{ "num_pairs": 24, "pairs": [ { "index": 1, "nt1": "///C/2", "nt2": "///D/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -44.218, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 53.620, "chi2": -83.568, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 55.103, "C1C1_dist": 10.556, "N1N9_dist": 8.838, "C6C8_dist": 9.776, "CNNC_torsion": 7.793, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 10.741, "planarity": 0.224, "simple_Shear": -0.196, "simple_Stretch": -0.286, "simple_Buckle": -9.889, "simple_Propeller": -4.192, "bp_simpleParams": [ -0.196, -0.286, -1.175, -9.889, -4.192, 1.639 ], "bp_params": [ -0.193, -0.289, -1.175, -9.837, -4.313, 1.634 ], "frame": { "rmsd": null, "origin": [ 133.330, 84.432, 159.838 ], "x_axis": [ -0.416, -0.669, -0.616 ], "y_axis": [ -0.817, -0.023, 0.576 ], "z_axis": [ -0.399, 0.743, -0.537 ], "quaternion": [ 0.078, -0.535, 0.695, 0.475 ] } }, { "index": 2, "nt1": "///C/3", "nt2": "///D/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -70.714, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 52.206, "chi2": -61.288, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 53.336, "C1C1_dist": 10.631, "N1N9_dist": 8.844, "C6C8_dist": 9.712, "CNNC_torsion": 13.946, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 10.814, "planarity": 0.252, "simple_Shear": -0.123, "simple_Stretch": -0.361, "simple_Buckle": -10.806, "simple_Propeller": 0.409, "bp_simpleParams": [ -0.123, -0.361, -1.346, -10.806, 0.409, -1.788 ], "bp_params": [ -0.120, -0.361, -1.346, -10.809, 0.325, -1.780 ], "frame": { "rmsd": null, "origin": [ 131.001, 87.763, 160.193 ], "x_axis": [ -0.830, -0.543, -0.126 ], "y_axis": [ -0.371, 0.369, 0.852 ], "z_axis": [ -0.416, 0.754, -0.508 ], "quaternion": [ -0.088, -0.278, 0.823, 0.488 ] } }, { "index": 3, "nt1": "///C/4", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.561, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.996, "chi2": -95.234, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.108, "C1C1_dist": 10.772, "N1N9_dist": 8.953, "C6C8_dist": 9.836, "CNNC_torsion": 4.360, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 1.532, "planarity": 0.172, "simple_Shear": -0.130, "simple_Stretch": -0.153, "simple_Buckle": -0.794, "simple_Propeller": -1.311, "bp_simpleParams": [ -0.130, -0.153, -0.812, -0.794, -1.311, -2.965 ], "bp_params": [ -0.127, -0.155, -0.812, -0.771, -1.324, -2.965 ], "frame": { "rmsd": null, "origin": [ 129.942, 90.847, 159.604 ], "x_axis": [ -0.860, -0.416, 0.297 ], "y_axis": [ 0.048, 0.512, 0.857 ], "z_axis": [ -0.508, 0.752, -0.420 ], "quaternion": [ -0.241, -0.110, 0.836, 0.481 ] } }, { "index": 4, "nt1": "///C/5", "nt2": "///D/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.521, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.418, "chi2": -120.709, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.858, "C1C1_dist": 10.722, "N1N9_dist": 8.954, "C6C8_dist": 9.874, "CNNC_torsion": 1.231, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.170, "planarity": 0.112, "simple_Shear": 0.196, "simple_Stretch": -0.161, "simple_Buckle": 2.770, "simple_Propeller": -3.117, "bp_simpleParams": [ 0.196, -0.161, -0.543, 2.770, -3.117, 0.135 ], "bp_params": [ 0.193, -0.164, -0.543, 2.724, -3.157, 0.135 ], "frame": { "rmsd": null, "origin": [ 127.664, 92.689, 158.316 ], "x_axis": [ -0.596, -0.062, 0.801 ], "y_axis": [ 0.573, 0.666, 0.478 ], "z_axis": [ -0.563, 0.744, -0.361 ], "quaternion": [ -0.421, 0.158, 0.810, 0.377 ] } }, { "index": 5, "nt1": "///C/6", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.866, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.885, "chi2": -114.427, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.637, "C1C1_dist": 10.741, "N1N9_dist": 8.955, "C6C8_dist": 9.873, "CNNC_torsion": -5.895, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 8.251, "planarity": 0.105, "simple_Shear": -0.111, "simple_Stretch": -0.081, "simple_Buckle": 0.056, "simple_Propeller": -8.251, "bp_simpleParams": [ -0.111, -0.081, -0.064, 0.056, -8.251, -1.469 ], "bp_params": [ -0.109, -0.083, -0.064, 0.183, -8.249, -1.472 ], "frame": { "rmsd": null, "origin": [ 125.795, 95.386, 157.599 ], "x_axis": [ -0.128, 0.358, 0.925 ], "y_axis": [ 0.799, 0.590, -0.118 ], "z_axis": [ -0.588, 0.724, -0.362 ], "quaternion": [ 0.525, -0.401, -0.721, -0.210 ] } }, { "index": 6, "nt1": "///C/7", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.466, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.996, "chi2": -113.945, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.350, "C1C1_dist": 10.683, "N1N9_dist": 8.915, "C6C8_dist": 9.855, "CNNC_torsion": -8.594, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 7.917, "planarity": 0.107, "simple_Shear": -0.163, "simple_Stretch": -0.098, "simple_Buckle": -1.085, "simple_Propeller": -7.842, "bp_simpleParams": [ -0.163, -0.098, 0.171, -1.085, -7.842, -0.815 ], "bp_params": [ -0.161, -0.102, 0.171, -0.924, -7.863, -0.817 ], "frame": { "rmsd": null, "origin": [ 123.547, 97.580, 156.535 ], "x_axis": [ 0.379, 0.626, 0.681 ], "y_axis": [ 0.717, 0.266, -0.644 ], "z_axis": [ -0.585, 0.732, -0.348 ], "quaternion": [ 0.570, -0.604, -0.556, -0.040 ] } }, { "index": 7, "nt1": "///C/8", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.154, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.893, "chi2": -109.561, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.571, "C1C1_dist": 10.743, "N1N9_dist": 8.961, "C6C8_dist": 9.868, "CNNC_torsion": -8.434, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 6.195, "planarity": 0.101, "simple_Shear": 0.181, "simple_Stretch": -0.158, "simple_Buckle": -1.653, "simple_Propeller": -5.970, "bp_simpleParams": [ 0.181, -0.158, 0.356, -1.653, -5.970, -0.942 ], "bp_params": [ 0.179, -0.161, 0.356, -1.734, -5.947, -0.943 ], "frame": { "rmsd": null, "origin": [ 121.932, 100.138, 154.961 ], "x_axis": [ 0.755, 0.642, 0.134 ], "y_axis": [ 0.335, -0.202, -0.920 ], "z_axis": [ -0.563, 0.740, -0.368 ], "quaternion": [ 0.544, -0.762, -0.320, 0.141 ] } }, { "index": 8, "nt1": "///C/9", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.404, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.276, "chi2": -105.016, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.182, "C1C1_dist": 10.845, "N1N9_dist": 9.230, "C6C8_dist": 10.318, "CNNC_torsion": -9.764, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.74],N1-N3(imino)[3.34]", "interBase_angle": 8.075, "planarity": 0.183, "simple_Shear": -0.005, "simple_Stretch": 0.379, "simple_Buckle": -5.602, "simple_Propeller": -5.816, "bp_simpleParams": [ -0.005, 0.379, 0.600, -5.602, -5.816, 5.858 ], "bp_params": [ -0.003, 0.379, 0.600, -5.635, -5.783, 5.858 ], "frame": { "rmsd": null, "origin": [ 120.204, 102.536, 152.648 ], "x_axis": [ 0.807, 0.367, -0.463 ], "y_axis": [ -0.197, -0.572, -0.796 ], "z_axis": [ -0.557, 0.734, -0.389 ], "quaternion": [ -0.460, 0.832, 0.051, -0.306 ] } }, { "index": 9, "nt1": "///C/10", "nt2": "///D/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.889, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.102, "chi2": -95.840, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.553, "C1C1_dist": 10.719, "N1N9_dist": 8.942, "C6C8_dist": 9.851, "CNNC_torsion": 0.522, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 5.580, "planarity": 0.073, "simple_Shear": 0.199, "simple_Stretch": -0.154, "simple_Buckle": -5.415, "simple_Propeller": 1.346, "bp_simpleParams": [ 0.199, -0.154, 0.015, -5.415, 1.346, -0.491 ], "bp_params": [ 0.196, -0.157, 0.015, -5.394, 1.426, -0.491 ], "frame": { "rmsd": null, "origin": [ 117.591, 104.875, 151.849 ], "x_axis": [ 0.572, -0.070, -0.817 ], "y_axis": [ -0.625, -0.683, -0.379 ], "z_axis": [ -0.531, 0.727, -0.435 ], "quaternion": [ -0.337, 0.820, -0.212, -0.411 ] } }, { "index": 10, "nt1": "///C/11", "nt2": "///D/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.091, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.674, "chi2": -121.558, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.167, "C1C1_dist": 10.574, "N1N9_dist": 8.846, "C6C8_dist": 9.816, "CNNC_torsion": -1.760, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 2.608, "planarity": 0.059, "simple_Shear": 0.073, "simple_Stretch": -0.132, "simple_Buckle": -2.475, "simple_Propeller": -0.820, "bp_simpleParams": [ 0.073, -0.132, 0.166, -2.475, -0.820, 0.623 ], "bp_params": [ 0.071, -0.133, 0.166, -2.485, -0.791, 0.623 ], "frame": { "rmsd": null, "origin": [ 115.323, 106.649, 149.251 ], "x_axis": [ 0.200, -0.536, -0.820 ], "y_axis": [ -0.846, -0.517, 0.131 ], "z_axis": [ -0.494, 0.667, -0.557 ], "quaternion": [ -0.178, 0.754, -0.458, -0.436 ] } }, { "index": 11, "nt1": "///C/12", "nt2": "///D/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.973, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.512, "chi2": -103.147, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.990, "C1C1_dist": 10.608, "N1N9_dist": 8.893, "C6C8_dist": 9.850, "CNNC_torsion": -0.586, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.924, "planarity": 0.100, "simple_Shear": 0.213, "simple_Stretch": -0.168, "simple_Buckle": -3.756, "simple_Propeller": -1.134, "bp_simpleParams": [ 0.213, -0.168, -0.246, -3.756, -1.134, 1.255 ], "bp_params": [ 0.211, -0.171, -0.246, -3.775, -1.070, 1.255 ], "frame": { "rmsd": null, "origin": [ 114.839, 109.897, 147.165 ], "x_axis": [ -0.243, -0.770, -0.589 ], "y_axis": [ -0.821, -0.160, 0.548 ], "z_axis": [ -0.517, 0.617, -0.594 ], "quaternion": [ 0.028, -0.615, 0.647, 0.450 ] } }, { "index": 12, "nt1": "///C/13", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.617, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.064, "chi2": -98.285, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.928, "C1C1_dist": 10.715, "N1N9_dist": 8.945, "C6C8_dist": 9.857, "CNNC_torsion": 3.968, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 2.392, "planarity": 0.046, "simple_Shear": 0.181, "simple_Stretch": -0.161, "simple_Buckle": 1.093, "simple_Propeller": 2.128, "bp_simpleParams": [ 0.181, -0.161, -0.195, 1.093, 2.128, -0.579 ], "bp_params": [ 0.178, -0.163, -0.195, 1.122, 2.113, -0.579 ], "frame": { "rmsd": null, "origin": [ 112.212, 111.686, 144.947 ], "x_axis": [ -0.570, -0.791, -0.221 ], "y_axis": [ -0.642, 0.262, 0.720 ], "z_axis": [ -0.512, 0.552, -0.658 ], "quaternion": [ -0.092, -0.454, 0.789, 0.403 ] } }, { "index": 13, "nt1": "///C/14", "nt2": "///D/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.137, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.822, "chi2": -114.453, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.271, "C1C1_dist": 10.716, "N1N9_dist": 8.947, "C6C8_dist": 9.860, "CNNC_torsion": 5.079, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 4.097, "planarity": 0.062, "simple_Shear": -0.183, "simple_Stretch": -0.156, "simple_Buckle": -2.939, "simple_Propeller": 2.854, "bp_simpleParams": [ -0.183, -0.156, -0.234, -2.939, 2.854, -0.487 ], "bp_params": [ -0.181, -0.159, -0.234, -2.978, 2.813, -0.487 ], "frame": { "rmsd": null, "origin": [ 109.506, 114.659, 142.966 ], "x_axis": [ -0.853, -0.475, 0.215 ], "y_axis": [ -0.189, 0.666, 0.722 ], "z_axis": [ -0.486, 0.575, -0.658 ], "quaternion": [ -0.197, -0.186, 0.891, 0.364 ] } }, { "index": 14, "nt1": "///C/15", "nt2": "///D/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.174, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.604, "chi2": -131.576, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.247, "C1C1_dist": 10.631, "N1N9_dist": 8.903, "C6C8_dist": 9.850, "CNNC_torsion": 0.150, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 2.647, "planarity": 0.037, "simple_Shear": -0.210, "simple_Stretch": -0.167, "simple_Buckle": 2.101, "simple_Propeller": 1.611, "bp_simpleParams": [ -0.210, -0.167, -0.035, 2.101, 1.611, 0.833 ], "bp_params": [ -0.208, -0.171, -0.035, 2.074, 1.645, 0.833 ], "frame": { "rmsd": null, "origin": [ 108.107, 117.417, 140.787 ], "x_axis": [ -0.781, -0.174, 0.600 ], "y_axis": [ 0.269, 0.774, 0.573 ], "z_axis": [ -0.564, 0.609, -0.557 ], "quaternion": [ -0.330, 0.027, 0.882, 0.335 ] } }, { "index": 15, "nt1": "///C/16", "nt2": "///D/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.181, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.586, "chi2": -119.905, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.955, "C1C1_dist": 10.512, "N1N9_dist": 8.801, "C6C8_dist": 9.784, "CNNC_torsion": -0.419, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 3.849, "planarity": 0.092, "simple_Shear": -0.060, "simple_Stretch": -0.171, "simple_Buckle": -0.172, "simple_Propeller": 3.845, "bp_simpleParams": [ -0.060, -0.171, 0.382, -0.172, 3.845, 1.378 ], "bp_params": [ -0.058, -0.172, 0.382, -0.212, 3.843, 1.378 ], "frame": { "rmsd": null, "origin": [ 104.909, 118.371, 138.774 ], "x_axis": [ -0.471, 0.246, 0.847 ], "y_axis": [ 0.635, 0.761, 0.132 ], "z_axis": [ -0.613, 0.600, -0.514 ], "quaternion": [ -0.440, 0.266, 0.829, 0.221 ] } }, { "index": 16, "nt1": "///C/17", "nt2": "///D/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.229, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.470, "chi2": -114.923, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.043, "C1C1_dist": 10.692, "N1N9_dist": 8.913, "C6C8_dist": 9.820, "CNNC_torsion": -4.456, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 3.638, "planarity": 0.105, "simple_Shear": -0.181, "simple_Stretch": -0.207, "simple_Buckle": 3.474, "simple_Propeller": 1.081, "bp_simpleParams": [ -0.181, -0.207, 0.547, 3.474, 1.081, -0.579 ], "bp_params": [ -0.178, -0.209, 0.547, 3.460, 1.126, -0.578 ], "frame": { "rmsd": null, "origin": [ 103.372, 120.787, 136.064 ], "x_axis": [ 0.018, 0.579, 0.815 ], "y_axis": [ 0.789, 0.493, -0.367 ], "z_axis": [ -0.614, 0.650, -0.448 ], "quaternion": [ 0.515, -0.493, -0.693, -0.102 ] } }, { "index": 17, "nt1": "///C/18", "nt2": "///D/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.052, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.547, "chi2": -116.253, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.692, "C1C1_dist": 10.701, "N1N9_dist": 8.912, "C6C8_dist": 9.801, "CNNC_torsion": -12.764, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 5.512, "planarity": 0.186, "simple_Shear": -0.154, "simple_Stretch": -0.259, "simple_Buckle": 2.339, "simple_Propeller": -4.991, "bp_simpleParams": [ -0.154, -0.259, 0.867, 2.339, -4.991, -2.037 ], "bp_params": [ -0.151, -0.260, 0.867, 2.395, -4.965, -2.039 ], "frame": { "rmsd": null, "origin": [ 101.203, 123.346, 134.994 ], "x_axis": [ 0.486, 0.738, 0.468 ], "y_axis": [ 0.617, 0.090, -0.782 ], "z_axis": [ -0.619, 0.669, -0.412 ], "quaternion": [ 0.539, -0.672, -0.504, 0.056 ] } }, { "index": 18, "nt1": "///C/19", "nt2": "///D/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.652, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.328, "chi2": -115.438, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.358, "C1C1_dist": 11.545, "N1N9_dist": 9.813, "C6C8_dist": 10.787, "CNNC_torsion": -15.346, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.78]", "interBase_angle": 12.159, "planarity": 0.189, "simple_Shear": 0.619, "simple_Stretch": 0.840, "simple_Buckle": 1.451, "simple_Propeller": -12.072, "bp_simpleParams": [ 0.619, 0.840, 0.550, 1.451, -12.072, 0.231 ], "bp_params": [ 0.673, 0.797, 0.550, 0.643, -12.142, 0.232 ], "frame": { "rmsd": null, "origin": [ 99.075, 125.320, 132.903 ], "x_axis": [ 0.766, 0.612, -0.196 ], "y_axis": [ 0.107, -0.422, -0.900 ], "z_axis": [ -0.633, 0.669, -0.389 ], "quaternion": [ -0.489, 0.803, 0.224, -0.258 ] } }, { "index": 19, "nt1": "///C/20", "nt2": "///D/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.778, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.672, "chi2": -106.323, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.548, "C1C1_dist": 10.600, "N1N9_dist": 8.871, "C6C8_dist": 9.850, "CNNC_torsion": -5.659, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 9.245, "planarity": 0.121, "simple_Shear": -0.057, "simple_Stretch": -0.105, "simple_Buckle": 1.087, "simple_Propeller": -9.181, "bp_simpleParams": [ -0.057, -0.105, -0.157, 1.087, -9.181, 1.357 ], "bp_params": [ -0.056, -0.105, -0.157, 1.183, -9.169, 1.362 ], "frame": { "rmsd": null, "origin": [ 97.184, 127.923, 131.679 ], "x_axis": [ 0.723, 0.324, -0.610 ], "y_axis": [ -0.308, -0.638, -0.705 ], "z_axis": [ -0.618, 0.698, -0.362 ], "quaternion": [ -0.425, 0.825, 0.005, -0.372 ] } }, { "index": 20, "nt1": "///C/21", "nt2": "///D/6", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.217, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.236, "chi2": -101.738, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.596, "C1C1_dist": 11.790, "N1N9_dist": 10.114, "C6C8_dist": 11.100, "CNNC_torsion": -18.643, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 28.188, "planarity": 0.326, "simple_Shear": -1.367, "simple_Stretch": 1.216, "simple_Buckle": -13.790, "simple_Propeller": -24.585, "bp_simpleParams": [ -1.367, 1.216, -0.304, -13.790, -24.585, 5.249 ], "bp_params": [ -1.505, 1.041, -0.304, -10.571, -26.131, 5.367 ], "frame": { "rmsd": null, "origin": [ 94.836, 129.792, 130.057 ], "x_axis": [ 0.490, -0.155, -0.858 ], "y_axis": [ -0.675, -0.691, -0.260 ], "z_axis": [ -0.552, 0.706, -0.443 ], "quaternion": [ -0.298, 0.810, -0.256, -0.435 ] } }, { "index": 21, "nt1": "///C/22", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.525, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.181, "chi2": -72.238, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 54.893, "C1C1_dist": 10.484, "N1N9_dist": 8.824, "C6C8_dist": 9.819, "CNNC_torsion": -11.853, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 17.916, "planarity": 0.266, "simple_Shear": 0.181, "simple_Stretch": -0.124, "simple_Buckle": -14.137, "simple_Propeller": -11.006, "bp_simpleParams": [ 0.181, -0.124, 0.043, -14.137, -11.006, 3.209 ], "bp_params": [ 0.179, -0.127, 0.043, -14.360, -10.714, 3.198 ], "frame": { "rmsd": null, "origin": [ 92.252, 131.583, 129.156 ], "x_axis": [ -0.101, -0.601, -0.793 ], "y_axis": [ -0.772, -0.455, 0.444 ], "z_axis": [ -0.627, 0.657, -0.418 ], "quaternion": [ -0.080, 0.666, -0.516, -0.533 ] } }, { "index": 22, "nt1": "///C/23", "nt2": "///D/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.040, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.735, "chi2": -95.105, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 64.483, "C1C1_dist": 11.258, "N1N9_dist": 9.677, "C6C8_dist": 10.718, "CNNC_torsion": -10.010, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.74]", "interBase_angle": 22.670, "planarity": 0.251, "simple_Shear": -1.562, "simple_Stretch": 0.901, "simple_Buckle": -17.368, "simple_Propeller": -14.570, "bp_simpleParams": [ -1.562, 0.901, -0.682, -17.368, -14.570, 8.560 ], "bp_params": [ -1.674, 0.669, -0.682, -15.136, -16.876, 8.580 ], "frame": { "rmsd": null, "origin": [ 90.098, 134.018, 128.380 ], "x_axis": [ -0.350, -0.866, -0.357 ], "y_axis": [ -0.555, -0.115, 0.824 ], "z_axis": [ -0.754, 0.487, -0.441 ], "quaternion": [ -0.154, -0.549, 0.647, 0.506 ] } }, { "index": 23, "nt1": "///C/24", "nt2": "///D/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.873, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.075, "chi2": -163.399, "conf2": "anti", "pucker2": "----", "lambda2": 58.848, "C1C1_dist": 9.988, "N1N9_dist": 8.541, "C6C8_dist": 9.780, "CNNC_torsion": -16.165, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.60]", "interBase_angle": 24.257, "planarity": 0.338, "simple_Shear": 0.493, "simple_Stretch": 0.011, "simple_Buckle": 17.029, "simple_Propeller": -17.275, "bp_simpleParams": [ 0.493, 0.011, 0.133, 17.029, -17.275, 14.014 ], "bp_params": [ 0.493, -0.005, 0.133, 16.452, -17.826, 14.042 ], "frame": { "rmsd": null, "origin": [ 87.110, 135.484, 129.834 ], "x_axis": [ -0.571, -0.741, 0.354 ], "y_axis": [ -0.016, 0.441, 0.898 ], "z_axis": [ -0.821, 0.507, -0.263 ], "quaternion": [ -0.389, -0.251, 0.754, 0.466 ] } }, { "index": 24, "nt1": "///C/25", "nt2": "///D/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -74.495, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 54.979, "chi2": -92.823, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.713, "C1C1_dist": 10.365, "N1N9_dist": 8.739, "C6C8_dist": 9.766, "CNNC_torsion": -9.936, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 19.200, "planarity": 0.299, "simple_Shear": -0.251, "simple_Stretch": -0.175, "simple_Buckle": 12.901, "simple_Propeller": -14.220, "bp_simpleParams": [ -0.251, -0.175, -0.124, 12.901, -14.220, 5.195 ], "bp_params": [ -0.246, -0.182, -0.124, 13.279, -13.868, 5.198 ], "frame": { "rmsd": null, "origin": [ 85.233, 138.413, 128.783 ], "x_axis": [ -0.423, -0.422, 0.802 ], "y_axis": [ 0.243, 0.800, 0.549 ], "z_axis": [ -0.873, 0.427, -0.235 ], "quaternion": [ 0.534, 0.057, -0.784, -0.311 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGTCTTCACACCGGTGGATGCGTG", "strand2": "CCAGAAGTGTGGCCACCTACGCAC", "bp_type": "|||||||||||||||||||.||||", "helix_form": ".B.BBBBBB.BBB.BBBBBB...", "helical_rise": 3.487, "helical_rise_std": 0.496, "helical_radius": 9.465, "helical_radius_std": 2.485, "helical_axis": [ -0.617, 0.704, -0.352 ], "point1": [ 134.816, 84.236, 158.134 ], "point2": [ 85.191, 140.909, 129.814 ], "num_pairs": 24, "pairs": [ { "index": 1, "nt1": "///C/2", "nt2": "///D/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.289, -1.175, -9.837, -4.313, 1.634 ], "step_params": [ -0.721, 2.347, 3.258, -1.968, -0.415, 38.188 ], "heli_params": [ 3.635, 0.854, 3.265, -0.633, 3.006, 38.239 ], "bp2_params": [ -0.120, -0.361, -1.346, -10.809, 0.325, -1.780 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.258, "simple_Twist": 37.870, "simple_hRise": 3.265, "simple_hTwist": 37.922 }, { "index": 2, "nt1": "///C/3", "nt2": "///D/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.361, -1.346, -10.809, 0.325, -1.780 ], "step_params": [ -0.617, 1.021, 3.091, -5.221, 5.105, 25.094 ], "heli_params": [ 0.876, -0.051, 3.289, 11.444, 11.704, 26.118 ], "bp2_params": [ -0.127, -0.155, -0.812, -0.771, -1.324, -2.965 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 25.198, "simple_hRise": 3.289, "simple_hTwist": 26.218 }, { "index": 3, "nt1": "///C/4", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.127, -0.155, -0.812, -0.771, -1.324, -2.965 ], "step_params": [ 0.553, -0.555, 3.103, -1.109, 4.489, 38.916 ], "heli_params": [ -1.331, -0.950, 3.007, 6.709, 1.657, 39.179 ], "bp2_params": [ 0.193, -0.164, -0.543, 2.724, -3.157, 0.135 ], "groove_widths": [ 12.621, null, 17.270, null ], "simple_Rise": 3.103, "simple_Twist": 37.124, "simple_hRise": 3.001, "simple_hTwist": 37.401 }, { "index": 4, "nt1": "///C/5", "nt2": "///D/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.164, -0.543, 2.724, -3.157, 0.135 ], "step_params": [ 0.465, 0.294, 3.314, 1.812, 0.345, 37.386 ], "heli_params": [ 0.412, -0.483, 3.334, 0.537, -2.824, 37.430 ], "bp2_params": [ -0.109, -0.083, -0.064, 0.183, -8.249, -1.472 ], "groove_widths": [ 11.007, 10.956, 18.714, 18.707 ], "simple_Rise": 3.314, "simple_Twist": 39.106, "simple_hRise": 3.333, "simple_hTwist": 39.148 }, { "index": 5, "nt1": "///C/6", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.083, -0.064, 0.183, -8.249, -1.472 ], "step_params": [ -0.059, -0.386, 3.294, -0.029, 0.940, 36.293 ], "heli_params": [ -0.752, 0.091, 3.283, 1.508, 0.046, 36.304 ], "bp2_params": [ -0.161, -0.102, 0.171, -0.924, -7.863, -0.817 ], "groove_widths": [ 11.298, 11.295, 16.987, 16.949 ], "simple_Rise": 3.294, "simple_Twist": 36.544, "simple_hRise": 3.283, "simple_hTwist": 36.556 }, { "index": 6, "nt1": "///C/7", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.161, -0.102, 0.171, -0.924, -7.863, -0.817 ], "step_params": [ 0.085, 0.486, 3.373, -1.646, 0.549, 38.774 ], "heli_params": [ 0.663, -0.335, 3.373, 0.826, 2.478, 38.811 ], "bp2_params": [ 0.179, -0.161, 0.356, -1.734, -5.947, -0.943 ], "groove_widths": [ 12.282, 12.275, 16.374, 16.307 ], "simple_Rise": 3.373, "simple_Twist": 36.764, "simple_hRise": 3.373, "simple_hTwist": 36.804 }, { "index": 7, "nt1": "///C/8", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.161, 0.356, -1.734, -5.947, -0.943 ], "step_params": [ 0.269, 0.990, 3.610, -1.285, 0.346, 38.489 ], "heli_params": [ 1.453, -0.583, 3.608, 0.524, 1.949, 38.511 ], "bp2_params": [ -0.003, 0.379, 0.600, -5.635, -5.783, 5.858 ], "groove_widths": [ 12.881, 12.830, 16.323, 16.284 ], "simple_Rise": 3.610, "simple_Twist": 39.433, "simple_hRise": 3.608, "simple_hTwist": 39.454 }, { "index": 8, "nt1": "///C/9", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.003, 0.379, 0.600, -5.635, -5.783, 5.858 ], "step_params": [ -0.979, 0.053, 3.461, -1.240, 2.760, 35.382 ], "heli_params": [ -0.342, 1.412, 3.486, 4.532, 2.035, 35.507 ], "bp2_params": [ 0.196, -0.157, 0.015, -5.394, 1.426, -0.491 ], "groove_widths": [ 14.281, 14.051, 16.954, 16.953 ], "simple_Rise": 3.461, "simple_Twist": 34.383, "simple_hRise": 3.487, "simple_hTwist": 34.512 }, { "index": 9, "nt1": "///C/10", "nt2": "///D/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.157, 0.015, -5.394, 1.426, -0.491 ], "step_params": [ 0.760, 0.890, 3.697, -1.432, 7.982, 33.792 ], "heli_params": [ 0.077, -1.527, 3.769, 13.491, 2.421, 34.724 ], "bp2_params": [ 0.071, -0.133, 0.166, -2.485, -0.791, 0.623 ], "groove_widths": [ 15.836, 15.480, 17.220, 17.102 ], "simple_Rise": 3.697, "simple_Twist": 34.482, "simple_hRise": 3.770, "simple_hTwist": 35.394 }, { "index": 10, "nt1": "///C/11", "nt2": "///D/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.071, -0.133, 0.166, -2.485, -0.791, 0.623 ], "step_params": [ -0.656, -1.492, 3.533, -1.404, 3.512, 31.838 ], "heli_params": [ -3.372, 0.921, 3.378, 6.373, 2.548, 32.056 ], "bp2_params": [ 0.211, -0.171, -0.246, -3.775, -1.070, 1.255 ], "groove_widths": [ 15.680, 15.361, 18.019, 17.708 ], "simple_Rise": 3.533, "simple_Twist": 31.007, "simple_hRise": 3.373, "simple_hTwist": 31.231 }, { "index": 11, "nt1": "///C/12", "nt2": "///D/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.171, -0.246, -3.775, -1.070, 1.255 ], "step_params": [ 0.564, 0.590, 3.789, 2.816, 4.405, 28.258 ], "heli_params": [ 0.020, -0.389, 3.871, 8.927, -5.706, 28.728 ], "bp2_params": [ 0.178, -0.163, -0.195, 1.122, 2.113, -0.579 ], "groove_widths": [ 15.063, 14.841, 18.887, 18.854 ], "simple_Rise": 3.789, "simple_Twist": 28.446, "simple_hRise": 3.871, "simple_hTwist": 28.912 }, { "index": 12, "nt1": "///C/13", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.163, -0.195, 1.122, 2.113, -0.579 ], "step_params": [ 0.051, 1.154, 4.330, 0.018, -1.958, 35.358 ], "heli_params": [ 2.275, -0.081, 4.262, -3.220, -0.030, 35.411 ], "bp2_params": [ -0.181, -0.159, -0.234, -2.978, 2.813, -0.487 ], "groove_widths": [ 15.084, 14.933, 18.423, 18.200 ], "simple_Rise": 4.330, "simple_Twist": 37.518, "simple_hRise": 4.267, "simple_hTwist": 37.567 }, { "index": 13, "nt1": "///C/14", "nt2": "///D/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.181, -0.159, -0.234, -2.978, 2.813, -0.487 ], "step_params": [ -0.619, 0.490, 3.700, -5.126, 5.552, 28.122 ], "heli_params": [ -0.440, -0.074, 3.777, 11.173, 10.315, 29.100 ], "bp2_params": [ -0.208, -0.171, -0.035, 2.074, 1.645, 0.833 ], "groove_widths": [ 15.089, 14.867, 18.797, 18.756 ], "simple_Rise": 3.700, "simple_Twist": 28.255, "simple_hRise": 3.777, "simple_hTwist": 29.229 }, { "index": 14, "nt1": "///C/15", "nt2": "///D/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.171, -0.035, 2.074, 1.645, 0.833 ], "step_params": [ 0.597, -1.518, 3.539, 0.818, 3.665, 33.326 ], "heli_params": [ -3.269, -0.892, 3.371, 6.366, -1.420, 33.531 ], "bp2_params": [ -0.058, -0.172, 0.382, -0.212, 3.843, 1.378 ], "groove_widths": [ 15.631, 15.324, 17.934, 17.662 ], "simple_Rise": 3.539, "simple_Twist": 32.436, "simple_hRise": 3.365, "simple_hTwist": 32.647 }, { "index": 15, "nt1": "///C/16", "nt2": "///D/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.172, 0.382, -0.212, 3.843, 1.378 ], "step_params": [ -0.938, 0.727, 3.761, -1.341, 4.546, 34.158 ], "heli_params": [ 0.401, 1.338, 3.855, 7.693, 2.269, 34.476 ], "bp2_params": [ -0.178, -0.209, 0.547, 3.460, 1.126, -0.578 ], "groove_widths": [ 15.722, 15.393, 17.350, 17.228 ], "simple_Rise": 3.761, "simple_Twist": 34.836, "simple_hRise": 3.854, "simple_hTwist": 35.147 }, { "index": 16, "nt1": "///C/17", "nt2": "///D/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.209, 0.547, 3.460, 1.126, -0.578 ], "step_params": [ 0.465, -0.193, 3.485, 1.145, 2.078, 35.106 ], "heli_params": [ -0.650, -0.587, 3.481, 3.441, -1.896, 35.184 ], "bp2_params": [ -0.151, -0.260, 0.867, 2.395, -4.965, -2.039 ], "groove_widths": [ 14.111, 13.895, 17.087, 17.081 ], "simple_Rise": 3.485, "simple_Twist": 35.003, "simple_hRise": 3.481, "simple_hTwist": 35.081 }, { "index": 17, "nt1": "///C/18", "nt2": "///D/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.260, 0.867, 2.395, -4.965, -2.039 ], "step_params": [ -0.323, 0.714, 3.490, 1.494, -0.338, 42.938 ], "heli_params": [ 1.011, 0.599, 3.472, -0.462, -2.041, 42.964 ], "bp2_params": [ 0.673, 0.797, 0.550, 0.643, -12.142, 0.232 ], "groove_widths": [ 12.799, 12.749, 16.702, 16.694 ], "simple_Rise": 3.490, "simple_Twist": 38.617, "simple_hRise": 3.470, "simple_hTwist": 38.646 }, { "index": 18, "nt1": "///C/19", "nt2": "///D/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.673, 0.797, 0.550, 0.643, -12.142, 0.232 ], "step_params": [ 0.294, -0.221, 3.422, 2.308, 0.822, 29.292 ], "heli_params": [ -0.621, -0.060, 3.427, 1.622, -4.555, 29.392 ], "bp2_params": [ -0.056, -0.105, -0.157, 1.183, -9.169, 1.362 ], "groove_widths": [ 12.363, 12.350, 16.398, 16.345 ], "simple_Rise": 3.422, "simple_Twist": 33.129, "simple_hRise": 3.428, "simple_hTwist": 33.217 }, { "index": 19, "nt1": "///C/20", "nt2": "///D/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.056, -0.105, -0.157, 1.183, -9.169, 1.362 ], "step_params": [ -0.077, 0.673, 3.343, -0.067, 6.027, 33.673 ], "heli_params": [ 0.154, 0.120, 3.409, 10.301, 0.115, 34.193 ], "bp2_params": [ -1.505, 1.041, -0.304, -10.571, -26.131, 5.367 ], "groove_widths": [ 11.317, 11.300, 17.560, 17.515 ], "simple_Rise": 3.343, "simple_Twist": 40.174, "simple_hRise": 3.405, "simple_hTwist": 40.605 }, { "index": 20, "nt1": "///C/21", "nt2": "///D/6", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.505, 1.041, -0.304, -10.571, -26.131, 5.367 ], "step_params": [ -0.413, 0.832, 3.136, -5.267, -0.990, 43.673 ], "heli_params": [ 1.201, 0.073, 3.144, -1.325, 7.049, 43.985 ], "bp2_params": [ 0.179, -0.127, 0.043, -14.360, -10.714, 3.198 ], "groove_widths": [ 10.701, 10.698, 18.256, 18.207 ], "simple_Rise": 3.136, "simple_Twist": 35.335, "simple_hRise": 3.139, "simple_hTwist": 35.726 }, { "index": 21, "nt1": "///C/22", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.127, 0.043, -14.360, -10.714, 3.198 ], "step_params": [ -0.835, 0.172, 3.232, -7.124, 9.972, 31.533 ], "heli_params": [ -1.361, 0.252, 3.244, 17.543, 12.533, 33.774 ], "bp2_params": [ -1.674, 0.669, -0.682, -15.136, -16.876, 8.580 ], "groove_widths": [ 11.744, null, 16.326, null ], "simple_Rise": 3.232, "simple_Twist": 41.097, "simple_hRise": 3.280, "simple_hTwist": 42.810 }, { "index": 22, "nt1": "///C/23", "nt2": "///D/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.674, 0.669, -0.682, -15.136, -16.876, 8.580 ], "step_params": [ 0.313, 2.535, 2.582, -10.906, 0.891, 44.522 ], "heli_params": [ 3.198, -1.149, 2.491, 1.156, 14.141, 45.780 ], "bp2_params": [ 0.493, -0.005, 0.133, 16.452, -17.826, 14.042 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.582, "simple_Twist": 34.279, "simple_hRise": 2.436, "simple_hTwist": 35.933 }, { "index": 23, "nt1": "///C/24", "nt2": "///D/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.493, -0.005, 0.133, 16.452, -17.826, 14.042 ], "step_params": [ -1.455, 0.836, 3.223, 2.102, 5.256, 32.708 ], "heli_params": [ 0.589, 2.898, 3.218, 9.247, -3.697, 33.181 ], "bp2_params": [ -0.246, -0.182, -0.124, 13.279, -13.868, 5.198 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.223, "simple_Twist": 36.653, "simple_hRise": 3.223, "simple_hTwist": 37.072 }, { "index": 24, "nt1": "///C/25", "nt2": "///D/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGTCTTCACACCGGTGGAT", "strand2": "CCAGAAGTGTGGCCACCTA", "bp_type": "|||||||||||||||||||", "helix_form": ".B.BBBBBB.BBB.BBBB", "helical_rise": 3.523, "helical_rise_std": 0.422, "helical_radius": 9.457, "helical_radius_std": 2.076, "helical_axis": [ -0.591, 0.711, -0.381 ], "point1": [ 133.824, 84.395, 160.228 ], "point2": [ 96.325, 129.494, 136.029 ], "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///C/2", "nt2": "///D/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.289, -1.175, -9.837, -4.313, 1.634 ], "step_params": [ -0.721, 2.347, 3.258, -1.968, -0.415, 38.188 ], "heli_params": [ 3.635, 0.854, 3.265, -0.633, 3.006, 38.239 ], "bp2_params": [ -0.120, -0.361, -1.346, -10.809, 0.325, -1.780 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.258, "simple_Twist": 37.870, "simple_hRise": 3.265, "simple_hTwist": 37.922 }, { "index": 2, "nt1": "///C/3", "nt2": "///D/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.361, -1.346, -10.809, 0.325, -1.780 ], "step_params": [ -0.617, 1.021, 3.091, -5.221, 5.105, 25.094 ], "heli_params": [ 0.876, -0.051, 3.289, 11.444, 11.704, 26.118 ], "bp2_params": [ -0.127, -0.155, -0.812, -0.771, -1.324, -2.965 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 25.198, "simple_hRise": 3.289, "simple_hTwist": 26.218 }, { "index": 3, "nt1": "///C/4", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.127, -0.155, -0.812, -0.771, -1.324, -2.965 ], "step_params": [ 0.553, -0.555, 3.103, -1.109, 4.489, 38.916 ], "heli_params": [ -1.331, -0.950, 3.007, 6.709, 1.657, 39.179 ], "bp2_params": [ 0.193, -0.164, -0.543, 2.724, -3.157, 0.135 ], "groove_widths": [ 12.621, null, 17.270, null ], "simple_Rise": 3.103, "simple_Twist": 37.124, "simple_hRise": 3.001, "simple_hTwist": 37.401 }, { "index": 4, "nt1": "///C/5", "nt2": "///D/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.164, -0.543, 2.724, -3.157, 0.135 ], "step_params": [ 0.465, 0.294, 3.314, 1.812, 0.345, 37.386 ], "heli_params": [ 0.412, -0.483, 3.334, 0.537, -2.824, 37.430 ], "bp2_params": [ -0.109, -0.083, -0.064, 0.183, -8.249, -1.472 ], "groove_widths": [ 11.007, 10.956, 18.714, 18.707 ], "simple_Rise": 3.314, "simple_Twist": 39.106, "simple_hRise": 3.333, "simple_hTwist": 39.148 }, { "index": 5, "nt1": "///C/6", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.083, -0.064, 0.183, -8.249, -1.472 ], "step_params": [ -0.059, -0.386, 3.294, -0.029, 0.940, 36.293 ], "heli_params": [ -0.752, 0.091, 3.283, 1.508, 0.046, 36.304 ], "bp2_params": [ -0.161, -0.102, 0.171, -0.924, -7.863, -0.817 ], "groove_widths": [ 11.298, 11.295, 16.987, 16.949 ], "simple_Rise": 3.294, "simple_Twist": 36.544, "simple_hRise": 3.283, "simple_hTwist": 36.556 }, { "index": 6, "nt1": "///C/7", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.161, -0.102, 0.171, -0.924, -7.863, -0.817 ], "step_params": [ 0.085, 0.486, 3.373, -1.646, 0.549, 38.774 ], "heli_params": [ 0.663, -0.335, 3.373, 0.826, 2.478, 38.811 ], "bp2_params": [ 0.179, -0.161, 0.356, -1.734, -5.947, -0.943 ], "groove_widths": [ 12.282, 12.275, 16.374, 16.307 ], "simple_Rise": 3.373, "simple_Twist": 36.764, "simple_hRise": 3.373, "simple_hTwist": 36.804 }, { "index": 7, "nt1": "///C/8", "nt2": "///D/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.161, 0.356, -1.734, -5.947, -0.943 ], "step_params": [ 0.269, 0.990, 3.610, -1.285, 0.346, 38.489 ], "heli_params": [ 1.453, -0.583, 3.608, 0.524, 1.949, 38.511 ], "bp2_params": [ -0.003, 0.379, 0.600, -5.635, -5.783, 5.858 ], "groove_widths": [ 12.881, 12.830, 16.323, 16.284 ], "simple_Rise": 3.610, "simple_Twist": 39.433, "simple_hRise": 3.608, "simple_hTwist": 39.454 }, { "index": 8, "nt1": "///C/9", "nt2": "///D/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.003, 0.379, 0.600, -5.635, -5.783, 5.858 ], "step_params": [ -0.979, 0.053, 3.461, -1.240, 2.760, 35.382 ], "heli_params": [ -0.342, 1.412, 3.486, 4.532, 2.035, 35.507 ], "bp2_params": [ 0.196, -0.157, 0.015, -5.394, 1.426, -0.491 ], "groove_widths": [ 14.281, 14.051, 16.954, 16.953 ], "simple_Rise": 3.461, "simple_Twist": 34.383, "simple_hRise": 3.487, "simple_hTwist": 34.512 }, { "index": 9, "nt1": "///C/10", "nt2": "///D/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.157, 0.015, -5.394, 1.426, -0.491 ], "step_params": [ 0.760, 0.890, 3.697, -1.432, 7.982, 33.792 ], "heli_params": [ 0.077, -1.527, 3.769, 13.491, 2.421, 34.724 ], "bp2_params": [ 0.071, -0.133, 0.166, -2.485, -0.791, 0.623 ], "groove_widths": [ 15.836, 15.480, 17.220, 17.102 ], "simple_Rise": 3.697, "simple_Twist": 34.482, "simple_hRise": 3.770, "simple_hTwist": 35.394 }, { "index": 10, "nt1": "///C/11", "nt2": "///D/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.071, -0.133, 0.166, -2.485, -0.791, 0.623 ], "step_params": [ -0.656, -1.492, 3.533, -1.404, 3.512, 31.838 ], "heli_params": [ -3.372, 0.921, 3.378, 6.373, 2.548, 32.056 ], "bp2_params": [ 0.211, -0.171, -0.246, -3.775, -1.070, 1.255 ], "groove_widths": [ 15.680, 15.361, 18.019, 17.708 ], "simple_Rise": 3.533, "simple_Twist": 31.007, "simple_hRise": 3.373, "simple_hTwist": 31.231 }, { "index": 11, "nt1": "///C/12", "nt2": "///D/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.171, -0.246, -3.775, -1.070, 1.255 ], "step_params": [ 0.564, 0.590, 3.789, 2.816, 4.405, 28.258 ], "heli_params": [ 0.020, -0.389, 3.871, 8.927, -5.706, 28.728 ], "bp2_params": [ 0.178, -0.163, -0.195, 1.122, 2.113, -0.579 ], "groove_widths": [ 15.063, 14.841, 18.887, 18.854 ], "simple_Rise": 3.789, "simple_Twist": 28.446, "simple_hRise": 3.871, "simple_hTwist": 28.912 }, { "index": 12, "nt1": "///C/13", "nt2": "///D/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.163, -0.195, 1.122, 2.113, -0.579 ], "step_params": [ 0.051, 1.154, 4.330, 0.018, -1.958, 35.358 ], "heli_params": [ 2.275, -0.081, 4.262, -3.220, -0.030, 35.411 ], "bp2_params": [ -0.181, -0.159, -0.234, -2.978, 2.813, -0.487 ], "groove_widths": [ 15.084, 14.933, 18.423, 18.200 ], "simple_Rise": 4.330, "simple_Twist": 37.518, "simple_hRise": 4.267, "simple_hTwist": 37.567 }, { "index": 13, "nt1": "///C/14", "nt2": "///D/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.181, -0.159, -0.234, -2.978, 2.813, -0.487 ], "step_params": [ -0.619, 0.490, 3.700, -5.126, 5.552, 28.122 ], "heli_params": [ -0.440, -0.074, 3.777, 11.173, 10.315, 29.100 ], "bp2_params": [ -0.208, -0.171, -0.035, 2.074, 1.645, 0.833 ], "groove_widths": [ 15.089, 14.867, 18.797, 18.756 ], "simple_Rise": 3.700, "simple_Twist": 28.255, "simple_hRise": 3.777, "simple_hTwist": 29.229 }, { "index": 14, "nt1": "///C/15", "nt2": "///D/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.171, -0.035, 2.074, 1.645, 0.833 ], "step_params": [ 0.597, -1.518, 3.539, 0.818, 3.665, 33.326 ], "heli_params": [ -3.269, -0.892, 3.371, 6.366, -1.420, 33.531 ], "bp2_params": [ -0.058, -0.172, 0.382, -0.212, 3.843, 1.378 ], "groove_widths": [ 15.631, 15.324, 17.934, 17.662 ], "simple_Rise": 3.539, "simple_Twist": 32.436, "simple_hRise": 3.365, "simple_hTwist": 32.647 }, { "index": 15, "nt1": "///C/16", "nt2": "///D/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.172, 0.382, -0.212, 3.843, 1.378 ], "step_params": [ -0.938, 0.727, 3.761, -1.341, 4.546, 34.158 ], "heli_params": [ 0.401, 1.338, 3.855, 7.693, 2.269, 34.476 ], "bp2_params": [ -0.178, -0.209, 0.547, 3.460, 1.126, -0.578 ], "groove_widths": [ 15.722, 15.393, 17.350, 17.228 ], "simple_Rise": 3.761, "simple_Twist": 34.836, "simple_hRise": 3.854, "simple_hTwist": 35.147 }, { "index": 16, "nt1": "///C/17", "nt2": "///D/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.209, 0.547, 3.460, 1.126, -0.578 ], "step_params": [ 0.465, -0.193, 3.485, 1.145, 2.078, 35.106 ], "heli_params": [ -0.650, -0.587, 3.481, 3.441, -1.896, 35.184 ], "bp2_params": [ -0.151, -0.260, 0.867, 2.395, -4.965, -2.039 ], "groove_widths": [ 14.111, null, 17.087, null ], "simple_Rise": 3.485, "simple_Twist": 35.003, "simple_hRise": 3.481, "simple_hTwist": 35.081 }, { "index": 17, "nt1": "///C/18", "nt2": "///D/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.260, 0.867, 2.395, -4.965, -2.039 ], "step_params": [ -0.323, 0.714, 3.490, 1.494, -0.338, 42.938 ], "heli_params": [ 1.011, 0.599, 3.472, -0.462, -2.041, 42.964 ], "bp2_params": [ 0.673, 0.797, 0.550, 0.643, -12.142, 0.232 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.490, "simple_Twist": 38.617, "simple_hRise": 3.470, "simple_hTwist": 38.646 }, { "index": 18, "nt1": "///C/19", "nt2": "///D/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.673, 0.797, 0.550, 0.643, -12.142, 0.232 ], "step_params": [ 0.294, -0.221, 3.422, 2.308, 0.822, 29.292 ], "heli_params": [ -0.621, -0.060, 3.427, 1.622, -4.555, 29.392 ], "bp2_params": [ -0.056, -0.105, -0.157, 1.183, -9.169, 1.362 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 33.129, "simple_hRise": 3.428, "simple_hTwist": 33.217 }, { "index": 19, "nt1": "///C/20", "nt2": "///D/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CGTG", "strand2": "GCAC", "bp_type": "||||", "helix_form": "...", "helical_rise": 3.491, "helical_rise_std": 0.453, "helical_radius": 8.762, "helical_radius_std": 1.140, "helical_axis": [ -0.743, 0.664, -0.091 ], "point1": [ 92.690, 132.058, 128.737 ], "point2": [ 84.940, 138.983, 127.787 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/22", "nt2": "///D/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.127, 0.043, -14.360, -10.714, 3.198 ], "step_params": [ -0.835, 0.172, 3.232, -7.124, 9.972, 31.533 ], "heli_params": [ -1.361, 0.252, 3.244, 17.543, 12.533, 33.774 ], "bp2_params": [ -1.674, 0.669, -0.682, -15.136, -16.876, 8.580 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.232, "simple_Twist": 41.097, "simple_hRise": 3.280, "simple_hTwist": 42.810 }, { "index": 2, "nt1": "///C/23", "nt2": "///D/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.674, 0.669, -0.682, -15.136, -16.876, 8.580 ], "step_params": [ 0.313, 2.535, 2.582, -10.906, 0.891, 44.522 ], "heli_params": [ 3.198, -1.149, 2.491, 1.156, 14.141, 45.780 ], "bp2_params": [ 0.493, -0.005, 0.133, 16.452, -17.826, 14.042 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.582, "simple_Twist": 34.279, "simple_hRise": 2.436, "simple_hTwist": 35.933 }, { "index": 3, "nt1": "///C/24", "nt2": "///D/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.493, -0.005, 0.133, 16.452, -17.826, 14.042 ], "step_params": [ -1.455, 0.836, 3.223, 2.102, 5.256, 32.708 ], "heli_params": [ 0.589, 2.898, 3.218, 9.247, -3.697, 33.181 ], "bp2_params": [ -0.246, -0.182, -0.124, 13.279, -13.868, 5.198 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.223, "simple_Twist": 36.653, "simple_hRise": 3.223, "simple_hTwist": 37.072 }, { "index": 4, "nt1": "///C/25", "nt2": "///D/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///C/25,///C/26" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///D/25,///D/26" }, { "index": 3, "num_nts": 3, "nts_short": "TGC", "nts_long": "///C/20,///C/21,///C/22" }, { "index": 4, "num_nts": 3, "nts_short": "GCA", "nts_long": "///D/5,///D/6,///D/7" } ], "nonStack": { "num_nts": 1, "nts_short": "C", "nts_long": "///D/1" }, "num_iloops": 1, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [C.20 D.7 C.22 D.5] 19 4", "num_nts": 6, "nts_short": "TGCGCA", "nts_long": "///C/20,///C/21,///C/22,///D/5,///D/6,///D/7", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///C/21" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///D/6" } ] } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///C/26" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///D/1" }, { "index": 3, "num_nts": 1, "nts_short": "C", "nts_long": "///D/26" } ], "dbn": { "all_chains": { "num_nts": 51, "num_chars": 52, "bseq": "GGTCTTCACACCGGTGGATGCGTGG&CCACGCATCCACCGGTGTGAAGACCC", "sstr": "(((((((((((((((((((.((((.&.)))).))))))))))))))))))).", "form": ".BBBBBBBB.B.B.BB.BBBB..B-&.B.BBBBBBB.B.B.BBBBBBBB..-" }, "chain_C": { "num_nts": 25, "num_chars": 25, "bseq": "GGTCTTCACACCGGTGGATGCGTGG", "sstr": "(((((((((((((((((((.((((.", "form": ".BBBBBBBB.B.B.BB.BBBB..B-" }, "chain_D": { "num_nts": 26, "num_chars": 26, "bseq": "CCACGCATCCACCGGTGTGAAGACCC", "sstr": ".)))).))))))))))))))))))).", "form": ".B.BBBBBBB.B.B.BBBBBBBB..-" } }, "chains": { "chain_C": { "num_nts": 25, "bseq": "GGTCTTCACACCGGTGGATGCGTGG", "sstr": "(((((((((((((((((((.((((.", "form": ".BBBBBBBB.B.B.BB.BBBB..B-", "helical_rise": 3.486, "helical_rise_std": 0.466, "helical_axis": [ -0.630, 0.698, -0.341 ], "point1": [ 134.770, 84.935, 156.821 ], "point2": [ 82.038, 143.354, 128.286 ], "num_chars": 73, "suite": "G!!G!!T!!C!!T!!T!!C!!A!!C!!A!!C1bC4bG!!G!!T!!G!!G!!A!!T4bG!!C!!G!!T!!G!!G" }, "chain_D": { "num_nts": 26, "bseq": "CCACGCATCCACCGGTGTGAAGACCC", "sstr": ".)))).))))))))))))))))))).", "form": ".B.BBBBBBB.B.B.BBBBBBBB..-", "helical_rise": 3.510, "helical_rise_std": 0.562, "helical_axis": [ 0.590, -0.703, 0.397 ], "point1": [ 84.698, 143.226, 126.973 ], "point2": [ 136.134, 81.943, 161.593 ], "num_chars": 76, "suite": "C!!C4nA!!C!!G!!C!!A!!T!!C!!C!!A!!C1bC4bG!!G!!T!!G!!T!!G!!A!!A!!G!!A!!C4bC!!C" } }, "num_nts": 51, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/2", "linked_nts": [ null, "///C/3" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 115.099, "gamma": 1.221, "delta": 154.909, "epsilon": -43.970, "zeta": 84.279, "epsilon_zeta": 231.752, "bb_type": "--", "chi": -44.218, "glyco_bond": "--", "C5prime_xyz": [ -3.367, 5.826, -3.178 ], "P_xyz": [ -0.986, 6.731, -3.816 ], "form": ".", "ssZp": -0.299, "Dp": 0.518, "splay_angle": 23.868, "splay_distance": 3.930, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": null, "theta": -175.797, "eta_prime": null, "theta_prime": 167.119, "eta_base": null, "theta_base": -133.504, "v0": -10.442, "v1": 30.880, "v2": -38.216, "v3": 33.275, "v4": -14.578, "amplitude": 38.275, "phase_angle": 183.178, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 133.722, 84.063, 160.130 ], "x_axis": [ -0.443, -0.642, -0.626 ], "y_axis": [ -0.774, -0.078, 0.628 ], "z_axis": [ -0.452, 0.763, -0.462 ], "quaternion": [ 0.065, -0.524, 0.676, 0.515 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 168.522, "beta": -124.990, "gamma": 86.781, "delta": 148.451, "epsilon": -60.362, "zeta": -153.064, "epsilon_zeta": 92.702, "bb_type": "--", "chi": -70.714, "glyco_bond": "--", "C5prime_xyz": [ -3.083, 7.122, -2.921 ], "P_xyz": [ -0.557, 7.712, -3.340 ], "form": "B", "ssZp": 0.074, "Dp": 0.117, "splay_angle": 21.212, "splay_distance": 3.586, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -170.349, "theta": -129.531, "eta_prime": -157.580, "theta_prime": -170.787, "eta_base": -117.837, "theta_base": -131.164, "v0": -23.282, "v1": 39.283, "v2": -39.432, "v3": 26.946, "v4": -2.516, "amplitude": 40.873, "phase_angle": 164.743, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 131.399, 87.222, 160.389 ], "x_axis": [ -0.824, -0.550, -0.139 ], "y_axis": [ -0.343, 0.288, 0.894 ], "z_axis": [ -0.452, 0.784, -0.426 ], "quaternion": [ -0.098, -0.280, 0.797, 0.527 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -25.043, "beta": -76.260, "gamma": -142.544, "delta": 145.366, "epsilon": -161.472, "zeta": -125.535, "epsilon_zeta": -35.936, "bb_type": "BI", "chi": -125.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.912, 8.676, -0.908 ], "P_xyz": [ -1.588, 8.653, -3.502 ], "form": "B", "ssZp": 1.899, "Dp": 2.015, "splay_angle": 19.330, "splay_distance": 3.365, "splay_ratio": 0.172, "d22": 4.126, "d64": 3.643, "eta": -137.529, "theta": 127.819, "eta_prime": -173.296, "theta_prime": 174.533, "eta_base": -142.891, "theta_base": -128.453, "v0": -23.440, "v1": 38.203, "v2": -37.795, "v3": 25.175, "v4": -1.369, "amplitude": 39.478, "phase_angle": 163.210, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 130.200, 90.528, 159.689 ], "x_axis": [ -0.867, -0.420, 0.270 ], "y_axis": [ 0.029, 0.497, 0.868 ], "z_axis": [ -0.498, 0.760, -0.418 ], "quaternion": [ -0.230, -0.117, 0.834, 0.488 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 19.097, "beta": 153.968, "gamma": -27.732, "delta": 151.501, "epsilon": -171.379, "zeta": -123.450, "epsilon_zeta": -47.929, "bb_type": "BI", "chi": -96.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.940, 7.995, -2.141 ], "P_xyz": [ -0.305, 9.997, -1.762 ], "form": "B", "ssZp": 1.902, "Dp": 1.964, "splay_angle": 21.546, "splay_distance": 3.586, "splay_ratio": 0.187, "d22": 4.481, "d64": 3.808, "eta": 160.074, "theta": -159.341, "eta_prime": -172.119, "theta_prime": -162.084, "eta_base": -116.412, "theta_base": -114.946, "v0": -15.174, "v1": 33.619, "v2": -38.218, "v3": 30.312, "v4": -9.763, "amplitude": 38.323, "phase_angle": 175.762, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 127.712, 92.426, 158.452 ], "x_axis": [ -0.610, -0.041, 0.791 ], "y_axis": [ 0.561, 0.683, 0.468 ], "z_axis": [ -0.559, 0.729, -0.394 ], "quaternion": [ -0.412, 0.159, 0.820, 0.365 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.358, "beta": 160.250, "gamma": 53.572, "delta": 138.918, "epsilon": -172.874, "zeta": -129.633, "epsilon_zeta": -43.241, "bb_type": "BI", "chi": -109.866, "glyco_bond": "anti", "C5prime_xyz": [ -2.359, 8.386, -1.794 ], "P_xyz": [ 0.099, 9.244, -1.934 ], "form": "B", "ssZp": 2.203, "Dp": 2.227, "splay_angle": 20.512, "splay_distance": 3.441, "splay_ratio": 0.179, "d22": 4.500, "d64": 3.948, "eta": 168.573, "theta": -142.771, "eta_prime": -162.247, "theta_prime": -162.204, "eta_base": -112.713, "theta_base": -122.724, "v0": -27.783, "v1": 39.038, "v2": -34.829, "v3": 19.657, "v4": 4.809, "amplitude": 38.707, "phase_angle": 154.133, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 125.788, 95.318, 157.565 ], "x_axis": [ -0.180, 0.402, 0.898 ], "y_axis": [ 0.796, 0.596, -0.107 ], "z_axis": [ -0.578, 0.695, -0.427 ], "quaternion": [ -0.497, 0.403, 0.742, 0.198 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 5.844, "beta": 171.471, "gamma": -7.515, "delta": 155.532, "epsilon": -168.272, "zeta": -122.175, "epsilon_zeta": -46.097, "bb_type": "BI", "chi": -98.466, "glyco_bond": "anti", "C5prime_xyz": [ -1.766, 7.938, -2.009 ], "P_xyz": [ 0.133, 9.666, -1.560 ], "form": "B", "ssZp": 1.722, "Dp": 1.790, "splay_angle": 21.113, "splay_distance": 3.510, "splay_ratio": 0.184, "d22": 4.421, "d64": 3.628, "eta": 178.867, "theta": -150.591, "eta_prime": -161.939, "theta_prime": -157.025, "eta_base": -118.364, "theta_base": -108.281, "v0": -10.700, "v1": 31.490, "v2": -39.119, "v3": 33.915, "v4": -14.843, "amplitude": 39.177, "phase_angle": 183.123, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 123.429, 97.579, 156.483 ], "x_axis": [ 0.333, 0.673, 0.660 ], "y_axis": [ 0.724, 0.266, -0.637 ], "z_axis": [ -0.604, 0.690, -0.399 ], "quaternion": [ 0.548, -0.606, -0.577, -0.023 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.785, "beta": 163.816, "gamma": 45.896, "delta": 141.816, "epsilon": -154.821, "zeta": -137.574, "epsilon_zeta": -17.247, "bb_type": "--", "chi": -107.154, "glyco_bond": "anti", "C5prime_xyz": [ -2.180, 8.366, -1.861 ], "P_xyz": [ 0.279, 9.250, -1.814 ], "form": "B", "ssZp": 1.996, "Dp": 2.037, "splay_angle": 23.592, "splay_distance": 3.947, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 170.552, "theta": -153.949, "eta_prime": -164.496, "theta_prime": -163.558, "eta_base": -112.963, "theta_base": -112.320, "v0": -25.312, "v1": 38.043, "v2": -35.635, "v3": 21.956, "v4": 1.829, "amplitude": 38.303, "phase_angle": 158.488, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 121.872, 100.343, 154.982 ], "x_axis": [ 0.722, 0.681, 0.122 ], "y_axis": [ 0.350, -0.207, -0.914 ], "z_axis": [ -0.597, 0.702, -0.388 ], "quaternion": [ 0.531, -0.761, -0.338, 0.156 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.980, "beta": 151.651, "gamma": 57.372, "delta": 143.899, "epsilon": -164.862, "zeta": -121.373, "epsilon_zeta": -43.489, "bb_type": "BI", "chi": -112.404, "glyco_bond": "anti", "C5prime_xyz": [ -1.892, 8.360, -1.568 ], "P_xyz": [ 0.715, 8.568, -1.544 ], "form": "B", "ssZp": 1.988, "Dp": 2.029, "splay_angle": 19.777, "splay_distance": 3.295, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 166.262, "theta": -135.525, "eta_prime": -161.492, "theta_prime": -160.167, "eta_base": -108.070, "theta_base": -131.875, "v0": -19.088, "v1": 33.527, "v2": -34.461, "v3": 24.352, "v4": -3.558, "amplitude": 35.383, "phase_angle": 166.888, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 119.999, 102.648, 152.382 ], "x_axis": [ 0.768, 0.371, -0.522 ], "y_axis": [ -0.208, -0.626, -0.751 ], "z_axis": [ -0.606, 0.686, -0.404 ], "quaternion": [ -0.429, 0.836, 0.049, -0.337 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -46.281, "beta": 177.401, "gamma": 28.835, "delta": 143.009, "epsilon": -148.624, "zeta": -114.178, "epsilon_zeta": -34.446, "bb_type": "BI", "chi": -106.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.798, 8.272, -1.834 ], "P_xyz": [ 0.469, 9.471, -1.328 ], "form": "B", "ssZp": 1.747, "Dp": 1.947, "splay_angle": 22.962, "splay_distance": 3.953, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 174.571, "theta": -134.071, "eta_prime": -170.156, "theta_prime": -141.722, "eta_base": -136.066, "theta_base": -100.075, "v0": -17.318, "v1": 31.423, "v2": -32.892, "v3": 23.644, "v4": -4.198, "amplitude": 33.585, "phase_angle": 168.336, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 117.693, 104.927, 151.795 ], "x_axis": [ 0.582, -0.076, -0.810 ], "y_axis": [ -0.597, -0.717, -0.361 ], "z_axis": [ -0.553, 0.693, -0.462 ], "quaternion": [ -0.317, 0.831, -0.202, -0.410 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.596, "beta": 147.751, "gamma": 60.338, "delta": 119.162, "epsilon": 166.443, "zeta": -90.180, "epsilon_zeta": -103.377, "bb_type": "BI", "chi": -119.091, "glyco_bond": "anti", "C5prime_xyz": [ -2.670, 8.482, -1.709 ], "P_xyz": [ -0.286, 9.344, -2.306 ], "form": ".", "ssZp": 2.506, "Dp": 2.532, "splay_angle": 21.064, "splay_distance": 3.677, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 154.059, "theta": -149.948, "eta_prime": -167.415, "theta_prime": -174.453, "eta_base": -119.347, "theta_base": -144.688, "v0": -36.423, "v1": 35.216, "v2": -21.182, "v3": 0.995, "v4": 22.039, "amplitude": 36.818, "phase_angle": 125.121, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 115.345, 106.719, 149.167 ], "x_axis": [ 0.192, -0.535, -0.823 ], "y_axis": [ -0.836, -0.528, 0.148 ], "z_axis": [ -0.514, 0.660, -0.549 ], "quaternion": [ -0.170, 0.753, -0.455, -0.444 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -64.485, "beta": -157.566, "gamma": 30.499, "delta": 94.200, "epsilon": -167.591, "zeta": -83.212, "epsilon_zeta": -84.379, "bb_type": "BI", "chi": -129.973, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.704, -1.250 ], "P_xyz": [ 0.421, 10.165, -0.624 ], "form": "B", "ssZp": 3.059, "Dp": 3.850, "splay_angle": 23.041, "splay_distance": 3.901, "splay_ratio": 0.203, "d22": 4.569, "d64": 4.031, "eta": 172.596, "theta": -163.076, "eta_prime": 171.756, "theta_prime": -151.840, "eta_base": -151.351, "theta_base": -118.970, "v0": -10.835, "v1": -6.531, "v2": 20.132, "v3": -26.886, "v4": 23.945, "amplitude": 26.949, "phase_angle": 41.663, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 114.947, 109.754, 147.129 ], "x_axis": [ -0.257, -0.767, -0.589 ], "y_axis": [ -0.801, -0.172, 0.574 ], "z_axis": [ -0.541, 0.619, -0.570 ], "quaternion": [ 0.018, -0.609, 0.643, 0.463 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.788, "beta": 163.153, "gamma": 65.735, "delta": 141.267, "epsilon": -130.144, "zeta": -150.555, "epsilon_zeta": 20.411, "bb_type": "--", "chi": -114.617, "glyco_bond": "anti", "C5prime_xyz": [ -2.095, 8.529, -1.510 ], "P_xyz": [ 0.442, 9.044, -1.717 ], "form": ".", "ssZp": 1.746, "Dp": 1.725, "splay_angle": 26.220, "splay_distance": 4.463, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": -169.706, "theta": -148.676, "eta_prime": -139.375, "theta_prime": -156.920, "eta_base": -111.247, "theta_base": -116.937, "v0": -25.532, "v1": 37.625, "v2": -34.750, "v3": 20.982, "v4": 2.625, "amplitude": 37.676, "phase_angle": 157.272, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.486, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 112.263, 111.540, 144.933 ], "x_axis": [ -0.558, -0.803, -0.212 ], "y_axis": [ -0.650, 0.264, 0.712 ], "z_axis": [ -0.516, 0.535, -0.669 ], "quaternion": [ -0.096, -0.460, 0.789, 0.395 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -37.384, "beta": 141.654, "gamma": 34.854, "delta": 140.993, "epsilon": -143.861, "zeta": -143.684, "epsilon_zeta": -0.177, "bb_type": "--", "chi": -101.137, "glyco_bond": "anti", "C5prime_xyz": [ -2.411, 8.156, -2.109 ], "P_xyz": [ 0.104, 8.847, -2.065 ], "form": "B", "ssZp": 1.766, "Dp": 1.900, "splay_angle": 22.784, "splay_distance": 3.886, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 173.531, "theta": -148.434, "eta_prime": -160.721, "theta_prime": -161.655, "eta_base": -120.583, "theta_base": -129.798, "v0": -25.084, "v1": 37.256, "v2": -34.668, "v3": 21.099, "v4": 2.232, "amplitude": 37.435, "phase_angle": 157.832, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 109.655, 114.582, 142.967 ], "x_axis": [ -0.840, -0.492, 0.228 ], "y_axis": [ -0.179, 0.649, 0.739 ], "z_axis": [ -0.512, 0.580, -0.634 ], "quaternion": [ -0.209, -0.190, 0.884, 0.373 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.896, "beta": 144.946, "gamma": 47.761, "delta": 140.217, "epsilon": -163.940, "zeta": -121.955, "epsilon_zeta": -41.985, "bb_type": "BI", "chi": -111.174, "glyco_bond": "anti", "C5prime_xyz": [ -2.574, 8.444, -1.708 ], "P_xyz": [ -0.104, 9.265, -1.760 ], "form": ".", "ssZp": 2.221, "Dp": 2.229, "splay_angle": 21.759, "splay_distance": 4.125, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.552, "theta": -119.707, "eta_prime": -170.447, "theta_prime": -152.665, "eta_base": -134.524, "theta_base": -119.246, "v0": -31.915, "v1": 43.218, "v2": -37.435, "v3": 20.071, "v4": 7.069, "amplitude": 42.531, "phase_angle": 151.664, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 108.175, 117.358, 140.685 ], "x_axis": [ -0.771, -0.176, 0.613 ], "y_axis": [ 0.264, 0.786, 0.559 ], "z_axis": [ -0.580, 0.592, -0.559 ], "quaternion": [ -0.338, 0.025, 0.883, 0.326 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 54.945, "beta": -164.982, "gamma": -84.980, "delta": 149.274, "epsilon": -147.225, "zeta": -117.596, "epsilon_zeta": -29.630, "bb_type": "--", "chi": -122.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.442, 8.412, -0.942 ], "P_xyz": [ -0.680, 10.787, -1.689 ], "form": "B", "ssZp": 1.889, "Dp": 1.869, "splay_angle": 23.925, "splay_distance": 4.016, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -170.365, "theta": 178.061, "eta_prime": -164.861, "theta_prime": -166.354, "eta_base": -124.511, "theta_base": -131.921, "v0": -12.007, "v1": 29.679, "v2": -34.948, "v3": 28.931, "v4": -10.861, "amplitude": 34.953, "phase_angle": 178.992, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 104.752, 118.414, 138.640 ], "x_axis": [ -0.442, 0.234, 0.866 ], "y_axis": [ 0.641, 0.757, 0.123 ], "z_axis": [ -0.627, 0.609, -0.485 ], "quaternion": [ -0.455, 0.267, 0.819, 0.223 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -74.915, "beta": 175.619, "gamma": 51.313, "delta": 142.270, "epsilon": 176.728, "zeta": -102.452, "epsilon_zeta": -80.819, "bb_type": "BI", "chi": -102.229, "glyco_bond": "anti", "C5prime_xyz": [ -1.942, 8.087, -2.044 ], "P_xyz": [ 0.599, 8.710, -2.036 ], "form": "B", "ssZp": 2.129, "Dp": 2.196, "splay_angle": 21.988, "splay_distance": 3.698, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 152.375, "theta": -134.893, "eta_prime": -174.895, "theta_prime": -154.886, "eta_base": -138.662, "theta_base": -116.252, "v0": -15.304, "v1": 29.089, "v2": -31.014, "v3": 22.992, "v4": -5.054, "amplitude": 31.465, "phase_angle": 170.282, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 103.120, 120.862, 135.907 ], "x_axis": [ 0.020, 0.570, 0.821 ], "y_axis": [ 0.770, 0.515, -0.376 ], "z_axis": [ -0.637, 0.640, -0.429 ], "quaternion": [ 0.526, -0.483, -0.694, -0.095 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -51.498, "beta": 176.078, "gamma": 50.713, "delta": 140.107, "epsilon": -150.991, "zeta": -145.460, "epsilon_zeta": -5.531, "bb_type": "--", "chi": -109.052, "glyco_bond": "anti", "C5prime_xyz": [ -2.403, 8.390, -1.796 ], "P_xyz": [ -0.120, 9.642, -1.709 ], "form": ".", "ssZp": 1.979, "Dp": 2.013, "splay_angle": 21.093, "splay_distance": 3.579, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -179.211, "theta": -164.107, "eta_prime": -156.287, "theta_prime": -169.041, "eta_base": -112.728, "theta_base": -114.086, "v0": -27.779, "v1": 39.388, "v2": -35.436, "v3": 20.335, "v4": 4.390, "amplitude": 39.150, "phase_angle": 154.842, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 100.817, 123.569, 134.882 ], "x_axis": [ 0.447, 0.764, 0.464 ], "y_axis": [ 0.612, 0.117, -0.782 ], "z_axis": [ -0.652, 0.634, -0.415 ], "quaternion": [ 0.536, -0.661, -0.521, 0.071 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.220, "beta": 151.370, "gamma": 53.052, "delta": 143.642, "epsilon": -178.574, "zeta": -99.162, "epsilon_zeta": -79.412, "bb_type": "BI", "chi": -106.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 8.176, -1.825 ], "P_xyz": [ 0.817, 8.269, -1.782 ], "form": "B", "ssZp": 1.967, "Dp": 2.052, "splay_angle": 18.001, "splay_distance": 3.129, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 161.559, "theta": -120.469, "eta_prime": -165.504, "theta_prime": -150.847, "eta_base": -108.978, "theta_base": -121.132, "v0": -14.755, "v1": 29.667, "v2": -32.565, "v3": 24.894, "v4": -6.624, "amplitude": 32.834, "phase_angle": 172.663, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 99.202, 125.542, 132.371 ], "x_axis": [ 0.695, 0.678, -0.238 ], "y_axis": [ 0.102, -0.420, -0.902 ], "z_axis": [ -0.711, 0.603, -0.361 ], "quaternion": [ -0.478, 0.787, 0.248, -0.302 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -47.633, "beta": -177.411, "gamma": 30.053, "delta": 142.979, "epsilon": -138.925, "zeta": -161.260, "epsilon_zeta": 22.336, "bb_type": "--", "chi": -99.778, "glyco_bond": "anti", "C5prime_xyz": [ -2.587, 8.120, -2.124 ], "P_xyz": [ -0.658, 9.882, -2.081 ], "form": "B", "ssZp": 1.768, "Dp": 1.814, "splay_angle": 20.979, "splay_distance": 3.583, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 176.828, "theta": -175.540, "eta_prime": -163.428, "theta_prime": -176.317, "eta_base": -126.875, "theta_base": -128.662, "v0": -28.163, "v1": 41.088, "v2": -37.614, "v3": 22.420, "v4": 3.314, "amplitude": 40.991, "phase_angle": 156.579, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 97.228, 127.892, 131.762 ], "x_axis": [ 0.668, 0.372, -0.645 ], "y_axis": [ -0.323, -0.636, -0.701 ], "z_axis": [ -0.671, 0.676, -0.304 ], "quaternion": [ -0.426, 0.807, 0.015, -0.407 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -55.885, "beta": 133.777, "gamma": 55.582, "delta": 140.287, "epsilon": -176.631, "zeta": -108.288, "epsilon_zeta": -68.343, "bb_type": "BI", "chi": -118.217, "glyco_bond": "anti", "C5prime_xyz": [ -2.239, 8.586, -1.370 ], "P_xyz": [ 0.370, 8.776, -1.418 ], "form": "B", "ssZp": 2.299, "Dp": 2.306, "splay_angle": 19.994, "splay_distance": 3.278, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 154.373, "theta": -126.420, "eta_prime": -170.384, "theta_prime": -156.784, "eta_base": -120.131, "theta_base": -108.020, "v0": -27.117, "v1": 38.692, "v2": -34.851, "v3": 20.169, "v4": 4.083, "amplitude": 38.413, "phase_angle": 155.129, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.085, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 94.201, 129.442, 130.634 ], "x_axis": [ 0.316, -0.034, -0.948 ], "y_axis": [ -0.632, -0.753, -0.184 ], "z_axis": [ -0.708, 0.657, -0.260 ], "quaternion": [ -0.275, 0.763, -0.218, -0.542 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -73.444, "beta": 173.538, "gamma": 67.855, "delta": 145.952, "epsilon": -159.004, "zeta": -167.228, "epsilon_zeta": 8.224, "bb_type": "--", "chi": -119.525, "glyco_bond": "anti", "C5prime_xyz": [ -2.092, 8.650, -1.276 ], "P_xyz": [ 0.358, 9.510, -0.944 ], "form": "B", "ssZp": 1.744, "Dp": 1.973, "splay_angle": 21.638, "splay_distance": 3.478, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 168.736, "theta": -152.216, "eta_prime": -160.372, "theta_prime": -163.135, "eta_base": -102.919, "theta_base": -131.966, "v0": -27.264, "v1": 41.874, "v2": -39.844, "v3": 25.255, "v4": 0.853, "amplitude": 42.412, "phase_angle": 159.957, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 92.279, 131.572, 129.048 ], "x_axis": [ -0.183, -0.555, -0.812 ], "y_axis": [ -0.684, -0.522, 0.511 ], "z_axis": [ -0.707, 0.648, -0.284 ], "quaternion": [ -0.054, 0.637, -0.486, -0.596 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 36.969, "beta": 143.465, "gamma": -22.220, "delta": 164.585, "epsilon": 179.347, "zeta": -106.113, "epsilon_zeta": -74.540, "bb_type": "BI", "chi": -92.040, "glyco_bond": "anti", "C5prime_xyz": [ -1.259, 7.477, -2.063 ], "P_xyz": [ 0.795, 8.737, -1.029 ], "form": ".", "ssZp": 1.341, "Dp": 1.589, "splay_angle": 22.389, "splay_distance": 3.723, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 173.201, "theta": -131.508, "eta_prime": -171.256, "theta_prime": -142.277, "eta_base": -137.021, "theta_base": -76.950, "v0": 4.296, "v1": 21.597, "v2": -37.736, "v3": 41.087, "v4": -28.872, "amplitude": 41.434, "phase_angle": 204.390, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 90.463, 134.539, 129.105 ], "x_axis": [ -0.495, -0.798, -0.343 ], "y_axis": [ -0.419, -0.127, 0.899 ], "z_axis": [ -0.761, 0.589, -0.272 ], "quaternion": [ -0.163, -0.475, 0.640, 0.581 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.311, "beta": 169.952, "gamma": 64.753, "delta": 142.895, "epsilon": 130.597, "zeta": 172.968, "epsilon_zeta": -42.371, "bb_type": "--", "chi": -90.873, "glyco_bond": "anti", "C5prime_xyz": [ -2.261, 7.756, -2.476 ], "P_xyz": [ 0.285, 8.106, -2.994 ], "form": ".", "ssZp": 1.822, "Dp": 1.920, "splay_angle": 24.338, "splay_distance": 3.649, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 138.566, "theta": -157.210, "eta_prime": -156.991, "theta_prime": -160.779, "eta_base": -89.528, "theta_base": -139.164, "v0": -16.643, "v1": 31.836, "v2": -34.209, "v3": 25.500, "v4": -5.909, "amplitude": 34.655, "phase_angle": 170.791, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 86.915, 135.334, 129.901 ], "x_axis": [ -0.701, -0.591, 0.400 ], "y_axis": [ -0.041, 0.593, 0.804 ], "z_axis": [ -0.712, 0.547, -0.440 ], "quaternion": [ -0.336, -0.191, 0.827, 0.409 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 106.033, "beta": 81.997, "gamma": 39.928, "delta": 147.205, "epsilon": -164.871, "zeta": -162.440, "epsilon_zeta": -2.431, "bb_type": "--", "chi": -74.495, "glyco_bond": "--", "C5prime_xyz": [ -2.936, 7.206, -2.929 ], "P_xyz": [ -0.346, 6.833, -2.614 ], "form": "B", "ssZp": 1.634, "Dp": 1.972, "splay_angle": 21.139, "splay_distance": 3.558, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": -177.006, "theta": -142.595, "eta_prime": -179.056, "theta_prime": 177.902, "eta_base": -153.701, "theta_base": -152.282, "v0": -20.181, "v1": 36.759, "v2": -38.478, "v3": 27.781, "v4": -5.011, "amplitude": 39.270, "phase_angle": 168.475, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 85.317, 138.366, 128.649 ], "x_axis": [ -0.520, -0.334, 0.786 ], "y_axis": [ 0.168, 0.863, 0.477 ], "z_axis": [ -0.838, 0.380, -0.392 ], "quaternion": [ -0.488, -0.050, 0.833, 0.257 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/26", "linked_nts": [ "///C/25", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -45.276, "beta": 137.050, "gamma": 60.191, "delta": 134.143, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -107.227, "glyco_bond": "anti", "C5prime_xyz": [ -2.503, 8.322, -1.972 ], "P_xyz": [ 0.025, 8.556, -2.598 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -29.290, "v1": 37.436, "v2": -31.047, "v3": 15.045, "v4": 8.688, "amplitude": 36.724, "phase_angle": 147.715, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 83.173, 140.412, 126.681 ], "x_axis": [ -0.499, 0.143, 0.855 ], "y_axis": [ 0.305, 0.952, 0.019 ], "z_axis": [ -0.811, 0.270, -0.519 ], "quaternion": [ -0.483, 0.130, 0.862, 0.084 ] } }, { "index": 26, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": ".", "summary": "~C3'-endo,BII,non-stack,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 54.061, "delta": 87.352, "epsilon": -133.618, "zeta": 153.842, "epsilon_zeta": 72.541, "bb_type": "BII", "chi": -52.999, "glyco_bond": "--", "C5prime_xyz": [ -3.564, 5.701, -3.397 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -2.847, "Dp": 4.603, "splay_angle": 72.627, "splay_distance": 10.518, "splay_ratio": 0.603, "d22": 7.694, "d64": 8.073, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.140, "v1": -24.137, "v2": 34.658, "v3": -33.824, "v4": 19.516, "amplitude": 35.678, "phase_angle": 13.731, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 76.209, 143.846, 127.614 ], "x_axis": [ -0.908, -0.320, 0.270 ], "y_axis": [ 0.332, -0.943, -0.002 ], "z_axis": [ 0.255, 0.088, 0.963 ], "quaternion": [ -0.167, 0.134, 0.022, 0.977 ] } }, { "index": 27, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -83.896, "beta": 107.648, "gamma": 84.820, "delta": 154.773, "epsilon": -139.357, "zeta": -154.371, "epsilon_zeta": 15.015, "bb_type": "--", "chi": -92.823, "glyco_bond": "anti", "C5prime_xyz": [ -2.324, 7.949, -2.236 ], "P_xyz": [ -0.277, 6.713, -3.312 ], "form": "B", "ssZp": 1.542, "Dp": 1.586, "splay_angle": 20.930, "splay_distance": 3.655, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 143.295, "theta": -93.257, "eta_prime": -141.548, "theta_prime": -175.401, "eta_base": -129.374, "theta_base": -112.996, "v0": -20.647, "v1": 39.719, "v2": -42.476, "v3": 31.804, "v4": -7.244, "amplitude": 43.037, "phase_angle": 170.738, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 85.149, 138.460, 128.917 ], "x_axis": [ -0.332, -0.509, 0.794 ], "y_axis": [ -0.331, -0.726, -0.603 ], "z_axis": [ 0.884, -0.463, 0.072 ], "quaternion": [ -0.061, 0.575, -0.365, 0.730 ] } }, { "index": 28, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 87.035, "beta": -109.275, "gamma": -155.458, "delta": 101.912, "epsilon": -93.559, "zeta": -142.177, "epsilon_zeta": 48.618, "bb_type": "--", "chi": -163.399, "glyco_bond": "anti", "C5prime_xyz": [ -2.341, 8.946, 0.302 ], "P_xyz": [ -1.105, 9.948, -1.790 ], "form": ".", "ssZp": 2.383, "Dp": 2.497, "splay_angle": 20.254, "splay_distance": 3.862, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -156.240, "theta": -169.035, "eta_prime": -162.945, "theta_prime": -154.653, "eta_base": -103.177, "theta_base": -98.333, "v0": -32.330, "v1": 19.395, "v2": -0.610, "v3": -17.795, "v4": 31.623, "amplitude": 32.869, "phase_angle": 91.063, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "4n", "suiteness": 0.046, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 87.306, 135.634, 129.766 ], "x_axis": [ -0.447, -0.855, 0.265 ], "y_axis": [ -0.054, -0.270, -0.961 ], "z_axis": [ 0.893, -0.444, 0.075 ], "quaternion": [ -0.299, 0.432, -0.525, 0.669 ] } }, { "index": 29, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 95.339, "beta": -112.775, "gamma": -169.872, "delta": 150.728, "epsilon": -162.882, "zeta": -126.117, "epsilon_zeta": -36.765, "bb_type": "BI", "chi": -95.105, "glyco_bond": "anti", "C5prime_xyz": [ -2.149, 7.995, -2.213 ], "P_xyz": [ -1.111, 6.903, -4.360 ], "form": "B", "ssZp": 1.904, "Dp": 1.965, "splay_angle": 20.623, "splay_distance": 3.525, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 153.001, "theta": -141.418, "eta_prime": -150.414, "theta_prime": -174.412, "eta_base": -101.533, "theta_base": -141.238, "v0": -18.847, "v1": 36.556, "v2": -39.314, "v3": 29.431, "v4": -6.902, "amplitude": 39.800, "phase_angle": 171.043, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 89.734, 133.498, 127.655 ], "x_axis": [ -0.192, -0.922, -0.336 ], "y_axis": [ 0.669, 0.128, -0.732 ], "z_axis": [ 0.718, -0.365, 0.592 ], "quaternion": [ 0.618, -0.148, 0.426, -0.644 ] } }, { "index": 30, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 50.722, "beta": 171.433, "gamma": -68.468, "delta": 166.145, "epsilon": -157.108, "zeta": -150.161, "epsilon_zeta": -6.946, "bb_type": "--", "chi": -72.238, "glyco_bond": "--", "C5prime_xyz": [ -2.072, 6.973, -2.776 ], "P_xyz": [ -1.079, 8.888, -4.250 ], "form": "B", "ssZp": 0.947, "Dp": 1.358, "splay_angle": 20.840, "splay_distance": 3.563, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 175.077, "theta": 178.139, "eta_prime": -164.417, "theta_prime": 177.309, "eta_base": -137.341, "theta_base": -109.930, "v0": -4.060, "v1": 29.677, "v2": -42.697, "v3": 41.459, "v4": -23.733, "amplitude": 43.903, "phase_angle": 193.461, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 92.226, 131.594, 129.264 ], "x_axis": [ -0.023, -0.652, -0.758 ], "y_axis": [ 0.846, 0.391, -0.362 ], "z_axis": [ 0.533, -0.650, 0.543 ], "quaternion": [ 0.691, 0.104, 0.467, -0.542 ] } }, { "index": 31, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -43.891, "beta": 129.154, "gamma": 57.080, "delta": 131.416, "epsilon": -160.293, "zeta": -127.618, "epsilon_zeta": -32.676, "bb_type": "BI", "chi": -101.738, "glyco_bond": "anti", "C5prime_xyz": [ -2.722, 8.196, -2.203 ], "P_xyz": [ -0.244, 8.319, -3.012 ], "form": "B", "ssZp": 2.198, "Dp": 2.306, "splay_angle": 20.549, "splay_distance": 3.472, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 165.229, "theta": -144.329, "eta_prime": -164.656, "theta_prime": -165.759, "eta_base": -95.158, "theta_base": -132.097, "v0": -32.584, "v1": 38.917, "v2": -30.250, "v3": 12.361, "v4": 12.399, "amplitude": 38.149, "phase_angle": 142.461, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 95.472, 130.142, 129.479 ], "x_axis": [ 0.628, -0.288, -0.723 ], "y_axis": [ 0.689, 0.639, 0.343 ], "z_axis": [ 0.363, -0.713, 0.599 ], "quaternion": [ 0.846, 0.312, 0.321, -0.288 ] } }, { "index": 32, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -49.577, "beta": 162.347, "gamma": 41.633, "delta": 137.171, "epsilon": -156.000, "zeta": -133.180, "epsilon_zeta": -22.820, "bb_type": "--", "chi": -106.323, "glyco_bond": "anti", "C5prime_xyz": [ -2.251, 8.241, -1.949 ], "P_xyz": [ 0.187, 9.189, -1.927 ], "form": "B", "ssZp": 2.028, "Dp": 2.151, "splay_angle": 22.687, "splay_distance": 3.847, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 170.176, "theta": -150.472, "eta_prime": -170.727, "theta_prime": -161.367, "eta_base": -133.357, "theta_base": -130.221, "v0": -24.395, "v1": 34.645, "v2": -31.289, "v3": 18.004, "v4": 3.800, "amplitude": 34.514, "phase_angle": 155.034, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 97.139, 127.953, 131.597 ], "x_axis": [ 0.774, 0.275, -0.570 ], "y_axis": [ 0.293, 0.643, 0.708 ], "z_axis": [ 0.562, -0.715, 0.416 ], "quaternion": [ 0.842, 0.423, 0.336, -0.005 ] } }, { "index": 33, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.669, "beta": 148.664, "gamma": 48.745, "delta": 129.471, "epsilon": -167.833, "zeta": -115.937, "epsilon_zeta": -51.896, "bb_type": "BI", "chi": -115.438, "glyco_bond": "anti", "C5prime_xyz": [ -2.615, 8.480, -1.690 ], "P_xyz": [ -0.199, 9.444, -1.860 ], "form": "B", "ssZp": 2.394, "Dp": 2.393, "splay_angle": 22.329, "splay_distance": 3.696, "splay_ratio": 0.194, "d22": 4.430, "d64": 3.769, "eta": 169.523, "theta": -146.953, "eta_prime": -167.037, "theta_prime": -159.782, "eta_base": -131.508, "theta_base": -111.033, "v0": -34.080, "v1": 39.144, "v2": -29.207, "v3": 10.512, "v4": 14.482, "amplitude": 38.498, "phase_angle": 139.345, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 98.949, 125.099, 133.434 ], "x_axis": [ 0.829, 0.539, -0.152 ], "y_axis": [ -0.112, 0.425, 0.898 ], "z_axis": [ 0.548, -0.728, 0.413 ], "quaternion": [ 0.816, 0.498, 0.214, 0.199 ] } }, { "index": 34, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.952, "beta": 164.153, "gamma": 55.077, "delta": 137.770, "epsilon": -163.446, "zeta": -121.860, "epsilon_zeta": -41.586, "bb_type": "BI", "chi": -116.253, "glyco_bond": "anti", "C5prime_xyz": [ -2.193, 8.583, -1.517 ], "P_xyz": [ 0.277, 9.436, -1.439 ], "form": "B", "ssZp": 2.199, "Dp": 2.196, "splay_angle": 20.080, "splay_distance": 3.347, "splay_ratio": 0.174, "d22": 4.522, "d64": 3.758, "eta": 171.017, "theta": -146.322, "eta_prime": -162.265, "theta_prime": -160.643, "eta_base": -108.164, "theta_base": -123.084, "v0": -27.791, "v1": 38.076, "v2": -33.377, "v3": 18.260, "v4": 5.723, "amplitude": 37.607, "phase_angle": 152.564, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 101.588, 123.124, 135.106 ], "x_axis": [ 0.523, 0.710, 0.472 ], "y_axis": [ -0.620, -0.063, 0.782 ], "z_axis": [ 0.585, -0.702, 0.407 ], "quaternion": [ 0.683, 0.543, 0.041, 0.487 ] } }, { "index": 35, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.363, "beta": 170.798, "gamma": 40.055, "delta": 135.996, "epsilon": -148.202, "zeta": -108.512, "epsilon_zeta": -39.690, "bb_type": "BI", "chi": -114.923, "glyco_bond": "anti", "C5prime_xyz": [ -1.918, 8.500, -1.576 ], "P_xyz": [ 0.460, 9.489, -1.139 ], "form": "B", "ssZp": 1.997, "Dp": 2.123, "splay_angle": 22.467, "splay_distance": 3.872, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 175.063, "theta": -130.829, "eta_prime": -168.898, "theta_prime": -139.562, "eta_base": -126.266, "theta_base": -98.363, "v0": -22.677, "v1": 32.404, "v2": -29.440, "v3": 17.095, "v4": 3.288, "amplitude": 32.351, "phase_angle": 155.510, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 103.624, 120.713, 136.221 ], "x_axis": [ 0.016, 0.588, 0.809 ], "y_axis": [ -0.807, -0.470, 0.357 ], "z_axis": [ 0.590, -0.658, 0.467 ], "quaternion": [ 0.503, 0.505, -0.109, 0.693 ] } }, { "index": 36, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -61.721, "beta": 149.557, "gamma": 61.885, "delta": 116.605, "epsilon": 165.131, "zeta": -89.776, "epsilon_zeta": -105.093, "bb_type": "BI", "chi": -119.905, "glyco_bond": "anti", "C5prime_xyz": [ -2.722, 8.487, -1.707 ], "P_xyz": [ -0.383, 9.426, -2.361 ], "form": ".", "ssZp": 2.513, "Dp": 2.550, "splay_angle": 21.263, "splay_distance": 3.671, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 155.337, "theta": -154.132, "eta_prime": -166.065, "theta_prime": -176.611, "eta_base": -117.485, "theta_base": -145.150, "v0": -37.488, "v1": 34.684, "v2": -19.394, "v3": -1.406, "v4": 24.247, "amplitude": 37.235, "phase_angle": 121.390, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 105.067, 118.329, 138.909 ], "x_axis": [ -0.499, 0.256, 0.828 ], "y_axis": [ -0.628, -0.766, -0.141 ], "z_axis": [ 0.598, -0.590, 0.543 ], "quaternion": [ 0.264, 0.425, -0.218, 0.838 ] } }, { "index": 37, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -66.528, "beta": -157.489, "gamma": 33.349, "delta": 94.739, "epsilon": -166.736, "zeta": -81.285, "epsilon_zeta": -85.451, "bb_type": "BI", "chi": -131.576, "glyco_bond": "anti", "C5prime_xyz": [ -1.603, 8.720, -1.151 ], "P_xyz": [ 0.531, 10.080, -0.481 ], "form": "B", "ssZp": 3.127, "Dp": 3.862, "splay_angle": 21.725, "splay_distance": 3.682, "splay_ratio": 0.192, "d22": 4.500, "d64": 3.912, "eta": 173.306, "theta": -159.937, "eta_prime": 172.360, "theta_prime": -149.246, "eta_base": -149.780, "theta_base": -116.341, "v0": -9.987, "v1": -6.998, "v2": 20.071, "v3": -26.335, "v4": 23.084, "amplitude": 26.322, "phase_angle": 40.311, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 108.039, 117.476, 140.888 ], "x_axis": [ -0.791, -0.170, 0.588 ], "y_axis": [ -0.273, -0.762, -0.588 ], "z_axis": [ 0.548, -0.625, 0.556 ], "quaternion": [ 0.029, 0.322, -0.344, 0.881 ] } }, { "index": 38, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -55.992, "beta": 163.501, "gamma": 67.232, "delta": 141.084, "epsilon": -128.824, "zeta": -152.478, "epsilon_zeta": 23.655, "bb_type": "--", "chi": -114.453, "glyco_bond": "anti", "C5prime_xyz": [ -2.126, 8.528, -1.529 ], "P_xyz": [ 0.405, 9.066, -1.766 ], "form": ".", "ssZp": 1.692, "Dp": 1.684, "splay_angle": 26.457, "splay_distance": 4.503, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": -170.468, "theta": -150.461, "eta_prime": -139.573, "theta_prime": -157.876, "eta_base": -110.530, "theta_base": -118.053, "v0": -25.987, "v1": 37.918, "v2": -34.819, "v3": 20.760, "v4": 3.050, "amplitude": 37.916, "phase_angle": 156.680, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.482, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 109.357, 114.736, 142.966 ], "x_axis": [ -0.866, -0.458, 0.202 ], "y_axis": [ 0.197, -0.683, -0.703 ], "z_axis": [ 0.460, -0.569, 0.682 ], "quaternion": [ -0.182, 0.184, -0.354, 0.899 ] } }, { "index": 39, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -36.597, "beta": 142.216, "gamma": 33.469, "delta": 143.467, "epsilon": -143.970, "zeta": -145.859, "epsilon_zeta": 1.889, "bb_type": "--", "chi": -98.285, "glyco_bond": "anti", "C5prime_xyz": [ -2.393, 8.070, -2.194 ], "P_xyz": [ 0.121, 8.768, -2.127 ], "form": "B", "ssZp": 1.666, "Dp": 1.825, "splay_angle": 22.611, "splay_distance": 3.851, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 173.651, "theta": -147.153, "eta_prime": -160.258, "theta_prime": -160.799, "eta_base": -121.057, "theta_base": -128.480, "v0": -23.620, "v1": 37.206, "v2": -35.989, "v3": 23.318, "v4": -0.099, "amplitude": 37.987, "phase_angle": 161.338, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 112.160, 111.832, 144.962 ], "x_axis": [ -0.583, -0.780, -0.229 ], "y_axis": [ 0.634, -0.261, -0.728 ], "z_axis": [ 0.507, -0.569, 0.647 ], "quaternion": [ -0.448, 0.088, -0.411, 0.789 ] } }, { "index": 40, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.268, "beta": 146.256, "gamma": 43.242, "delta": 142.184, "epsilon": -163.702, "zeta": -121.905, "epsilon_zeta": -41.797, "bb_type": "BI", "chi": -103.147, "glyco_bond": "anti", "C5prime_xyz": [ -2.652, 8.236, -2.017 ], "P_xyz": [ -0.211, 9.130, -2.163 ], "form": ".", "ssZp": 2.129, "Dp": 2.160, "splay_angle": 21.394, "splay_distance": 4.107, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 163.321, "theta": -119.964, "eta_prime": -169.177, "theta_prime": -154.088, "eta_base": -133.942, "theta_base": -121.055, "v0": -30.678, "v1": 43.143, "v2": -38.569, "v3": 21.911, "v4": 5.124, "amplitude": 42.790, "phase_angle": 154.337, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 114.731, 110.040, 147.201 ], "x_axis": [ -0.229, -0.775, -0.589 ], "y_axis": [ 0.840, 0.149, -0.522 ], "z_axis": [ 0.492, -0.615, 0.617 ], "quaternion": [ 0.620, 0.038, 0.436, -0.651 ] } }, { "index": 41, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 54.380, "beta": -159.165, "gamma": -87.101, "delta": 144.682, "epsilon": -147.755, "zeta": -111.071, "epsilon_zeta": -36.683, "bb_type": "BI", "chi": -121.558, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.466, -1.058 ], "P_xyz": [ -1.042, 10.787, -2.099 ], "form": "B", "ssZp": 1.997, "Dp": 1.993, "splay_angle": 22.478, "splay_distance": 3.803, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": -168.076, "theta": 178.402, "eta_prime": -165.407, "theta_prime": -164.720, "eta_base": -126.598, "theta_base": -131.293, "v0": -15.014, "v1": 30.062, "v2": -32.787, "v3": 24.959, "v4": -6.482, "amplitude": 33.085, "phase_angle": 172.305, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 115.300, 106.578, 149.335 ], "x_axis": [ 0.208, -0.538, -0.817 ], "y_axis": [ 0.855, 0.505, -0.115 ], "z_axis": [ 0.474, -0.675, 0.566 ], "quaternion": [ 0.755, 0.185, 0.427, -0.462 ] } }, { "index": 42, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -80.798, "beta": 178.942, "gamma": 54.048, "delta": 143.472, "epsilon": 179.334, "zeta": -107.450, "epsilon_zeta": -73.217, "bb_type": "BI", "chi": -95.840, "glyco_bond": "anti", "C5prime_xyz": [ -2.087, 7.904, -2.296 ], "P_xyz": [ 0.432, 8.564, -2.472 ], "form": "B", "ssZp": 1.982, "Dp": 2.116, "splay_angle": 23.504, "splay_distance": 3.912, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 149.989, "theta": -136.516, "eta_prime": -175.289, "theta_prime": -156.198, "eta_base": -140.366, "theta_base": -110.432, "v0": -15.363, "v1": 29.931, "v2": -32.264, "v3": 24.213, "v4": -5.816, "amplitude": 32.643, "phase_angle": 171.260, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 117.490, 104.824, 151.902 ], "x_axis": [ 0.563, -0.064, -0.824 ], "y_axis": [ 0.652, 0.648, 0.395 ], "z_axis": [ 0.508, -0.759, 0.406 ], "quaternion": [ 0.809, 0.357, 0.412, -0.221 ] } }, { "index": 43, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -48.433, "beta": 171.888, "gamma": 50.185, "delta": 139.780, "epsilon": -148.114, "zeta": -142.744, "epsilon_zeta": -5.370, "bb_type": "--", "chi": -105.016, "glyco_bond": "anti", "C5prime_xyz": [ -2.377, 8.245, -1.969 ], "P_xyz": [ -0.004, 9.310, -2.100 ], "form": "B", "ssZp": 1.923, "Dp": 1.992, "splay_angle": 21.122, "splay_distance": 3.580, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -177.808, "theta": -158.345, "eta_prime": -155.006, "theta_prime": -165.821, "eta_base": -106.487, "theta_base": -123.941, "v0": -26.230, "v1": 37.709, "v2": -34.260, "v3": 20.056, "v4": 3.615, "amplitude": 37.576, "phase_angle": 155.750, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 120.410, 102.425, 152.915 ], "x_axis": [ 0.844, 0.355, -0.401 ], "y_axis": [ 0.180, 0.517, 0.837 ], "z_axis": [ 0.505, -0.779, 0.372 ], "quaternion": [ 0.827, 0.489, 0.274, 0.053 ] } }, { "index": 44, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.708, "beta": 146.544, "gamma": 50.727, "delta": 140.697, "epsilon": -154.726, "zeta": -131.553, "epsilon_zeta": -23.173, "bb_type": "--", "chi": -109.561, "glyco_bond": "anti", "C5prime_xyz": [ -2.290, 8.395, -1.762 ], "P_xyz": [ 0.267, 8.902, -1.843 ], "form": "B", "ssZp": 2.031, "Dp": 2.058, "splay_angle": 19.866, "splay_distance": 3.321, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 168.167, "theta": -142.133, "eta_prime": -165.355, "theta_prime": -161.178, "eta_base": -121.966, "theta_base": -114.503, "v0": -26.035, "v1": 38.056, "v2": -34.991, "v3": 20.924, "v4": 2.937, "amplitude": 38.063, "phase_angle": 156.824, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 121.992, 99.932, 154.941 ], "x_axis": [ 0.786, 0.601, 0.145 ], "y_axis": [ -0.320, 0.196, 0.927 ], "z_axis": [ 0.528, -0.775, 0.346 ], "quaternion": [ 0.763, 0.558, 0.126, 0.302 ] } }, { "index": 45, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.965, "beta": 151.305, "gamma": 52.242, "delta": 133.889, "epsilon": -172.028, "zeta": -114.572, "epsilon_zeta": -57.456, "bb_type": "BI", "chi": -113.945, "glyco_bond": "anti", "C5prime_xyz": [ -2.288, 8.431, -1.682 ], "P_xyz": [ 0.230, 9.114, -1.790 ], "form": "B", "ssZp": 2.254, "Dp": 2.284, "splay_angle": 19.073, "splay_distance": 3.194, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 163.491, "theta": -142.015, "eta_prime": -167.868, "theta_prime": -160.888, "eta_base": -115.236, "theta_base": -119.479, "v0": -27.836, "v1": 36.016, "v2": -30.224, "v3": 15.043, "v4": 7.769, "amplitude": 35.375, "phase_angle": 148.691, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 123.664, 97.582, 156.586 ], "x_axis": [ 0.424, 0.577, 0.698 ], "y_axis": [ -0.709, -0.268, 0.652 ], "z_axis": [ 0.564, -0.772, 0.295 ], "quaternion": [ 0.602, 0.591, -0.056, 0.534 ] } }, { "index": 46, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -46.900, "beta": 166.862, "gamma": 42.981, "delta": 139.002, "epsilon": -160.989, "zeta": -133.623, "epsilon_zeta": -27.366, "bb_type": "--", "chi": -114.427, "glyco_bond": "anti", "C5prime_xyz": [ -2.322, 8.469, -1.562 ], "P_xyz": [ -0.007, 9.643, -1.269 ], "form": "B", "ssZp": 2.239, "Dp": 2.214, "splay_angle": 19.174, "splay_distance": 3.138, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 170.597, "theta": -159.321, "eta_prime": -166.057, "theta_prime": -167.576, "eta_base": -117.692, "theta_base": -124.159, "v0": -28.328, "v1": 39.191, "v2": -34.490, "v3": 19.090, "v4": 5.539, "amplitude": 38.692, "phase_angle": 153.050, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 125.802, 95.453, 157.633 ], "x_axis": [ -0.075, 0.313, 0.947 ], "y_axis": [ -0.801, -0.585, 0.130 ], "z_axis": [ 0.594, -0.749, 0.294 ], "quaternion": [ 0.398, 0.551, -0.221, 0.699 ] } }, { "index": 47, "index_chain": 22, "chain_name": "D", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.515, "beta": 157.018, "gamma": 60.496, "delta": 146.346, "epsilon": -168.290, "zeta": -131.105, "epsilon_zeta": -37.186, "bb_type": "BI", "chi": -120.709, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.604, -1.136 ], "P_xyz": [ 0.747, 8.971, -0.780 ], "form": "B", "ssZp": 1.794, "Dp": 1.948, "splay_angle": 17.944, "splay_distance": 3.044, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 161.995, "theta": -118.425, "eta_prime": -166.131, "theta_prime": -148.304, "eta_base": -118.340, "theta_base": -115.985, "v0": -20.754, "v1": 36.529, "v2": -37.673, "v3": 26.666, "v4": -4.024, "amplitude": 38.651, "phase_angle": 167.082, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 127.616, 92.951, 158.179 ], "x_axis": [ -0.581, -0.083, 0.810 ], "y_axis": [ -0.586, -0.648, -0.487 ], "z_axis": [ 0.565, -0.757, 0.327 ], "quaternion": [ 0.157, 0.430, -0.389, 0.799 ] } }, { "index": 48, "index_chain": 23, "chain_name": "D", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 49.843, "beta": 162.153, "gamma": -57.215, "delta": 160.949, "epsilon": -164.463, "zeta": -134.876, "epsilon_zeta": -29.587, "bb_type": "--", "chi": -95.234, "glyco_bond": "anti", "C5prime_xyz": [ -1.221, 7.573, -1.970 ], "P_xyz": [ 0.337, 9.674, -1.979 ], "form": "B", "ssZp": 1.080, "Dp": 1.496, "splay_angle": 17.788, "splay_distance": 3.042, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 174.140, "theta": -137.533, "eta_prime": -167.504, "theta_prime": -134.876, "eta_base": -127.926, "theta_base": -97.507, "v0": 2.793, "v1": 21.559, "v2": -36.432, "v3": 38.954, "v4": -26.656, "amplitude": 39.484, "phase_angle": 202.674, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 129.685, 91.165, 159.518 ], "x_axis": [ -0.852, -0.411, 0.324 ], "y_axis": [ -0.067, -0.528, -0.847 ], "z_axis": [ 0.519, -0.743, 0.423 ], "quaternion": [ -0.103, 0.252, -0.475, 0.837 ] } }, { "index": 49, "index_chain": 24, "chain_name": "D", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 27.266, "beta": 118.948, "gamma": -17.432, "delta": 142.721, "epsilon": -94.255, "zeta": 149.730, "epsilon_zeta": 116.015, "bb_type": "BII", "chi": -61.288, "glyco_bond": "--", "C5prime_xyz": [ -3.544, 6.786, -3.001 ], "P_xyz": [ -1.782, 8.592, -3.669 ], "form": ".", "ssZp": 0.374, "Dp": 0.873, "splay_angle": 23.311, "splay_distance": 4.233, "splay_ratio": 0.223, "d22": 5.025, "d64": 3.596, "eta": 175.947, "theta": 179.463, "eta_prime": -155.965, "theta_prime": 179.955, "eta_base": -120.591, "theta_base": -116.342, "v0": -26.636, "v1": 39.703, "v2": -36.923, "v3": 22.503, "v4": 2.328, "amplitude": 39.854, "phase_angle": 157.892, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 130.604, 88.305, 159.998 ], "x_axis": [ -0.838, -0.534, -0.115 ], "y_axis": [ 0.395, -0.447, -0.802 ], "z_axis": [ 0.377, -0.718, 0.586 ], "quaternion": [ -0.274, 0.077, -0.449, 0.847 ] } }, { "index": 50, "index_chain": 25, "chain_name": "D", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -55.052, "beta": 122.049, "gamma": 34.920, "delta": 140.642, "epsilon": -166.022, "zeta": -84.298, "epsilon_zeta": -81.724, "bb_type": "BI", "chi": -83.568, "glyco_bond": "--", "C5prime_xyz": [ -2.960, 7.639, -2.656 ], "P_xyz": [ -0.396, 7.969, -3.077 ], "form": ".", "ssZp": 1.985, "Dp": 2.212, "splay_angle": 31.267, "splay_distance": 5.269, "splay_ratio": 0.270, "d22": 3.939, "d64": 3.951, "eta": 160.774, "theta": -118.354, "eta_prime": -170.282, "theta_prime": -149.056, "eta_base": -111.327, "theta_base": -86.653, "v0": -28.171, "v1": 39.867, "v2": -35.797, "v3": 20.551, "v4": 4.467, "amplitude": 39.578, "phase_angle": 154.753, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.123, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 132.937, 84.801, 159.547 ], "x_axis": [ -0.390, -0.697, -0.602 ], "y_axis": [ 0.855, -0.030, -0.518 ], "z_axis": [ 0.343, -0.717, 0.607 ], "quaternion": [ 0.545, 0.091, 0.434, -0.712 ] } }, { "index": 51, "index_chain": 26, "chain_name": "D", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/26", "linked_nts": [ "///D/25", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -100.778, "beta": 95.968, "gamma": 150.407, "delta": 150.150, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -141.380, "glyco_bond": "anti", "C5prime_xyz": [ -1.457, 8.677, 0.088 ], "P_xyz": [ -0.273, 9.483, -2.112 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -15.935, "v1": 33.547, "v2": -37.448, "v3": 29.228, "v4": -8.611, "amplitude": 37.638, "phase_angle": 174.231, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 135.189, 80.258, 158.113 ], "x_axis": [ 0.455, -0.455, -0.766 ], "y_axis": [ 0.854, 0.467, 0.231 ], "z_axis": [ 0.252, -0.759, 0.601 ], "quaternion": [ 0.794, 0.311, 0.320, -0.412 ] } } ], "num_hbonds": 667, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 351, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/2/N", "atom2_id": "///A/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 4, "atom2_serNum": 575, "donAcc_type": "standard", "distance": 3.966, "atom1_id": "///A/2/O", "atom2_id": "///A/74/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 11, "atom2_serNum": 543, "donAcc_type": "standard", "distance": 3.997, "atom1_id": "///A/3/O", "atom2_id": "///A/70/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 11, "atom2_serNum": 575, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/3/O", "atom2_id": "///A/74/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 37, "atom2_serNum": 71, "donAcc_type": "acceptable", "distance": 3.801, "atom1_id": "///A/5/OH", "atom2_id": "///A/10/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 41, "atom2_serNum": 66, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 41, "atom2_serNum": 359, "donAcc_type": "acceptable", "distance": 3.470, "atom1_id": "///A/6/O", "atom2_id": "///A/45/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 47, "atom2_serNum": 73, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 55, "atom2_serNum": 84, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 69, "atom2_serNum": 92, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/10/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 103, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/14/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 108, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///A/15/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 108, "atom2_serNum": 161, "donAcc_type": "standard", "distance": 3.692, "atom1_id": "///A/15/O", "atom2_id": "///A/21/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 142, "atom2_serNum": 296, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/19/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 153, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/21/N", "atom2_id": "///A/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 156, "atom2_serNum": 279, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/21/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 168, "atom2_serNum": 178, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/22/OD1", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 170, "atom2_serNum": 262, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/23/N", "atom2_id": "///A/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 244, "atom2_serNum": 6161, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/31/NH1", "atom2_id": "///D/17/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 20, "atom1_serNum": 245, "atom2_serNum": 2829, "donAcc_type": "questionable", "distance": 3.024, "atom1_id": "///A/31/NH2", "atom2_id": "///C/9/N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 21, "atom1_serNum": 245, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/31/NH2", "atom2_id": "///D/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 22, "atom1_serNum": 249, "atom2_serNum": 259, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/32/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 287, "atom2_serNum": 6172, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/36/NE2", "atom2_id": "///D/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 24, "atom1_serNum": 288, "atom2_serNum": 6149, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/37/N", "atom2_id": "///D/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 25, "atom1_serNum": 299, "atom2_serNum": 327, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 301, "atom2_serNum": 6156, "donAcc_type": "standard", "distance": 3.641, "atom1_id": "///A/39/N", "atom2_id": "///D/17/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 27, "atom1_serNum": 304, "atom2_serNum": 335, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 308, "atom2_serNum": 318, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/39/OE1", "atom2_id": "///A/40/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 309, "atom2_serNum": 752, "donAcc_type": "questionable", "distance": 3.118, "atom1_id": "///A/39/NE2", "atom2_id": "///A/96/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 309, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/39/NE2", "atom2_id": "///A/100/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 310, "atom2_serNum": 6171, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///A/40/N", "atom2_id": "///D/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 32, "atom1_serNum": 313, "atom2_serNum": 343, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 313, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/40/O", "atom2_id": "///A/216/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 317, "atom2_serNum": 1680, "donAcc_type": "standard", "distance": 2.476, "atom1_id": "///A/40/OE1", "atom2_id": "///A/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 317, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/40/OE1", "atom2_id": "///A/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 322, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 330, "atom2_serNum": 360, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 365, "atom2_serNum": 575, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///A/46/OG1", "atom2_id": "///A/74/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 370, "atom2_serNum": 1656, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/47/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 401, "atom2_serNum": 417, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/51/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 401, "atom2_serNum": 428, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 413, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/53/N", "atom2_id": "///A/60/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 416, "atom2_serNum": 1037, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///A/53/O", "atom2_id": "///A/132/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 428, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/55/N", "atom2_id": "///A/60/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 431, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/55/O", "atom2_id": "///A/60/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 436, "atom2_serNum": 448, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/56/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 436, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 442, "atom2_serNum": 464, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 459, "atom2_serNum": 2496, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///A/60/O", "atom2_id": "///A/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 459, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/60/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 459, "atom2_serNum": 2503, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/60/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 471, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 3.886, "atom1_id": "///A/62/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 479, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/63/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 479, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 482, "atom2_serNum": 2487, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///A/63/OD1", "atom2_id": "///A/317/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 483, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///A/63/OD2", "atom2_id": "///A/65/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 484, "atom2_serNum": 2487, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/64/N", "atom2_id": "///A/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 487, "atom2_serNum": 522, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 518, "atom2_serNum": 530, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/67/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 533, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 537, "atom2_serNum": 568, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 548, "atom2_serNum": 576, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 555, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 562, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 562, "atom2_serNum": 593, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/73/O", "atom2_id": "///A/77/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 571, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 579, "atom2_serNum": 604, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 584, "atom2_serNum": 608, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 584, "atom2_serNum": 613, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///A/76/O", "atom2_id": "///A/80/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 591, "atom2_serNum": 615, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 598, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 602, "atom2_serNum": 604, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/78/OE1", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 607, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 618, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/81/O", "atom2_id": "///A/84/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 639, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/83/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 639, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 695, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/88/NH2", "atom2_id": "///A/90/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 699, "atom2_serNum": 738, "donAcc_type": "standard", "distance": 3.884, "atom1_id": "///A/89/O", "atom2_id": "///A/94/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 706, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/90/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 706, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 714, "atom2_serNum": 716, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///A/91/O", "atom2_id": "///A/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 714, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 720, "atom2_serNum": 6125, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///A/92/O", "atom2_id": "///D/15/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 84, "atom1_serNum": 723, "atom2_serNum": 6103, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///A/92/OD1", "atom2_id": "///D/14/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 85, "atom1_serNum": 724, "atom2_serNum": 6112, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/92/ND2", "atom2_id": "///D/15/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 86, "atom1_serNum": 728, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 733, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 742, "atom2_serNum": 765, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 747, "atom2_serNum": 769, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 752, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.473, "atom1_id": "///A/96/NZ", "atom2_id": "///A/100/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 756, "atom2_serNum": 777, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 763, "atom2_serNum": 785, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 768, "atom2_serNum": 796, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 772, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 776, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/100/OD2", "atom2_id": "///A/152/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 780, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 788, "atom2_serNum": 820, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 788, "atom2_serNum": 825, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///A/102/O", "atom2_id": "///A/106/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 799, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 799, "atom2_serNum": 831, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///A/103/O", "atom2_id": "///A/107/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 803, "atom2_serNum": 1167, "donAcc_type": "questionable", "distance": 3.068, "atom1_id": "///A/103/OE1", "atom2_id": "///A/149/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 804, "atom2_serNum": 831, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///A/103/OE2", "atom2_id": "///A/107/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 808, "atom2_serNum": 832, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 816, "atom2_serNum": 837, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 823, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 829, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 835, "atom2_serNum": 866, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 840, "atom2_serNum": 874, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 847, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 855, "atom2_serNum": 885, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 869, "atom2_serNum": 890, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 872, "atom2_serNum": 1639, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/112/OD1", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 873, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///A/112/ND2", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 877, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 883, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 888, "atom2_serNum": 923, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 893, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 897, "atom2_serNum": 1638, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/116/NE", "atom2_id": "///A/207/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 899, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///A/116/NH1", "atom2_id": "///A/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 900, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/116/NH2", "atom2_id": "///A/207/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 900, "atom2_serNum": 1638, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/116/NH2", "atom2_id": "///A/207/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 904, "atom2_serNum": 937, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 909, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/117/NE1", "atom2_id": "///A/143/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 918, "atom2_serNum": 945, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 921, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/118/OD1", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 922, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/118/ND2", "atom2_id": "///A/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 922, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/118/ND2", "atom2_id": "///A/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 926, "atom2_serNum": 952, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 926, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/119/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 956, "atom2_serNum": 963, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///A/124/N", "atom2_id": "///A/124/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 964, "atom2_serNum": 1620, "donAcc_type": "standard", "distance": 3.696, "atom1_id": "///A/124/OE2", "atom2_id": "///A/205/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 976, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/126/NE1", "atom2_id": "///A/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 992, "atom2_serNum": 1613, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/127/NH2", "atom2_id": "///A/205/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1011, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/130/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1041, "atom2_serNum": 1043, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/133/O", "atom2_id": "///A/133/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1065, "atom2_serNum": 1067, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///A/136/O", "atom2_id": "///A/136/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1080, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/138/O", "atom2_id": "///A/143/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1093, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/140/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1099, "atom2_serNum": 1132, "donAcc_type": "questionable", "distance": 2.960, "atom1_id": "///A/141/O", "atom2_id": "///A/144/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1106, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///A/142/O", "atom2_id": "///A/199/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1123, "atom2_serNum": 2628, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/143/NH1", "atom2_id": "///A/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1123, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 2.359, "atom1_id": "///A/143/NH1", "atom2_id": "///A/337/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1128, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/144/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1141, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/146/N", "atom2_id": "///A/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1144, "atom2_serNum": 1496, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/146/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1153, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/148/N", "atom2_id": "///A/190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1156, "atom2_serNum": 1484, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/148/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1167, "atom2_serNum": 1471, "donAcc_type": "questionable", "distance": 3.229, "atom1_id": "///A/149/OD1", "atom2_id": "///A/188/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1180, "atom2_serNum": 1459, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///A/151/O", "atom2_id": "///A/186/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1187, "atom2_serNum": 2854, "donAcc_type": "questionable", "distance": 3.249, "atom1_id": "///A/152/O", "atom2_id": "///C/11/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 151, "atom1_serNum": 1193, "atom2_serNum": 2859, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/152/NH1", "atom2_id": "///C/11/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 152, "atom1_serNum": 1198, "atom2_serNum": 1200, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///A/153/O", "atom2_id": "///A/153/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1219, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///A/155/OD2", "atom2_id": "///A/172/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1237, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/157/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1244, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/158/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1250, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/159/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1250, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/159/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1250, "atom2_serNum": 1809, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/159/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1263, "atom2_serNum": 1812, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/161/N", "atom2_id": "///A/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1266, "atom2_serNum": 1286, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/161/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1266, "atom2_serNum": 1292, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1273, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1289, "atom2_serNum": 1291, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///A/164/O", "atom2_id": "///A/164/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1295, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1304, "atom2_serNum": 1334, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1313, "atom2_serNum": 1343, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1320, "atom2_serNum": 1354, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1328, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1337, "atom2_serNum": 1370, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1346, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1357, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1368, "atom2_serNum": 1393, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1377, "atom2_serNum": 1402, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/175/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1377, "atom2_serNum": 1414, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///A/175/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1385, "atom2_serNum": 1410, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/176/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1392, "atom2_serNum": 5487, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/176/NH2", "atom2_id": "///B/292/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1422, "atom2_serNum": 5483, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/181/N", "atom2_id": "///B/292/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1425, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/181/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1437, "atom2_serNum": 2016, "donAcc_type": "acceptable", "distance": 3.800, "atom1_id": "///A/183/O", "atom2_id": "///A/255/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1453, "atom2_serNum": 1989, "donAcc_type": "acceptable", "distance": 3.698, "atom1_id": "///A/185/OG", "atom2_id": "///A/252/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1453, "atom2_serNum": 2855, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///A/185/OG", "atom2_id": "///C/11/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 182, "atom1_serNum": 1453, "atom2_serNum": 2856, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///A/185/OG", "atom2_id": "///C/11/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 183, "atom1_serNum": 1454, "atom2_serNum": 2854, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///A/186/N", "atom2_id": "///C/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 184, "atom1_serNum": 1475, "atom2_serNum": 1887, "donAcc_type": "questionable", "distance": 3.354, "atom1_id": "///A/188/OD2", "atom2_id": "///A/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1475, "atom2_serNum": 2875, "donAcc_type": "questionable", "distance": 2.813, "atom1_id": "///A/188/OD2", "atom2_id": "///C/12/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 186, "atom1_serNum": 1476, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/189/N", "atom2_id": "///A/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1479, "atom2_serNum": 1872, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/189/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1489, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/191/N", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1492, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/191/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1492, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/191/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1503, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/193/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1513, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/194/O", "atom2_id": "///A/199/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1521, "atom2_serNum": 1543, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/195/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1521, "atom2_serNum": 1554, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1542, "atom2_serNum": 1807, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/197/OE2", "atom2_id": "///A/229/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1546, "atom2_serNum": 1571, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/198/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1582, "atom2_serNum": 1610, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///A/202/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1655, "atom2_serNum": 1696, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/210/O", "atom2_id": "///A/215/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1659, "atom2_serNum": 1705, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///A/211/O", "atom2_id": "///A/216/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1667, "atom2_serNum": 1697, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/212/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1669, "atom2_serNum": 1696, "donAcc_type": "acceptable", "distance": 2.494, "atom1_id": "///A/212/OG1", "atom2_id": "///A/215/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1674, "atom2_serNum": 1678, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/213/O", "atom2_id": "///A/213/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1674, "atom2_serNum": 1706, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1685, "atom2_serNum": 1714, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1692, "atom2_serNum": 1722, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1700, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1700, "atom2_serNum": 1735, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///A/216/O", "atom2_id": "///A/220/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1709, "atom2_serNum": 1736, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1725, "atom2_serNum": 1740, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/219/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1739, "atom2_serNum": 1764, "donAcc_type": "questionable", "distance": 3.331, "atom1_id": "///A/221/O", "atom2_id": "///A/224/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1748, "atom2_serNum": 1777, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/223/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1760, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1769, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/225/O", "atom2_id": "///A/229/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1780, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/226/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1816, "atom2_serNum": 1843, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/231/N", "atom2_id": "///A/234/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1819, "atom2_serNum": 1836, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1839, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/234/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1856, "atom2_serNum": 2623, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/236/O", "atom2_id": "///A/333/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1858, "atom2_serNum": 2623, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///A/236/OG", "atom2_id": "///A/333/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1870, "atom2_serNum": 2152, "donAcc_type": "questionable", "distance": 3.359, "atom1_id": "///A/238/O", "atom2_id": "///A/274/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1870, "atom2_serNum": 2169, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/238/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1879, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/240/N", "atom2_id": "///A/276/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1882, "atom2_serNum": 2185, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/240/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1895, "atom2_serNum": 2188, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/242/N", "atom2_id": "///A/278/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1898, "atom2_serNum": 2188, "donAcc_type": "questionable", "distance": 2.900, "atom1_id": "///A/242/O", "atom2_id": "///A/278/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1900, "atom2_serNum": 2894, "donAcc_type": "standard", "distance": 2.354, "atom1_id": "///A/243/N", "atom2_id": "///C/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 227, "atom1_serNum": 1903, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/243/O", "atom2_id": "///A/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1909, "atom2_serNum": 2914, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/243/NH1", "atom2_id": "///C/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 229, "atom1_serNum": 1911, "atom2_serNum": 2200, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///A/244/N", "atom2_id": "///A/279/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1914, "atom2_serNum": 1916, "donAcc_type": "acceptable", "distance": 2.327, "atom1_id": "///A/244/O", "atom2_id": "///A/244/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1914, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.353, "atom1_id": "///A/244/O", "atom2_id": "///A/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1916, "atom2_serNum": 2914, "donAcc_type": "acceptable", "distance": 2.237, "atom1_id": "///A/244/OG", "atom2_id": "///C/14/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 233, "atom1_serNum": 1932, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/246/NE", "atom2_id": "///C/15/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 234, "atom1_serNum": 1935, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/246/NH2", "atom2_id": "///C/15/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 235, "atom1_serNum": 1936, "atom2_serNum": 6038, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///A/247/N", "atom2_id": "///D/11/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 236, "atom1_serNum": 1941, "atom2_serNum": 6008, "donAcc_type": "acceptable", "distance": 2.260, "atom1_id": "///A/247/OG", "atom2_id": "///D/10/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 237, "atom1_serNum": 1949, "atom2_serNum": 6081, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///A/248/OD2", "atom2_id": "///D/13/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 238, "atom1_serNum": 1953, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/249/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1957, "atom2_serNum": 2928, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/249/NE", "atom2_id": "///C/14/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 240, "atom1_serNum": 1959, "atom2_serNum": 2895, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/249/NH1", "atom2_id": "///C/13/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 241, "atom1_serNum": 1964, "atom2_serNum": 1997, "donAcc_type": "standard", "distance": 3.680, "atom1_id": "///A/250/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1964, "atom2_serNum": 2291, "donAcc_type": "acceptable", "distance": 3.049, "atom1_id": "///A/250/O", "atom2_id": "///A/291/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1972, "atom2_serNum": 2005, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///A/251/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1984, "atom2_serNum": 2017, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/252/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1988, "atom2_serNum": 5137, "donAcc_type": "questionable", "distance": 3.218, "atom1_id": "///A/252/OE1", "atom2_id": "///B/248/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1989, "atom2_serNum": 2025, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/252/NE2", "atom2_id": "///A/256/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1989, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/252/NE2", "atom2_id": "///C/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 248, "atom1_serNum": 1993, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/253/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2000, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/254/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2000, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///A/254/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2008, "atom2_serNum": 2039, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/255/O", "atom2_id": "///A/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2029, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/257/O", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2038, "atom2_serNum": 5204, "donAcc_type": "acceptable", "distance": 3.932, "atom1_id": "///A/258/ND2", "atom2_id": "///B/255/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2042, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/259/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2049, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/260/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2049, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2057, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/261/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2057, "atom2_serNum": 2087, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/261/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2057, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/261/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2061, "atom2_serNum": 2316, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///A/261/OE1", "atom2_id": "///A/295/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2061, "atom2_serNum": 2405, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/261/OE1", "atom2_id": "///A/307/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2062, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 3.755, "atom1_id": "///A/261/NE2", "atom2_id": "///A/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2062, "atom2_serNum": 2420, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/261/NE2", "atom2_id": "///A/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2082, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/264/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2090, "atom2_serNum": 2117, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2161, "atom2_serNum": 2430, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/275/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2176, "atom2_serNum": 2440, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///A/276/OE1", "atom2_id": "///A/311/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2176, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/276/OE1", "atom2_id": "///A/325/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2176, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/276/OE1", "atom2_id": "///A/325/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2177, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 2.296, "atom1_id": "///A/276/OE2", "atom2_id": "///A/278/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2177, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/276/OE2", "atom2_id": "///A/325/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2178, "atom2_serNum": 2444, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/277/N", "atom2_id": "///A/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2181, "atom2_serNum": 2458, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/277/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2195, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/279/N", "atom2_id": "///A/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2231, "atom2_serNum": 5989, "donAcc_type": "standard", "distance": 3.885, "atom1_id": "///A/284/N", "atom2_id": "///D/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 276, "atom1_serNum": 2240, "atom2_serNum": 2250, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///A/285/OG1", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2242, "atom2_serNum": 6008, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/286/N", "atom2_id": "///D/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 278, "atom1_serNum": 2245, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/286/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2245, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/286/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2269, "atom2_serNum": 2292, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///A/289/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2295, "atom2_serNum": 4610, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/292/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2304, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/293/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2306, "atom2_serNum": 4613, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/294/N", "atom2_id": "///B/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2316, "atom2_serNum": 2399, "donAcc_type": "acceptable", "distance": 3.259, "atom1_id": "///A/295/OG", "atom2_id": "///A/307/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2320, "atom2_serNum": 2337, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/296/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2328, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/297/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2328, "atom2_serNum": 2344, "donAcc_type": "questionable", "distance": 2.918, "atom1_id": "///A/297/O", "atom2_id": "///A/299/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2449, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///A/312/OE2", "atom2_id": "///A/325/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2469, "atom2_serNum": 2514, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///A/314/OH", "atom2_id": "///A/321/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2473, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/315/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2496, "atom2_serNum": 2503, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///A/318/OG1", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2496, "atom2_serNum": 2508, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///A/318/OG1", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2501, "atom2_serNum": 2524, "donAcc_type": "standard", "distance": 3.775, "atom1_id": "///A/319/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2506, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/320/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2511, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2519, "atom2_serNum": 2551, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2527, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/323/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2532, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2543, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2554, "atom2_serNum": 2589, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2565, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2576, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2581, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2592, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2617, "atom2_serNum": 2621, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/333/O", "atom2_id": "///A/333/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2664, "atom2_serNum": 2666, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/338/OD1", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2687, "atom2_serNum": 6332, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/2/O6", "atom2_id": "///D/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 2688, "atom2_serNum": 6330, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/2/N1", "atom2_id": "///D/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 2688, "atom2_serNum": 6348, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/2/N1", "atom2_id": "///D/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 2690, "atom2_serNum": 6329, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///C/2/N2", "atom2_id": "///D/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 2709, "atom2_serNum": 6313, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/3/O6", "atom2_id": "///D/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 2710, "atom2_serNum": 6311, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/3/N1", "atom2_id": "///D/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 313, "atom1_serNum": 2712, "atom2_serNum": 6310, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/3/N2", "atom2_id": "///D/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 314, "atom1_serNum": 2729, "atom2_serNum": 6293, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///C/4/N3", "atom2_id": "///D/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 2731, "atom2_serNum": 6292, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/4/O4", "atom2_id": "///D/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 2748, "atom2_serNum": 6273, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/5/O2", "atom2_id": "///D/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 2749, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/5/N3", "atom2_id": "///D/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 2751, "atom2_serNum": 6270, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/5/N4", "atom2_id": "///D/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 2768, "atom2_serNum": 6250, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/6/N3", "atom2_id": "///D/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 2770, "atom2_serNum": 6249, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/6/O4", "atom2_id": "///D/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 2788, "atom2_serNum": 6229, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/7/N3", "atom2_id": "///D/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 2790, "atom2_serNum": 6228, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/7/O4", "atom2_id": "///D/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 2807, "atom2_serNum": 6209, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/8/O2", "atom2_id": "///D/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 2808, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/8/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 2810, "atom2_serNum": 6206, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/8/N4", "atom2_id": "///D/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 2815, "atom2_serNum": 5419, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///C/9/OP2", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 327, "atom1_serNum": 2829, "atom2_serNum": 6186, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///C/9/N6", "atom2_id": "///D/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 2830, "atom2_serNum": 6184, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///C/9/N1", "atom2_id": "///D/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 2836, "atom2_serNum": 5129, "donAcc_type": "acceptable", "distance": 2.330, "atom1_id": "///C/10/OP2", "atom2_id": "///B/247/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 330, "atom1_serNum": 2847, "atom2_serNum": 6167, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/10/O2", "atom2_id": "///D/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 331, "atom1_serNum": 2848, "atom2_serNum": 6165, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///C/10/N3", "atom2_id": "///D/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 2850, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/10/N4", "atom2_id": "///D/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 2866, "atom2_serNum": 5124, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///C/11/N7", "atom2_id": "///B/247/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 334, "atom1_serNum": 2869, "atom2_serNum": 6144, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/11/N6", "atom2_id": "///D/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 2870, "atom2_serNum": 6142, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/11/N1", "atom2_id": "///D/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 2887, "atom2_serNum": 6125, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/12/O2", "atom2_id": "///D/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 2888, "atom2_serNum": 6123, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/12/N3", "atom2_id": "///D/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 338, "atom1_serNum": 2890, "atom2_serNum": 6122, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/12/N4", "atom2_id": "///D/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 339, "atom1_serNum": 2906, "atom2_serNum": 6103, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///C/13/O2", "atom2_id": "///D/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 2907, "atom2_serNum": 6101, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/13/N3", "atom2_id": "///D/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 2909, "atom2_serNum": 5137, "donAcc_type": "standard", "distance": 3.954, "atom1_id": "///C/13/N4", "atom2_id": "///B/248/OD2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 342, "atom1_serNum": 2909, "atom2_serNum": 6100, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/13/N4", "atom2_id": "///D/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 2928, "atom2_serNum": 6081, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/14/O6", "atom2_id": "///D/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 344, "atom1_serNum": 2929, "atom2_serNum": 6079, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/14/N1", "atom2_id": "///D/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 2931, "atom2_serNum": 3911, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///C/14/N2", "atom2_id": "///B/92/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 346, "atom1_serNum": 2931, "atom2_serNum": 6078, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/14/N2", "atom2_id": "///D/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 2940, "atom2_serNum": 3912, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///C/15/O4'", "atom2_id": "///B/92/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 348, "atom1_serNum": 2950, "atom2_serNum": 6062, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/15/O6", "atom2_id": "///D/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 349, "atom1_serNum": 2951, "atom2_serNum": 6060, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/15/N1", "atom2_id": "///D/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 350, "atom1_serNum": 2953, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.506, "atom1_id": "///C/15/N2", "atom2_id": "///B/92/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 351, "atom1_serNum": 2953, "atom2_serNum": 6059, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///C/15/N2", "atom2_id": "///D/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 2970, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/16/N3", "atom2_id": "///D/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 2972, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/16/O4", "atom2_id": "///D/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 354, "atom1_serNum": 2977, "atom2_serNum": 3476, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/17/OP1", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 355, "atom1_serNum": 2984, "atom2_serNum": 3489, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///C/17/O3'", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 356, "atom1_serNum": 2989, "atom2_serNum": 3432, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/17/N7", "atom2_id": "///B/31/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 357, "atom1_serNum": 2992, "atom2_serNum": 3433, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/17/O6", "atom2_id": "///B/31/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 358, "atom1_serNum": 2992, "atom2_serNum": 6022, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/17/O6", "atom2_id": "///D/10/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 2993, "atom2_serNum": 6020, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/17/N1", "atom2_id": "///D/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 2995, "atom2_serNum": 4382, "donAcc_type": "questionable", "distance": 2.999, "atom1_id": "///C/17/N2", "atom2_id": "///B/152/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 361, "atom1_serNum": 2995, "atom2_serNum": 6019, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/17/N2", "atom2_id": "///D/10/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 2999, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///C/18/OP1", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 363, "atom1_serNum": 3000, "atom2_serNum": 3475, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/18/OP2", "atom2_id": "///B/36/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 364, "atom1_serNum": 3014, "atom2_serNum": 6003, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/18/O6", "atom2_id": "///D/9/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 3015, "atom2_serNum": 6001, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/18/N1", "atom2_id": "///D/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 3017, "atom2_serNum": 6000, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/18/N2", "atom2_id": "///D/9/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 3037, "atom2_serNum": 5981, "donAcc_type": "standard", "distance": 3.777, "atom1_id": "///C/19/N1", "atom2_id": "///D/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 3055, "atom2_serNum": 5963, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/20/N3", "atom2_id": "///D/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 3057, "atom2_serNum": 5962, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/20/O4", "atom2_id": "///D/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 370, "atom1_serNum": 3096, "atom2_serNum": 5924, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/22/O2", "atom2_id": "///D/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 3097, "atom2_serNum": 5922, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/22/N3", "atom2_id": "///D/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 372, "atom1_serNum": 3099, "atom2_serNum": 5921, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/22/N4", "atom2_id": "///D/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 373, "atom1_serNum": 3121, "atom2_serNum": 5899, "donAcc_type": "standard", "distance": 3.740, "atom1_id": "///C/23/N2", "atom2_id": "///D/4/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 374, "atom1_serNum": 3138, "atom2_serNum": 5882, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/24/N3", "atom2_id": "///D/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 375, "atom1_serNum": 3140, "atom2_serNum": 5881, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///C/24/O4", "atom2_id": "///D/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 376, "atom1_serNum": 3160, "atom2_serNum": 5862, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/25/O6", "atom2_id": "///D/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 3161, "atom2_serNum": 5860, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///C/25/N1", "atom2_id": "///D/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 3163, "atom2_serNum": 5859, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///C/25/N2", "atom2_id": "///D/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 379, "atom1_serNum": 3163, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/25/N2", "atom2_id": "///D/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 380, "atom1_serNum": 3183, "atom2_serNum": 5833, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///C/26/N1", "atom2_id": "///D/1/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 381, "atom1_serNum": 3185, "atom2_serNum": 5859, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///C/26/N2", "atom2_id": "///D/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 382, "atom1_serNum": 3189, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/2/N", "atom2_id": "///B/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3199, "atom2_serNum": 3731, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///B/3/O", "atom2_id": "///B/70/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3199, "atom2_serNum": 3762, "donAcc_type": "questionable", "distance": 3.101, "atom1_id": "///B/3/O", "atom2_id": "///B/74/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3225, "atom2_serNum": 3259, "donAcc_type": "acceptable", "distance": 3.784, "atom1_id": "///B/5/OH", "atom2_id": "///B/10/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3229, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///B/6/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3229, "atom2_serNum": 3547, "donAcc_type": "acceptable", "distance": 3.417, "atom1_id": "///B/6/O", "atom2_id": "///B/45/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3235, "atom2_serNum": 3261, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3243, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3252, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/9/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3257, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/10/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3291, "atom2_serNum": 3307, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/14/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3296, "atom2_serNum": 3349, "donAcc_type": "standard", "distance": 3.970, "atom1_id": "///B/15/O", "atom2_id": "///B/21/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3330, "atom2_serNum": 3484, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/19/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3333, "atom2_serNum": 3790, "donAcc_type": "standard", "distance": 3.994, "atom1_id": "///B/20/N", "atom2_id": "///B/78/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3341, "atom2_serNum": 3470, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/21/N", "atom2_id": "///B/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3344, "atom2_serNum": 3467, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/21/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3357, "atom2_serNum": 3366, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/22/OD2", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3358, "atom2_serNum": 3450, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/23/N", "atom2_id": "///B/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3411, "atom2_serNum": 5948, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///B/29/NE", "atom2_id": "///D/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 401, "atom1_serNum": 3433, "atom2_serNum": 6003, "donAcc_type": "questionable", "distance": 3.180, "atom1_id": "///B/31/NH2", "atom2_id": "///D/9/N4", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 402, "atom1_serNum": 3437, "atom2_serNum": 3447, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/32/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3487, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/38/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3487, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3492, "atom2_serNum": 3523, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3496, "atom2_serNum": 3940, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/39/OE1", "atom2_id": "///B/96/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3501, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3501, "atom2_serNum": 4893, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/40/O", "atom2_id": "///B/216/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3505, "atom2_serNum": 4868, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/40/OE1", "atom2_id": "///B/213/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3505, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.414, "atom1_id": "///B/40/OE1", "atom2_id": "///B/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3510, "atom2_serNum": 3536, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3518, "atom2_serNum": 3548, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3553, "atom2_serNum": 3762, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///B/46/OG1", "atom2_id": "///B/74/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3558, "atom2_serNum": 4844, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/47/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3589, "atom2_serNum": 3605, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/51/O", "atom2_id": "///B/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3589, "atom2_serNum": 3616, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///B/51/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3601, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/53/N", "atom2_id": "///B/60/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3604, "atom2_serNum": 4225, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///B/53/O", "atom2_id": "///B/132/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3616, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/55/N", "atom2_id": "///B/60/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3619, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/55/O", "atom2_id": "///B/60/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3624, "atom2_serNum": 3636, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/56/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3624, "atom2_serNum": 3644, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3630, "atom2_serNum": 3652, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3647, "atom2_serNum": 5655, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///B/60/O", "atom2_id": "///B/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3647, "atom2_serNum": 5657, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/60/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3647, "atom2_serNum": 5662, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/60/O", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3659, "atom2_serNum": 5657, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///B/62/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3667, "atom2_serNum": 3695, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/63/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3667, "atom2_serNum": 3703, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3670, "atom2_serNum": 5646, "donAcc_type": "questionable", "distance": 3.166, "atom1_id": "///B/63/OD1", "atom2_id": "///B/317/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3671, "atom2_serNum": 3694, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///B/63/OD2", "atom2_id": "///B/65/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3672, "atom2_serNum": 5646, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/64/N", "atom2_id": "///B/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3675, "atom2_serNum": 3710, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3706, "atom2_serNum": 3718, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/67/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3721, "atom2_serNum": 3747, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3725, "atom2_serNum": 3756, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3736, "atom2_serNum": 3764, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3743, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3750, "atom2_serNum": 3776, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3750, "atom2_serNum": 3781, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///B/73/O", "atom2_id": "///B/77/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3759, "atom2_serNum": 3783, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3767, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3772, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3772, "atom2_serNum": 3801, "donAcc_type": "acceptable", "distance": 2.935, "atom1_id": "///B/76/O", "atom2_id": "///B/80/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3779, "atom2_serNum": 3803, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3786, "atom2_serNum": 3813, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3795, "atom2_serNum": 3824, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3806, "atom2_serNum": 3845, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/81/O", "atom2_id": "///B/84/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3827, "atom2_serNum": 3854, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///B/83/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3827, "atom2_serNum": 3862, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3883, "atom2_serNum": 3898, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///B/88/NH2", "atom2_id": "///B/90/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3887, "atom2_serNum": 3926, "donAcc_type": "standard", "distance": 3.774, "atom1_id": "///B/89/O", "atom2_id": "///B/94/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3894, "atom2_serNum": 3913, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/90/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3894, "atom2_serNum": 3918, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3897, "atom2_serNum": 3899, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/90/OD1", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3902, "atom2_serNum": 3904, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///B/91/O", "atom2_id": "///B/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3902, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3916, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3921, "atom2_serNum": 3948, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3930, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3935, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3940, "atom2_serNum": 3964, "donAcc_type": "standard", "distance": 2.377, "atom1_id": "///B/96/NZ", "atom2_id": "///B/100/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3940, "atom2_serNum": 4382, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///B/96/NZ", "atom2_id": "///B/152/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3944, "atom2_serNum": 3965, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3951, "atom2_serNum": 3973, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/98/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3956, "atom2_serNum": 3984, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/99/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3960, "atom2_serNum": 3993, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/100/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3963, "atom2_serNum": 4381, "donAcc_type": "standard", "distance": 3.946, "atom1_id": "///B/100/OD1", "atom2_id": "///B/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3964, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///B/100/OD2", "atom2_id": "///B/152/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3968, "atom2_serNum": 4001, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/101/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3976, "atom2_serNum": 4008, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/102/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3987, "atom2_serNum": 4014, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/103/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3987, "atom2_serNum": 4019, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///B/103/O", "atom2_id": "///B/107/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3992, "atom2_serNum": 6047, "donAcc_type": "questionable", "distance": 3.263, "atom1_id": "///B/103/OE2", "atom2_id": "///D/12/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 475, "atom1_serNum": 3996, "atom2_serNum": 4020, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/104/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4004, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/105/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4011, "atom2_serNum": 4032, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/106/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4017, "atom2_serNum": 4040, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/107/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4023, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/108/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4028, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/109/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4035, "atom2_serNum": 4068, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/110/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4043, "atom2_serNum": 4073, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/111/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4057, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/112/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4060, "atom2_serNum": 4827, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/112/OD1", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4061, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 3.716, "atom1_id": "///B/112/ND2", "atom2_id": "///B/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4065, "atom2_serNum": 4089, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/113/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4071, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/114/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4076, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/115/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4081, "atom2_serNum": 4117, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/116/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4085, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///B/116/NE", "atom2_id": "///B/207/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4087, "atom2_serNum": 4199, "donAcc_type": "standard", "distance": 3.872, "atom1_id": "///B/116/NH1", "atom2_id": "///B/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4088, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/116/NH2", "atom2_id": "///B/207/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4088, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/116/NH2", "atom2_id": "///B/207/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4092, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/117/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4097, "atom2_serNum": 4305, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///B/117/NE1", "atom2_id": "///B/143/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4106, "atom2_serNum": 4133, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/118/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4109, "atom2_serNum": 4322, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/118/OD1", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4110, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/118/ND2", "atom2_id": "///B/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4110, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/118/ND2", "atom2_id": "///B/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4114, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///B/119/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4114, "atom2_serNum": 4144, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/119/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4128, "atom2_serNum": 4278, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/121/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4152, "atom2_serNum": 4808, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/124/OE2", "atom2_id": "///B/205/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4180, "atom2_serNum": 4801, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///B/127/NH2", "atom2_id": "///B/205/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4184, "atom2_serNum": 4186, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///B/128/O", "atom2_id": "///B/128/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4199, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/130/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4206, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 3.974, "atom1_id": "///B/131/O", "atom2_id": "///B/324/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4225, "atom2_serNum": 5665, "donAcc_type": "acceptable", "distance": 3.915, "atom1_id": "///B/132/OH", "atom2_id": "///B/320/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4229, "atom2_serNum": 4231, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///B/133/O", "atom2_id": "///B/133/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4253, "atom2_serNum": 4255, "donAcc_type": "acceptable", "distance": 2.434, "atom1_id": "///B/136/O", "atom2_id": "///B/136/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4268, "atom2_serNum": 4311, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/138/O", "atom2_id": "///B/143/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4270, "atom2_serNum": 4311, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///B/138/OG", "atom2_id": "///B/143/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4281, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/140/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4287, "atom2_serNum": 4320, "donAcc_type": "questionable", "distance": 3.006, "atom1_id": "///B/141/O", "atom2_id": "///B/144/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4298, "atom2_serNum": 4721, "donAcc_type": "standard", "distance": 3.869, "atom1_id": "///B/142/NE", "atom2_id": "///B/196/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4309, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/143/NE", "atom2_id": "///B/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4312, "atom2_serNum": 5813, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/143/NH2", "atom2_id": "///B/337/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4316, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/144/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4329, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/146/N", "atom2_id": "///B/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4332, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/146/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4341, "atom2_serNum": 4675, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/148/N", "atom2_id": "///B/190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4344, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/148/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4355, "atom2_serNum": 4659, "donAcc_type": "questionable", "distance": 3.347, "atom1_id": "///B/149/OD1", "atom2_id": "///B/188/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4368, "atom2_serNum": 4647, "donAcc_type": "acceptable", "distance": 3.263, "atom1_id": "///B/151/O", "atom2_id": "///B/186/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4375, "atom2_serNum": 6026, "donAcc_type": "questionable", "distance": 3.303, "atom1_id": "///B/152/O", "atom2_id": "///D/11/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 526, "atom1_serNum": 4379, "atom2_serNum": 6019, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/152/NE", "atom2_id": "///D/10/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 527, "atom1_serNum": 4386, "atom2_serNum": 4388, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///B/153/O", "atom2_id": "///B/153/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4406, "atom2_serNum": 4551, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/155/OD1", "atom2_id": "///B/172/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4406, "atom2_serNum": 4552, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///B/155/OD1", "atom2_id": "///B/172/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4425, "atom2_serNum": 4443, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/157/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4432, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/158/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4438, "atom2_serNum": 4986, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/159/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4438, "atom2_serNum": 4997, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/159/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4451, "atom2_serNum": 5000, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/161/N", "atom2_id": "///B/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4454, "atom2_serNum": 4474, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/161/O", "atom2_id": "///B/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4454, "atom2_serNum": 4480, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/161/O", "atom2_id": "///B/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4483, "atom2_serNum": 4513, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/165/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4492, "atom2_serNum": 4522, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/166/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4501, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/167/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4508, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/168/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4516, "atom2_serNum": 4553, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/169/O", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4525, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/170/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4534, "atom2_serNum": 4562, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/171/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4545, "atom2_serNum": 4570, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/172/O", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4556, "atom2_serNum": 4581, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4565, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/175/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4565, "atom2_serNum": 4602, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///B/175/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4573, "atom2_serNum": 4598, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/176/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4590, "atom2_serNum": 4596, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///B/178/N", "atom2_id": "///B/178/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4625, "atom2_serNum": 5204, "donAcc_type": "acceptable", "distance": 3.924, "atom1_id": "///B/183/O", "atom2_id": "///B/255/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4641, "atom2_serNum": 5177, "donAcc_type": "acceptable", "distance": 3.323, "atom1_id": "///B/185/OG", "atom2_id": "///B/252/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4641, "atom2_serNum": 6027, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///B/185/OG", "atom2_id": "///D/11/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 553, "atom1_serNum": 4641, "atom2_serNum": 6028, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///B/185/OG", "atom2_id": "///D/11/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 554, "atom1_serNum": 4642, "atom2_serNum": 6026, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///B/186/N", "atom2_id": "///D/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 555, "atom1_serNum": 4663, "atom2_serNum": 5075, "donAcc_type": "questionable", "distance": 3.040, "atom1_id": "///B/188/OD2", "atom2_id": "///B/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4663, "atom2_serNum": 6047, "donAcc_type": "questionable", "distance": 2.805, "atom1_id": "///B/188/OD2", "atom2_id": "///D/12/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 557, "atom1_serNum": 4664, "atom2_serNum": 5063, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/189/N", "atom2_id": "///B/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4667, "atom2_serNum": 5060, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/189/O", "atom2_id": "///B/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4677, "atom2_serNum": 5050, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/191/N", "atom2_id": "///B/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4680, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/191/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4680, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/191/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4691, "atom2_serNum": 5027, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/193/N", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4709, "atom2_serNum": 4731, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///B/195/O", "atom2_id": "///B/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4716, "atom2_serNum": 4742, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///B/196/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4722, "atom2_serNum": 4729, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/197/N", "atom2_id": "///B/197/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4770, "atom2_serNum": 4798, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///B/202/O", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4843, "atom2_serNum": 4884, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/210/O", "atom2_id": "///B/215/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4847, "atom2_serNum": 4893, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///B/211/O", "atom2_id": "///B/216/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4855, "atom2_serNum": 4885, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/212/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4857, "atom2_serNum": 4884, "donAcc_type": "acceptable", "distance": 2.413, "atom1_id": "///B/212/OG1", "atom2_id": "///B/215/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4862, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/213/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4873, "atom2_serNum": 4902, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/214/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4880, "atom2_serNum": 4910, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/215/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4888, "atom2_serNum": 4918, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/216/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4888, "atom2_serNum": 4923, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/216/O", "atom2_id": "///B/220/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4897, "atom2_serNum": 4924, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4913, "atom2_serNum": 4928, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/219/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4936, "atom2_serNum": 4973, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/223/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4948, "atom2_serNum": 4973, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/224/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4957, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/225/O", "atom2_id": "///B/229/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4957, "atom2_serNum": 4996, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/225/O", "atom2_id": "///B/229/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4968, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///B/226/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4968, "atom2_serNum": 4986, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/226/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5004, "atom2_serNum": 5032, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/231/N", "atom2_id": "///B/234/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5007, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/231/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5016, "atom2_serNum": 5033, "donAcc_type": "standard", "distance": 3.911, "atom1_id": "///B/232/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5027, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/234/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5044, "atom2_serNum": 5782, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/236/O", "atom2_id": "///B/333/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5046, "atom2_serNum": 5782, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///B/236/OG", "atom2_id": "///B/333/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5055, "atom2_serNum": 5340, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/238/N", "atom2_id": "///B/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5058, "atom2_serNum": 5357, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/238/O", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5067, "atom2_serNum": 5360, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/240/N", "atom2_id": "///B/276/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5070, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/240/O", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5083, "atom2_serNum": 5376, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/242/N", "atom2_id": "///B/278/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5088, "atom2_serNum": 6066, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///B/243/N", "atom2_id": "///D/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 596, "atom1_serNum": 5091, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///B/243/O", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5097, "atom2_serNum": 6086, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/243/NH1", "atom2_id": "///D/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 598, "atom1_serNum": 5099, "atom2_serNum": 5388, "donAcc_type": "acceptable", "distance": 3.267, "atom1_id": "///B/244/N", "atom2_id": "///B/279/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5102, "atom2_serNum": 5104, "donAcc_type": "acceptable", "distance": 2.307, "atom1_id": "///B/244/O", "atom2_id": "///B/244/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5102, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.359, "atom1_id": "///B/244/O", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5104, "atom2_serNum": 6086, "donAcc_type": "acceptable", "distance": 2.240, "atom1_id": "///B/244/OG", "atom2_id": "///D/14/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 602, "atom1_serNum": 5120, "atom2_serNum": 6122, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/246/NE", "atom2_id": "///D/15/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 603, "atom1_serNum": 5123, "atom2_serNum": 6119, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/246/NH2", "atom2_id": "///D/15/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 604, "atom1_serNum": 5129, "atom2_serNum": 5428, "donAcc_type": "acceptable", "distance": 3.257, "atom1_id": "///B/247/OG", "atom2_id": "///B/285/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5133, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///B/248/O", "atom2_id": "///B/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5145, "atom2_serNum": 6100, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/249/NE", "atom2_id": "///D/14/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 607, "atom1_serNum": 5147, "atom2_serNum": 6067, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/249/NH1", "atom2_id": "///D/13/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 608, "atom1_serNum": 5152, "atom2_serNum": 5185, "donAcc_type": "standard", "distance": 3.726, "atom1_id": "///B/250/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5152, "atom2_serNum": 5479, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///B/250/O", "atom2_id": "///B/291/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5160, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///B/251/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5172, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/252/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5177, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/252/NE2", "atom2_id": "///B/256/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5177, "atom2_serNum": 6048, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/252/NE2", "atom2_id": "///D/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 614, "atom1_serNum": 5181, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/253/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5188, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/254/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5188, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///B/254/O", "atom2_id": "///B/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5196, "atom2_serNum": 5227, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/255/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5217, "atom2_serNum": 5242, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/257/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5222, "atom2_serNum": 5251, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///B/258/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5230, "atom2_serNum": 5259, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5237, "atom2_serNum": 5259, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/260/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5237, "atom2_serNum": 5267, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5245, "atom2_serNum": 5267, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/261/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5245, "atom2_serNum": 5275, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///B/261/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5245, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///B/261/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5249, "atom2_serNum": 5504, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///B/261/OE1", "atom2_id": "///B/295/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5249, "atom2_serNum": 5564, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/261/OE1", "atom2_id": "///B/307/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5250, "atom2_serNum": 5568, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///B/261/NE2", "atom2_id": "///B/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5250, "atom2_serNum": 5579, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/261/NE2", "atom2_id": "///B/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5270, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/264/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5283, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///B/265/OE2", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5333, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///B/273/O", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5345, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///B/274/OE2", "atom2_id": "///B/333/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5349, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 2.555, "atom1_id": "///B/275/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5364, "atom2_serNum": 5598, "donAcc_type": "standard", "distance": 2.448, "atom1_id": "///B/276/OE1", "atom2_id": "///B/311/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5364, "atom2_serNum": 5708, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/276/OE1", "atom2_id": "///B/325/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5364, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/276/OE1", "atom2_id": "///B/325/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5365, "atom2_serNum": 5382, "donAcc_type": "standard", "distance": 2.281, "atom1_id": "///B/276/OE2", "atom2_id": "///B/278/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5365, "atom2_serNum": 5708, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/276/OE2", "atom2_id": "///B/325/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5366, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/277/N", "atom2_id": "///B/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5369, "atom2_serNum": 5617, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/277/O", "atom2_id": "///B/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5383, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/279/N", "atom2_id": "///B/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5433, "atom2_serNum": 5454, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/286/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5433, "atom2_serNum": 5461, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/286/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5492, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/293/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5508, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///B/296/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5516, "atom2_serNum": 5529, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/297/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5574, "atom2_serNum": 5592, "donAcc_type": "standard", "distance": 2.375, "atom1_id": "///B/308/NH1", "atom2_id": "///B/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5607, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.336, "atom1_id": "///B/312/OE1", "atom2_id": "///B/325/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5628, "atom2_serNum": 5673, "donAcc_type": "acceptable", "distance": 2.379, "atom1_id": "///B/314/OH", "atom2_id": "///B/321/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5632, "atom2_serNum": 5643, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/315/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5655, "atom2_serNum": 5662, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///B/318/OG1", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5655, "atom2_serNum": 5667, "donAcc_type": "acceptable", "distance": 3.136, "atom1_id": "///B/318/OG1", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5660, "atom2_serNum": 5683, "donAcc_type": "standard", "distance": 3.793, "atom1_id": "///B/319/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5665, "atom2_serNum": 5688, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/320/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5670, "atom2_serNum": 5699, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/321/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5678, "atom2_serNum": 5710, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/322/O", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5686, "atom2_serNum": 5721, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/323/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5691, "atom2_serNum": 5732, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/324/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5702, "atom2_serNum": 5737, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/325/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5713, "atom2_serNum": 5748, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/326/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5724, "atom2_serNum": 5756, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/327/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5735, "atom2_serNum": 5764, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/328/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5740, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/329/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5751, "atom2_serNum": 5784, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5776, "atom2_serNum": 5801, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/333/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5823, "atom2_serNum": 5825, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/338/OD1", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9bgj", "num_aaChains": 2, "aaChains": "A=338,B=334", "num_naChains": 2, "naChains": "C=25,D=26", "num_atoms": 6361, "num_waters": 9, "num_metals": 2, "metals_desc": "Mg=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }