "v0": 6.487, "v1": -26.949, "v2": 35.980, "v3": -33.263, "v4": 16.887, "amplitude": 36.388, "phase_angle": 8.583, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.580, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 129.380, 77.848, 82.164 ], "x_axis": [ 0.121, -0.490, -0.863 ], "y_axis": [ 0.449, -0.749, 0.488 ], "z_axis": [ -0.885, -0.446, 0.130 ], "quaternion": [ -0.354, -0.660, 0.016, 0.663 ] } }, { "index": 28, "index_chain": 28, "chain_name": "S", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///S/28", "linked_nts": [ "///S/27", "///S/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.495, "beta": 165.998, "gamma": 64.122, "delta": 77.048, "epsilon": -122.867, "zeta": -85.542, "epsilon_zeta": -37.325, "bb_type": "--", "chi": -176.716, "glyco_bond": "anti", "C5prime_xyz": [ -1.672, 8.553, 1.451 ], "P_xyz": [ 0.840, 9.196, 1.595 ], "form": "A", "ssZp": 4.697, "Dp": 4.745, "splay_angle": 22.768, "splay_distance": 3.528, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 177.141, "theta": -146.168, "eta_prime": -169.137, "theta_prime": -145.609, "eta_base": -137.986, "theta_base": -113.507, "v0": 0.512, "v1": -25.304, "v2": 39.072, "v3": -39.775, "v4": 24.708, "amplitude": 41.042, "phase_angle": 17.825, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 125.333, 78.075, 81.255 ], "x_axis": [ 0.175, -0.822, -0.542 ], "y_axis": [ 0.393, -0.447, 0.804 ], "z_axis": [ -0.903, -0.354, 0.245 ], "quaternion": [ -0.493, -0.587, 0.183, 0.616 ] } }, { "index": 29, "index_chain": 29, "chain_name": "S", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///S/29", "linked_nts": [ "///S/28", "///S/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -71.889, "beta": 134.044, "gamma": 84.198, "delta": 78.645, "epsilon": -123.283, "zeta": -109.707, "epsilon_zeta": -13.576, "bb_type": "--", "chi": 168.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.884, 8.057, 2.203 ], "P_xyz": [ 0.497, 8.934, 1.633 ], "form": ".", "ssZp": 4.739, "Dp": 4.747, "splay_angle": 26.693, "splay_distance": 3.923, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 163.990, "theta": -140.060, "eta_prime": -179.165, "theta_prime": -138.730, "eta_base": -127.960, "theta_base": -90.591, "v0": 1.686, "v1": -25.509, "v2": 38.386, "v3": -38.370, "v4": 23.135, "amplitude": 39.972, "phase_angle": 16.194, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.226, "filter_rmsd": 0.052, "frame": { "rmsd": 0.027, "origin": [ 122.320, 76.522, 80.278 ], "x_axis": [ 0.421, -0.906, -0.050 ], "y_axis": [ 0.233, 0.055, 0.971 ], "z_axis": [ -0.877, -0.420, 0.234 ], "quaternion": [ 0.654, 0.532, -0.316, -0.435 ] } }, { "index": 30, "index_chain": 30, "chain_name": "S", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///S/30", "linked_nts": [ "///S/29", "///S/31" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": 1.361, "beta": 131.836, "gamma": 20.159, "delta": 83.212, "epsilon": -148.044, "zeta": -76.951, "epsilon_zeta": -71.093, "bb_type": "BI", "chi": -164.675, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.690, 0.795 ], "P_xyz": [ 1.257, 8.452, 1.543 ], "form": "A", "ssZp": 4.421, "Dp": 4.534, "splay_angle": 21.334, "splay_distance": 3.305, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 168.999, "theta": -139.133, "eta_prime": -173.371, "theta_prime": -131.270, "eta_base": -106.021, "theta_base": -100.956, "v0": -0.421, "v1": -21.446, "v2": 33.914, "v3": -35.077, "v4": 22.296, "amplitude": 35.911, "phase_angle": 19.200, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.024, "origin": [ 120.544, 73.030, 80.484 ], "x_axis": [ 0.428, -0.490, 0.760 ], "y_axis": [ -0.216, 0.760, 0.612 ], "z_axis": [ -0.878, -0.426, 0.219 ], "quaternion": [ 0.776, 0.335, -0.528, -0.088 ] } }, { "index": 31, "index_chain": 31, "chain_name": "S", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///S/31", "linked_nts": [ "///S/30", "///S/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate", "alpha": -58.831, "beta": 159.098, "gamma": 76.011, "delta": 151.035, "epsilon": -157.021, "zeta": 170.579, "epsilon_zeta": 32.400, "bb_type": "--", "chi": -149.836, "glyco_bond": "anti", "C5prime_xyz": [ -2.082, 8.583, 0.429 ], "P_xyz": [ 0.366, 8.905, 1.219 ], "form": ".", "ssZp": 1.364, "Dp": 1.957, "splay_angle": 55.535, "splay_distance": 7.698, "splay_ratio": 0.476, "d22": null, "d64": null, "eta": 168.586, "theta": 178.387, "eta_prime": -141.353, "theta_prime": 107.501, "eta_base": -97.907, "theta_base": 60.009, "v0": -23.223, "v1": 38.275, "v2": -37.731, "v3": 25.396, "v4": -1.587, "amplitude": 39.362, "phase_angle": 163.446, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.434, "filter_rmsd": 0.046, "frame": { "rmsd": 0.028, "origin": [ 118.670, 70.588, 81.687 ], "x_axis": [ 0.480, 0.150, 0.864 ], "y_axis": [ -0.457, 0.884, 0.101 ], "z_axis": [ -0.749, -0.444, 0.493 ], "quaternion": [ 0.845, 0.161, -0.477, 0.180 ] } }, { "index": 32, "index_chain": 32, "chain_name": "S", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///S/32", "linked_nts": [ "///S/31", "///S/33" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart", "alpha": 49.419, "beta": -142.883, "gamma": 170.141, "delta": 84.603, "epsilon": -141.293, "zeta": -60.694, "epsilon_zeta": -80.599, "bb_type": "BI", "chi": 60.620, "glyco_bond": "syn", "C5prime_xyz": [ -5.133, 4.035, 1.841 ], "P_xyz": [ -4.609, 3.461, 4.339 ], "form": ".", "ssZp": -2.300, "Dp": 4.507, "splay_angle": 120.019, "splay_distance": 14.121, "splay_ratio": 0.867, "d22": null, "d64": null, "eta": 93.142, "theta": -101.433, "eta_prime": 82.619, "theta_prime": -132.668, "eta_base": 83.459, "theta_base": -158.123, "v0": -1.687, "v1": -19.607, "v2": 32.124, "v3": -33.955, "v4": 22.509, "amplitude": 34.478, "phase_angle": 21.298, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.019, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ 118.139, 77.664, 78.704 ], "x_axis": [ 0.204, 0.939, 0.276 ], "y_axis": [ -0.573, 0.343, -0.745 ], "z_axis": [ -0.794, -0.007, 0.608 ], "quaternion": [ 0.734, -0.251, -0.365, 0.515 ] } }, { "index": 33, "index_chain": 33, "chain_name": "S", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///S/33", "linked_nts": [ "///S/32", "///S/34" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BII,non-stack,hairpin-loop,splayed-apart", "alpha": 92.581, "beta": 135.557, "gamma": 54.614, "delta": 81.770, "epsilon": -134.697, "zeta": 143.793, "epsilon_zeta": 81.510, "bb_type": "BII", "chi": -146.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.701, -0.292 ], "P_xyz": [ 1.078, 8.519, -1.191 ], "form": ".", "ssZp": 3.828, "Dp": 4.684, "splay_angle": 93.627, "splay_distance": 13.963, "splay_ratio": 0.729, "d22": 7.475, "d64": 9.355, "eta": -73.096, "theta": 98.958, "eta_prime": -33.229, "theta_prime": 87.290, "eta_base": -58.171, "theta_base": 75.766, "v0": 2.477, "v1": -24.375, "v2": 35.670, "v3": -35.305, "v4": 20.754, "amplitude": 36.911, "phase_angle": 14.899, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.027, "filter_rmsd": 0.101, "frame": { "rmsd": 0.007, "origin": [ 123.053, 68.936, 68.751 ], "x_axis": [ -0.750, -0.369, -0.549 ], "y_axis": [ -0.638, 0.622, 0.454 ], "z_axis": [ 0.174, 0.690, -0.702 ], "quaternion": [ 0.206, -0.287, 0.877, 0.326 ] } }, { "index": 34, "index_chain": 34, "chain_name": "S", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///S/34", "linked_nts": [ "///S/33", "///S/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -43.673, "beta": 132.250, "gamma": -25.900, "delta": 85.603, "epsilon": 171.135, "zeta": -76.114, "epsilon_zeta": -112.750, "bb_type": "BI", "chi": -141.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.661, -0.528 ], "P_xyz": [ 0.448, 9.718, 0.839 ], "form": "A", "ssZp": 3.743, "Dp": 4.124, "splay_angle": 20.795, "splay_distance": 3.610, "splay_ratio": 0.187, "d22": 4.348, "d64": 4.781, "eta": 128.940, "theta": -150.505, "eta_prime": 131.010, "theta_prime": -156.079, "eta_base": 139.970, "theta_base": -141.693, "v0": 1.032, "v1": -21.200, "v2": 32.201, "v3": -32.501, "v4": 19.892, "amplitude": 33.659, "phase_angle": 16.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.099, "frame": { "rmsd": 0.014, "origin": [ 122.822, 76.766, 80.309 ], "x_axis": [ 0.329, -0.918, -0.222 ], "y_axis": [ -0.379, 0.087, -0.921 ], "z_axis": [ 0.865, 0.387, -0.319 ], "quaternion": [ 0.524, -0.625, 0.519, -0.257 ] } }, { "index": 35, "index_chain": 35, "chain_name": "S", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///S/35", "linked_nts": [ "///S/34", "///S/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 148.496, "beta": -158.672, "gamma": 179.778, "delta": 85.508, "epsilon": -157.010, "zeta": -83.530, "epsilon_zeta": -73.480, "bb_type": "BI", "chi": -171.843, "glyco_bond": "anti", "C5prime_xyz": [ -1.162, 8.561, 1.294 ], "P_xyz": [ 0.664, 10.114, 0.285 ], "form": "A", "ssZp": 4.347, "Dp": 4.418, "splay_angle": 21.041, "splay_distance": 3.682, "splay_ratio": 0.194, "d22": 4.555, "d64": 5.216, "eta": 169.162, "theta": -149.731, "eta_prime": 178.425, "theta_prime": -157.547, "eta_base": -154.337, "theta_base": -138.603, "v0": 1.265, "v1": -20.948, "v2": 31.736, "v3": -31.887, "v4": 19.259, "amplitude": 33.099, "phase_angle": 16.500, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.586, "filter_rmsd": 0.066, "frame": { "rmsd": 0.011, "origin": [ 126.042, 78.114, 81.232 ], "x_axis": [ 0.129, -0.847, -0.516 ], "y_axis": [ -0.428, 0.422, -0.799 ], "z_axis": [ 0.894, 0.324, -0.309 ], "quaternion": [ 0.557, -0.504, 0.633, -0.188 ] } }, { "index": 36, "index_chain": 36, "chain_name": "S", "nt_resnum": 36, "nt_name": "C", "nt_code": "C", "nt_id": "///S/36", "linked_nts": [ "///S/35", "///S/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 137.513, "beta": -152.472, "gamma": -170.694, "delta": 83.152, "epsilon": -110.642, "zeta": -81.302, "epsilon_zeta": -29.341, "bb_type": "--", "chi": -179.827, "glyco_bond": "anti", "C5prime_xyz": [ -1.036, 8.274, 1.708 ], "P_xyz": [ 0.566, 10.076, 0.730 ], "form": ".", "ssZp": 4.717, "Dp": 4.773, "splay_angle": 27.170, "splay_distance": 4.208, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 168.353, "theta": -151.135, "eta_prime": -178.802, "theta_prime": -140.927, "eta_base": -142.152, "theta_base": -88.911, "v0": 5.989, "v1": -27.583, "v2": 37.529, "v3": -35.098, "v4": 18.294, "amplitude": 38.077, "phase_angle": 9.737, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.583, "filter_rmsd": 0.062, "frame": { "rmsd": 0.015, "origin": [ 129.600, 77.691, 82.079 ], "x_axis": [ 0.117, -0.496, -0.860 ], "y_axis": [ -0.374, 0.780, -0.501 ], "z_axis": [ 0.920, 0.380, -0.095 ], "quaternion": [ 0.671, -0.328, 0.663, -0.045 ] } }, { "index": 37, "index_chain": 37, "chain_name": "S", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///S/37", "linked_nts": [ "///S/36", "///S/38" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -49.549, "beta": 139.986, "gamma": 64.227, "delta": 83.249, "epsilon": -134.739, "zeta": -127.439, "epsilon_zeta": -7.300, "bb_type": "--", "chi": -177.757, "glyco_bond": "anti", "C5prime_xyz": [ -1.972, 8.520, 1.451 ], "P_xyz": [ 0.580, 8.969, 1.417 ], "form": ".", "ssZp": 4.440, "Dp": 4.475, "splay_angle": 46.011, "splay_distance": 7.045, "splay_ratio": 0.391, "d22": null, "d64": null, "eta": 163.884, "theta": 173.102, "eta_prime": -166.611, "theta_prime": 176.141, "eta_base": -96.109, "theta_base": 175.052, "v0": -5.388, "v1": -17.306, "v2": 31.984, "v3": -36.045, "v4": 26.131, "amplitude": 35.911, "phase_angle": 27.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.870, "filter_rmsd": 0.042, "frame": { "rmsd": 0.019, "origin": [ 132.500, 77.390, 79.045 ], "x_axis": [ -0.294, 0.193, -0.936 ], "y_axis": [ -0.286, 0.917, 0.279 ], "z_axis": [ 0.912, 0.350, -0.214 ], "quaternion": [ 0.593, -0.030, 0.779, 0.202 ] } }, { "index": 38, "index_chain": 38, "chain_name": "S", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///S/38", "linked_nts": [ "///S/37", "///S/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -68.558, "beta": 161.606, "gamma": 53.752, "delta": 82.629, "epsilon": -150.031, "zeta": -54.725, "epsilon_zeta": -95.306, "bb_type": "BI", "chi": -167.416, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.600, 0.921 ], "P_xyz": [ 1.078, 8.991, 1.016 ], "form": ".", "ssZp": 4.553, "Dp": 4.616, "splay_angle": 33.804, "splay_distance": 5.132, "splay_ratio": 0.291, "d22": null, "d64": null, "eta": 173.640, "theta": -125.935, "eta_prime": 167.352, "theta_prime": -125.645, "eta_base": 162.833, "theta_base": -82.534, "v0": 0.630, "v1": -23.089, "v2": 35.350, "v3": -35.945, "v4": 22.278, "amplitude": 37.085, "phase_angle": 17.596, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.811, "filter_rmsd": 0.040, "frame": { "rmsd": 0.018, "origin": [ 137.784, 75.236, 83.177 ], "x_axis": [ -0.389, 0.100, -0.916 ], "y_axis": [ -0.263, 0.941, 0.215 ], "z_axis": [ 0.883, 0.324, -0.340 ], "quaternion": [ 0.550, -0.050, 0.817, 0.165 ] } }, { "index": 39, "index_chain": 39, "chain_name": "S", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///S/39", "linked_nts": [ "///S/38", "///S/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -74.667, "beta": 170.472, "gamma": 59.942, "delta": 80.408, "epsilon": -131.100, "zeta": -106.705, "epsilon_zeta": -24.396, "bb_type": "--", "chi": 176.119, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.240, 1.864 ], "P_xyz": [ 0.908, 8.578, 2.374 ], "form": "A", "ssZp": 4.790, "Dp": 4.757, "splay_angle": 26.310, "splay_distance": 3.895, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 164.201, "theta": -139.594, "eta_prime": -172.074, "theta_prime": -133.696, "eta_base": -101.889, "theta_base": -89.255, "v0": 2.967, "v1": -25.723, "v2": 37.512, "v3": -36.750, "v4": 21.291, "amplitude": 38.706, "phase_angle": 14.264, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.041, "frame": { "rmsd": 0.013, "origin": [ 139.766, 77.353, 78.943 ], "x_axis": [ -0.561, 0.761, -0.327 ], "y_axis": [ 0.007, 0.399, 0.917 ], "z_axis": [ 0.828, 0.512, -0.229 ], "quaternion": [ 0.390, 0.260, 0.740, 0.483 ] } }, { "index": 40, "index_chain": 40, "chain_name": "S", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///S/40", "linked_nts": [ "///S/39", "///S/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 1.139, "beta": 130.764, "gamma": 18.355, "delta": 76.525, "epsilon": -152.487, "zeta": -85.656, "epsilon_zeta": -66.831, "bb_type": "BI", "chi": -168.093, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.625, 0.987 ], "P_xyz": [ 1.061, 8.527, 1.550 ], "form": "A", "ssZp": 4.629, "Dp": 4.668, "splay_angle": 24.552, "splay_distance": 3.670, "splay_ratio": 0.214, "d22": 4.397, "d64": 4.465, "eta": 165.047, "theta": -152.676, "eta_prime": -177.526, "theta_prime": -150.399, "eta_base": -113.598, "theta_base": -127.503, "v0": 3.173, "v1": -27.260, "v2": 39.814, "v3": -39.011, "v4": 22.489, "amplitude": 41.073, "phase_angle": 14.227, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.009, "origin": [ 141.140, 80.346, 76.863 ], "x_axis": [ -0.340, 0.835, 0.432 ], "y_axis": [ 0.417, -0.277, 0.866 ], "z_axis": [ 0.843, 0.475, -0.254 ], "quaternion": [ 0.179, 0.546, 0.574, 0.584 ] } }, { "index": 41, "index_chain": 41, "chain_name": "S", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///S/41", "linked_nts": [ "///S/40", "///S/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.519, "beta": 170.078, "gamma": 38.415, "delta": 79.665, "epsilon": -138.713, "zeta": -94.556, "epsilon_zeta": -44.157, "bb_type": "BI", "chi": -167.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.098, 8.545, 0.958 ], "P_xyz": [ 1.463, 8.548, 1.494 ], "form": "A", "ssZp": 4.593, "Dp": 4.739, "splay_angle": 23.457, "splay_distance": 3.537, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 175.396, "theta": -150.980, "eta_prime": -178.841, "theta_prime": -147.237, "eta_base": -145.758, "theta_base": -125.735, "v0": 6.181, "v1": -28.879, "v2": 39.629, "v3": -37.119, "v4": 19.365, "amplitude": 40.236, "phase_angle": 9.963, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.355, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 142.967, 82.745, 74.771 ], "x_axis": [ -0.175, 0.496, 0.850 ], "y_axis": [ 0.546, -0.670, 0.503 ], "z_axis": [ 0.819, 0.553, -0.154 ], "quaternion": [ -0.019, 0.642, 0.406, 0.650 ] } }, { "index": 42, "index_chain": 42, "chain_name": "S", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///S/42", "linked_nts": [ "///S/41", "///S/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -33.658, "beta": 150.620, "gamma": 39.770, "delta": 78.410, "epsilon": -141.746, "zeta": -85.723, "epsilon_zeta": -56.023, "bb_type": "BI", "chi": -174.545, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.445, 1.356 ], "P_xyz": [ 1.120, 8.612, 1.568 ], "form": "A", "ssZp": 4.732, "Dp": 4.742, "splay_angle": 23.800, "splay_distance": 3.621, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 168.955, "theta": -147.619, "eta_prime": 179.605, "theta_prime": -146.673, "eta_base": -144.950, "theta_base": -123.789, "v0": 5.466, "v1": -28.502, "v2": 39.574, "v3": -37.568, "v4": 20.172, "amplitude": 40.321, "phase_angle": 11.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.143, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 144.679, 85.718, 73.911 ], "x_axis": [ -0.022, 0.060, 0.998 ], "y_axis": [ 0.568, -0.821, 0.062 ], "z_axis": [ 0.823, 0.568, -0.016 ], "quaternion": [ -0.188, 0.674, 0.233, 0.676 ] } }, { "index": 43, "index_chain": 43, "chain_name": "S", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///S/43", "linked_nts": [ "///S/42", "///S/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -46.450, "beta": 157.250, "gamma": 50.505, "delta": 78.638, "epsilon": -113.365, "zeta": -102.175, "epsilon_zeta": -11.191, "bb_type": "--", "chi": -177.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.526, 8.412, 1.510 ], "P_xyz": [ 1.057, 8.752, 1.678 ], "form": ".", "ssZp": 4.727, "Dp": 4.813, "splay_angle": 29.419, "splay_distance": 4.297, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 177.855, "theta": -142.861, "eta_prime": -173.061, "theta_prime": -136.364, "eta_base": -136.879, "theta_base": -91.087, "v0": 4.634, "v1": -27.791, "v2": 39.231, "v3": -37.693, "v4": 20.742, "amplitude": 40.131, "phase_angle": 12.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.588, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 146.016, 89.017, 74.574 ], "x_axis": [ 0.255, -0.383, 0.888 ], "y_axis": [ 0.509, -0.728, -0.459 ], "z_axis": [ 0.822, 0.569, 0.009 ], "quaternion": [ -0.366, 0.702, 0.045, 0.609 ] } }, { "index": 44, "index_chain": 44, "chain_name": "S", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///S/44", "linked_nts": [ "///S/43", "///S/45" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -49.194, "beta": 143.153, "gamma": 56.025, "delta": 81.030, "epsilon": -129.251, "zeta": -100.126, "epsilon_zeta": -29.124, "bb_type": "--", "chi": -171.559, "glyco_bond": "anti", "C5prime_xyz": [ -0.953, 8.371, 1.185 ], "P_xyz": [ 1.593, 8.164, 0.616 ], "form": "A", "ssZp": 4.726, "Dp": 4.834, "splay_angle": 23.463, "splay_distance": 3.400, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 166.667, "theta": -147.037, "eta_prime": -178.285, "theta_prime": -147.862, "eta_base": -118.325, "theta_base": -122.287, "v0": 8.746, "v1": -30.504, "v2": 39.475, "v3": -35.501, "v4": 16.899, "amplitude": 39.706, "phase_angle": 6.177, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.777, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ 149.602, 90.092, 76.683 ], "x_axis": [ 0.490, -0.841, 0.230 ], "y_axis": [ 0.208, -0.144, -0.968 ], "z_axis": [ 0.847, 0.522, 0.104 ], "quaternion": [ 0.602, -0.618, 0.256, -0.435 ] } }, { "index": 45, "index_chain": 45, "chain_name": "S", "nt_resnum": 45, "nt_name": "A", "nt_code": "A", "nt_id": "///S/45", "linked_nts": [ "///S/44", "///S/46" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -45.520, "beta": 146.000, "gamma": 49.293, "delta": 82.423, "epsilon": -119.466, "zeta": -113.969, "epsilon_zeta": -5.498, "bb_type": "--", "chi": -178.295, "glyco_bond": "anti", "C5prime_xyz": [ -1.035, 8.225, 1.616 ], "P_xyz": [ 1.546, 7.899, 1.626 ], "form": "A", "ssZp": 4.769, "Dp": 4.817, "splay_angle": 22.298, "splay_distance": 3.277, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 172.841, "theta": -146.180, "eta_prime": -177.642, "theta_prime": -142.231, "eta_base": -136.476, "theta_base": -117.595, "v0": 7.193, "v1": -28.673, "v2": 38.233, "v3": -35.078, "v4": 17.611, "amplitude": 38.622, "phase_angle": 8.136, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.246, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ 152.520, 91.246, 77.996 ], "x_axis": [ 0.345, -0.855, -0.388 ], "y_axis": [ -0.089, 0.382, -0.920 ], "z_axis": [ 0.934, 0.352, 0.056 ], "quaternion": [ 0.668, -0.476, 0.495, -0.287 ] } }, { "index": 46, "index_chain": 46, "chain_name": "S", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///S/46", "linked_nts": [ "///S/45", "///S/47" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.084, "beta": 133.643, "gamma": 43.511, "delta": 81.098, "epsilon": -108.426, "zeta": -104.712, "epsilon_zeta": -3.714, "bb_type": "--", "chi": -171.195, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.543, 1.223 ], "P_xyz": [ 1.273, 8.189, 1.253 ], "form": ".", "ssZp": 4.497, "Dp": 4.752, "splay_angle": 21.202, "splay_distance": 3.274, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 176.818, "theta": -141.813, "eta_prime": -173.633, "theta_prime": -133.636, "eta_base": -138.103, "theta_base": -99.589, "v0": 4.437, "v1": -26.514, "v2": 37.431, "v3": -35.921, "v4": 19.806, "amplitude": 38.287, "phase_angle": 12.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.221, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 155.645, 91.548, 78.931 ], "x_axis": [ 0.138, -0.542, -0.829 ], "y_axis": [ -0.194, 0.806, -0.559 ], "z_axis": [ 0.971, 0.238, 0.006 ], "quaternion": [ 0.698, -0.285, 0.645, -0.124 ] } }, { "index": 47, "index_chain": 47, "chain_name": "S", "nt_resnum": 47, "nt_name": "C", "nt_code": "C", "nt_id": "///S/47", "linked_nts": [ "///S/46", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -60.240, "beta": 103.509, "gamma": 109.433, "delta": 149.486, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -160.230, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.587, 1.001 ], "P_xyz": [ 0.760, 8.530, -0.110 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -19.156, "v1": 34.429, "v2": -35.768, "v3": 25.615, "v4": -4.236, "amplitude": 36.590, "phase_angle": 167.833, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 158.765, 91.527, 77.941 ], "x_axis": [ -0.028, -0.006, -1.000 ], "y_axis": [ -0.050, 0.999, -0.004 ], "z_axis": [ 0.998, 0.050, -0.028 ], "quaternion": [ 0.697, -0.019, 0.717, 0.016 ] } }, { "index": 48, "index_chain": 48, "chain_name": "S", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///S/49", "linked_nts": [ null, "///S/50" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,phosphate", "alpha": null, "beta": -146.184, "gamma": 124.453, "delta": 153.798, "epsilon": -90.905, "zeta": 21.477, "epsilon_zeta": 247.618, "bb_type": "--", "chi": -122.128, "glyco_bond": "anti", "C5prime_xyz": [ -2.027, 8.516, -1.019 ], "P_xyz": [ 0.587, 8.613, -1.189 ], "form": ".", "ssZp": 0.437, "Dp": 0.500, "splay_angle": 33.632, "splay_distance": 5.557, "splay_ratio": 0.327, "d22": null, "d64": null, "eta": null, "theta": 80.846, "eta_prime": null, "theta_prime": 64.852, "eta_base": null, "theta_base": 67.591, "v0": -21.266, "v1": 38.040, "v2": -39.259, "v3": 28.010, "v4": -4.465, "amplitude": 40.215, "phase_angle": 167.480, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.006, "origin": [ 161.903, 95.537, 75.288 ], "x_axis": [ -0.031, 0.903, 0.429 ], "y_axis": [ 0.173, -0.418, 0.892 ], "z_axis": [ 0.984, 0.102, -0.143 ], "quaternion": [ 0.319, 0.618, 0.435, 0.571 ] } }, { "index": 49, "index_chain": 49, "chain_name": "S", "nt_resnum": 50, "nt_name": "G", "nt_code": "G", "nt_id": "///S/50", "linked_nts": [ "///S/49", "///S/51" ], "nt_type": "RNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,cap-acceptor", "alpha": 144.350, "beta": -119.776, "gamma": 154.735, "delta": 155.512, "epsilon": -153.371, "zeta": -177.038, "epsilon_zeta": 23.667, "bb_type": "--", "chi": -74.320, "glyco_bond": "--", "C5prime_xyz": [ -3.013, 7.011, -2.850 ], "P_xyz": [ -1.051, 5.795, -4.078 ], "form": "B", "ssZp": 1.421, "Dp": 1.657, "splay_angle": 19.679, "splay_distance": 3.334, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 134.732, "theta": -126.440, "eta_prime": -145.951, "theta_prime": 142.772, "eta_base": -169.081, "theta_base": -166.570, "v0": -19.016, "v1": 36.820, "v2": -39.569, "v3": 29.660, "v4": -6.940, "amplitude": 40.060, "phase_angle": 171.024, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 158.886, 91.777, 78.051 ], "x_axis": [ 0.020, -0.032, -0.999 ], "y_axis": [ 0.166, -0.986, 0.035 ], "z_axis": [ -0.986, -0.167, -0.015 ], "quaternion": [ 0.071, 0.711, 0.047, -0.698 ] } }, { "index": 50, "index_chain": 50, "chain_name": "S", "nt_resnum": 51, "nt_name": "C", "nt_code": "C", "nt_id": "///S/51", "linked_nts": [ "///S/50", "///S/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 95.598, "beta": -127.664, "gamma": -178.563, "delta": 82.691, "epsilon": -164.461, "zeta": -93.603, "epsilon_zeta": -70.858, "bb_type": "BI", "chi": -163.013, "glyco_bond": "anti", "C5prime_xyz": [ -1.253, 8.746, 0.696 ], "P_xyz": [ 0.215, 9.682, -1.261 ], "form": "A", "ssZp": 4.368, "Dp": 4.447, "splay_angle": 18.625, "splay_distance": 2.888, "splay_ratio": 0.162, "d22": 4.119, "d64": 3.535, "eta": 150.579, "theta": -155.634, "eta_prime": 148.783, "theta_prime": -164.396, "eta_base": -155.607, "theta_base": -133.758, "v0": 0.549, "v1": -22.121, "v2": 34.068, "v3": -34.692, "v4": 21.504, "amplitude": 35.767, "phase_angle": 17.732, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.232, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 155.613, 91.637, 78.668 ], "x_axis": [ 0.031, -0.567, -0.823 ], "y_axis": [ 0.189, -0.805, 0.562 ], "z_axis": [ -0.982, -0.173, 0.082 ], "quaternion": [ -0.277, -0.662, 0.143, 0.681 ] } }, { "index": 51, "index_chain": 51, "chain_name": "S", "nt_resnum": 52, "nt_name": "U", "nt_code": "U", "nt_id": "///S/52", "linked_nts": [ "///S/51", "///S/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": 175.468, "beta": -137.293, "gamma": 141.377, "delta": 85.641, "epsilon": -81.635, "zeta": -139.303, "epsilon_zeta": 57.669, "bb_type": "--", "chi": -173.078, "glyco_bond": "anti", "C5prime_xyz": [ -1.407, 8.524, 1.290 ], "P_xyz": [ 1.011, 8.903, 0.373 ], "form": ".", "ssZp": 4.120, "Dp": 4.463, "splay_angle": 20.614, "splay_distance": 3.414, "splay_ratio": 0.179, "d22": 3.988, "d64": 3.560, "eta": 172.710, "theta": -134.113, "eta_prime": -177.216, "theta_prime": -137.638, "eta_base": -136.268, "theta_base": -122.144, "v0": 1.006, "v1": -21.829, "v2": 33.086, "v3": -33.467, "v4": 20.454, "amplitude": 34.594, "phase_angle": 16.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 152.877, 91.396, 77.778 ], "x_axis": [ 0.293, -0.894, -0.340 ], "y_axis": [ -0.032, -0.364, 0.931 ], "z_axis": [ -0.956, -0.262, -0.135 ], "quaternion": [ 0.446, 0.669, -0.346, -0.484 ] } }, { "index": 52, "index_chain": 52, "chain_name": "S", "nt_resnum": 53, "nt_name": "U", "nt_code": "U", "nt_id": "///S/53", "linked_nts": [ "///S/52", "///S/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": 73.376, "beta": -98.760, "gamma": -151.229, "delta": 144.252, "epsilon": -123.967, "zeta": 139.190, "epsilon_zeta": 96.842, "bb_type": "BII", "chi": -171.161, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.337, 1.534 ], "P_xyz": [ 0.334, 9.497, 0.172 ], "form": ".", "ssZp": 1.583, "Dp": 1.700, "splay_angle": 95.688, "splay_distance": 14.083, "splay_ratio": 0.742, "d22": null, "d64": null, "eta": -141.226, "theta": 59.632, "eta_prime": -146.471, "theta_prime": 85.850, "eta_base": -123.027, "theta_base": 112.453, "v0": -17.859, "v1": 31.004, "v2": -31.694, "v3": 22.125, "v4": -2.868, "amplitude": 32.629, "phase_angle": 166.249, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.013, "origin": [ 149.871, 90.376, 76.520 ], "x_axis": [ 0.590, -0.788, 0.176 ], "y_axis": [ -0.234, 0.041, 0.971 ], "z_axis": [ -0.773, -0.614, -0.160 ], "quaternion": [ 0.606, 0.654, -0.391, -0.228 ] } }, { "index": 53, "index_chain": 53, "chain_name": "S", "nt_resnum": 54, "nt_name": "A", "nt_code": "A", "nt_id": "///S/54", "linked_nts": [ "///S/53", "///S/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart", "alpha": -71.715, "beta": 113.289, "gamma": 104.926, "delta": 82.028, "epsilon": -124.326, "zeta": -81.403, "epsilon_zeta": -42.923, "bb_type": "--", "chi": -174.347, "glyco_bond": "anti", "C5prime_xyz": [ -1.098, 8.384, 1.348 ], "P_xyz": [ 0.483, 9.103, -0.607 ], "form": ".", "ssZp": 4.723, "Dp": 4.810, "splay_angle": 31.493, "splay_distance": 4.627, "splay_ratio": 0.271, "d22": null, "d64": null, "eta": -140.287, "theta": -135.307, "eta_prime": -137.975, "theta_prime": -139.375, "eta_base": -137.000, "theta_base": -87.800, "v0": 7.429, "v1": -28.992, "v2": 38.420, "v3": -35.110, "v4": 17.470, "amplitude": 38.777, "phase_angle": 7.782, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ 146.420, 103.085, 81.510 ], "x_axis": [ -0.776, 0.162, -0.610 ], "y_axis": [ -0.343, -0.920, 0.191 ], "z_axis": [ -0.530, 0.357, 0.769 ], "quaternion": [ 0.136, -0.306, 0.147, 0.931 ] } }, { "index": 54, "index_chain": 54, "chain_name": "S", "nt_resnum": 55, "nt_name": "A", "nt_code": "A", "nt_id": "///S/55", "linked_nts": [ "///S/54", "///S/56" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -32.216, "beta": 149.205, "gamma": 31.586, "delta": 76.480, "epsilon": -108.235, "zeta": -126.240, "epsilon_zeta": 18.005, "bb_type": "--", "chi": -173.371, "glyco_bond": "anti", "C5prime_xyz": [ -1.083, 8.365, 1.266 ], "P_xyz": [ 1.516, 8.186, 1.522 ], "form": "A", "ssZp": 4.601, "Dp": 4.857, "splay_angle": 21.889, "splay_distance": 3.266, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.088, "theta": -154.349, "eta_prime": -173.544, "theta_prime": -144.841, "eta_base": -96.975, "theta_base": -127.545, "v0": 8.800, "v1": -31.679, "v2": 41.676, "v3": -37.647, "v4": 18.157, "amplitude": 41.972, "phase_angle": 6.813, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.045, "filter_rmsd": 0.037, "frame": { "rmsd": 0.014, "origin": [ 141.836, 103.644, 81.786 ], "x_axis": [ -0.662, -0.724, -0.193 ], "y_axis": [ 0.457, -0.595, 0.662 ], "z_axis": [ -0.594, 0.350, 0.725 ], "quaternion": [ -0.342, -0.228, 0.293, 0.863 ] } }, { "index": 55, "index_chain": 55, "chain_name": "S", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///S/56", "linked_nts": [ "///S/55", "///S/57" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.656, "beta": 116.761, "gamma": 59.345, "delta": 77.650, "epsilon": -144.809, "zeta": -90.605, "epsilon_zeta": -54.204, "bb_type": "BI", "chi": -169.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.741, 1.034 ], "P_xyz": [ 0.837, 8.650, 0.292 ], "form": "A", "ssZp": 4.555, "Dp": 4.628, "splay_angle": 27.208, "splay_distance": 4.126, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 168.928, "theta": -145.303, "eta_prime": -176.742, "theta_prime": -153.212, "eta_base": -149.425, "theta_base": -131.898, "v0": -1.231, "v1": -22.819, "v2": 36.953, "v3": -38.708, "v4": 25.116, "amplitude": 39.419, "phase_angle": 20.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.150, "filter_rmsd": 0.057, "frame": { "rmsd": 0.009, "origin": [ 139.195, 105.187, 82.931 ], "x_axis": [ -0.321, -0.946, -0.051 ], "y_axis": [ 0.548, -0.230, 0.804 ], "z_axis": [ -0.772, 0.231, 0.592 ], "quaternion": [ 0.510, 0.281, -0.353, -0.732 ] } }, { "index": 56, "index_chain": 56, "chain_name": "S", "nt_resnum": 57, "nt_name": "A", "nt_code": "A", "nt_id": "///S/57", "linked_nts": [ "///S/56", "///S/58" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.891, "beta": 155.216, "gamma": 48.983, "delta": 82.417, "epsilon": -125.095, "zeta": -103.829, "epsilon_zeta": -21.266, "bb_type": "--", "chi": -176.832, "glyco_bond": "anti", "C5prime_xyz": [ -1.380, 8.384, 1.512 ], "P_xyz": [ 1.189, 8.475, 1.895 ], "form": "A", "ssZp": 4.682, "Dp": 4.724, "splay_angle": 20.222, "splay_distance": 3.121, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 179.962, "theta": -144.922, "eta_prime": -171.178, "theta_prime": -142.396, "eta_base": -133.241, "theta_base": -115.954, "v0": 3.021, "v1": -24.421, "v2": 35.369, "v3": -34.615, "v4": 19.989, "amplitude": 36.454, "phase_angle": 14.011, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.441, "filter_rmsd": 0.038, "frame": { "rmsd": 0.020, "origin": [ 135.384, 106.009, 84.283 ], "x_axis": [ 0.073, -0.938, 0.339 ], "y_axis": [ 0.735, 0.280, 0.617 ], "z_axis": [ -0.674, 0.204, 0.710 ], "quaternion": [ 0.718, 0.144, -0.353, -0.582 ] } }, { "index": 57, "index_chain": 57, "chain_name": "S", "nt_resnum": 58, "nt_name": "C", "nt_code": "C", "nt_id": "///S/58", "linked_nts": [ "///S/57", "///S/59" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.459, "beta": 138.879, "gamma": 37.896, "delta": 74.550, "epsilon": -126.759, "zeta": -138.175, "epsilon_zeta": 11.416, "bb_type": "--", "chi": -164.258, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.737, 0.727 ], "P_xyz": [ 1.115, 8.893, 0.551 ], "form": "A", "ssZp": 4.465, "Dp": 4.797, "splay_angle": 23.601, "splay_distance": 3.592, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 164.466, "theta": -145.580, "eta_prime": 177.154, "theta_prime": -150.313, "eta_base": -141.137, "theta_base": -126.897, "v0": 2.376, "v1": -27.006, "v2": 40.150, "v3": -39.843, "v4": 23.536, "amplitude": 41.642, "phase_angle": 15.383, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.127, "filter_rmsd": 0.061, "frame": { "rmsd": 0.011, "origin": [ 132.606, 105.708, 85.672 ], "x_axis": [ 0.387, -0.633, 0.671 ], "y_axis": [ 0.483, 0.759, 0.437 ], "z_axis": [ -0.786, 0.154, 0.599 ], "quaternion": [ 0.828, 0.085, -0.439, -0.337 ] } }, { "index": 58, "index_chain": 58, "chain_name": "S", "nt_resnum": 59, "nt_name": "A", "nt_code": "A", "nt_id": "///S/59", "linked_nts": [ "///S/58", "///S/60" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 115.247, "beta": -99.643, "gamma": 174.440, "delta": 82.288, "epsilon": -152.025, "zeta": -67.387, "epsilon_zeta": -84.638, "bb_type": "BI", "chi": 155.568, "glyco_bond": "anti", "C5prime_xyz": [ -1.598, 7.502, 2.813 ], "P_xyz": [ 0.472, 8.645, 1.674 ], "form": ".", "ssZp": 4.113, "Dp": 4.672, "splay_angle": 26.278, "splay_distance": 3.531, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 151.153, "theta": -106.760, "eta_prime": 174.516, "theta_prime": -128.629, "eta_base": -137.386, "theta_base": -72.372, "v0": 7.494, "v1": -28.446, "v2": 37.610, "v3": -34.192, "v4": 16.915, "amplitude": 37.932, "phase_angle": 7.465, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.021, "origin": [ 129.881, 104.877, 87.860 ], "x_axis": [ 0.821, -0.274, 0.501 ], "y_axis": [ 0.275, 0.959, 0.072 ], "z_axis": [ -0.500, 0.079, 0.863 ], "quaternion": [ 0.954, -0.002, -0.262, -0.144 ] } }, { "index": 59, "index_chain": 59, "chain_name": "S", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///S/60", "linked_nts": [ "///S/59", "///S/61" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart", "alpha": 95.769, "beta": 133.942, "gamma": -68.144, "delta": 143.193, "epsilon": -81.716, "zeta": -99.799, "epsilon_zeta": 18.082, "bb_type": "--", "chi": 57.929, "glyco_bond": "syn", "C5prime_xyz": [ -5.251, 3.671, 1.114 ], "P_xyz": [ -7.435, 2.518, 0.183 ], "form": ".", "ssZp": -0.561, "Dp": 0.814, "splay_angle": 112.151, "splay_distance": 17.027, "splay_ratio": 0.830, "d22": null, "d64": null, "eta": -154.883, "theta": -84.076, "eta_prime": -134.592, "theta_prime": -103.261, "eta_base": -67.565, "theta_base": -100.465, "v0": -20.534, "v1": 33.466, "v2": -33.006, "v3": 21.988, "v4": -1.146, "amplitude": 34.496, "phase_angle": 163.098, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 130.295, 105.090, 91.361 ], "x_axis": [ 0.419, -0.903, 0.091 ], "y_axis": [ -0.797, -0.414, -0.440 ], "z_axis": [ 0.435, 0.112, -0.893 ], "quaternion": [ -0.167, 0.826, -0.515, 0.159 ] } }, { "index": 60, "index_chain": 60, "chain_name": "S", "nt_resnum": 61, "nt_name": "U", "nt_code": "U", "nt_id": "///S/61", "linked_nts": [ "///S/60", "///S/62" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": 51.695, "beta": -94.688, "gamma": -18.813, "delta": 139.616, "epsilon": 59.926, "zeta": -156.971, "epsilon_zeta": -143.104, "bb_type": "--", "chi": -163.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.327, 1.220 ], "P_xyz": [ -2.334, 9.888, 3.116 ], "form": ".", "ssZp": -0.407, "Dp": 0.850, "splay_angle": 137.359, "splay_distance": 16.951, "splay_ratio": 0.932, "d22": 10.863, "d64": 13.024, "eta": -69.114, "theta": 19.371, "eta_prime": -22.649, "theta_prime": 133.216, "eta_base": -36.189, "theta_base": 134.966, "v0": -12.245, "v1": 25.453, "v2": -28.277, "v3": 21.963, "v4": -6.342, "amplitude": 28.442, "phase_angle": 173.840, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.007, "origin": [ 113.951, 107.369, 95.556 ], "x_axis": [ -0.236, 0.962, 0.139 ], "y_axis": [ 0.849, 0.273, -0.453 ], "z_axis": [ -0.474, 0.011, -0.881 ], "quaternion": [ -0.198, 0.586, 0.773, -0.143 ] } }, { "index": 61, "index_chain": 61, "chain_name": "S", "nt_resnum": 62, "nt_name": "U", "nt_code": "U", "nt_id": "///S/62", "linked_nts": [ "///S/61", "///S/63" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": -59.438, "beta": -131.021, "gamma": 30.741, "delta": 79.298, "epsilon": -141.922, "zeta": -73.477, "epsilon_zeta": -68.445, "bb_type": "BI", "chi": -169.702, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.591, 1.058 ], "P_xyz": [ 0.306, 8.995, 3.052 ], "form": ".", "ssZp": 4.641, "Dp": 4.730, "splay_angle": 13.241, "splay_distance": 2.070, "splay_ratio": 0.118, "d22": 4.169, "d64": 4.073, "eta": 175.062, "theta": -159.112, "eta_prime": 58.956, "theta_prime": -153.323, "eta_base": 63.300, "theta_base": -112.351, "v0": 4.078, "v1": -26.775, "v2": 37.951, "v3": -36.580, "v4": 20.499, "amplitude": 38.896, "phase_angle": 12.655, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.006, "origin": [ 129.422, 100.449, 95.235 ], "x_axis": [ 0.327, 0.942, 0.071 ], "y_axis": [ -0.729, 0.299, -0.616 ], "z_axis": [ -0.601, 0.150, 0.785 ], "quaternion": [ 0.776, -0.246, -0.217, 0.538 ] } }, { "index": 62, "index_chain": 62, "chain_name": "S", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///S/63", "linked_nts": [ "///S/62", "///S/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -88.765, "beta": 141.302, "gamma": 89.897, "delta": 82.704, "epsilon": -139.701, "zeta": -91.994, "epsilon_zeta": -47.707, "bb_type": "BI", "chi": -170.985, "glyco_bond": "anti", "C5prime_xyz": [ -1.157, 8.461, 1.158 ], "P_xyz": [ 1.000, 8.940, -0.270 ], "form": "A", "ssZp": 4.715, "Dp": 4.763, "splay_angle": 24.507, "splay_distance": 3.635, "splay_ratio": 0.213, "d22": 4.350, "d64": 4.339, "eta": 156.581, "theta": -152.534, "eta_prime": 176.005, "theta_prime": -156.922, "eta_base": -130.667, "theta_base": -136.837, "v0": 8.802, "v1": -30.281, "v2": 39.057, "v3": -34.997, "v4": 16.560, "amplitude": 39.266, "phase_angle": 5.924, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.013, "origin": [ 129.455, 100.933, 97.247 ], "x_axis": [ -0.168, 0.986, -0.015 ], "y_axis": [ -0.950, -0.166, -0.266 ], "z_axis": [ -0.265, -0.030, 0.964 ], "quaternion": [ 0.638, -0.092, -0.098, 0.758 ] } }, { "index": 63, "index_chain": 63, "chain_name": "S", "nt_resnum": 64, "nt_name": "U", "nt_code": "U", "nt_id": "///S/64", "linked_nts": [ "///S/63", "///S/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.357, "beta": 155.619, "gamma": 53.842, "delta": 86.166, "epsilon": -114.792, "zeta": -63.492, "epsilon_zeta": -51.300, "bb_type": "--", "chi": -169.423, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 8.488, 1.111 ], "P_xyz": [ 1.333, 8.472, 1.162 ], "form": "A", "ssZp": 4.509, "Dp": 4.721, "splay_angle": 20.731, "splay_distance": 3.331, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -176.982, "theta": -122.365, "eta_prime": -167.441, "theta_prime": -135.158, "eta_base": -135.601, "theta_base": -114.042, "v0": 4.806, "v1": -24.856, "v2": 34.340, "v3": -32.509, "v4": 17.488, "amplitude": 34.970, "phase_angle": 10.890, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.500, "filter_rmsd": 0.101, "frame": { "rmsd": 0.011, "origin": [ 129.818, 101.657, 100.790 ], "x_axis": [ -0.623, 0.749, -0.225 ], "y_axis": [ -0.729, -0.661, -0.177 ], "z_axis": [ -0.282, 0.054, 0.958 ], "quaternion": [ 0.410, -0.141, -0.034, 0.900 ] } }, { "index": 64, "index_chain": 64, "chain_name": "S", "nt_resnum": 65, "nt_name": "A", "nt_code": "A", "nt_id": "///S/65", "linked_nts": [ "///S/64", "///S/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -111.676, "beta": 106.481, "gamma": 123.993, "delta": 86.298, "epsilon": -134.140, "zeta": -113.066, "epsilon_zeta": -21.073, "bb_type": "--", "chi": 167.645, "glyco_bond": "anti", "C5prime_xyz": [ -1.088, 7.789, 2.331 ], "P_xyz": [ 0.505, 9.305, 0.902 ], "form": ".", "ssZp": 4.716, "Dp": 4.787, "splay_angle": 24.395, "splay_distance": 3.400, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 153.906, "theta": -160.633, "eta_prime": 171.265, "theta_prime": -168.308, "eta_base": -141.428, "theta_base": -132.219, "v0": 9.906, "v1": -28.894, "v2": 35.758, "v3": -31.052, "v4": 13.446, "amplitude": 35.806, "phase_angle": 2.964, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.021, "origin": [ 129.219, 103.192, 103.686 ], "x_axis": [ -0.826, 0.308, -0.473 ], "y_axis": [ -0.362, -0.932, 0.025 ], "z_axis": [ -0.433, 0.192, 0.881 ], "quaternion": [ 0.176, -0.237, 0.057, 0.954 ] } }, { "index": 65, "index_chain": 65, "chain_name": "S", "nt_resnum": 66, "nt_name": "A", "nt_code": "A", "nt_id": "///S/66", "linked_nts": [ "///S/65", "///S/67" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 169.330, "beta": -146.423, "gamma": 136.116, "delta": 89.873, "epsilon": 166.841, "zeta": 101.784, "epsilon_zeta": 65.057, "bb_type": "--", "chi": 154.975, "glyco_bond": "--", "C5prime_xyz": [ -0.866, 6.961, 2.722 ], "P_xyz": [ 1.666, 7.175, 1.977 ], "form": ".", "ssZp": 3.683, "Dp": 4.451, "splay_angle": 25.555, "splay_distance": 3.947, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 126.414, "theta": -2.184, "eta_prime": 161.677, "theta_prime": -97.608, "eta_base": -130.290, "theta_base": -114.385, "v0": 20.782, "v1": -37.355, "v2": 38.647, "v3": -27.739, "v4": 4.650, "amplitude": 39.542, "phase_angle": 347.786, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.018, "origin": [ 128.202, 104.666, 106.577 ], "x_axis": [ -0.794, -0.447, -0.412 ], "y_axis": [ 0.341, -0.889, 0.307 ], "z_axis": [ -0.503, 0.104, 0.858 ], "quaternion": [ -0.209, -0.243, 0.109, 0.941 ] } }, { "index": 66, "index_chain": 66, "chain_name": "S", "nt_resnum": 67, "nt_name": "C", "nt_code": "C", "nt_id": "///S/67", "linked_nts": [ "///S/66", null ], "nt_type": "RNA", "dbn": ")", "is_broken": true, "summary": "break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 142.299, "beta": 102.945, "gamma": 100.216, "delta": 81.729, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -171.522, "glyco_bond": "anti", "C5prime_xyz": [ -1.151, 8.550, 1.194 ], "P_xyz": [ 0.420, 8.954, -0.862 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.904, "v1": -25.526, "v2": 36.176, "v3": -34.942, "v4": 19.534, "amplitude": 37.080, "phase_angle": 12.678, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.012, "origin": [ 125.314, 107.078, 107.768 ], "x_axis": [ -0.220, -0.929, -0.297 ], "y_axis": [ 0.648, -0.367, 0.668 ], "z_axis": [ -0.730, -0.046, 0.682 ], "quaternion": [ 0.523, 0.341, -0.207, -0.753 ] } }, { "index": 67, "index_chain": 67, "chain_name": "S", "nt_resnum": 201, "nt_name": "GDP", "nt_code": "g", "is_modified": true, "nt_id": "///S/201", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 114.815, "delta": 109.908, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -135.718, "glyco_bond": "anti", "C5prime_xyz": [ -1.085, 8.577, -0.691 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.008, "v1": -6.319, "v2": 11.689, "v3": -13.034, "v4": 9.597, "amplitude": 13.118, "phase_angle": 26.987, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.067, "origin": [ 120.045, 105.730, 119.041 ], "x_axis": [ 0.467, 0.107, -0.877 ], "y_axis": [ -0.557, 0.806, -0.199 ], "z_axis": [ 0.686, 0.582, 0.437 ], "quaternion": [ 0.823, -0.237, 0.475, 0.202 ] } } ], "num_hbonds": 1155, "hbonds": [ { "index": 1, "atom1_serNum": 9, "atom2_serNum": 27, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 11, "atom2_serNum": 1280, "donAcc_type": "acceptable", "distance": 3.300, "atom1_id": "///A/8/OG1", "atom2_id": "///A/185/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 16, "atom2_serNum": 32, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 21, "atom2_serNum": 46, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 25, "atom2_serNum": 51, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 30, "atom2_serNum": 56, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 35, "atom2_serNum": 61, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 40, "atom2_serNum": 150, "donAcc_type": "acceptable", "distance": 2.585, "atom1_id": "///A/13/NE1", "atom2_id": "///A/28/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 49, "atom2_serNum": 69, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 54, "atom2_serNum": 69, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/15/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 54, "atom2_serNum": 77, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 64, "atom2_serNum": 82, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/17/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 64, "atom2_serNum": 10373, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/17/O", "atom2_id": "///S/201/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 14, "atom1_serNum": 72, "atom2_serNum": 10373, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/18/O", "atom2_id": "///S/201/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 15, "atom1_serNum": 75, "atom2_serNum": 10363, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///A/18/OD1", "atom2_id": "///S/201/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 16, "atom1_serNum": 76, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/18/ND2", "atom2_id": "///A/152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 85, "atom2_serNum": 10373, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/20/O", "atom2_id": "///S/201/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 18, "atom1_serNum": 93, "atom2_serNum": 115, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 99, "atom2_serNum": 126, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 104, "atom2_serNum": 134, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 113, "atom2_serNum": 139, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 118, "atom2_serNum": 151, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 137, "atom2_serNum": 160, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/27/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 142, "atom2_serNum": 1472, "donAcc_type": "questionable", "distance": 3.050, "atom1_id": "///A/28/O", "atom2_id": "///A/212/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 150, "atom2_serNum": 1648, "donAcc_type": "acceptable", "distance": 3.514, "atom1_id": "///A/28/OH", "atom2_id": "///A/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 154, "atom2_serNum": 1466, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/29/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 159, "atom2_serNum": 9021, "donAcc_type": "standard", "distance": 3.848, "atom1_id": "///A/29/NZ", "atom2_id": "///S/4/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 28, "atom1_serNum": 163, "atom2_serNum": 171, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/30/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 165, "atom2_serNum": 1472, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/31/N", "atom2_id": "///A/212/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 170, "atom2_serNum": 1666, "donAcc_type": "acceptable", "distance": 3.796, "atom1_id": "///A/31/OG", "atom2_id": "///A/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 171, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///A/32/N", "atom2_id": "///A/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 178, "atom2_serNum": 1733, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/33/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 186, "atom2_serNum": 188, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///A/34/O", "atom2_id": "///A/34/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 190, "atom2_serNum": 1736, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/35/N", "atom2_id": "///A/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 193, "atom2_serNum": 1748, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/35/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 198, "atom2_serNum": 210, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/36/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 202, "atom2_serNum": 1751, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/37/N", "atom2_id": "///A/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 208, "atom2_serNum": 215, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/37/OD1", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 208, "atom2_serNum": 220, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/37/OD1", "atom2_id": "///A/39/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 213, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 218, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/39/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 218, "atom2_serNum": 241, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 225, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 234, "atom2_serNum": 254, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 239, "atom2_serNum": 262, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 244, "atom2_serNum": 267, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 253, "atom2_serNum": 278, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 253, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/44/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 276, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///A/47/NH1", "atom2_id": "///A/49/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 294, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/50/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 301, "atom2_serNum": 309, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///A/51/OG1", "atom2_id": "///A/52/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 303, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/52/N", "atom2_id": "///A/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 340, "atom2_serNum": 352, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///A/56/OG", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 341, "atom2_serNum": 8985, "donAcc_type": "standard", "distance": 3.537, "atom1_id": "///A/57/N", "atom2_id": "///S/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 344, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 348, "atom2_serNum": 1465, "donAcc_type": "questionable", "distance": 3.028, "atom1_id": "///A/57/NE", "atom2_id": "///A/211/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 348, "atom2_serNum": 8986, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///A/57/NE", "atom2_id": "///S/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 58, "atom1_serNum": 351, "atom2_serNum": 8962, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/57/NH2", "atom2_id": "///S/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 59, "atom1_serNum": 355, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 355, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/58/O", "atom2_id": "///A/87/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 359, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 365, "atom2_serNum": 393, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 370, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 3.769, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 370, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/61/O", "atom2_id": "///A/207/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 379, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 387, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 391, "atom2_serNum": 601, "donAcc_type": "acceptable", "distance": 3.732, "atom1_id": "///A/63/OE1", "atom2_id": "///A/90/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 410, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 410, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///A/65/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 421, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/66/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 432, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/67/OE1", "atom2_id": "///A/352/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 432, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/67/OE1", "atom2_id": "///A/352/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 448, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 3.781, "atom1_id": "///A/69/O", "atom2_id": "///A/222/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 456, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/70/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 465, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///A/72/N", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 468, "atom2_serNum": 971, "donAcc_type": "acceptable", "distance": 3.959, "atom1_id": "///A/72/O", "atom2_id": "///A/142/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 480, "atom2_serNum": 971, "donAcc_type": "acceptable", "distance": 2.904, "atom1_id": "///A/74/N", "atom2_id": "///A/142/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 483, "atom2_serNum": 971, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///A/74/O", "atom2_id": "///A/142/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 488, "atom2_serNum": 646, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/75/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 489, "atom2_serNum": 965, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/76/N", "atom2_id": "///A/141/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 492, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/76/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 492, "atom2_serNum": 966, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/76/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 494, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/77/N", "atom2_id": "///A/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 497, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/77/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 501, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/78/N", "atom2_id": "///A/142/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 504, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/78/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 509, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/79/N", "atom2_id": "///A/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 512, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/79/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 515, "atom2_serNum": 984, "donAcc_type": "questionable", "distance": 2.850, "atom1_id": "///A/79/OD1", "atom2_id": "///A/144/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 516, "atom2_serNum": 577, "donAcc_type": "acceptable", "distance": 3.222, "atom1_id": "///A/79/OD2", "atom2_id": "///A/88/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 517, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/80/N", "atom2_id": "///A/144/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 520, "atom2_serNum": 995, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///A/80/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 525, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/81/N", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 529, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.496, "atom1_id": "///A/82/N", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 532, "atom2_serNum": 550, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/82/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 542, "atom2_serNum": 754, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/84/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 553, "atom2_serNum": 578, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 557, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 561, "atom2_serNum": 602, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 575, "atom2_serNum": 608, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 581, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 3.790, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 589, "atom2_serNum": 757, "donAcc_type": "acceptable", "distance": 3.627, "atom1_id": "///A/89/OH", "atom2_id": "///A/114/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 611, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///A/92/O", "atom2_id": "///A/262/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 616, "atom2_serNum": 2118, "donAcc_type": "standard", "distance": 2.416, "atom1_id": "///A/93/O", "atom2_id": "///A/300/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 620, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/94/O", "atom2_id": "///A/262/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 620, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///A/94/O", "atom2_id": "///A/262/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 628, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/95/O", "atom2_id": "///A/262/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 638, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/96/NZ", "atom2_id": "///A/295/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 658, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/100/N", "atom2_id": "///A/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 661, "atom2_serNum": 842, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/100/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 674, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/101/NH1", "atom2_id": "///A/138/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 675, "atom2_serNum": 691, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///A/101/NH2", "atom2_id": "///A/103/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 676, "atom2_serNum": 845, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/102/N", "atom2_id": "///A/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 679, "atom2_serNum": 855, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/102/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 692, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/104/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 695, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/104/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 697, "atom2_serNum": 704, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///A/104/OG1", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 711, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/107/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 779, "atom2_serNum": 1800, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/117/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 785, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/118/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 789, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/119/N", "atom2_id": "///A/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 801, "atom2_serNum": 1803, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///A/120/N", "atom2_id": "///A/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 804, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 808, "atom2_serNum": 835, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/121/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 819, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///A/122/N", "atom2_id": "///A/122/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 825, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/122/OD1", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 826, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/122/ND2", "atom2_id": "///A/262/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 888, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///A/131/OD1", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 942, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/138/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 961, "atom2_serNum": 1208, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///A/141/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 973, "atom2_serNum": 1211, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/143/N", "atom2_id": "///A/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 976, "atom2_serNum": 1228, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/143/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 989, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/145/N", "atom2_id": "///A/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 992, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/145/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1014, "atom2_serNum": 8959, "donAcc_type": "questionable", "distance": 3.251, "atom1_id": "///A/148/O", "atom2_id": "///S/1/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 136, "atom1_serNum": 1029, "atom2_serNum": 8940, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///A/150/OG", "atom2_id": "///S/1/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 137, "atom1_serNum": 1029, "atom2_serNum": 8941, "donAcc_type": "acceptable", "distance": 2.454, "atom1_id": "///A/150/OG", "atom2_id": "///S/1/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 138, "atom1_serNum": 1030, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/151/N", "atom2_id": "///A/157/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1035, "atom2_serNum": 1043, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///A/151/OG", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1039, "atom2_serNum": 1049, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/152/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1046, "atom2_serNum": 1070, "donAcc_type": "standard", "distance": 3.404, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1048, "atom2_serNum": 1061, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///A/153/OG", "atom2_id": "///A/155/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1048, "atom2_serNum": 1063, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///A/153/OG", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1052, "atom2_serNum": 1079, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1052, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/154/O", "atom2_id": "///A/183/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1059, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1059, "atom2_serNum": 1089, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///A/155/O", "atom2_id": "///A/159/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1066, "atom2_serNum": 1089, "donAcc_type": "acceptable", "distance": 2.591, "atom1_id": "///A/156/O", "atom2_id": "///A/159/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1066, "atom2_serNum": 1090, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1073, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1073, "atom2_serNum": 1106, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///A/157/O", "atom2_id": "///A/161/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1082, "atom2_serNum": 1108, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1087, "atom2_serNum": 1116, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1093, "atom2_serNum": 1127, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1104, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1106, "atom2_serNum": 1262, "donAcc_type": "acceptable", "distance": 3.642, "atom1_id": "///A/161/OG1", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1111, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1119, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1130, "atom2_serNum": 1152, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1137, "atom2_serNum": 1159, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1150, "atom2_serNum": 1179, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///A/167/O", "atom2_id": "///A/171/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1162, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/169/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1162, "atom2_serNum": 1185, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/169/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1174, "atom2_serNum": 1193, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/171/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1215, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/176/OE1", "atom2_id": "///A/222/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1216, "atom2_serNum": 1552, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/176/NE2", "atom2_id": "///A/222/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1220, "atom2_serNum": 1540, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/177/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1234, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/179/N", "atom2_id": "///A/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1237, "atom2_serNum": 1518, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/179/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1247, "atom2_serNum": 1504, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/181/N", "atom2_id": "///A/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1250, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/181/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1268, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/183/OD1", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1292, "atom2_serNum": 1308, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/186/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1292, "atom2_serNum": 1315, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1297, "atom2_serNum": 1320, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1304, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1311, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1318, "atom2_serNum": 1343, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1323, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1328, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1338, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1346, "atom2_serNum": 1367, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1351, "atom2_serNum": 1372, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1356, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1361, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1366, "atom2_serNum": 1568, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///A/197/NE2", "atom2_id": "///A/225/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1390, "atom2_serNum": 1526, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/201/O", "atom2_id": "///A/219/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1395, "atom2_serNum": 1535, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/203/N", "atom2_id": "///A/220/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1398, "atom2_serNum": 1532, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/203/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1408, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/205/N", "atom2_id": "///A/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1411, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/205/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1424, "atom2_serNum": 1495, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/206/NH1", "atom2_id": "///A/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1425, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/206/NH2", "atom2_id": "///A/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1429, "atom2_serNum": 1449, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/207/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1429, "atom2_serNum": 1454, "donAcc_type": "acceptable", "distance": 2.466, "atom1_id": "///A/207/O", "atom2_id": "///A/210/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1432, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/207/OD1", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1432, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/207/OD1", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1462, "atom2_serNum": 8962, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///A/211/NE", "atom2_id": "///S/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 199, "atom1_serNum": 1465, "atom2_serNum": 8964, "donAcc_type": "standard", "distance": 3.743, "atom1_id": "///A/211/NH2", "atom2_id": "///S/2/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 200, "atom1_serNum": 1479, "atom2_serNum": 10351, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/213/OG", "atom2_id": "///S/201/O3B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 201, "atom1_serNum": 1485, "atom2_serNum": 1492, "donAcc_type": "acceptable", "distance": 3.227, "atom1_id": "///A/214/OG1", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1499, "atom2_serNum": 1517, "donAcc_type": "acceptable", "distance": 2.774, "atom1_id": "///A/216/OE1", "atom2_id": "///A/218/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1572, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/226/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1577, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1582, "atom2_serNum": 1604, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1589, "atom2_serNum": 1609, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1595, "atom2_serNum": 1614, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1600, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1607, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1612, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1617, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1624, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1629, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1640, "atom2_serNum": 1663, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1648, "atom2_serNum": 1663, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/238/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1648, "atom2_serNum": 1668, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1656, "atom2_serNum": 1668, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/239/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1682, "atom2_serNum": 1698, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/243/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1694, "atom2_serNum": 1696, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///A/245/O", "atom2_id": "///A/245/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1755, "atom2_serNum": 2464, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///A/252/OE1", "atom2_id": "///A/352/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1778, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/256/N", "atom2_id": "///A/356/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1809, "atom2_serNum": 1831, "donAcc_type": "acceptable", "distance": 3.227, "atom1_id": "///A/261/OG1", "atom2_id": "///A/263/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1835, "atom2_serNum": 1852, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/264/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1855, "atom2_serNum": 2537, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/267/O", "atom2_id": "///A/361/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1879, "atom2_serNum": 1891, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/271/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1886, "atom2_serNum": 1907, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///A/272/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1886, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1894, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1910, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/275/O", "atom2_id": "///A/279/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1917, "atom2_serNum": 1942, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/276/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1925, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/277/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1929, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1934, "atom2_serNum": 1972, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/279/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1940, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/279/NH1", "atom2_id": "///A/449/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1940, "atom2_serNum": 3944, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///A/279/NH1", "atom2_id": "///A/570/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1945, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/280/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1953, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1964, "atom2_serNum": 1994, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/282/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1975, "atom2_serNum": 2003, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2028, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///A/290/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2028, "atom2_serNum": 2052, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/290/O", "atom2_id": "///A/292/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2030, "atom2_serNum": 2189, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///A/290/OG1", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2040, "atom2_serNum": 2160, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///A/291/NE1", "atom2_id": "///A/305/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2046, "atom2_serNum": 2052, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///A/292/N", "atom2_id": "///A/292/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2049, "atom2_serNum": 2176, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///A/292/O", "atom2_id": "///A/307/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2068, "atom2_serNum": 2156, "donAcc_type": "acceptable", "distance": 3.619, "atom1_id": "///A/294/N", "atom2_id": "///A/304/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2081, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/296/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2086, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/297/O", "atom2_id": "///A/297/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2086, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/297/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2109, "atom2_serNum": 4099, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///A/299/OH", "atom2_id": "///A/590/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2122, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/301/O", "atom2_id": "///A/361/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2122, "atom2_serNum": 4132, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/301/O", "atom2_id": "///A/594/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2124, "atom2_serNum": 2526, "donAcc_type": "acceptable", "distance": 3.171, "atom1_id": "///A/301/OG1", "atom2_id": "///A/360/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2124, "atom2_serNum": 4132, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///A/301/OG1", "atom2_id": "///A/594/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2134, "atom2_serNum": 4157, "donAcc_type": "standard", "distance": 3.915, "atom1_id": "///A/302/NE1", "atom2_id": "///A/597/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2140, "atom2_serNum": 4119, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/303/N", "atom2_id": "///A/593/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2143, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/303/O", "atom2_id": "///A/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2157, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/305/N", "atom2_id": "///A/591/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2166, "atom2_serNum": 4121, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///A/305/NE2", "atom2_id": "///A/593/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2170, "atom2_serNum": 4100, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/306/O", "atom2_id": "///A/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2177, "atom2_serNum": 4087, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/308/N", "atom2_id": "///A/589/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2180, "atom2_serNum": 4084, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/308/O", "atom2_id": "///A/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2194, "atom2_serNum": 4073, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/310/N", "atom2_id": "///A/587/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2197, "atom2_serNum": 4073, "donAcc_type": "questionable", "distance": 2.794, "atom1_id": "///A/310/O", "atom2_id": "///A/587/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2213, "atom2_serNum": 2382, "donAcc_type": "standard", "distance": 3.667, "atom1_id": "///A/318/N", "atom2_id": "///A/341/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2221, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///A/319/O", "atom2_id": "///A/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2226, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/320/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2228, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/321/N", "atom2_id": "///A/739/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2231, "atom2_serNum": 2254, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2234, "atom2_serNum": 2240, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/321/OD1", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2234, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/321/OD1", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2235, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.441, "atom1_id": "///A/321/ND2", "atom2_id": "///A/751/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2239, "atom2_serNum": 2259, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2250, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/324/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2250, "atom2_serNum": 2275, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2278, "atom2_serNum": 2298, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/328/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2278, "atom2_serNum": 5252, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/328/O", "atom2_id": "///A/739/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2280, "atom2_serNum": 5252, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///A/328/OG1", "atom2_id": "///A/739/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2285, "atom2_serNum": 2298, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/329/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2285, "atom2_serNum": 2312, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/329/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2315, "atom2_serNum": 2360, "donAcc_type": "acceptable", "distance": 3.631, "atom1_id": "///A/332/O", "atom2_id": "///A/338/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2318, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/332/OD1", "atom2_id": "///A/739/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2323, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/333/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2330, "atom2_serNum": 2355, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2337, "atom2_serNum": 2362, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2344, "atom2_serNum": 2371, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2351, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2358, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/338/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2358, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2374, "atom2_serNum": 2394, "donAcc_type": "acceptable", "distance": 3.357, "atom1_id": "///A/340/O", "atom2_id": "///A/343/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2382, "atom2_serNum": 2389, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/341/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2411, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/346/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2411, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/346/O", "atom2_id": "///A/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2415, "atom2_serNum": 2444, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/347/N", "atom2_id": "///A/350/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2418, "atom2_serNum": 2446, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/347/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2425, "atom2_serNum": 2455, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2436, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/349/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2440, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/350/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2445, "atom2_serNum": 3167, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///A/350/NE2", "atom2_id": "///A/454/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2449, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2454, "atom2_serNum": 4023, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/351/NE2", "atom2_id": "///A/580/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2458, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2469, "atom2_serNum": 2502, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2476, "atom2_serNum": 2511, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2476, "atom2_serNum": 2518, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/354/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2505, "atom2_serNum": 3708, "donAcc_type": "acceptable", "distance": 3.726, "atom1_id": "///A/357/O", "atom2_id": "///A/539/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2514, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/358/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2514, "atom2_serNum": 4158, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/358/O", "atom2_id": "///A/597/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2526, "atom2_serNum": 4131, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/360/O", "atom2_id": "///A/594/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2546, "atom2_serNum": 3706, "donAcc_type": "acceptable", "distance": 3.948, "atom1_id": "///A/362/OG1", "atom2_id": "///A/539/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2571, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/366/N", "atom2_id": "///A/683/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2574, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/366/O", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2582, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/367/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2586, "atom2_serNum": 4418, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/368/N", "atom2_id": "///A/633/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2589, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/368/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2593, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/369/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2600, "atom2_serNum": 2632, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/370/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2611, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2620, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2620, "atom2_serNum": 2654, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/372/O", "atom2_id": "///A/376/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2627, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2635, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2644, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2652, "atom2_serNum": 2679, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2659, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2664, "atom2_serNum": 2701, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2668, "atom2_serNum": 2712, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2682, "atom2_serNum": 2719, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2690, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2690, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/381/O", "atom2_id": "///A/555/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2695, "atom2_serNum": 3775, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/381/NE1", "atom2_id": "///A/548/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2715, "atom2_serNum": 2731, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/383/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2740, "atom2_serNum": 3426, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///A/386/NH1", "atom2_id": "///A/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2740, "atom2_serNum": 3429, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/386/NH1", "atom2_id": "///A/501/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2741, "atom2_serNum": 3417, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/386/NH2", "atom2_id": "///A/500/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2741, "atom2_serNum": 3426, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/386/NH2", "atom2_id": "///A/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2778, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///A/391/NE", "atom2_id": "///A/494/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2781, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///A/391/NH2", "atom2_id": "///A/494/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2790, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/393/N", "atom2_id": "///A/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2799, "atom2_serNum": 2824, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2806, "atom2_serNum": 2824, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/395/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2806, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/395/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2817, "atom2_serNum": 2842, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/396/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2822, "atom2_serNum": 2851, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2827, "atom2_serNum": 2860, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/398/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2838, "atom2_serNum": 2867, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/399/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2845, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2845, "atom2_serNum": 2883, "donAcc_type": "acceptable", "distance": 3.028, "atom1_id": "///A/400/O", "atom2_id": "///A/404/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2863, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/402/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2863, "atom2_serNum": 2891, "donAcc_type": "questionable", "distance": 2.666, "atom1_id": "///A/402/O", "atom2_id": "///A/405/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2870, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/403/O", "atom2_id": "///A/422/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2891, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///A/405/OD1", "atom2_id": "///A/422/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2896, "atom2_serNum": 2925, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///A/417/O", "atom2_id": "///A/420/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2896, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2901, "atom2_serNum": 2931, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2915, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2923, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2929, "atom2_serNum": 2952, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/421/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2934, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2945, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/423/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2950, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/424/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2955, "atom2_serNum": 2996, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/425/O", "atom2_id": "///A/431/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2965, "atom2_serNum": 2996, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/427/O", "atom2_id": "///A/431/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2970, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///A/428/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2970, "atom2_serNum": 3002, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2975, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2980, "atom2_serNum": 3012, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2991, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/431/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3005, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/432/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3010, "atom2_serNum": 3032, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/433/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3015, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/434/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3019, "atom2_serNum": 3025, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///A/435/N", "atom2_id": "///A/435/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3022, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/435/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3030, "atom2_serNum": 3061, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3035, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3040, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/437/OE2", "atom2_id": "///A/441/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3040, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/437/OE2", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3044, "atom2_serNum": 3079, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3055, "atom2_serNum": 3088, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3064, "atom2_serNum": 3097, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3064, "atom2_serNum": 3101, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/440/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3069, "atom2_serNum": 3104, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/441/N", "atom2_id": "///A/445/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3123, "atom2_serNum": 3132, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/448/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3139, "atom2_serNum": 3993, "donAcc_type": "standard", "distance": 3.573, "atom1_id": "///A/451/N", "atom2_id": "///A/576/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3142, "atom2_serNum": 4004, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/451/O", "atom2_id": "///A/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3156, "atom2_serNum": 4007, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///A/453/N", "atom2_id": "///A/578/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3172, "atom2_serNum": 3201, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/471/O", "atom2_id": "///A/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3177, "atom2_serNum": 3213, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/472/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3182, "atom2_serNum": 3218, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3190, "atom2_serNum": 3232, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3204, "atom2_serNum": 3240, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/475/O", "atom2_id": "///A/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3216, "atom2_serNum": 3244, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/476/O", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3221, "atom2_serNum": 3249, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/477/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3235, "atom2_serNum": 3260, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/478/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3243, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/479/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3247, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/480/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3252, "atom2_serNum": 3289, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/481/O", "atom2_id": "///A/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3259, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///A/481/NH2", "atom2_id": "///A/484/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3263, "atom2_serNum": 3300, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/482/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3275, "atom2_serNum": 3305, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/483/O", "atom2_id": "///A/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3283, "atom2_serNum": 3310, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/484/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3288, "atom2_serNum": 4196, "donAcc_type": "questionable", "distance": 3.181, "atom1_id": "///A/484/OE2", "atom2_id": "///A/603/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3292, "atom2_serNum": 3318, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/485/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3308, "atom2_serNum": 3866, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/487/O", "atom2_id": "///A/560/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3321, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/489/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3321, "atom2_serNum": 3349, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/489/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3325, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3336, "atom2_serNum": 3372, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/491/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3344, "atom2_serNum": 3362, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/492/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3354, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/494/N", "atom2_id": "///A/494/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3365, "atom2_serNum": 3402, "donAcc_type": "acceptable", "distance": 3.084, "atom1_id": "///A/495/O", "atom2_id": "///A/498/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3365, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 3.696, "atom1_id": "///A/495/O", "atom2_id": "///A/501/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3368, "atom2_serNum": 3473, "donAcc_type": "acceptable", "distance": 2.968, "atom1_id": "///A/495/ND1", "atom2_id": "///A/507/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3400, "atom2_serNum": 3423, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/498/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3400, "atom2_serNum": 3431, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3406, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/499/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3412, "atom2_serNum": 3452, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/499/NH1", "atom2_id": "///A/504/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3412, "atom2_serNum": 4615, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///A/499/NH1", "atom2_id": "///A/658/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3434, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///A/502/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3436, "atom2_serNum": 3455, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///A/502/OG", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3440, "atom2_serNum": 3454, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///A/503/O", "atom2_id": "///A/504/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3452, "atom2_serNum": 4625, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/504/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3454, "atom2_serNum": 4587, "donAcc_type": "acceptable", "distance": 2.528, "atom1_id": "///A/504/OG", "atom2_id": "///A/655/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3459, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///A/506/N", "atom2_id": "///A/660/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3462, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/506/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3487, "atom2_serNum": 3506, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/510/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3487, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///A/510/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3488, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/511/N", "atom2_id": "///A/798/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3491, "atom2_serNum": 3506, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///A/511/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3491, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/511/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3509, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/513/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3518, "atom2_serNum": 3547, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/514/O", "atom2_id": "///A/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3526, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/515/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3530, "atom2_serNum": 3566, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/516/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3538, "atom2_serNum": 5899, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///A/516/OH", "atom2_id": "///A/821/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3542, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/517/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3550, "atom2_serNum": 3582, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/518/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3558, "atom2_serNum": 3582, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/519/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3558, "atom2_serNum": 3587, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/519/O", "atom2_id": "///A/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3573, "atom2_serNum": 5915, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///A/520/OD2", "atom2_id": "///A/823/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3577, "atom2_serNum": 3596, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/521/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3599, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/524/O", "atom2_id": "///A/668/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3607, "atom2_serNum": 4610, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/525/O", "atom2_id": "///A/657/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3615, "atom2_serNum": 4688, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/527/N", "atom2_id": "///A/669/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3618, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/527/O", "atom2_id": "///A/668/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3619, "atom2_serNum": 4708, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/528/N", "atom2_id": "///A/672/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3624, "atom2_serNum": 4923, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/529/N", "atom2_id": "///A/700/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3627, "atom2_serNum": 4920, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/529/O", "atom2_id": "///A/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3632, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/530/N", "atom2_id": "///A/667/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3635, "atom2_serNum": 4669, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/530/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3656, "atom2_serNum": 4332, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/532/OD2", "atom2_id": "///A/620/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3656, "atom2_serNum": 4906, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///A/532/OD2", "atom2_id": "///A/697/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3660, "atom2_serNum": 4834, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/533/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3668, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/534/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3672, "atom2_serNum": 4819, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/535/N", "atom2_id": "///A/687/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3680, "atom2_serNum": 3708, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///A/536/O", "atom2_id": "///A/539/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3680, "atom2_serNum": 3710, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///A/536/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3684, "atom2_serNum": 3710, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/537/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3689, "atom2_serNum": 4241, "donAcc_type": "standard", "distance": 2.480, "atom1_id": "///A/537/NE1", "atom2_id": "///A/609/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3701, "atom2_serNum": 4242, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/538/OD1", "atom2_id": "///A/609/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3706, "atom2_serNum": 4158, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/539/O", "atom2_id": "///A/597/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3719, "atom2_serNum": 4806, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///A/540/NH1", "atom2_id": "///A/685/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3724, "atom2_serNum": 4150, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/541/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3729, "atom2_serNum": 3753, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/542/N", "atom2_id": "///A/545/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3732, "atom2_serNum": 3746, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/542/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3732, "atom2_serNum": 3754, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3734, "atom2_serNum": 3753, "donAcc_type": "acceptable", "distance": 2.443, "atom1_id": "///A/542/OG1", "atom2_id": "///A/545/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3739, "atom2_serNum": 3754, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/543/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3739, "atom2_serNum": 3762, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3744, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3749, "atom2_serNum": 3780, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3752, "atom2_serNum": 4815, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/545/OD1", "atom2_id": "///A/686/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3757, "atom2_serNum": 3785, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3765, "atom2_serNum": 3790, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/547/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3768, "atom2_serNum": 3976, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///A/547/ND1", "atom2_id": "///A/573/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3775, "atom2_serNum": 3790, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/548/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3779, "atom2_serNum": 4292, "donAcc_type": "standard", "distance": 3.991, "atom1_id": "///A/548/ND2", "atom2_id": "///A/615/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3783, "atom2_serNum": 3799, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///A/549/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3788, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/550/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3793, "atom2_serNum": 3814, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/551/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3810, "atom2_serNum": 3874, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/553/O", "atom2_id": "///A/561/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3835, "atom2_serNum": 3877, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/556/O", "atom2_id": "///A/561/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3840, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///A/557/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3840, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/557/O", "atom2_id": "///A/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3848, "atom2_serNum": 3878, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/558/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3855, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 3.614, "atom1_id": "///A/559/O", "atom2_id": "///A/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3860, "atom2_serNum": 3895, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/560/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3870, "atom2_serNum": 3900, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/561/O", "atom2_id": "///A/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3881, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/562/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3890, "atom2_serNum": 3913, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/563/O", "atom2_id": "///A/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3898, "atom2_serNum": 3921, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/564/O", "atom2_id": "///A/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3903, "atom2_serNum": 3932, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/565/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3911, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/566/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3916, "atom2_serNum": 3949, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/567/O", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3916, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/567/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3924, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///A/568/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3924, "atom2_serNum": 3968, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/568/O", "atom2_id": "///A/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3944, "atom2_serNum": 3980, "donAcc_type": "questionable", "distance": 2.723, "atom1_id": "///A/570/O", "atom2_id": "///A/574/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3952, "atom2_serNum": 4192, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/571/O", "atom2_id": "///A/602/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3967, "atom2_serNum": 4196, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///A/572/OH", "atom2_id": "///A/603/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3971, "atom2_serNum": 4136, "donAcc_type": "questionable", "distance": 3.214, "atom1_id": "///A/573/O", "atom2_id": "///A/595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3985, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/575/N", "atom2_id": "///A/594/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3988, "atom2_serNum": 4122, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/575/O", "atom2_id": "///A/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3997, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/577/N", "atom2_id": "///A/592/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4000, "atom2_serNum": 4108, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/577/O", "atom2_id": "///A/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4013, "atom2_serNum": 4095, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/579/N", "atom2_id": "///A/590/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4016, "atom2_serNum": 4092, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/579/O", "atom2_id": "///A/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4029, "atom2_serNum": 4080, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/581/N", "atom2_id": "///A/588/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4032, "atom2_serNum": 4077, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/581/O", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4036, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 2.471, "atom1_id": "///A/581/NE", "atom2_id": "///A/590/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4039, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/581/NH2", "atom2_id": "///A/590/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4047, "atom2_serNum": 4069, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/583/N", "atom2_id": "///A/586/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4050, "atom2_serNum": 4061, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///A/583/O", "atom2_id": "///A/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4050, "atom2_serNum": 4066, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/583/O", "atom2_id": "///A/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4052, "atom2_serNum": 4069, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///A/583/OG1", "atom2_id": "///A/586/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4073, "atom2_serNum": 4075, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/587/O", "atom2_id": "///A/587/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4131, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 3.789, "atom1_id": "///A/594/NH1", "atom2_id": "///A/596/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4169, "atom2_serNum": 4266, "donAcc_type": "acceptable", "distance": 3.902, "atom1_id": "///A/598/NH2", "atom2_id": "///A/612/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4170, "atom2_serNum": 4191, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/599/N", "atom2_id": "///A/602/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4173, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/599/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4173, "atom2_serNum": 4191, "donAcc_type": "questionable", "distance": 2.772, "atom1_id": "///A/599/O", "atom2_id": "///A/602/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4173, "atom2_serNum": 4209, "donAcc_type": "acceptable", "distance": 3.791, "atom1_id": "///A/599/O", "atom2_id": "///A/605/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4187, "atom2_serNum": 4204, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/602/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4187, "atom2_serNum": 4209, "donAcc_type": "acceptable", "distance": 2.242, "atom1_id": "///A/602/O", "atom2_id": "///A/605/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4203, "atom2_serNum": 4227, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4207, "atom2_serNum": 4235, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4214, "atom2_serNum": 4243, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4222, "atom2_serNum": 4638, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/606/OH", "atom2_id": "///A/661/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4226, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/607/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4230, "atom2_serNum": 4261, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4238, "atom2_serNum": 4268, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/609/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4246, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/610/O", "atom2_id": "///A/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4248, "atom2_serNum": 4639, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///A/610/OG1", "atom2_id": "///A/662/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4253, "atom2_serNum": 4284, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/611/O", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4264, "atom2_serNum": 4293, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/612/O", "atom2_id": "///A/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4271, "atom2_serNum": 4298, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4274, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///A/613/OD1", "atom2_id": "///A/617/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4275, "atom2_serNum": 4642, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/613/ND2", "atom2_id": "///A/662/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4275, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 3.623, "atom1_id": "///A/613/ND2", "atom2_id": "///A/664/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4279, "atom2_serNum": 4307, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4287, "atom2_serNum": 4315, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4296, "atom2_serNum": 4323, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4301, "atom2_serNum": 4334, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/617/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4310, "atom2_serNum": 4343, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/618/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4318, "atom2_serNum": 4351, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/619/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4326, "atom2_serNum": 4356, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/620/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4333, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/620/NH2", "atom2_id": "///A/674/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4333, "atom2_serNum": 4906, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///A/620/NH2", "atom2_id": "///A/697/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4337, "atom2_serNum": 4360, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/621/O", "atom2_id": "///A/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4342, "atom2_serNum": 4576, "donAcc_type": "standard", "distance": 3.978, "atom1_id": "///A/621/NE2", "atom2_id": "///A/654/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4346, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/622/O", "atom2_id": "///A/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4346, "atom2_serNum": 4373, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/622/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4354, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/623/O", "atom2_id": "///A/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4359, "atom2_serNum": 4719, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/624/O", "atom2_id": "///A/673/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4367, "atom2_serNum": 4518, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/625/OE1", "atom2_id": "///A/646/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4367, "atom2_serNum": 4583, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/625/OE1", "atom2_id": "///A/654/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4368, "atom2_serNum": 4580, "donAcc_type": "standard", "distance": 2.378, "atom1_id": "///A/625/OE2", "atom2_id": "///A/654/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4368, "atom2_serNum": 4583, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/625/OE2", "atom2_id": "///A/654/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4376, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///A/627/O", "atom2_id": "///A/642/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4385, "atom2_serNum": 4414, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/629/N", "atom2_id": "///A/632/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4388, "atom2_serNum": 4415, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4390, "atom2_serNum": 4400, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/629/OG", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4390, "atom2_serNum": 4407, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///A/629/OG", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4394, "atom2_serNum": 4423, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4403, "atom2_serNum": 4432, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4403, "atom2_serNum": 4438, "donAcc_type": "questionable", "distance": 3.141, "atom1_id": "///A/631/O", "atom2_id": "///A/635/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4410, "atom2_serNum": 4438, "donAcc_type": "questionable", "distance": 2.658, "atom1_id": "///A/632/O", "atom2_id": "///A/635/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4432, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/635/N", "atom2_id": "///A/635/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4450, "atom2_serNum": 4453, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///A/637/O", "atom2_id": "///A/637/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4470, "atom2_serNum": 4494, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/640/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4475, "atom2_serNum": 4501, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/641/O", "atom2_id": "///A/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4480, "atom2_serNum": 4510, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/642/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4489, "atom2_serNum": 4524, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/643/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4497, "atom2_serNum": 4532, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/644/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4504, "atom2_serNum": 4537, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/645/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4504, "atom2_serNum": 4542, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///A/645/O", "atom2_id": "///A/649/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4513, "atom2_serNum": 4542, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///A/646/O", "atom2_id": "///A/649/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4513, "atom2_serNum": 4544, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4527, "atom2_serNum": 4553, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4547, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/650/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4556, "atom2_serNum": 4584, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/651/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4560, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4576, "atom2_serNum": 4601, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/654/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4587, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/655/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4604, "atom2_serNum": 4676, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/657/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4620, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/659/N", "atom2_id": "///A/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4623, "atom2_serNum": 4662, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/659/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4633, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/661/N", "atom2_id": "///A/664/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4636, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/661/O", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4638, "atom2_serNum": 5707, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///A/661/OG", "atom2_id": "///A/798/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4700, "atom2_serNum": 4721, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/671/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4705, "atom2_serNum": 4732, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/672/O", "atom2_id": "///A/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4713, "atom2_serNum": 4737, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/673/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4735, "atom2_serNum": 4901, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/675/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4740, "atom2_serNum": 4750, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/676/O", "atom2_id": "///A/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4753, "atom2_serNum": 4779, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/678/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4761, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/679/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4769, "atom2_serNum": 4795, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/680/O", "atom2_id": "///A/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4774, "atom2_serNum": 4803, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/681/O", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4774, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/681/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4782, "atom2_serNum": 4803, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/682/O", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4786, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/682/ND2", "atom2_id": "///A/693/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4832, "atom2_serNum": 4892, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/688/NH1", "atom2_id": "///A/695/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4832, "atom2_serNum": 4906, "donAcc_type": "acceptable", "distance": 3.537, "atom1_id": "///A/688/NH1", "atom2_id": "///A/697/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4833, "atom2_serNum": 4862, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/688/NH2", "atom2_id": "///A/692/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4862, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/692/O", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4862, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/692/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4919, "atom2_serNum": 4940, "donAcc_type": "acceptable", "distance": 3.680, "atom1_id": "///A/699/O", "atom2_id": "///A/701/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4947, "atom2_serNum": 4975, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/702/O", "atom2_id": "///A/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4950, "atom2_serNum": 4966, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/702/OD1", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4973, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///A/704/OE1", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4978, "atom2_serNum": 4991, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/705/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4998, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/708/N", "atom2_id": "///A/711/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5001, "atom2_serNum": 5021, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/708/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5012, "atom2_serNum": 5020, "donAcc_type": "acceptable", "distance": 2.355, "atom1_id": "///A/709/O", "atom2_id": "///A/710/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5012, "atom2_serNum": 5027, "donAcc_type": "acceptable", "distance": 2.654, "atom1_id": "///A/709/O", "atom2_id": "///A/711/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5018, "atom2_serNum": 5174, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///A/710/O", "atom2_id": "///A/729/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5021, "atom2_serNum": 5027, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///A/711/N", "atom2_id": "///A/711/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5030, "atom2_serNum": 5455, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///A/711/NE2", "atom2_id": "///A/766/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5031, "atom2_serNum": 5164, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/712/N", "atom2_id": "///A/728/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5034, "atom2_serNum": 5161, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/712/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5052, "atom2_serNum": 5150, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/714/N", "atom2_id": "///A/726/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5055, "atom2_serNum": 5147, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/714/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5071, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/716/N", "atom2_id": "///A/724/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5074, "atom2_serNum": 5132, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/716/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5087, "atom2_serNum": 5115, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/718/N", "atom2_id": "///A/722/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5090, "atom2_serNum": 5108, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/718/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5121, "atom2_serNum": 5941, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/722/NH1", "atom2_id": "///A/826/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5121, "atom2_serNum": 5958, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/722/NH1", "atom2_id": "///A/828/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5122, "atom2_serNum": 5958, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/722/NH2", "atom2_id": "///A/828/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5170, "atom2_serNum": 5185, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/729/O", "atom2_id": "///A/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5174, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/729/NE", "atom2_id": "///A/733/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5181, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/730/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5185, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///A/731/N", "atom2_id": "///A/847/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5188, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///A/731/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5188, "atom2_serNum": 5215, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5193, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/732/O", "atom2_id": "///A/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5201, "atom2_serNum": 5227, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/733/O", "atom2_id": "///A/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5210, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/734/O", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5218, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/735/O", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5218, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/735/O", "atom2_id": "///A/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5226, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/736/O", "atom2_id": "///A/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5265, "atom2_serNum": 5267, "donAcc_type": "acceptable", "distance": 2.800, "atom1_id": "///A/741/O", "atom2_id": "///A/741/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5265, "atom2_serNum": 5277, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/741/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5265, "atom2_serNum": 5280, "donAcc_type": "questionable", "distance": 3.131, "atom1_id": "///A/741/O", "atom2_id": "///A/744/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5289, "atom2_serNum": 5305, "donAcc_type": "acceptable", "distance": 2.682, "atom1_id": "///A/746/O", "atom2_id": "///A/747/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5303, "atom2_serNum": 5323, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/747/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5303, "atom2_serNum": 5332, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/747/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5309, "atom2_serNum": 5337, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///A/748/O", "atom2_id": "///A/751/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5309, "atom2_serNum": 5339, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/748/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5322, "atom2_serNum": 6469, "donAcc_type": "questionable", "distance": 3.274, "atom1_id": "///A/749/NZ", "atom2_id": "///B/185/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5326, "atom2_serNum": 5349, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/750/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5335, "atom2_serNum": 5357, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/751/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5342, "atom2_serNum": 5361, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/752/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5347, "atom2_serNum": 5370, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/753/O", "atom2_id": "///A/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5352, "atom2_serNum": 5375, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/754/O", "atom2_id": "///A/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5360, "atom2_serNum": 5387, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/755/O", "atom2_id": "///A/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5364, "atom2_serNum": 5392, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/756/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5369, "atom2_serNum": 5592, "donAcc_type": "standard", "distance": 3.698, "atom1_id": "///A/756/NZ", "atom2_id": "///A/784/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5373, "atom2_serNum": 5401, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/757/O", "atom2_id": "///A/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5378, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/758/O", "atom2_id": "///A/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5386, "atom2_serNum": 5659, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///A/758/OH", "atom2_id": "///A/793/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5390, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/759/O", "atom2_id": "///A/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5395, "atom2_serNum": 5428, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/760/O", "atom2_id": "///A/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5400, "atom2_serNum": 5741, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///A/760/NE2", "atom2_id": "///A/803/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5400, "atom2_serNum": 5763, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///A/760/NE2", "atom2_id": "///A/805/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5404, "atom2_serNum": 5428, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/761/O", "atom2_id": "///A/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5404, "atom2_serNum": 5436, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/761/O", "atom2_id": "///A/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5412, "atom2_serNum": 5444, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/762/O", "atom2_id": "///A/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5412, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/762/O", "atom2_id": "///A/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5431, "atom2_serNum": 5865, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/764/O", "atom2_id": "///A/817/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5447, "atom2_serNum": 5477, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/766/O", "atom2_id": "///A/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5459, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 3.461, "atom1_id": "///A/767/O", "atom2_id": "///A/773/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5470, "atom2_serNum": 6040, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/768/O", "atom2_id": "///A/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5480, "atom2_serNum": 5515, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/769/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5484, "atom2_serNum": 6076, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/769/NE", "atom2_id": "///A/844/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5487, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///A/769/NH2", "atom2_id": "///A/847/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5488, "atom2_serNum": 6077, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/770/N", "atom2_id": "///A/844/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5491, "atom2_serNum": 5515, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/770/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5491, "atom2_serNum": 5526, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/770/O", "atom2_id": "///A/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5497, "atom2_serNum": 6077, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/770/NH1", "atom2_id": "///A/844/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5498, "atom2_serNum": 6043, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/770/NH2", "atom2_id": "///A/839/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5498, "atom2_serNum": 9619, "donAcc_type": "standard", "distance": 3.831, "atom1_id": "///A/770/NH2", "atom2_id": "///S/32/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 684, "atom1_serNum": 5502, "atom2_serNum": 5534, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/771/O", "atom2_id": "///A/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5505, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/771/OD1", "atom2_id": "///A/856/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5505, "atom2_serNum": 6166, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/771/OD1", "atom2_id": "///A/856/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5506, "atom2_serNum": 6116, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/771/OD2", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5510, "atom2_serNum": 5539, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/772/O", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5510, "atom2_serNum": 5544, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///A/772/O", "atom2_id": "///A/776/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5518, "atom2_serNum": 5544, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///A/773/O", "atom2_id": "///A/776/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5518, "atom2_serNum": 5545, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/773/O", "atom2_id": "///A/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5524, "atom2_serNum": 5993, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/773/NH1", "atom2_id": "///A/833/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5525, "atom2_serNum": 6024, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/773/NH2", "atom2_id": "///A/837/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5529, "atom2_serNum": 5553, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/774/O", "atom2_id": "///A/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5537, "atom2_serNum": 5558, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/775/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5542, "atom2_serNum": 5566, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/776/O", "atom2_id": "///A/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5548, "atom2_serNum": 5572, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/777/O", "atom2_id": "///A/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5556, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/778/O", "atom2_id": "///A/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5561, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/779/O", "atom2_id": "///A/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5561, "atom2_serNum": 5582, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/779/O", "atom2_id": "///A/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5575, "atom2_serNum": 6278, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/781/O", "atom2_id": "///A/871/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5575, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/781/O", "atom2_id": "///A/871/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5575, "atom2_serNum": 6344, "donAcc_type": "questionable", "distance": 3.206, "atom1_id": "///A/781/O", "atom2_id": "///A/880/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5592, "atom2_serNum": 5613, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///A/784/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5606, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/786/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5616, "atom2_serNum": 5634, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/787/O", "atom2_id": "///A/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5661, "atom2_serNum": 5746, "donAcc_type": "acceptable", "distance": 3.483, "atom1_id": "///A/793/OG1", "atom2_id": "///A/803/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5666, "atom2_serNum": 5732, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///A/794/O", "atom2_id": "///A/801/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5668, "atom2_serNum": 5684, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///A/794/OG1", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5689, "atom2_serNum": 5698, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///A/796/OG", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5736, "atom2_serNum": 5765, "donAcc_type": "acceptable", "distance": 3.859, "atom1_id": "///A/802/O", "atom2_id": "///A/805/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5765, "atom2_serNum": 5774, "donAcc_type": "acceptable", "distance": 3.408, "atom1_id": "///A/805/OG1", "atom2_id": "///A/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5770, "atom2_serNum": 5772, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///A/806/O", "atom2_id": "///A/806/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5782, "atom2_serNum": 5808, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///A/808/O", "atom2_id": "///A/811/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5782, "atom2_serNum": 5810, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///A/808/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5785, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/808/OD1", "atom2_id": "///A/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5790, "atom2_serNum": 5810, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/809/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5790, "atom2_serNum": 5817, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/809/O", "atom2_id": "///A/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5798, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/810/O", "atom2_id": "///A/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5798, "atom2_serNum": 5838, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/810/O", "atom2_id": "///A/814/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5806, "atom2_serNum": 5839, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/811/O", "atom2_id": "///A/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5813, "atom2_serNum": 5850, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/812/O", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5820, "atom2_serNum": 5857, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/813/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5834, "atom2_serNum": 5871, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/814/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5834, "atom2_serNum": 5879, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/814/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5837, "atom2_serNum": 5969, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/814/OD1", "atom2_id": "///A/830/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5838, "atom2_serNum": 5972, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/814/ND2", "atom2_id": "///A/830/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5842, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///A/815/O", "atom2_id": "///A/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5860, "atom2_serNum": 5899, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///A/817/O", "atom2_id": "///A/821/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5874, "atom2_serNum": 5954, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/818/O", "atom2_id": "///A/827/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5882, "atom2_serNum": 5954, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/819/O", "atom2_id": "///A/827/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5895, "atom2_serNum": 5921, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/821/O", "atom2_id": "///A/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5898, "atom2_serNum": 5907, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/821/OD1", "atom2_id": "///A/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5932, "atom2_serNum": 5946, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///A/825/O", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5944, "atom2_serNum": 5946, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/826/OD1", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5944, "atom2_serNum": 5955, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/826/OD1", "atom2_id": "///A/828/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5944, "atom2_serNum": 5960, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///A/826/OD1", "atom2_id": "///A/828/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5986, "atom2_serNum": 6009, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/832/O", "atom2_id": "///A/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6012, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/835/O", "atom2_id": "///A/837/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6048, "atom2_serNum": 6065, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/840/O", "atom2_id": "///A/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6048, "atom2_serNum": 6070, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/840/O", "atom2_id": "///A/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6052, "atom2_serNum": 6078, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/841/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6057, "atom2_serNum": 6087, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6064, "atom2_serNum": 9676, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/842/NH2", "atom2_id": "///S/35/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 745, "atom1_serNum": 6068, "atom2_serNum": 6101, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6073, "atom2_serNum": 6111, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/844/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6119, "atom2_serNum": 6136, "donAcc_type": "standard", "distance": 3.662, "atom1_id": "///A/850/O", "atom2_id": "///A/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6139, "atom2_serNum": 6157, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/853/O", "atom2_id": "///A/856/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6139, "atom2_serNum": 6168, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/853/O", "atom2_id": "///A/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6147, "atom2_serNum": 6173, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/854/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6154, "atom2_serNum": 6178, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/855/O", "atom2_id": "///A/858/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6154, "atom2_serNum": 6180, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/855/O", "atom2_id": "///A/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6160, "atom2_serNum": 6194, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/856/O", "atom2_id": "///A/860/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6166, "atom2_serNum": 9584, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///A/856/NH1", "atom2_id": "///S/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 755, "atom1_serNum": 6171, "atom2_serNum": 6199, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/857/O", "atom2_id": "///A/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6176, "atom2_serNum": 6208, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/858/O", "atom2_id": "///A/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6183, "atom2_serNum": 6208, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/859/O", "atom2_id": "///A/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6183, "atom2_serNum": 6216, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/859/O", "atom2_id": "///A/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6197, "atom2_serNum": 6406, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/860/O", "atom2_id": "///A/888/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6202, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/861/O", "atom2_id": "///A/861/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6211, "atom2_serNum": 6231, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///A/862/O", "atom2_id": "///A/865/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6211, "atom2_serNum": 6233, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/862/O", "atom2_id": "///A/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6219, "atom2_serNum": 6238, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/863/O", "atom2_id": "///A/867/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6224, "atom2_serNum": 6246, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/864/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6229, "atom2_serNum": 6255, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/865/O", "atom2_id": "///A/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6236, "atom2_serNum": 6264, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/866/O", "atom2_id": "///A/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6241, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/867/O", "atom2_id": "///A/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6249, "atom2_serNum": 6282, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/868/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6249, "atom2_serNum": 6287, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/868/O", "atom2_id": "///A/872/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6258, "atom2_serNum": 6288, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/869/O", "atom2_id": "///A/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6267, "atom2_serNum": 6296, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/870/O", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6274, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/871/O", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6291, "atom2_serNum": 7210, "donAcc_type": "questionable", "distance": 2.870, "atom1_id": "///A/873/O", "atom2_id": "///B/306/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6299, "atom2_serNum": 7210, "donAcc_type": "questionable", "distance": 3.007, "atom1_id": "///A/874/O", "atom2_id": "///B/306/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6321, "atom2_serNum": 6329, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/878/N", "atom2_id": "///A/878/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6354, "atom2_serNum": 6378, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/882/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6366, "atom2_serNum": 6384, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/883/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6387, "atom2_serNum": 6408, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/886/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6392, "atom2_serNum": 9593, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/887/N", "atom2_id": "///S/31/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 780, "atom1_serNum": 6392, "atom2_serNum": 9607, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///A/887/N", "atom2_id": "///S/32/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 781, "atom1_serNum": 6404, "atom2_serNum": 9597, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/888/NE", "atom2_id": "///S/31/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 782, "atom1_serNum": 6407, "atom2_serNum": 9565, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/888/NH2", "atom2_id": "///S/30/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 783, "atom1_serNum": 6428, "atom2_serNum": 6435, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/179/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6433, "atom2_serNum": 6445, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/180/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6438, "atom2_serNum": 6450, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/181/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6443, "atom2_serNum": 6461, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/182/O", "atom2_id": "///B/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6443, "atom2_serNum": 6491, "donAcc_type": "standard", "distance": 3.748, "atom1_id": "///B/182/O", "atom2_id": "///B/188/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6479, "atom2_serNum": 7232, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/187/N", "atom2_id": "///B/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6487, "atom2_serNum": 7239, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/188/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6490, "atom2_serNum": 6492, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///B/188/OD1", "atom2_id": "///B/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6497, "atom2_serNum": 7242, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/190/N", "atom2_id": "///B/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6500, "atom2_serNum": 7252, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/190/O", "atom2_id": "///B/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6509, "atom2_serNum": 7255, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/192/N", "atom2_id": "///B/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6512, "atom2_serNum": 7268, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/192/O", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6512, "atom2_serNum": 7271, "donAcc_type": "questionable", "distance": 2.975, "atom1_id": "///B/192/O", "atom2_id": "///B/316/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6547, "atom2_serNum": 6557, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/197/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6556, "atom2_serNum": 6574, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///B/199/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6556, "atom2_serNum": 6583, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///B/199/O", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6560, "atom2_serNum": 6595, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///B/200/O", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6577, "atom2_serNum": 6607, "donAcc_type": "standard", "distance": 3.920, "atom1_id": "///B/203/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6586, "atom2_serNum": 6607, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/204/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6586, "atom2_serNum": 6612, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/204/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6598, "atom2_serNum": 6617, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/205/O", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6603, "atom2_serNum": 6622, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/206/O", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6610, "atom2_serNum": 6633, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/207/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6615, "atom2_serNum": 6638, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/208/O", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6620, "atom2_serNum": 6643, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/209/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6625, "atom2_serNum": 6648, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/210/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6636, "atom2_serNum": 6653, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///B/211/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6641, "atom2_serNum": 6664, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/212/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6641, "atom2_serNum": 6675, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/212/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6646, "atom2_serNum": 6664, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/213/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6686, "atom2_serNum": 7035, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///B/218/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6686, "atom2_serNum": 7043, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/218/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6693, "atom2_serNum": 6884, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/218/NH2", "atom2_id": "///B/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6697, "atom2_serNum": 6894, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/219/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6701, "atom2_serNum": 7046, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/220/N", "atom2_id": "///B/281/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6704, "atom2_serNum": 7053, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/220/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6709, "atom2_serNum": 6897, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/221/N", "atom2_id": "///B/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6712, "atom2_serNum": 6904, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/221/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6714, "atom2_serNum": 7056, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/222/N", "atom2_id": "///B/283/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6717, "atom2_serNum": 7066, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/222/O", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6722, "atom2_serNum": 6907, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/223/N", "atom2_id": "///B/261/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6725, "atom2_serNum": 6917, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///B/223/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6737, "atom2_serNum": 6754, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/225/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6742, "atom2_serNum": 6759, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/226/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6747, "atom2_serNum": 6764, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/227/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6752, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/228/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6757, "atom2_serNum": 6774, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/229/O", "atom2_id": "///B/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6762, "atom2_serNum": 6779, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/230/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6767, "atom2_serNum": 6784, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/231/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6772, "atom2_serNum": 6789, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/232/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6777, "atom2_serNum": 6789, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/233/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6777, "atom2_serNum": 6842, "donAcc_type": "acceptable", "distance": 3.409, "atom1_id": "///B/233/O", "atom2_id": "///B/243/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6792, "atom2_serNum": 6799, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/236/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6792, "atom2_serNum": 6842, "donAcc_type": "acceptable", "distance": 3.553, "atom1_id": "///B/236/O", "atom2_id": "///B/243/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6806, "atom2_serNum": 6815, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/239/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6818, "atom2_serNum": 6831, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/241/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6820, "atom2_serNum": 6892, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///B/242/N", "atom2_id": "///B/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6823, "atom2_serNum": 6843, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/242/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6823, "atom2_serNum": 6899, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///B/242/O", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6829, "atom2_serNum": 6879, "donAcc_type": "standard", "distance": 3.950, "atom1_id": "///B/242/NH1", "atom2_id": "///B/256/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6843, "atom2_serNum": 6902, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/244/N", "atom2_id": "///B/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6858, "atom2_serNum": 6880, "donAcc_type": "standard", "distance": 3.942, "atom1_id": "///B/253/N", "atom2_id": "///B/256/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6872, "atom2_serNum": 6879, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/256/N", "atom2_id": "///B/256/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6915, "atom2_serNum": 6927, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/262/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6915, "atom2_serNum": 6934, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/262/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6920, "atom2_serNum": 6945, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/263/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6925, "atom2_serNum": 6952, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/264/O", "atom2_id": "///B/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6930, "atom2_serNum": 6960, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/265/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6937, "atom2_serNum": 6971, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/266/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6948, "atom2_serNum": 6976, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/267/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6950, "atom2_serNum": 7122, "donAcc_type": "acceptable", "distance": 2.627, "atom1_id": "///B/267/OG1", "atom2_id": "///B/293/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6955, "atom2_serNum": 6981, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/268/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6963, "atom2_serNum": 6984, "donAcc_type": "questionable", "distance": 3.225, "atom1_id": "///B/269/O", "atom2_id": "///B/272/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6984, "atom2_serNum": 6993, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///B/272/O", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6996, "atom2_serNum": 7003, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/274/O", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7011, "atom2_serNum": 7023, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///B/277/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7038, "atom2_serNum": 7234, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/280/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7048, "atom2_serNum": 7237, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/282/N", "atom2_id": "///B/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7051, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/282/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7058, "atom2_serNum": 7247, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/284/N", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7061, "atom2_serNum": 7263, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/284/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7071, "atom2_serNum": 7266, "donAcc_type": "standard", "distance": 3.468, "atom1_id": "///B/286/N", "atom2_id": "///B/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7074, "atom2_serNum": 7091, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/286/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7087, "atom2_serNum": 7273, "donAcc_type": "acceptable", "distance": 2.872, "atom1_id": "///B/288/ND1", "atom2_id": "///B/316/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7087, "atom2_serNum": 7285, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///B/288/ND1", "atom2_id": "///B/318/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7094, "atom2_serNum": 7154, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///B/289/O", "atom2_id": "///B/298/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7110, "atom2_serNum": 7124, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/291/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7110, "atom2_serNum": 7129, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/291/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7115, "atom2_serNum": 7134, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/292/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7122, "atom2_serNum": 7139, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/293/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7127, "atom2_serNum": 7144, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/294/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7132, "atom2_serNum": 7155, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/295/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7137, "atom2_serNum": 7159, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/296/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7142, "atom2_serNum": 7171, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7147, "atom2_serNum": 7176, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7158, "atom2_serNum": 7181, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///B/299/O", "atom2_id": "///B/302/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7158, "atom2_serNum": 7182, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/299/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7158, "atom2_serNum": 7187, "donAcc_type": "acceptable", "distance": 2.833, "atom1_id": "///B/299/O", "atom2_id": "///B/303/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7162, "atom2_serNum": 7189, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/300/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7174, "atom2_serNum": 7200, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/301/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7179, "atom2_serNum": 7207, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/302/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7185, "atom2_serNum": 7211, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/303/O", "atom2_id": "///B/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7187, "atom2_serNum": 8388, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///B/303/OG1", "atom2_id": "///B/508/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7192, "atom2_serNum": 7220, "donAcc_type": "standard", "distance": 3.564, "atom1_id": "///B/304/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7199, "atom2_serNum": 7227, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///B/304/NH2", "atom2_id": "///B/309/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7203, "atom2_serNum": 7216, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///B/305/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7283, "atom2_serNum": 7285, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///B/318/O", "atom2_id": "///B/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7290, "atom2_serNum": 7305, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/319/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7313, "atom2_serNum": 7320, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/323/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7339, "atom2_serNum": 8116, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/327/O", "atom2_id": "///B/459/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7353, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///B/330/N", "atom2_id": "///B/463/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7359, "atom2_serNum": 8141, "donAcc_type": "questionable", "distance": 3.058, "atom1_id": "///B/330/OD1", "atom2_id": "///B/464/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7376, "atom2_serNum": 7383, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/333/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7378, "atom2_serNum": 8184, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///B/334/N", "atom2_id": "///B/471/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7381, "atom2_serNum": 8195, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/334/O", "atom2_id": "///B/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7388, "atom2_serNum": 8198, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/336/N", "atom2_id": "///B/473/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7391, "atom2_serNum": 8212, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/336/O", "atom2_id": "///B/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7398, "atom2_serNum": 8215, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/338/N", "atom2_id": "///B/475/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7412, "atom2_serNum": 7419, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/339/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7449, "atom2_serNum": 7471, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///B/345/NE1", "atom2_id": "///B/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7475, "atom2_serNum": 7499, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/349/O", "atom2_id": "///B/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7478, "atom2_serNum": 7493, "donAcc_type": "standard", "distance": 3.838, "atom1_id": "///B/349/OD1", "atom2_id": "///B/351/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7483, "atom2_serNum": 7504, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///B/350/O", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7483, "atom2_serNum": 7509, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///B/350/O", "atom2_id": "///B/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7537, "atom2_serNum": 7896, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/358/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7537, "atom2_serNum": 7901, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/358/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7539, "atom2_serNum": 7804, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/359/N", "atom2_id": "///B/404/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7542, "atom2_serNum": 7811, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/359/O", "atom2_id": "///B/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7546, "atom2_serNum": 7904, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/360/N", "atom2_id": "///B/422/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7549, "atom2_serNum": 7913, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/360/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7551, "atom2_serNum": 7814, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/361/N", "atom2_id": "///B/406/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7554, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/361/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7565, "atom2_serNum": 7916, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/362/N", "atom2_id": "///B/424/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7576, "atom2_serNum": 7824, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///B/363/N", "atom2_id": "///B/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7591, "atom2_serNum": 7608, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/365/O", "atom2_id": "///B/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7596, "atom2_serNum": 7612, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/366/O", "atom2_id": "///B/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7601, "atom2_serNum": 7617, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/367/O", "atom2_id": "///B/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7606, "atom2_serNum": 7622, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/368/O", "atom2_id": "///B/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7611, "atom2_serNum": 7627, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/369/O", "atom2_id": "///B/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7615, "atom2_serNum": 7632, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/370/O", "atom2_id": "///B/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7620, "atom2_serNum": 7637, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/371/O", "atom2_id": "///B/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7625, "atom2_serNum": 7643, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/372/O", "atom2_id": "///B/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7630, "atom2_serNum": 7648, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/373/O", "atom2_id": "///B/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7635, "atom2_serNum": 7653, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/374/O", "atom2_id": "///B/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7640, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/375/O", "atom2_id": "///B/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7646, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/376/O", "atom2_id": "///B/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7646, "atom2_serNum": 7666, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///B/376/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7646, "atom2_serNum": 7670, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/376/O", "atom2_id": "///B/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7651, "atom2_serNum": 7666, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///B/377/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7678, "atom2_serNum": 7801, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/382/O", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7678, "atom2_serNum": 7806, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/382/O", "atom2_id": "///B/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7685, "atom2_serNum": 7809, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/384/N", "atom2_id": "///B/405/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7688, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/384/O", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7695, "atom2_serNum": 7819, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/386/N", "atom2_id": "///B/407/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7703, "atom2_serNum": 7720, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/387/O", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7718, "atom2_serNum": 7735, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/390/O", "atom2_id": "///B/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7723, "atom2_serNum": 7740, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/391/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7738, "atom2_serNum": 7762, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/394/O", "atom2_id": "///B/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7743, "atom2_serNum": 7767, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/395/O", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7751, "atom2_serNum": 7873, "donAcc_type": "acceptable", "distance": 3.427, "atom1_id": "///B/395/OH", "atom2_id": "///B/417/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7755, "atom2_serNum": 7767, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///B/396/O", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7755, "atom2_serNum": 7772, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/396/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7760, "atom2_serNum": 7772, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///B/397/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7765, "atom2_serNum": 7775, "donAcc_type": "questionable", "distance": 2.682, "atom1_id": "///B/398/O", "atom2_id": "///B/400/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7765, "atom2_serNum": 7795, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/398/O", "atom2_id": "///B/403/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7775, "atom2_serNum": 7795, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/400/O", "atom2_id": "///B/403/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7829, "atom2_serNum": 7843, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///B/409/O", "atom2_id": "///B/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7836, "atom2_serNum": 7848, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/410/O", "atom2_id": "///B/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7841, "atom2_serNum": 7853, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///B/411/O", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7899, "atom2_serNum": 8179, "donAcc_type": "questionable", "distance": 2.771, "atom1_id": "///B/421/O", "atom2_id": "///B/470/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7899, "atom2_serNum": 8186, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///B/421/O", "atom2_id": "///B/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7906, "atom2_serNum": 8189, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/423/N", "atom2_id": "///B/472/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7909, "atom2_serNum": 8207, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/423/O", "atom2_id": "///B/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7918, "atom2_serNum": 8210, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/425/N", "atom2_id": "///B/474/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 7921, "atom2_serNum": 7930, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/425/O", "atom2_id": "///B/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 7940, "atom2_serNum": 8050, "donAcc_type": "standard", "distance": 2.457, "atom1_id": "///B/429/N", "atom2_id": "///B/448/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 7943, "atom2_serNum": 8039, "donAcc_type": "questionable", "distance": 2.884, "atom1_id": "///B/429/O", "atom2_id": "///B/446/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 7943, "atom2_serNum": 8047, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///B/429/O", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 7953, "atom2_serNum": 7962, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/431/O", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 7953, "atom2_serNum": 8031, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///B/431/O", "atom2_id": "///B/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 7958, "atom2_serNum": 8278, "donAcc_type": "standard", "distance": 3.923, "atom1_id": "///B/432/O", "atom2_id": "///B/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 7962, "atom2_serNum": 8024, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/433/N", "atom2_id": "///B/443/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 7965, "atom2_serNum": 8021, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/433/O", "atom2_id": "///B/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 7972, "atom2_serNum": 8008, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/435/N", "atom2_id": "///B/441/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 7975, "atom2_serNum": 8005, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/435/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 7992, "atom2_serNum": 8000, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/438/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 7996, "atom2_serNum": 8005, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/439/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8016, "atom2_serNum": 8812, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/442/N", "atom2_id": "///B/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8019, "atom2_serNum": 8819, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/442/O", "atom2_id": "///B/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8024, "atom2_serNum": 8031, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/443/O", "atom2_id": "///B/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8062, "atom2_serNum": 8238, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/450/O", "atom2_id": "///B/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8067, "atom2_serNum": 8087, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/451/O", "atom2_id": "///B/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8069, "atom2_serNum": 8081, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///B/451/OG1", "atom2_id": "///B/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8069, "atom2_serNum": 8086, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///B/451/OG1", "atom2_id": "///B/454/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8074, "atom2_serNum": 8092, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/452/O", "atom2_id": "///B/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8079, "atom2_serNum": 8097, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/453/O", "atom2_id": "///B/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8084, "atom2_serNum": 8102, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/454/O", "atom2_id": "///B/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8090, "atom2_serNum": 8107, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/455/O", "atom2_id": "///B/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8095, "atom2_serNum": 8118, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/456/O", "atom2_id": "///B/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8100, "atom2_serNum": 8122, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/457/O", "atom2_id": "///B/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8105, "atom2_serNum": 8122, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/458/O", "atom2_id": "///B/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8110, "atom2_serNum": 8127, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/459/O", "atom2_id": "///B/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8121, "atom2_serNum": 8147, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/460/O", "atom2_id": "///B/464/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8152, "atom2_serNum": 8166, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/465/O", "atom2_id": "///B/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8174, "atom2_serNum": 8181, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///B/469/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8256, "atom2_serNum": 8268, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/483/O", "atom2_id": "///B/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8256, "atom2_serNum": 8274, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///B/483/O", "atom2_id": "///B/486/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8281, "atom2_serNum": 8307, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/487/O", "atom2_id": "///B/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8281, "atom2_serNum": 8312, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/487/O", "atom2_id": "///B/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8286, "atom2_serNum": 8317, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/488/O", "atom2_id": "///B/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8296, "atom2_serNum": 8322, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/489/O", "atom2_id": "///B/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8310, "atom2_serNum": 8327, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/490/O", "atom2_id": "///B/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8315, "atom2_serNum": 8332, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/491/O", "atom2_id": "///B/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8320, "atom2_serNum": 8340, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/492/O", "atom2_id": "///B/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8325, "atom2_serNum": 8348, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/493/O", "atom2_id": "///B/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8330, "atom2_serNum": 8353, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/494/O", "atom2_id": "///B/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8335, "atom2_serNum": 8358, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/495/O", "atom2_id": "///B/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8398, "atom2_serNum": 8418, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/510/O", "atom2_id": "///B/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8398, "atom2_serNum": 8423, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///B/510/O", "atom2_id": "///B/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8409, "atom2_serNum": 8423, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/511/O", "atom2_id": "///B/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8464, "atom2_serNum": 8626, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/524/O", "atom2_id": "///B/549/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8492, "atom2_serNum": 8508, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///B/527/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8497, "atom2_serNum": 8513, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/528/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8501, "atom2_serNum": 8518, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/529/O", "atom2_id": "///B/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8506, "atom2_serNum": 8523, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/530/O", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8511, "atom2_serNum": 8528, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/531/O", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8516, "atom2_serNum": 8533, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/532/O", "atom2_id": "///B/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8521, "atom2_serNum": 8538, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/533/O", "atom2_id": "///B/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8526, "atom2_serNum": 8543, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/534/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8531, "atom2_serNum": 8548, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/535/O", "atom2_id": "///B/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8536, "atom2_serNum": 8553, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///B/536/O", "atom2_id": "///B/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8536, "atom2_serNum": 8564, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///B/536/O", "atom2_id": "///B/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8541, "atom2_serNum": 8573, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/537/O", "atom2_id": "///B/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8581, "atom2_serNum": 8604, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/544/O", "atom2_id": "///B/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8581, "atom2_serNum": 8612, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/544/O", "atom2_id": "///B/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8588, "atom2_serNum": 8617, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/545/O", "atom2_id": "///B/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8593, "atom2_serNum": 8627, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/546/O", "atom2_id": "///B/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8607, "atom2_serNum": 8636, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/547/O", "atom2_id": "///B/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8615, "atom2_serNum": 8643, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/548/O", "atom2_id": "///B/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8620, "atom2_serNum": 8648, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/549/O", "atom2_id": "///B/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8630, "atom2_serNum": 8653, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///B/550/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8639, "atom2_serNum": 8653, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/551/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8639, "atom2_serNum": 8658, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///B/551/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8646, "atom2_serNum": 8658, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/552/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8670, "atom2_serNum": 8689, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/557/O", "atom2_id": "///B/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8683, "atom2_serNum": 8935, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///B/558/OH", "atom2_id": "///B/619/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8683, "atom2_serNum": 8937, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///B/558/OH", "atom2_id": "///B/619/OXT", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8692, "atom2_serNum": 8712, "donAcc_type": "standard", "distance": 3.769, "atom1_id": "///B/560/O", "atom2_id": "///B/563/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8702, "atom2_serNum": 8724, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///B/562/O", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8702, "atom2_serNum": 8729, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/562/O", "atom2_id": "///B/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8707, "atom2_serNum": 8781, "donAcc_type": "questionable", "distance": 2.871, "atom1_id": "///B/563/O", "atom2_id": "///B/593/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8707, "atom2_serNum": 8790, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/563/O", "atom2_id": "///B/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8721, "atom2_serNum": 8778, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/564/O", "atom2_id": "///B/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8729, "atom2_serNum": 8781, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/566/N", "atom2_id": "///B/593/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8734, "atom2_serNum": 8781, "donAcc_type": "standard", "distance": 2.457, "atom1_id": "///B/567/N", "atom2_id": "///B/593/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8751, "atom2_serNum": 8758, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/570/O", "atom2_id": "///B/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8763, "atom2_serNum": 8776, "donAcc_type": "standard", "distance": 3.825, "atom1_id": "///B/573/N", "atom2_id": "///B/592/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8817, "atom2_serNum": 8835, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/598/O", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8822, "atom2_serNum": 8840, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/599/O", "atom2_id": "///B/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8822, "atom2_serNum": 8845, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/599/O", "atom2_id": "///B/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8853, "atom2_serNum": 8872, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/604/O", "atom2_id": "///B/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8858, "atom2_serNum": 8877, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/605/O", "atom2_id": "///B/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8865, "atom2_serNum": 8882, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/606/O", "atom2_id": "///B/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8870, "atom2_serNum": 8887, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/607/O", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8875, "atom2_serNum": 8892, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/608/O", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8880, "atom2_serNum": 8897, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/609/O", "atom2_id": "///B/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8885, "atom2_serNum": 8902, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/610/O", "atom2_id": "///B/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8890, "atom2_serNum": 8913, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/611/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8895, "atom2_serNum": 8918, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/612/O", "atom2_id": "///B/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8900, "atom2_serNum": 8927, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/613/O", "atom2_id": "///B/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8905, "atom2_serNum": 8923, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/614/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 8940, "atom2_serNum": 10349, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///S/1/OP1", "atom2_id": "///S/201/O1B", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1055, "atom1_serNum": 8940, "atom2_serNum": 10355, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///S/1/OP1", "atom2_id": "///S/201/O2A", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1056, "atom1_serNum": 8963, "atom2_serNum": 10349, "donAcc_type": "acceptable", "distance": 3.361, "atom1_id": "///S/2/OP2", "atom2_id": "///S/201/O1B", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1057, "atom1_serNum": 9001, "atom2_serNum": 10349, "donAcc_type": "acceptable", "distance": 3.493, "atom1_id": "///S/3/O4", "atom2_id": "///S/201/O1B", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1058, "atom1_serNum": 9041, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///S/5/O6", "atom2_id": "///S/67/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1059, "atom1_serNum": 9042, "atom2_serNum": 10340, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///S/5/N1", "atom2_id": "///S/67/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1060, "atom1_serNum": 9044, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///S/5/N2", "atom2_id": "///S/67/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1061, "atom1_serNum": 9062, "atom2_serNum": 10321, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///S/6/N3", "atom2_id": "///S/66/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1062, "atom1_serNum": 9064, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///S/6/O4", "atom2_id": "///S/66/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1063, "atom1_serNum": 9082, "atom2_serNum": 10299, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///S/7/N3", "atom2_id": "///S/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1064, "atom1_serNum": 9084, "atom2_serNum": 10298, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///S/7/O4", "atom2_id": "///S/65/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1065, "atom1_serNum": 9104, "atom2_serNum": 10278, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///S/8/N6", "atom2_id": "///S/64/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1066, "atom1_serNum": 9105, "atom2_serNum": 10276, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///S/8/N1", "atom2_id": "///S/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1067, "atom1_serNum": 9126, "atom2_serNum": 10258, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///S/9/O6", "atom2_id": "///S/63/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1068, "atom1_serNum": 9127, "atom2_serNum": 10256, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///S/9/N1", "atom2_id": "///S/63/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1069, "atom1_serNum": 9129, "atom2_serNum": 10255, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///S/9/N2", "atom2_id": "///S/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1070, "atom1_serNum": 9146, "atom2_serNum": 10235, "donAcc_type": "questionable", "distance": 2.753, "atom1_id": "///S/10/O2", "atom2_id": "///S/62/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1071, "atom1_serNum": 9146, "atom2_serNum": 10236, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///S/10/O2", "atom2_id": "///S/62/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1072, "atom1_serNum": 9147, "atom2_serNum": 10236, "donAcc_type": "questionable", "distance": 2.841, "atom1_id": "///S/10/N3", "atom2_id": "///S/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1073, "atom1_serNum": 9147, "atom2_serNum": 10238, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///S/10/N3", "atom2_id": "///S/62/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1074, "atom1_serNum": 9149, "atom2_serNum": 10238, "donAcc_type": "questionable", "distance": 2.786, "atom1_id": "///S/10/O4", "atom2_id": "///S/62/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1075, "atom1_serNum": 9166, "atom2_serNum": 10192, "donAcc_type": "questionable", "distance": 2.841, "atom1_id": "///S/11/O2", "atom2_id": "///S/60/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1076, "atom1_serNum": 9169, "atom2_serNum": 10195, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///S/11/N4", "atom2_id": "///S/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1077, "atom1_serNum": 9187, "atom2_serNum": 10174, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///S/12/N3", "atom2_id": "///S/59/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1078, "atom1_serNum": 9189, "atom2_serNum": 10173, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///S/12/O4", "atom2_id": "///S/59/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1079, "atom1_serNum": 9202, "atom2_serNum": 9221, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///S/13/O2'", "atom2_id": "///S/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1080, "atom1_serNum": 9209, "atom2_serNum": 10153, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///S/13/O6", "atom2_id": "///S/58/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1081, "atom1_serNum": 9210, "atom2_serNum": 10151, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///S/13/N1", "atom2_id": "///S/58/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1082, "atom1_serNum": 9212, "atom2_serNum": 10150, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///S/13/N2", "atom2_id": "///S/58/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1083, "atom1_serNum": 9230, "atom2_serNum": 10132, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///S/14/N3", "atom2_id": "///S/57/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1084, "atom1_serNum": 9232, "atom2_serNum": 10131, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///S/14/O4", "atom2_id": "///S/57/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1085, "atom1_serNum": 9252, "atom2_serNum": 10111, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///S/15/O6", "atom2_id": "///S/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1086, "atom1_serNum": 9253, "atom2_serNum": 10109, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///S/15/N1", "atom2_id": "///S/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1087, "atom1_serNum": 9255, "atom2_serNum": 10108, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///S/15/N2", "atom2_id": "///S/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1088, "atom1_serNum": 9273, "atom2_serNum": 10090, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///S/16/N3", "atom2_id": "///S/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 9275, "atom2_serNum": 10089, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///S/16/O4", "atom2_id": "///S/55/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 9288, "atom2_serNum": 9341, "donAcc_type": "acceptable", "distance": 2.450, "atom1_id": "///S/17/O2'", "atom2_id": "///S/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 9288, "atom2_serNum": 10067, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///S/17/O2'", "atom2_id": "///S/54/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 9288, "atom2_serNum": 10068, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///S/17/O2'", "atom2_id": "///S/54/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 9296, "atom2_serNum": 9347, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///S/17/N1", "atom2_id": "///S/20/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 9298, "atom2_serNum": 9348, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///S/17/N2", "atom2_id": "///S/20/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 9298, "atom2_serNum": 10064, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///S/17/N2", "atom2_id": "///S/54/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 9299, "atom2_serNum": 10067, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///S/17/N3", "atom2_id": "///S/54/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 9321, "atom2_serNum": 9902, "donAcc_type": "standard", "distance": 2.328, "atom1_id": "///S/18/N2", "atom2_id": "///S/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 9334, "atom2_serNum": 9348, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///S/19/O2'", "atom2_id": "///S/20/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 9334, "atom2_serNum": 9352, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///S/19/O2'", "atom2_id": "///S/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1100, "atom1_serNum": 9334, "atom2_serNum": 10052, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///S/19/O2'", "atom2_id": "///S/54/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1101, "atom1_serNum": 9348, "atom2_serNum": 10052, "donAcc_type": "questionable", "distance": 2.962, "atom1_id": "///S/20/OP2", "atom2_id": "///S/54/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1102, "atom1_serNum": 9360, "atom2_serNum": 9857, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///S/20/O2", "atom2_id": "///S/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1103, "atom1_serNum": 9361, "atom2_serNum": 9855, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///S/20/N3", "atom2_id": "///S/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1104, "atom1_serNum": 9363, "atom2_serNum": 9854, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///S/20/N4", "atom2_id": "///S/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1105, "atom1_serNum": 9380, "atom2_serNum": 9834, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///S/21/O2", "atom2_id": "///S/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1106, "atom1_serNum": 9381, "atom2_serNum": 9832, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///S/21/N3", "atom2_id": "///S/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1107, "atom1_serNum": 9383, "atom2_serNum": 9831, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///S/21/N4", "atom2_id": "///S/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1108, "atom1_serNum": 9403, "atom2_serNum": 9811, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///S/22/O6", "atom2_id": "///S/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1109, "atom1_serNum": 9404, "atom2_serNum": 9809, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///S/22/N1", "atom2_id": "///S/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1110, "atom1_serNum": 9406, "atom2_serNum": 9808, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///S/22/N2", "atom2_id": "///S/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1111, "atom1_serNum": 9426, "atom2_serNum": 9791, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///S/23/N6", "atom2_id": "///S/40/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 9427, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///S/23/N1", "atom2_id": "///S/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 9445, "atom2_serNum": 9769, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///S/24/O2", "atom2_id": "///S/39/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 9446, "atom2_serNum": 9769, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///S/24/N3", "atom2_id": "///S/39/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 9461, "atom2_serNum": 9476, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///S/25/O2'", "atom2_id": "///S/26/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 9461, "atom2_serNum": 9479, "donAcc_type": "acceptable", "distance": 3.009, "atom1_id": "///S/25/O2'", "atom2_id": "///S/26/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 9461, "atom2_serNum": 9747, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///S/25/O2'", "atom2_id": "///S/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 9465, "atom2_serNum": 9725, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///S/25/N7", "atom2_id": "///S/37/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 9471, "atom2_serNum": 9747, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///S/25/N3", "atom2_id": "///S/38/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 9490, "atom2_serNum": 9718, "donAcc_type": "acceptable", "distance": 2.573, "atom1_id": "///S/26/N6", "atom2_id": "///S/37/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 9490, "atom2_serNum": 9728, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///S/26/N6", "atom2_id": "///S/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 9512, "atom2_serNum": 9705, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///S/27/O6", "atom2_id": "///S/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 9513, "atom2_serNum": 9703, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///S/27/N1", "atom2_id": "///S/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 9515, "atom2_serNum": 9702, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///S/27/N2", "atom2_id": "///S/36/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1125, "atom1_serNum": 9535, "atom2_serNum": 9685, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///S/28/O6", "atom2_id": "///S/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 9536, "atom2_serNum": 9683, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///S/28/N1", "atom2_id": "///S/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 9538, "atom2_serNum": 9682, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///S/28/N2", "atom2_id": "///S/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 9558, "atom2_serNum": 9665, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///S/29/N6", "atom2_id": "///S/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1129, "atom1_serNum": 9559, "atom2_serNum": 9663, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///S/29/N1", "atom2_id": "///S/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 9577, "atom2_serNum": 9623, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///S/30/O2", "atom2_id": "///S/32/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 9577, "atom2_serNum": 9625, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///S/30/O2", "atom2_id": "///S/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 9593, "atom2_serNum": 9607, "donAcc_type": "acceptable", "distance": 2.418, "atom1_id": "///S/31/O2'", "atom2_id": "///S/32/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 9658, "atom2_serNum": 9671, "donAcc_type": "acceptable", "distance": 2.452, "atom1_id": "///S/34/O2'", "atom2_id": "///S/35/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1134, "atom1_serNum": 9658, "atom2_serNum": 9674, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///S/34/O2'", "atom2_id": "///S/35/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1135, "atom1_serNum": 9784, "atom2_serNum": 9800, "donAcc_type": "acceptable", "distance": 3.271, "atom1_id": "///S/40/O2'", "atom2_id": "///S/41/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1136, "atom1_serNum": 9877, "atom2_serNum": 10047, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///S/44/N6", "atom2_id": "///S/53/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1137, "atom1_serNum": 9878, "atom2_serNum": 10045, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///S/44/N1", "atom2_id": "///S/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1138, "atom1_serNum": 9899, "atom2_serNum": 10027, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///S/45/N6", "atom2_id": "///S/52/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1139, "atom1_serNum": 9900, "atom2_serNum": 10025, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///S/45/N1", "atom2_id": "///S/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1140, "atom1_serNum": 9921, "atom2_serNum": 10007, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///S/46/O6", "atom2_id": "///S/51/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1141, "atom1_serNum": 9922, "atom2_serNum": 10005, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///S/46/N1", "atom2_id": "///S/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1142, "atom1_serNum": 9924, "atom2_serNum": 10004, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///S/46/N2", "atom2_id": "///S/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1143, "atom1_serNum": 9937, "atom2_serNum": 9941, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///S/47/O2'", "atom2_id": "///S/47/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1144, "atom1_serNum": 9937, "atom2_serNum": 9949, "donAcc_type": "acceptable", "distance": 3.435, "atom1_id": "///S/47/O2'", "atom2_id": "///S/49/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1145, "atom1_serNum": 9941, "atom2_serNum": 9987, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///S/47/O2", "atom2_id": "///S/50/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1146, "atom1_serNum": 9942, "atom2_serNum": 9985, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///S/47/N3", "atom2_id": "///S/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1147, "atom1_serNum": 9944, "atom2_serNum": 9984, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///S/47/N4", "atom2_id": "///S/50/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1148, "atom1_serNum": 9977, "atom2_serNum": 9992, "donAcc_type": "acceptable", "distance": 2.600, "atom1_id": "///S/50/O2'", "atom2_id": "///S/51/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1149, "atom1_serNum": 10188, "atom2_serNum": 10209, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///S/60/O2'", "atom2_id": "///S/61/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1150, "atom1_serNum": 10188, "atom2_serNum": 10223, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///S/60/O2'", "atom2_id": "///S/62/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1151, "atom1_serNum": 10188, "atom2_serNum": 10224, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///S/60/O2'", "atom2_id": "///S/62/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1152, "atom1_serNum": 10211, "atom2_serNum": 10215, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///S/61/O2'", "atom2_id": "///S/61/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1153, "atom1_serNum": 10211, "atom2_serNum": 10222, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///S/61/O2'", "atom2_id": "///S/62/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1154, "atom1_serNum": 10349, "atom2_serNum": 10355, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///S/201/O1B", "atom2_id": "///S/201/O2A", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 1155, "atom1_serNum": 10350, "atom2_serNum": 10355, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///S/201/O2B", "atom2_id": "///S/201/O2A", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "8gzq", "num_aaChains": 2, "aaChains": "A=852,B=408", "num_naChains": 1, "naChains": "S=67", "num_atoms": 10372, "num_waters": 0, "num_metals": 2, "metals_desc": "Zn=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 8, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 9, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 10, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 11, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 12, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }