{ "num_pairs": 52, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///A/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.592, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.425, "chi2": -128.914, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.705, "C1C1_dist": 10.591, "N1N9_dist": 8.906, "C6C8_dist": 9.836, "CNNC_torsion": -6.294, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.91]", "interBase_angle": 8.522, "planarity": 0.101, "simple_Shear": -0.340, "simple_Stretch": -0.112, "simple_Buckle": -1.061, "simple_Propeller": -8.456, "bp_simpleParams": [ -0.340, -0.112, -0.037, -1.061, -8.456, -1.259 ], "bp_params": [ -0.336, -0.122, -0.037, -0.808, -8.484, -1.263 ], "frame": { "rmsd": null, "origin": [ 29.918, -5.261, 36.630 ], "x_axis": [ 0.950, -0.310, 0.034 ], "y_axis": [ -0.172, -0.612, -0.772 ], "z_axis": [ 0.260, 0.727, -0.635 ], "quaternion": [ -0.419, 0.894, -0.135, 0.082 ] } }, { "index": 2, "nt1": "///A/3", "nt2": "///A/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.178, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.335, "chi2": -166.245, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.587, "C1C1_dist": 10.593, "N1N9_dist": 8.911, "C6C8_dist": 9.970, "CNNC_torsion": -25.387, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.38],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 28.810, "planarity": 0.363, "simple_Shear": 0.117, "simple_Stretch": -0.002, "simple_Buckle": -10.455, "simple_Propeller": -26.846, "bp_simpleParams": [ 0.117, -0.002, 0.425, -10.455, -26.846, 5.434 ], "bp_params": [ 0.117, -0.006, 0.425, -11.057, -26.604, 5.559 ], "frame": { "rmsd": null, "origin": [ 32.309, -2.657, 35.329 ], "x_axis": [ 0.566, -0.766, -0.304 ], "y_axis": [ -0.695, -0.245, -0.676 ], "z_axis": [ 0.443, 0.594, -0.671 ], "quaternion": [ -0.403, 0.788, -0.464, 0.044 ] } }, { "index": 3, "nt1": "///A/4", "nt2": "///A/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.140, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.132, "chi2": -169.765, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.137, "C1C1_dist": 10.702, "N1N9_dist": 8.888, "C6C8_dist": 9.584, "CNNC_torsion": -14.889, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.03],N3(imino)-O6(carbonyl)[2.71]", "interBase_angle": 27.139, "planarity": 0.383, "simple_Shear": 2.619, "simple_Stretch": 0.115, "simple_Buckle": -14.600, "simple_Propeller": -22.877, "bp_simpleParams": [ 2.619, 0.115, 0.193, -14.600, -22.877, -9.115 ], "bp_params": [ 2.549, -0.613, 0.193, -20.285, -18.029, -9.088 ], "frame": { "rmsd": null, "origin": [ 34.595, -0.137, 34.008 ], "x_axis": [ -0.157, -0.704, -0.692 ], "y_axis": [ -0.851, 0.453, -0.267 ], "z_axis": [ 0.502, 0.547, -0.670 ], "quaternion": [ 0.395, -0.515, 0.755, 0.093 ] } }, { "index": 4, "nt1": "///A/5", "nt2": "///A/26", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -144.553, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 11.814, "chi2": -150.948, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 113.978, "C1C1_dist": 9.944, "N1N9_dist": 9.233, "C6C8_dist": 10.176, "CNNC_torsion": -139.257, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.51],N1-N2(amino)[3.15]", "interBase_angle": 17.950, "planarity": 0.313, "simple_Shear": 2.355, "simple_Stretch": 4.767, "simple_Buckle": -12.133, "simple_Propeller": 13.229, "bp_simpleParams": [ 2.355, 4.767, -0.495, -12.133, 13.229, 72.302 ], "bp_params": [ -3.429, 4.063, -0.495, -16.976, -5.832, 71.773 ], "frame": { "rmsd": null, "origin": [ 30.872, 14.296, 22.974 ], "x_axis": [ -0.697, 0.513, -0.501 ], "y_axis": [ -0.717, -0.496, 0.490 ], "z_axis": [ 0.003, 0.701, 0.713 ], "quaternion": [ 0.361, -0.146, 0.349, 0.852 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/42", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -144.553, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.949, "chi2": -170.012, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.920, "C1C1_dist": 12.162, "N1N9_dist": 9.470, "C6C8_dist": 7.995, "CNNC_torsion": -159.821, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.00],N6(amino)-N1[3.14]", "interBase_angle": 21.097, "planarity": 0.257, "simple_Shear": -2.977, "simple_Stretch": 3.440, "simple_Buckle": 2.876, "simple_Propeller": 20.900, "bp_simpleParams": [ -2.977, 3.440, 0.810, 2.876, 20.900, -111.322 ], "bp_params": [ -4.384, 1.215, 0.810, -9.207, 18.981, -111.882 ], "frame": { "rmsd": null, "origin": [ 28.653, 11.134, 25.193 ], "x_axis": [ -0.696, -0.500, 0.516 ], "y_axis": [ 0.718, -0.473, 0.510 ], "z_axis": [ -0.011, 0.725, 0.688 ], "quaternion": [ -0.360, 0.149, 0.365, 0.845 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -100.784, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.517, "chi2": -170.395, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.947, "C1C1_dist": 10.532, "N1N9_dist": 8.898, "C6C8_dist": 9.881, "CNNC_torsion": -6.645, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[3.06],N4(amino)-O6(carbonyl)[3.22]", "interBase_angle": 23.063, "planarity": 0.256, "simple_Shear": 0.494, "simple_Stretch": 0.021, "simple_Buckle": -22.910, "simple_Propeller": 2.649, "bp_simpleParams": [ 0.494, 0.021, 1.005, -22.910, 2.649, 4.209 ], "bp_params": [ 0.494, 0.001, 1.005, -22.785, 3.572, 4.128 ], "frame": { "rmsd": null, "origin": [ 29.265, 13.143, 32.261 ], "x_axis": [ -0.738, -0.674, -0.033 ], "y_axis": [ 0.649, -0.722, 0.242 ], "z_axis": [ -0.187, 0.157, 0.970 ], "quaternion": [ -0.357, -0.059, 0.108, 0.926 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.904, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.772, "chi2": -174.790, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.640, "C1C1_dist": 10.566, "N1N9_dist": 8.861, "C6C8_dist": 9.864, "CNNC_torsion": -12.322, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 21.529, "planarity": 0.245, "simple_Shear": 0.148, "simple_Stretch": -0.083, "simple_Buckle": 13.479, "simple_Propeller": -16.787, "bp_simpleParams": [ 0.148, -0.083, -0.082, 13.479, -16.787, 4.487 ], "bp_params": [ 0.148, -0.084, -0.082, 13.438, -16.820, 4.505 ], "frame": { "rmsd": null, "origin": [ 38.517, 1.983, 34.378 ], "x_axis": [ -0.658, 0.065, -0.750 ], "y_axis": [ -0.163, 0.960, 0.226 ], "z_axis": [ 0.735, 0.271, -0.621 ], "quaternion": [ 0.413, -0.027, 0.900, 0.138 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.963, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.058, "chi2": -172.064, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.311, "C1C1_dist": 10.468, "N1N9_dist": 8.826, "C6C8_dist": 9.868, "CNNC_torsion": -6.564, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.54],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 7.016, "planarity": 0.096, "simple_Shear": 0.499, "simple_Stretch": -0.137, "simple_Buckle": -1.219, "simple_Propeller": -6.909, "bp_simpleParams": [ 0.499, -0.137, 0.230, -1.219, -6.909, 4.914 ], "bp_params": [ 0.493, -0.159, 0.230, -1.529, -6.847, 4.922 ], "frame": { "rmsd": null, "origin": [ 41.369, 1.393, 31.530 ], "x_axis": [ -0.688, 0.592, -0.420 ], "y_axis": [ 0.241, 0.733, 0.636 ], "z_axis": [ 0.685, 0.336, -0.647 ], "quaternion": [ 0.316, 0.238, 0.876, 0.278 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.689, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.927, "chi2": -173.223, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.883, "C1C1_dist": 10.761, "N1N9_dist": 9.069, "C6C8_dist": 9.948, "CNNC_torsion": -6.179, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.02],N3(imino)-O6(carbonyl)[3.04]", "interBase_angle": 8.942, "planarity": 0.104, "simple_Shear": 2.290, "simple_Stretch": 0.203, "simple_Buckle": 5.615, "simple_Propeller": -6.960, "bp_simpleParams": [ 2.290, 0.203, -0.034, 5.615, -6.960, -2.238 ], "bp_params": [ 2.277, -0.314, -0.034, 3.917, -8.039, -2.242 ], "frame": { "rmsd": null, "origin": [ 42.756, 1.636, 28.442 ], "x_axis": [ -0.417, 0.906, 0.076 ], "y_axis": [ 0.677, 0.254, 0.691 ], "z_axis": [ 0.606, 0.340, -0.719 ], "quaternion": [ 0.171, 0.512, 0.773, 0.333 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.384, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.932, "chi2": -171.387, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.769, "C1C1_dist": 10.608, "N1N9_dist": 8.784, "C6C8_dist": 9.666, "CNNC_torsion": -9.524, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[2.65]", "interBase_angle": 9.652, "planarity": 0.128, "simple_Shear": 0.188, "simple_Stretch": -0.353, "simple_Buckle": -1.615, "simple_Propeller": -9.516, "bp_simpleParams": [ 0.188, -0.353, 0.151, -1.615, -9.516, -1.945 ], "bp_params": [ 0.183, -0.355, 0.151, -1.751, -9.492, -1.952 ], "frame": { "rmsd": null, "origin": [ 43.197, 2.851, 24.571 ], "x_axis": [ -0.103, 0.928, 0.359 ], "y_axis": [ 0.793, -0.141, 0.593 ], "z_axis": [ 0.601, 0.346, -0.721 ], "quaternion": [ 0.093, 0.663, 0.649, 0.362 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.243, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.426, "chi2": -125.130, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.292, "C1C1_dist": 11.188, "N1N9_dist": 9.214, "C6C8_dist": 9.910, "CNNC_torsion": -10.914, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.22],N3-N1(imino)[3.03],N3-N2(amino)[3.08],N4(amino)-O6(carbonyl)[2.73]", "interBase_angle": 11.582, "planarity": 0.161, "simple_Shear": -1.123, "simple_Stretch": 0.000, "simple_Buckle": 4.729, "simple_Propeller": -10.573, "bp_simpleParams": [ -1.123, 0.000, 0.263, 4.729, -10.573, -10.122 ], "bp_params": [ -1.115, -0.133, 0.263, 5.941, -9.943, -10.146 ], "frame": { "rmsd": null, "origin": [ 43.809, 5.073, 22.177 ], "x_axis": [ 0.240, 0.686, 0.687 ], "y_axis": [ 0.773, -0.563, 0.292 ], "z_axis": [ 0.587, 0.461, -0.666 ], "quaternion": [ -0.054, 0.786, 0.464, 0.405 ] } }, { "index": 12, "nt1": "///A/13", "nt2": "///A/52", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -113.139, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.600, "chi2": -166.730, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 83.568, "C1C1_dist": 8.246, "N1N9_dist": 7.601, "C6C8_dist": 9.506, "CNNC_torsion": 143.124, "hbonds_num": 3, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.33],N1-O2'(hydroxyl)[2.91],N3-N2(amino)[2.85]", "interBase_angle": 59.555, "planarity": 0.658, "simple_Shear": 6.553, "simple_Stretch": 2.418, "simple_Buckle": 47.147, "simple_Propeller": -36.387, "bp_simpleParams": [ 6.553, 2.418, -2.444, 47.147, -36.387, 157.713 ], "bp_params": [ 2.573, 6.494, -2.444, 58.420, 11.572, 154.660 ], "frame": { "rmsd": null, "origin": [ 45.812, -1.035, 6.378 ], "x_axis": [ 0.633, 0.514, -0.578 ], "y_axis": [ 0.770, -0.490, 0.408 ], "z_axis": [ -0.073, -0.704, -0.707 ], "quaternion": [ 0.331, 0.841, 0.382, -0.194 ] } }, { "index": 13, "nt1": "///A/14", "nt2": "///A/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 69.407, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 54.194, "chi2": -158.164, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.773, "C1C1_dist": 10.575, "N1N9_dist": 8.973, "C6C8_dist": 10.024, "CNNC_torsion": 9.147, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.28],N1(imino)-N3[3.04],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 7.471, "planarity": 0.176, "simple_Shear": -0.456, "simple_Stretch": 0.009, "simple_Buckle": 5.845, "simple_Propeller": 4.653, "bp_simpleParams": [ -0.456, 0.009, -0.532, 5.845, 4.653, 5.362 ], "bp_params": [ -0.456, -0.009, -0.532, 5.660, 4.877, 5.360 ], "frame": { "rmsd": null, "origin": [ 41.166, -5.424, 5.667 ], "x_axis": [ -0.383, 0.397, -0.834 ], "y_axis": [ -0.920, -0.243, 0.307 ], "z_axis": [ -0.081, 0.885, 0.459 ], "quaternion": [ 0.456, -0.317, 0.413, 0.722 ] } }, { "index": 14, "nt1": "///A/16", "nt2": "///A/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.823, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.909, "chi2": -166.730, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.582, "C1C1_dist": 10.962, "N1N9_dist": 9.174, "C6C8_dist": 10.009, "CNNC_torsion": -6.365, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.24],N3-N1(imino)[3.12],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 19.099, "planarity": 0.211, "simple_Shear": 0.308, "simple_Stretch": 0.019, "simple_Buckle": 11.422, "simple_Propeller": -15.308, "bp_simpleParams": [ 0.308, 0.019, -0.534, 11.422, -15.308, -3.197 ], "bp_params": [ 0.308, 0.012, -0.534, 11.089, -15.550, -3.211 ], "frame": { "rmsd": null, "origin": [ 42.340, -1.163, 4.706 ], "x_axis": [ -0.567, 0.298, -0.768 ], "y_axis": [ -0.818, -0.313, 0.482 ], "z_axis": [ -0.096, 0.902, 0.422 ], "quaternion": [ 0.368, -0.285, 0.456, 0.759 ] } }, { "index": 15, "nt1": "///A/17", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.888, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.756, "chi2": 178.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.953, "C1C1_dist": 11.224, "N1N9_dist": 9.344, "C6C8_dist": 10.157, "CNNC_torsion": -16.515, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.36],N3-N1(imino)[3.32],N4(amino)-O6(carbonyl)[3.23]", "interBase_angle": 13.700, "planarity": 0.203, "simple_Shear": 0.540, "simple_Stretch": 0.147, "simple_Buckle": -5.148, "simple_Propeller": -12.696, "bp_simpleParams": [ 0.540, 0.147, 0.647, -5.148, -12.696, -5.515 ], "bp_params": [ 0.547, 0.118, 0.647, -5.795, -12.415, -5.541 ], "frame": { "rmsd": null, "origin": [ 43.145, 3.110, 5.234 ], "x_axis": [ -0.918, -0.016, -0.396 ], "y_axis": [ -0.327, -0.536, 0.779 ], "z_axis": [ -0.224, 0.844, 0.487 ], "quaternion": [ 0.091, -0.181, 0.473, 0.857 ] } }, { "index": 16, "nt1": "///A/18", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.795, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.608, "chi2": -162.592, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.789, "C1C1_dist": 10.899, "N1N9_dist": 9.049, "C6C8_dist": 9.846, "CNNC_torsion": -10.795, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.08],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 13.208, "planarity": 0.157, "simple_Shear": 0.662, "simple_Stretch": -0.062, "simple_Buckle": 2.448, "simple_Propeller": -12.979, "bp_simpleParams": [ 0.662, -0.062, 0.003, 2.448, -12.979, -6.107 ], "bp_params": [ 0.657, -0.103, 0.003, 1.628, -13.107, -6.147 ], "frame": { "rmsd": null, "origin": [ 42.648, 6.328, 5.297 ], "x_axis": [ -0.944, -0.300, 0.141 ], "y_axis": [ 0.245, -0.347, 0.905 ], "z_axis": [ -0.222, 0.889, 0.401 ], "quaternion": [ -0.166, -0.025, 0.547, 0.820 ] } }, { "index": 17, "nt1": "///A/19", "nt2": "///A/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.765, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.383, "chi2": -152.059, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.105, "C1C1_dist": 11.320, "N1N9_dist": 9.492, "C6C8_dist": 10.233, "CNNC_torsion": -9.446, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17],N1-N3(imino)[3.46]", "interBase_angle": 13.191, "planarity": 0.155, "simple_Shear": -0.528, "simple_Stretch": 0.334, "simple_Buckle": -5.518, "simple_Propeller": -11.981, "bp_simpleParams": [ -0.528, 0.334, -0.011, -5.518, -11.981, -9.138 ], "bp_params": [ -0.543, 0.308, -0.011, -4.927, -12.236, -9.182 ], "frame": { "rmsd": null, "origin": [ 41.122, 9.384, 5.762 ], "x_axis": [ -0.573, -0.730, 0.373 ], "y_axis": [ 0.613, -0.080, 0.786 ], "z_axis": [ -0.544, 0.679, 0.493 ], "quaternion": [ -0.458, -0.058, 0.500, 0.732 ] } }, { "index": 18, "nt1": "///A/20", "nt2": "///A/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.691, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.922, "chi2": 178.627, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.919, "C1C1_dist": 11.206, "N1N9_dist": 9.095, "C6C8_dist": 9.608, "CNNC_torsion": -19.289, "hbonds_num": 2, "hbonds_desc": "N3-N1(imino)[3.20],N4(amino)-O6(carbonyl)[2.68]", "interBase_angle": 15.580, "planarity": 0.213, "simple_Shear": 1.053, "simple_Stretch": -0.248, "simple_Buckle": -0.889, "simple_Propeller": -15.554, "bp_simpleParams": [ 1.053, -0.248, 0.340, -0.889, -15.554, -18.118 ], "bp_params": [ 1.021, -0.356, 0.340, -2.506, -15.377, -18.275 ], "frame": { "rmsd": null, "origin": [ 38.262, 11.445, 6.217 ], "x_axis": [ 0.034, -0.658, 0.752 ], "y_axis": [ 0.846, 0.419, 0.329 ], "z_axis": [ -0.532, 0.626, 0.571 ], "quaternion": [ 0.711, -0.104, -0.451, -0.529 ] } }, { "index": 19, "nt1": "///A/21", "nt2": "///A/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.142, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.732, "chi2": -164.879, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.015, "C1C1_dist": 10.877, "N1N9_dist": 9.061, "C6C8_dist": 9.879, "CNNC_torsion": -11.158, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[3.11]", "interBase_angle": 11.012, "planarity": 0.142, "simple_Shear": -0.708, "simple_Stretch": -0.033, "simple_Buckle": 3.865, "simple_Propeller": -10.312, "bp_simpleParams": [ -0.708, -0.033, 0.280, 3.865, -10.312, -5.112 ], "bp_params": [ -0.704, -0.081, 0.280, 4.553, -10.027, -5.127 ], "frame": { "rmsd": null, "origin": [ 34.996, 11.988, 7.553 ], "x_axis": [ 0.370, -0.601, 0.709 ], "y_axis": [ 0.797, 0.597, 0.090 ], "z_axis": [ -0.477, 0.531, 0.700 ], "quaternion": [ 0.817, -0.135, -0.363, -0.428 ] } }, { "index": 20, "nt1": "///A/22", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.117, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.377, "chi2": -162.330, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.974, "C1C1_dist": 10.918, "N1N9_dist": 9.272, "C6C8_dist": 10.276, "CNNC_torsion": -2.843, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.43],N1(imino)-N3[3.28],N2(amino)-O2(carbonyl)[3.02]", "interBase_angle": 7.945, "planarity": 0.086, "simple_Shear": -0.492, "simple_Stretch": 0.269, "simple_Buckle": -5.776, "simple_Propeller": -5.455, "bp_simpleParams": [ -0.492, 0.269, -0.179, -5.776, -5.455, 3.598 ], "bp_params": [ -0.503, 0.247, -0.179, -5.536, -5.698, 3.598 ], "frame": { "rmsd": null, "origin": [ 32.400, 12.413, 10.196 ], "x_axis": [ 0.835, -0.263, 0.484 ], "y_axis": [ 0.437, 0.851, -0.290 ], "z_axis": [ -0.335, 0.454, 0.826 ], "quaternion": [ 0.937, -0.199, -0.219, -0.187 ] } }, { "index": 21, "nt1": "///A/23", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.025, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.332, "chi2": -166.749, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.840, "C1C1_dist": 10.894, "N1N9_dist": 9.039, "C6C8_dist": 9.820, "CNNC_torsion": -6.413, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.69],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[3.09]", "interBase_angle": 18.071, "planarity": 0.193, "simple_Shear": -0.074, "simple_Stretch": -0.146, "simple_Buckle": -11.883, "simple_Propeller": -13.614, "bp_simpleParams": [ -0.074, -0.146, -0.347, -11.883, -13.614, -5.962 ], "bp_params": [ -0.074, -0.146, -0.347, -11.912, -13.589, -5.972 ], "frame": { "rmsd": null, "origin": [ 30.479, 12.091, 13.814 ], "x_axis": [ 0.963, 0.189, 0.190 ], "y_axis": [ -0.079, 0.878, -0.472 ], "z_axis": [ -0.256, 0.440, 0.861 ], "quaternion": [ 0.962, -0.237, -0.116, 0.070 ] } }, { "index": 22, "nt1": "///A/24", "nt2": "///A/31", "bp": "U+A", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -166.649, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.476, "chi2": -36.534, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 21.738, "C1C1_dist": 11.241, "N1N9_dist": 9.014, "C6C8_dist": 9.834, "CNNC_torsion": 152.528, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.76],N3(imino)-N1[3.07]", "interBase_angle": 18.143, "planarity": 0.242, "simple_Shear": 0.884, "simple_Stretch": 0.213, "simple_Buckle": -10.507, "simple_Propeller": -14.791, "bp_simpleParams": [ 0.884, 0.213, 0.131, -10.507, -14.791, -155.900 ], "bp_params": [ 0.129, -0.900, 0.131, -13.745, 11.843, -155.854 ], "frame": { "rmsd": null, "origin": [ 29.388, 11.512, 17.785 ], "x_axis": [ -0.314, 0.776, -0.546 ], "y_axis": [ -0.920, -0.391, -0.028 ], "z_axis": [ -0.235, 0.494, 0.837 ], "quaternion": [ 0.532, -0.245, 0.146, 0.797 ] } }, { "index": 23, "nt1": "///A/25", "nt2": "///A/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -156.264, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 35.281, "chi2": -77.135, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 16.757, "C1C1_dist": 9.569, "N1N9_dist": 7.071, "C6C8_dist": 6.209, "CNNC_torsion": 165.848, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.71],N3(imino)-N7[2.79]", "interBase_angle": 14.719, "planarity": 0.156, "simple_Shear": 4.690, "simple_Stretch": 1.203, "simple_Buckle": -13.261, "simple_Propeller": 6.386, "bp_simpleParams": [ 4.690, 1.203, 0.359, -13.261, 6.386, -92.741 ], "bp_params": [ 4.221, -2.373, 0.359, -5.186, 13.775, -93.097 ], "frame": { "rmsd": null, "origin": [ 29.451, 10.595, 22.084 ], "x_axis": [ -0.300, 0.773, -0.559 ], "y_axis": [ -0.950, -0.294, 0.104 ], "z_axis": [ -0.083, 0.563, 0.822 ], "quaternion": [ 0.554, -0.207, 0.215, 0.777 ] } }, { "index": 24, "nt1": "///A/25", "nt2": "///A/42", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -156.264, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 135.440, "chi2": -170.012, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.887, "C1C1_dist": 6.017, "N1N9_dist": 7.345, "C6C8_dist": 9.829, "CNNC_torsion": -35.036, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.61],O2'(hydroxyl)-N3[3.02]", "interBase_angle": 20.167, "planarity": 0.411, "simple_Shear": 0.954, "simple_Stretch": 6.139, "simple_Buckle": 19.483, "simple_Propeller": -5.210, "bp_simpleParams": [ 0.954, 6.139, -1.399, 19.483, -5.210, 137.643 ], "bp_params": [ 2.253, 5.790, -1.399, 17.925, -9.242, 137.291 ], "frame": { "rmsd": null, "origin": [ 28.313, 11.354, 23.331 ], "x_axis": [ 0.985, -0.064, 0.159 ], "y_axis": [ 0.161, 0.662, -0.732 ], "z_axis": [ -0.058, 0.747, 0.662 ], "quaternion": [ 0.910, -0.406, -0.060, -0.062 ] } }, { "index": 25, "nt1": "///A/27", "nt2": "///A/41", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -170.395, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.701, "chi2": -173.437, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 29.089, "C1C1_dist": 12.200, "N1N9_dist": 9.638, "C6C8_dist": 8.512, "CNNC_torsion": -18.212, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.33]", "interBase_angle": 17.366, "planarity": 0.244, "simple_Shear": -5.786, "simple_Stretch": 2.023, "simple_Buckle": -16.996, "simple_Propeller": -3.566, "bp_simpleParams": [ -5.786, 2.023, -1.201, -16.996, -3.566, 121.582 ], "bp_params": [ 2.350, -5.661, -1.201, 13.974, -10.310, 121.414 ], "frame": { "rmsd": null, "origin": [ 26.759, 13.531, 30.395 ], "x_axis": [ 0.105, -0.889, 0.445 ], "y_axis": [ -0.978, -0.174, -0.117 ], "z_axis": [ 0.181, -0.423, -0.888 ], "quaternion": [ 0.104, 0.736, -0.634, 0.213 ] } }, { "index": 26, "nt1": "///A/29", "nt2": "///A/43", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -77.135, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 14.312, "chi2": -170.402, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 109.395, "C1C1_dist": 9.635, "N1N9_dist": 8.849, "C6C8_dist": 9.801, "CNNC_torsion": -135.412, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.21],N1-N2(amino)[2.85]", "interBase_angle": 30.657, "planarity": 0.411, "simple_Shear": 2.496, "simple_Stretch": 4.407, "simple_Buckle": -20.729, "simple_Propeller": 22.587, "bp_simpleParams": [ 2.496, 4.407, 0.328, -20.729, 22.587, 74.051 ], "bp_params": [ -2.965, 4.106, 0.328, -29.183, -9.393, 72.441 ], "frame": { "rmsd": null, "origin": [ 27.904, 6.996, 24.969 ], "x_axis": [ -0.982, -0.114, 0.150 ], "y_axis": [ -0.186, 0.713, -0.676 ], "z_axis": [ -0.030, -0.692, -0.721 ], "quaternion": [ -0.049, -0.081, 0.924, -0.370 ] } }, { "index": 27, "nt1": "///B/2", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.066, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.833, "chi2": -129.422, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.364, "C1C1_dist": 10.637, "N1N9_dist": 8.832, "C6C8_dist": 9.687, "CNNC_torsion": -10.574, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.77],N1-N3(imino)[2.83]", "interBase_angle": 12.078, "planarity": 0.146, "simple_Shear": -0.456, "simple_Stretch": -0.243, "simple_Buckle": -0.346, "simple_Propeller": -12.074, "bp_simpleParams": [ -0.456, -0.243, 0.055, -0.346, -12.074, -3.657 ], "bp_params": [ -0.445, -0.261, 0.055, 0.158, -12.077, -3.677 ], "frame": { "rmsd": null, "origin": [ 4.882, 8.256, 44.267 ], "x_axis": [ -0.860, 0.303, -0.411 ], "y_axis": [ 0.506, 0.614, -0.606 ], "z_axis": [ 0.069, -0.729, -0.681 ], "quaternion": [ 0.135, 0.228, 0.888, -0.376 ] } }, { "index": 28, "nt1": "///B/3", "nt2": "///B/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.639, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.310, "chi2": -168.046, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.038, "C1C1_dist": 10.410, "N1N9_dist": 8.714, "C6C8_dist": 9.745, "CNNC_torsion": -24.595, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.16],N1(imino)-N3[2.72],N2(amino)-O2(carbonyl)[2.48]", "interBase_angle": 29.874, "planarity": 0.369, "simple_Shear": 0.054, "simple_Stretch": -0.221, "simple_Buckle": -11.601, "simple_Propeller": -27.530, "bp_simpleParams": [ 0.054, -0.221, 0.361, -11.601, -27.530, 4.522 ], "bp_params": [ 0.049, -0.222, 0.361, -12.061, -27.331, 4.629 ], "frame": { "rmsd": null, "origin": [ 3.354, 5.665, 41.894 ], "x_axis": [ -0.325, 0.770, -0.549 ], "y_axis": [ 0.943, 0.222, -0.247 ], "z_axis": [ -0.068, -0.598, -0.799 ], "quaternion": [ 0.157, 0.559, 0.766, -0.276 ] } }, { "index": 29, "nt1": "///B/4", "nt2": "///B/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.226, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.737, "chi2": -172.636, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.566, "C1C1_dist": 10.802, "N1N9_dist": 9.014, "C6C8_dist": 9.779, "CNNC_torsion": -14.977, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.11],N3(imino)-O6(carbonyl)[2.95]", "interBase_angle": 27.856, "planarity": 0.383, "simple_Shear": 2.211, "simple_Stretch": 0.226, "simple_Buckle": -18.372, "simple_Propeller": -20.939, "bp_simpleParams": [ 2.211, 0.226, 0.376, -18.372, -20.939, -6.591 ], "bp_params": [ 2.203, -0.300, 0.376, -22.761, -16.060, -6.528 ], "frame": { "rmsd": null, "origin": [ 1.858, 3.387, 39.431 ], "x_axis": [ 0.455, 0.709, -0.539 ], "y_axis": [ 0.883, -0.439, 0.168 ], "z_axis": [ -0.117, -0.552, -0.825 ], "quaternion": [ 0.219, 0.824, 0.483, -0.199 ] } }, { "index": 30, "nt1": "///B/5", "nt2": "///B/26", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -144.819, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 11.957, "chi2": -167.592, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 109.187, "C1C1_dist": 9.985, "N1N9_dist": 9.176, "C6C8_dist": 10.185, "CNNC_torsion": -147.965, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.43],N1-N2(amino)[2.97]", "interBase_angle": 13.821, "planarity": 0.250, "simple_Shear": 2.504, "simple_Stretch": 4.569, "simple_Buckle": -8.154, "simple_Propeller": 11.159, "bp_simpleParams": [ 2.504, 4.569, -0.452, -8.154, 11.159, 76.273 ], "bp_params": [ -3.143, 4.155, -0.452, -13.522, -2.860, 75.903 ], "frame": { "rmsd": null, "origin": [ 9.796, -11.328, 31.858 ], "x_axis": [ 0.818, -0.565, -0.106 ], "y_axis": [ 0.435, 0.487, 0.757 ], "z_axis": [ -0.377, -0.666, 0.644 ], "quaternion": [ 0.859, 0.414, -0.079, -0.291 ] } }, { "index": 31, "nt1": "///B/5", "nt2": "///B/42", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -144.819, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 20.993, "chi2": -167.960, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.698, "C1C1_dist": 12.172, "N1N9_dist": 9.467, "C6C8_dist": 8.008, "CNNC_torsion": -164.798, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.00],N6(amino)-N1[3.08]", "interBase_angle": 19.402, "planarity": 0.243, "simple_Shear": -3.025, "simple_Stretch": 3.308, "simple_Buckle": 4.049, "simple_Propeller": 18.974, "bp_simpleParams": [ -3.025, 3.308, 0.886, 4.049, 18.974, -109.210 ], "bp_params": [ -4.340, 1.123, 0.886, -6.983, 18.101, -109.785 ], "frame": { "rmsd": null, "origin": [ 10.964, -8.196, 34.833 ], "x_axis": [ 0.381, 0.487, 0.786 ], "y_axis": [ -0.853, 0.513, 0.096 ], "z_axis": [ -0.356, -0.707, 0.611 ], "quaternion": [ 0.791, 0.254, -0.361, 0.423 ] } }, { "index": 32, "nt1": "///B/6", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -95.926, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.032, "chi2": -170.269, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.710, "C1C1_dist": 10.572, "N1N9_dist": 8.900, "C6C8_dist": 9.854, "CNNC_torsion": -7.055, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.11]", "interBase_angle": 18.646, "planarity": 0.213, "simple_Shear": 0.576, "simple_Stretch": -0.059, "simple_Buckle": -18.645, "simple_Propeller": 0.049, "bp_simpleParams": [ 0.576, -0.059, 0.837, -18.645, 0.049, 2.026 ], "bp_params": [ 0.572, -0.089, 0.837, -18.617, 1.028, 1.999 ], "frame": { "rmsd": null, "origin": [ 6.898, -10.221, 40.549 ], "x_axis": [ 0.666, 0.655, 0.357 ], "y_axis": [ -0.679, 0.730, -0.074 ], "z_axis": [ -0.309, -0.194, 0.931 ], "quaternion": [ 0.912, 0.033, -0.183, 0.366 ] } }, { "index": 33, "nt1": "///B/7", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.892, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.142, "chi2": -174.951, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.951, "C1C1_dist": 10.644, "N1N9_dist": 8.909, "C6C8_dist": 9.871, "CNNC_torsion": -10.372, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 20.795, "planarity": 0.233, "simple_Shear": -0.081, "simple_Stretch": -0.073, "simple_Buckle": 14.251, "simple_Propeller": -15.144, "bp_simpleParams": [ -0.081, -0.073, -0.143, 14.251, -15.144, 2.627 ], "bp_params": [ -0.079, -0.075, -0.143, 14.565, -14.843, 2.628 ], "frame": { "rmsd": null, "origin": [ -1.924, 1.237, 38.197 ], "x_axis": [ 0.933, -0.078, -0.352 ], "y_axis": [ 0.024, -0.961, 0.276 ], "z_axis": [ -0.360, -0.266, -0.894 ], "quaternion": [ 0.139, 0.973, -0.014, -0.183 ] } }, { "index": 34, "nt1": "///B/8", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.689, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.355, "chi2": -172.126, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.658, "C1C1_dist": 10.565, "N1N9_dist": 8.934, "C6C8_dist": 9.979, "CNNC_torsion": -5.245, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[3.20]", "interBase_angle": 6.720, "planarity": 0.087, "simple_Shear": 0.508, "simple_Stretch": -0.023, "simple_Buckle": 3.721, "simple_Propeller": -5.596, "bp_simpleParams": [ 0.508, -0.023, 0.107, 3.721, -5.596, 5.167 ], "bp_params": [ 0.507, -0.046, 0.107, 3.465, -5.758, 5.172 ], "frame": { "rmsd": null, "origin": [ -2.815, 1.730, 34.371 ], "x_axis": [ 0.791, -0.609, -0.060 ], "y_axis": [ -0.526, -0.727, 0.442 ], "z_axis": [ -0.313, -0.318, -0.895 ], "quaternion": [ 0.205, 0.924, -0.307, -0.101 ] } }, { "index": 35, "nt1": "///B/9", "nt2": "///B/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.439, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.263, "chi2": -172.175, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.525, "C1C1_dist": 10.470, "N1N9_dist": 8.803, "C6C8_dist": 9.684, "CNNC_torsion": -7.756, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.75],N3(imino)-O6(carbonyl)[2.77]", "interBase_angle": 9.341, "planarity": 0.116, "simple_Shear": 2.444, "simple_Stretch": -0.027, "simple_Buckle": 3.347, "simple_Propeller": -8.721, "bp_simpleParams": [ 2.444, -0.027, -0.027, 3.347, -8.721, -1.766 ], "bp_params": [ 2.367, -0.611, -0.027, 1.158, -9.269, -1.772 ], "frame": { "rmsd": null, "origin": [ -2.640, 1.460, 30.722 ], "x_axis": [ 0.283, -0.923, 0.259 ], "y_axis": [ -0.934, -0.203, 0.295 ], "z_axis": [ -0.220, -0.325, -0.920 ], "quaternion": [ 0.200, 0.776, -0.599, 0.013 ] } }, { "index": 36, "nt1": "///B/10", "nt2": "///B/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.693, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.850, "chi2": -165.359, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.186, "C1C1_dist": 10.573, "N1N9_dist": 8.837, "C6C8_dist": 9.818, "CNNC_torsion": -9.249, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 12.567, "planarity": 0.173, "simple_Shear": -0.102, "simple_Stretch": -0.195, "simple_Buckle": -2.272, "simple_Propeller": -12.359, "bp_simpleParams": [ -0.102, -0.195, -0.071, -2.272, -12.359, 2.984 ], "bp_params": [ -0.099, -0.197, -0.071, -2.080, -12.393, 3.001 ], "frame": { "rmsd": null, "origin": [ -1.295, 0.122, 27.339 ], "x_axis": [ -0.084, -0.920, 0.383 ], "y_axis": [ -0.985, 0.136, 0.109 ], "z_axis": [ -0.152, -0.368, -0.917 ], "quaternion": [ -0.183, -0.651, 0.731, -0.088 ] } }, { "index": 37, "nt1": "///B/11", "nt2": "///B/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.519, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.147, "chi2": -121.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.149, "C1C1_dist": 11.312, "N1N9_dist": 9.294, "C6C8_dist": 9.933, "CNNC_torsion": -11.292, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.37],N3-N1(imino)[3.08],N3-N2(amino)[3.23],N4(amino)-O6(carbonyl)[2.67]", "interBase_angle": 10.917, "planarity": 0.154, "simple_Shear": -1.074, "simple_Stretch": 0.041, "simple_Buckle": 4.866, "simple_Propeller": -9.773, "bp_simpleParams": [ -1.074, 0.041, 0.248, 4.866, -9.773, -12.605 ], "bp_params": [ -1.072, -0.081, 0.248, 5.935, -9.163, -12.629 ], "frame": { "rmsd": null, "origin": [ -0.715, -1.873, 24.746 ], "x_axis": [ -0.551, -0.670, 0.497 ], "y_axis": [ -0.807, 0.579, -0.115 ], "z_axis": [ -0.210, -0.465, -0.860 ], "quaternion": [ -0.204, -0.427, 0.865, -0.168 ] } }, { "index": 38, "nt1": "///B/13", "nt2": "///B/52", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "t.S", "DSSR": "t.+m", "intra_chain": true, "chi1": -119.239, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.337, "chi2": 173.659, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 81.094, "C1C1_dist": 8.679, "N1N9_dist": 8.009, "C6C8_dist": 10.033, "CNNC_torsion": 140.765, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.02],N3-N2(amino)[2.85]", "interBase_angle": 52.166, "planarity": 0.587, "simple_Shear": 6.475, "simple_Stretch": 2.841, "simple_Buckle": 35.828, "simple_Propeller": -37.916, "bp_simpleParams": [ 6.475, 2.841, -1.909, 35.828, -37.916, 158.312 ], "bp_params": [ 2.258, 6.700, -1.909, 52.159, 0.855, 155.922 ], "frame": { "rmsd": null, "origin": [ 5.093, 3.866, 9.358 ], "x_axis": [ -0.257, -0.518, -0.815 ], "y_axis": [ -0.889, 0.458, -0.010 ], "z_axis": [ 0.378, 0.722, -0.579 ], "quaternion": [ 0.394, -0.465, 0.757, 0.235 ] } }, { "index": 39, "nt1": "///B/14", "nt2": "///B/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 73.211, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 53.605, "chi2": -154.188, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 70.845, "C1C1_dist": 9.963, "N1N9_dist": 8.610, "C6C8_dist": 9.863, "CNNC_torsion": 6.522, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.92],N1(imino)-N3[3.06],N2(amino)-O2(carbonyl)[2.38]", "interBase_angle": 3.554, "planarity": 0.188, "simple_Shear": -1.319, "simple_Stretch": -0.004, "simple_Buckle": 3.542, "simple_Propeller": -0.293, "bp_simpleParams": [ -1.319, -0.004, -0.685, 3.542, -0.293, 16.108 ], "bp_params": [ -1.308, -0.170, -0.685, 3.550, 0.156, 16.100 ], "frame": { "rmsd": null, "origin": [ 9.920, 7.834, 10.948 ], "x_axis": [ 0.717, -0.438, -0.543 ], "y_axis": [ 0.672, 0.225, 0.705 ], "z_axis": [ -0.186, -0.871, 0.455 ], "quaternion": [ 0.774, 0.509, 0.115, -0.358 ] } }, { "index": 40, "nt1": "///B/16", "nt2": "///B/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.514, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.431, "chi2": 173.659, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.590, "C1C1_dist": 11.126, "N1N9_dist": 9.149, "C6C8_dist": 9.839, "CNNC_torsion": -5.774, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.17],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.55]", "interBase_angle": 15.279, "planarity": 0.163, "simple_Shear": -0.526, "simple_Stretch": -0.096, "simple_Buckle": 10.017, "simple_Propeller": -11.536, "bp_simpleParams": [ -0.526, -0.096, -0.251, 10.017, -11.536, -9.728 ], "bp_params": [ -0.519, -0.128, -0.251, 10.703, -10.903, -9.730 ], "frame": { "rmsd": null, "origin": [ 8.480, 3.776, 9.760 ], "x_axis": [ 0.848, -0.320, -0.423 ], "y_axis": [ 0.524, 0.383, 0.761 ], "z_axis": [ -0.081, -0.867, 0.492 ], "quaternion": [ 0.825, 0.493, 0.104, -0.256 ] } }, { "index": 41, "nt1": "///B/17", "nt2": "///B/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.405, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.032, "chi2": -166.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.518, "C1C1_dist": 10.937, "N1N9_dist": 9.155, "C6C8_dist": 10.049, "CNNC_torsion": -13.722, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.12],N3-N1(imino)[3.15],N4(amino)-O6(carbonyl)[3.15]", "interBase_angle": 15.053, "planarity": 0.192, "simple_Shear": 0.609, "simple_Stretch": 0.035, "simple_Buckle": 1.890, "simple_Propeller": -14.934, "bp_simpleParams": [ 0.609, 0.035, 0.245, 1.890, -14.934, -1.924 ], "bp_params": [ 0.610, 0.001, 0.245, 1.041, -15.017, -1.940 ], "frame": { "rmsd": null, "origin": [ 7.986, -0.220, 9.922 ], "x_axis": [ 0.995, -0.007, 0.096 ], "y_axis": [ -0.077, 0.541, 0.838 ], "z_axis": [ -0.058, -0.841, 0.538 ], "quaternion": [ 0.877, 0.479, -0.044, 0.020 ] } }, { "index": 42, "nt1": "///B/18", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.916, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.993, "chi2": -161.827, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.034, "C1C1_dist": 10.725, "N1N9_dist": 9.010, "C6C8_dist": 9.946, "CNNC_torsion": -10.912, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 9.912, "planarity": 0.142, "simple_Shear": -0.041, "simple_Stretch": -0.003, "simple_Buckle": -3.787, "simple_Propeller": -9.160, "bp_simpleParams": [ -0.041, -0.003, 0.425, -3.787, -9.160, -0.533 ], "bp_params": [ -0.040, -0.003, 0.425, -3.715, -9.190, -0.534 ], "frame": { "rmsd": null, "origin": [ 8.337, -3.690, 10.572 ], "x_axis": [ 0.795, 0.419, 0.439 ], "y_axis": [ -0.600, 0.431, 0.674 ], "z_axis": [ 0.093, -0.799, 0.594 ], "quaternion": [ 0.840, 0.439, -0.103, 0.303 ] } }, { "index": 43, "nt1": "///B/19", "nt2": "///B/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.354, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.044, "chi2": -158.309, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.124, "C1C1_dist": 11.131, "N1N9_dist": 9.306, "C6C8_dist": 10.102, "CNNC_torsion": -11.458, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.28],N1-N3(imino)[3.44]", "interBase_angle": 11.788, "planarity": 0.150, "simple_Shear": -0.987, "simple_Stretch": 0.216, "simple_Buckle": 0.788, "simple_Propeller": -11.762, "bp_simpleParams": [ -0.987, 0.216, 0.252, 0.788, -11.762, -6.563 ], "bp_params": [ -1.004, 0.120, 0.252, 1.918, -11.631, -6.596 ], "frame": { "rmsd": null, "origin": [ 9.322, -6.629, 11.472 ], "x_axis": [ 0.399, 0.712, 0.577 ], "y_axis": [ -0.893, 0.160, 0.420 ], "z_axis": [ 0.207, -0.684, 0.700 ], "quaternion": [ 0.752, 0.367, -0.123, 0.534 ] } }, { "index": 44, "nt1": "///B/20", "nt2": "///B/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.323, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.391, "chi2": -179.862, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.929, "C1C1_dist": 11.013, "N1N9_dist": 9.032, "C6C8_dist": 9.703, "CNNC_torsion": -16.689, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.35],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[2.70]", "interBase_angle": 16.901, "planarity": 0.216, "simple_Shear": 0.726, "simple_Stretch": -0.256, "simple_Buckle": 1.116, "simple_Propeller": -16.864, "bp_simpleParams": [ 0.726, -0.256, 0.225, 1.116, -16.864, -11.047 ], "bp_params": [ 0.706, -0.306, 0.225, -0.056, -16.901, -11.168 ], "frame": { "rmsd": null, "origin": [ 11.684, -8.519, 13.589 ], "x_axis": [ -0.322, 0.715, 0.620 ], "y_axis": [ -0.923, -0.384, -0.037 ], "z_axis": [ 0.212, -0.584, 0.784 ], "quaternion": [ 0.519, 0.264, -0.197, 0.789 ] } }, { "index": 45, "nt1": "///B/21", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.731, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.829, "chi2": -162.781, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.338, "C1C1_dist": 10.515, "N1N9_dist": 8.896, "C6C8_dist": 9.872, "CNNC_torsion": -14.030, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.24],N1-N3(imino)[3.07]", "interBase_angle": 14.242, "planarity": 0.184, "simple_Shear": -0.932, "simple_Stretch": -0.043, "simple_Buckle": -1.241, "simple_Propeller": -14.188, "bp_simpleParams": [ -0.932, -0.043, 0.279, -1.241, -14.188, 1.410 ], "bp_params": [ -0.924, -0.125, 0.279, 0.029, -14.242, 1.419 ], "frame": { "rmsd": null, "origin": [ 13.806, -9.278, 16.447 ], "x_axis": [ -0.624, 0.661, 0.417 ], "y_axis": [ -0.779, -0.569, -0.264 ], "z_axis": [ 0.063, -0.489, 0.870 ], "quaternion": [ 0.411, 0.137, -0.215, 0.875 ] } }, { "index": 46, "nt1": "///B/22", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.405, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.842, "chi2": -162.702, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.619, "C1C1_dist": 10.681, "N1N9_dist": 9.038, "C6C8_dist": 10.053, "CNNC_torsion": -4.807, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.22],N1(imino)-N3[3.06],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 6.450, "planarity": 0.077, "simple_Shear": -0.465, "simple_Stretch": 0.041, "simple_Buckle": -2.261, "simple_Propeller": -6.041, "bp_simpleParams": [ -0.465, 0.041, -0.035, -2.261, -6.041, 3.841 ], "bp_params": [ -0.467, 0.022, -0.035, -2.010, -6.129, 3.846 ], "frame": { "rmsd": null, "origin": [ 14.907, -9.828, 19.768 ], "x_axis": [ -0.952, 0.288, 0.103 ], "y_axis": [ -0.303, -0.840, -0.449 ], "z_axis": [ -0.043, -0.459, 0.887 ], "quaternion": [ 0.154, 0.015, -0.237, 0.959 ] } }, { "index": 47, "nt1": "///B/23", "nt2": "///B/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.723, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.736, "chi2": -165.944, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.970, "C1C1_dist": 10.800, "N1N9_dist": 8.995, "C6C8_dist": 9.826, "CNNC_torsion": -5.471, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.68],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 16.508, "planarity": 0.177, "simple_Shear": 0.159, "simple_Stretch": -0.159, "simple_Buckle": -10.836, "simple_Propeller": -12.453, "bp_simpleParams": [ 0.159, -0.159, -0.358, -10.836, -12.453, -3.940 ], "bp_params": [ 0.155, -0.163, -0.358, -11.139, -12.183, -3.944 ], "frame": { "rmsd": null, "origin": [ 14.799, -9.512, 23.815 ], "x_axis": [ -0.949, -0.174, -0.263 ], "y_axis": [ 0.267, -0.888, -0.374 ], "z_axis": [ -0.168, -0.425, 0.890 ], "quaternion": [ -0.114, -0.112, -0.207, 0.965 ] } }, { "index": 48, "nt1": "///B/24", "nt2": "///B/31", "bp": "U+A", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -164.365, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.111, "chi2": -37.626, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 21.502, "C1C1_dist": 11.385, "N1N9_dist": 9.145, "C6C8_dist": 9.922, "CNNC_torsion": 150.838, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.89],N3(imino)-N1[3.22]", "interBase_angle": 18.440, "planarity": 0.253, "simple_Shear": 0.698, "simple_Stretch": 0.303, "simple_Buckle": -11.902, "simple_Propeller": -14.084, "bp_simpleParams": [ 0.698, 0.303, 0.054, -11.902, -14.084, -155.383 ], "bp_params": [ 0.250, -0.719, 0.054, -13.154, 12.922, -155.376 ], "frame": { "rmsd": null, "origin": [ 13.883, -8.816, 27.901 ], "x_axis": [ 0.520, -0.791, -0.321 ], "y_axis": [ 0.826, 0.372, 0.423 ], "z_axis": [ -0.216, -0.485, 0.847 ], "quaternion": [ 0.828, 0.274, 0.032, -0.489 ] } }, { "index": 49, "nt1": "///B/25", "nt2": "///B/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -152.546, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 34.170, "chi2": -76.553, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 14.575, "C1C1_dist": 9.738, "N1N9_dist": 7.194, "C6C8_dist": 6.295, "CNNC_torsion": 165.806, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.64],N3(imino)-N7[2.82]", "interBase_angle": 13.491, "planarity": 0.138, "simple_Shear": 4.456, "simple_Stretch": 1.065, "simple_Buckle": -11.868, "simple_Propeller": 6.416, "bp_simpleParams": [ 4.456, 1.065, 0.397, -11.868, 6.416, -92.606 ], "bp_params": [ 4.062, -2.119, 0.397, -4.762, 12.623, -92.905 ], "frame": { "rmsd": null, "origin": [ 11.742, -7.850, 31.590 ], "x_axis": [ 0.489, -0.797, -0.355 ], "y_axis": [ 0.805, 0.255, 0.536 ], "z_axis": [ -0.337, -0.547, 0.766 ], "quaternion": [ 0.792, 0.342, 0.006, -0.506 ] } }, { "index": 50, "nt1": "///B/25", "nt2": "///B/42", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -152.546, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 134.293, "chi2": -167.960, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 98.224, "C1C1_dist": 6.063, "N1N9_dist": 7.382, "C6C8_dist": 9.876, "CNNC_torsion": -36.026, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.67],O2'(hydroxyl)-N3[3.13]", "interBase_angle": 19.956, "planarity": 0.416, "simple_Shear": 0.908, "simple_Stretch": 6.186, "simple_Buckle": 18.951, "simple_Propeller": -6.252, "bp_simpleParams": [ 0.908, 6.186, -1.391, 18.951, -6.252, 137.889 ], "bp_params": [ 2.143, 5.873, -1.391, 17.314, -9.922, 137.590 ], "frame": { "rmsd": null, "origin": [ 12.121, -8.481, 33.333 ], "x_axis": [ -0.937, 0.118, -0.329 ], "y_axis": [ 0.165, -0.680, -0.714 ], "z_axis": [ -0.308, -0.724, 0.618 ], "quaternion": [ -0.013, -0.177, -0.400, 0.899 ] } }, { "index": 51, "nt1": "///B/27", "nt2": "///B/41", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -170.269, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.605, "chi2": -173.577, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 30.152, "C1C1_dist": 12.118, "N1N9_dist": 9.583, "C6C8_dist": 8.419, "CNNC_torsion": -26.031, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.50]", "interBase_angle": 19.311, "planarity": 0.299, "simple_Shear": -5.872, "simple_Stretch": 2.062, "simple_Buckle": -19.165, "simple_Propeller": -2.366, "bp_simpleParams": [ -5.872, 2.062, -1.680, -19.165, -2.366, 120.228 ], "bp_params": [ 2.490, -5.704, -1.680, 14.773, -12.437, 120.105 ], "frame": { "rmsd": null, "origin": [ 10.017, -10.583, 40.010 ], "x_axis": [ -0.304, 0.886, 0.351 ], "y_axis": [ 0.908, 0.157, 0.389 ], "z_axis": [ 0.289, 0.437, -0.852 ], "quaternion": [ -0.020, 0.590, 0.760, 0.272 ] } }, { "index": 52, "nt1": "///B/29", "nt2": "///B/43", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -76.553, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 14.801, "chi2": -178.625, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 105.691, "C1C1_dist": 9.980, "N1N9_dist": 9.113, "C6C8_dist": 10.092, "CNNC_torsion": -138.067, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.26],N1-N2(amino)[2.71]", "interBase_angle": 30.207, "planarity": 0.397, "simple_Shear": 2.475, "simple_Stretch": 4.330, "simple_Buckle": -19.235, "simple_Propeller": 23.291, "bp_simpleParams": [ 2.475, 4.330, 0.322, -19.235, 23.291, 79.022 ], "bp_params": [ -3.014, 3.974, 0.322, -28.985, -8.505, 77.365 ], "frame": { "rmsd": null, "origin": [ 11.855, -4.345, 34.711 ], "x_axis": [ 0.795, 0.118, 0.596 ], "y_axis": [ 0.479, -0.724, -0.496 ], "z_axis": [ 0.373, 0.680, -0.632 ], "quaternion": [ -0.331, 0.887, 0.168, 0.273 ] } } ], "num_multiplets": 8, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "AGA", "nts_long": "///A/5,///A/26,///A/42", "planarity": 0.398 }, { "index": 2, "num_nts": 3, "nts_short": "CGC", "nts_long": "///A/6,///A/27,///A/41", "planarity": 0.292 }, { "index": 3, "num_nts": 3, "nts_short": "ACG", "nts_long": "///A/13,///A/16,///A/52", "planarity": 0.568 }, { "index": 4, "num_nts": 3, "nts_short": "UAG", "nts_long": "///A/25,///A/29,///A/43", "planarity": 0.366 }, { "index": 5, "num_nts": 3, "nts_short": "AGA", "nts_long": "///B/5,///B/26,///B/42", "planarity": 0.355 }, { "index": 6, "num_nts": 3, "nts_short": "CGC", "nts_long": "///B/6,///B/27,///B/41", "planarity": 0.306 }, { "index": 7, "num_nts": 3, "nts_short": "ACG", "nts_long": "///B/13,///B/16,///B/52", "planarity": 0.506 }, { "index": 8, "num_nts": 3, "nts_short": "UAG", "nts_long": "///B/25,///B/29,///B/43", "planarity": 0.364 } ], "num_helices": 4, "helices": [ { "index": 1, "num_stems": 2, "strand1": "AGUCCUCC", "strand2": "UCGGGGGG", "bp_type": "||||||||", "helix_form": "..xA..x", "helical_rise": 3.327, "helical_rise_std": 0.625, "helical_radius": 8.959, "helical_radius_std": 2.336, "helical_axis": [ 0.504, 0.410, -0.760 ], "point1": [ 33.016, -4.442, 40.222 ], "point2": [ 44.909, 5.236, 22.310 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///A/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.336, -0.122, -0.037, -0.808, -8.484, -1.263 ], "step_params": [ 0.628, -1.417, 3.434, -0.229, 13.175, 37.939 ], "heli_params": [ -3.547, -0.941, 2.805, 19.558, 0.340, 40.083 ], "bp2_params": [ 0.117, -0.006, 0.425, -11.057, -26.604, 5.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.434, "simple_Twist": 34.842, "simple_hRise": 2.735, "simple_hTwist": 37.178 }, { "index": 2, "nt1": "///A/3", "nt2": "///A/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.006, 0.425, -11.057, -26.604, 5.559 ], "step_params": [ -0.840, -1.007, 3.406, 3.191, 2.880, 48.539 ], "heli_params": [ -1.446, 1.268, 3.287, 3.495, -3.873, 48.717 ], "bp2_params": [ 2.549, -0.613, 0.193, -20.285, -18.029, -9.088 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.406, "simple_Twist": 35.106, "simple_hRise": 3.230, "simple_hTwist": 35.360 }, { "index": 3, "nt1": "///A/4", "nt2": "///A/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.549, -0.613, 0.193, -20.285, -18.029, -9.088 ], "step_params": [ -3.174, -0.538, 3.106, 20.844, -2.796, 55.718 ], "heli_params": [ -0.431, 4.058, 1.933, -2.880, -21.471, 59.256 ], "bp2_params": [ 0.148, -0.084, -0.082, 13.438, -16.820, 4.505 ], "groove_widths": [ 16.281, null, 11.203, null ], "simple_Rise": 3.106, "simple_Twist": 69.882, "simple_hRise": 2.228, "simple_hTwist": 72.591 }, { "index": 4, "nt1": "///A/7", "nt2": "///A/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.084, -0.082, 13.438, -16.820, 4.505 ], "step_params": [ -0.444, -1.744, 3.654, -2.550, 4.244, 36.003 ], "heli_params": [ -3.443, 0.323, 3.455, 6.827, 4.101, 36.331 ], "bp2_params": [ 0.493, -0.159, 0.230, -1.529, -6.847, 4.922 ], "groove_widths": [ 15.967, 14.664, 11.857, 11.850 ], "simple_Rise": 3.654, "simple_Twist": 33.620, "simple_hRise": 3.438, "simple_hTwist": 33.973 }, { "index": 5, "nt1": "///A/8", "nt2": "///A/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.493, -0.159, 0.230, -1.529, -6.847, 4.922 ], "step_params": [ -0.101, -1.399, 3.091, 4.995, 3.553, 37.603 ], "heli_params": [ -2.561, 0.741, 2.915, 5.467, -7.686, 38.081 ], "bp2_params": [ 2.277, -0.314, -0.034, 3.917, -8.039, -2.242 ], "groove_widths": [ 16.193, null, 14.535, null ], "simple_Rise": 3.091, "simple_Twist": 28.306, "simple_hRise": 2.839, "simple_hTwist": 28.949 }, { "index": 6, "nt1": "///A/9", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.277, -0.314, -0.034, 3.917, -8.039, -2.242 ], "step_params": [ 0.159, -2.143, 3.469, 0.280, 0.370, 24.418 ], "heli_params": [ -5.187, -0.284, 3.438, 0.875, -0.662, 24.423 ], "bp2_params": [ 0.183, -0.355, 0.151, -1.751, -9.492, -1.952 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.469, "simple_Twist": 35.551, "simple_hRise": 3.448, "simple_hTwist": 35.554 }, { "index": 7, "nt1": "///A/10", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.355, 0.151, -1.751, -9.492, -1.952 ], "step_params": [ 0.595, -1.460, 2.925, 1.611, 7.195, 30.080 ], "heli_params": [ -3.916, -0.851, 2.544, 13.607, -3.047, 30.950 ], "bp2_params": [ -1.115, -0.133, 0.263, 5.941, -9.943, -10.146 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.925, "simple_Twist": 36.598, "simple_hRise": 2.624, "simple_hTwist": 37.309 }, { "index": 8, "nt1": "///A/11", "nt2": "///A/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "GCCUACAGGUUAC", "strand2": "CGGAUGUCCAAAG", "bp_type": "|||||||||...|", "helix_form": "xAAAA.AAxxxx", "helical_rise": 2.765, "helical_rise_std": 1.146, "helical_radius": 10.223, "helical_radius_std": 3.452, "helical_axis": [ -0.274, 0.656, 0.703 ], "point1": [ 37.290, -2.479, 2.621 ], "point2": [ 28.206, 19.254, 25.889 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///A/14", "nt2": "///A/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.456, -0.009, -0.532, 5.660, 4.877, 5.360 ], "step_params": [ 1.704, -2.608, 3.279, 0.339, 2.451, 12.329 ], "heli_params": [ -14.608, -7.405, 2.755, 11.266, -1.558, 12.574 ], "bp2_params": [ 0.308, 0.012, -0.534, 11.089, -15.550, -3.211 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.279, "simple_Twist": 8.587, "simple_hRise": 2.502, "simple_hTwist": 8.936 }, { "index": 2, "nt1": "///A/16", "nt2": "///A/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.308, 0.012, -0.534, 11.089, -15.550, -3.211 ], "step_params": [ -0.229, -2.073, 3.852, -8.354, 2.958, 34.886 ], "heli_params": [ -3.847, -1.012, 3.627, 4.838, 13.664, 35.960 ], "bp2_params": [ 0.547, 0.118, 0.647, -5.795, -12.415, -5.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.852, "simple_Twist": 33.257, "simple_hRise": 3.610, "simple_hTwist": 34.386 }, { "index": 3, "nt1": "///A/17", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.547, 0.118, 0.647, -5.795, -12.415, -5.541 ], "step_params": [ -0.101, -1.417, 2.931, 5.535, 0.115, 35.446 ], "heli_params": [ -2.316, 0.872, 2.879, 0.188, -9.023, 35.862 ], "bp2_params": [ 0.657, -0.103, 0.003, 1.628, -13.107, -6.147 ], "groove_widths": [ 17.140, null, 18.092, null ], "simple_Rise": 2.931, "simple_Twist": 34.922, "simple_hRise": 2.877, "simple_hTwist": 35.345 }, { "index": 4, "nt1": "///A/18", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.657, -0.103, 0.003, 1.628, -13.107, -6.147 ], "step_params": [ -0.316, -1.099, 3.252, 0.954, 22.749, 27.689 ], "heli_params": [ -4.707, 0.638, 1.843, 40.045, -1.679, 35.706 ], "bp2_params": [ -0.543, 0.308, -0.011, -4.927, -12.236, -9.182 ], "groove_widths": [ 17.816, 16.654, 15.086, 12.352 ], "simple_Rise": 3.252, "simple_Twist": 33.968, "simple_hRise": 2.128, "simple_hTwist": 40.706 }, { "index": 5, "nt1": "///A/19", "nt2": "///A/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.543, 0.308, -0.011, -4.927, -12.236, -9.182 ], "step_params": [ -0.403, -1.639, 3.129, -2.672, 4.771, 41.939 ], "heli_params": [ -2.728, 0.304, 2.952, 6.632, 3.714, 42.278 ], "bp2_params": [ 1.021, -0.356, 0.340, -2.506, -15.377, -18.275 ], "groove_widths": [ 17.639, 16.485, 16.532, 11.118 ], "simple_Rise": 3.129, "simple_Twist": 34.148, "simple_hRise": 2.902, "simple_hTwist": 34.570 }, { "index": 6, "nt1": "///A/20", "nt2": "///A/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.021, -0.356, 0.340, -2.506, -15.377, -18.275 ], "step_params": [ -0.021, -2.188, 2.821, -1.382, 9.588, 17.374 ], "heli_params": [ -9.480, -0.390, 1.423, 28.995, 4.178, 19.874 ], "bp2_params": [ -0.704, -0.081, 0.280, 4.553, -10.027, -5.127 ], "groove_widths": [ 17.478, 16.224, 16.786, 14.292 ], "simple_Rise": 2.821, "simple_Twist": 26.008, "simple_hRise": 1.907, "simple_hTwist": 27.724 }, { "index": 7, "nt1": "///A/21", "nt2": "///A/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.704, -0.081, 0.280, 4.553, -10.027, -5.127 ], "step_params": [ -0.172, -1.733, 3.297, -1.129, 11.703, 34.002 ], "heli_params": [ -4.357, 0.130, 2.583, 19.310, 1.863, 35.921 ], "bp2_params": [ -0.503, 0.247, -0.179, -5.536, -5.698, 3.598 ], "groove_widths": [ 16.985, 15.747, 20.231, 12.843 ], "simple_Rise": 3.297, "simple_Twist": 33.189, "simple_hRise": 2.562, "simple_hTwist": 35.154 }, { "index": 8, "nt1": "///A/22", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.503, 0.247, -0.179, -5.536, -5.698, 3.598 ], "step_params": [ -0.521, -2.124, 3.479, 0.670, 4.964, 31.803 ], "heli_params": [ -4.730, 1.060, 3.109, 8.989, -1.213, 32.185 ], "bp2_params": [ -0.074, -0.146, -0.347, -11.912, -13.589, -5.972 ], "groove_widths": [ 16.371, 15.610, 14.679, 11.743 ], "simple_Rise": 3.479, "simple_Twist": 29.377, "simple_hRise": 3.074, "simple_hTwist": 29.791 }, { "index": 9, "nt1": "///A/23", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.074, -0.146, -0.347, -11.912, -13.589, -5.972 ], "step_params": [ -2.173, -1.102, 3.370, -0.794, 3.502, 105.010 ], "heli_params": [ -0.744, 1.358, 3.355, 2.206, 0.500, 105.053 ], "bp2_params": [ 0.129, -0.900, 0.131, -13.745, 11.843, -155.854 ], "groove_widths": [ 17.513, 13.950, 14.842, 13.749 ], "simple_Rise": 3.370, "simple_Twist": 34.600, "simple_hRise": 3.294, "simple_hTwist": 34.780 }, { "index": 10, "nt1": "///A/24", "nt2": "///A/31", "bp": "U+A", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ 0.129, -0.900, 0.131, -13.745, 11.843, -155.854 ], "step_params": [ -3.104, 0.423, 3.083, 9.557, 0.847, -0.696 ], "heli_params": [ -5.635, 16.584, 3.270, -7.582, 85.528, -9.620 ], "bp2_params": [ 4.221, -2.373, 0.359, -5.186, 13.775, -93.097 ], "groove_widths": [ 16.601, null, 25.255, null ], "simple_Rise": 3.083, "simple_Twist": 43.098, "simple_hRise": 2.383, "simple_hTwist": 44.103 }, { "index": 11, "nt1": "///A/25", "nt2": "///A/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.221, -2.373, 0.359, -5.186, 13.775, -93.097 ], "step_params": [ 0.278, 1.718, 2.750, 12.738, -1.257, 118.941 ], "heli_params": [ 1.005, -0.057, 2.752, -0.729, -7.384, 119.362 ], "bp2_params": [ -4.384, 1.215, 0.810, -9.207, 18.981, -111.882 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.750, "simple_Twist": 166.994, "simple_hRise": 2.752, "simple_hTwist": 167.076 }, { "index": 12, "nt1": "///A/5", "nt2": "///A/42", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.384, 1.215, 0.810, -9.207, 18.981, -111.882 ], "step_params": [ 0.051, 2.060, 7.079, -20.158, 32.720, -8.415 ], "heli_params": [ -10.097, -4.258, -0.141, -66.505, -40.972, -39.308 ], "bp2_params": [ 0.494, 0.001, 1.005, -22.785, 3.572, 4.128 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.079, "simple_Twist": -32.719, "simple_hRise": 3.424, "simple_hTwist": -50.069 }, { "index": 13, "nt1": "///A/6", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 2, "strand1": "AGUCCUCC", "strand2": "UCGGGGGG", "bp_type": "||||||||", "helix_form": "..xA..x", "helical_rise": 3.334, "helical_rise_std": 0.635, "helical_radius": 8.944, "helical_radius_std": 2.343, "helical_axis": [ -0.087, -0.417, -0.905 ], "point1": [ 0.340, 7.606, 45.806 ], "point2": [ -1.715, -2.248, 24.448 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.445, -0.261, 0.055, 0.158, -12.077, -3.677 ], "step_params": [ 0.705, -1.401, 3.496, -0.334, 12.822, 40.508 ], "heli_params": [ -3.252, -1.009, 2.935, 17.982, 0.469, 42.408 ], "bp2_params": [ 0.049, -0.222, 0.361, -12.061, -27.331, 4.629 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.496, "simple_Twist": 37.403, "simple_hRise": 2.876, "simple_hTwist": 39.467 }, { "index": 2, "nt1": "///B/3", "nt2": "///B/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.222, 0.361, -12.061, -27.331, 4.629 ], "step_params": [ -0.520, -1.147, 3.451, 3.012, 2.783, 45.987 ], "heli_params": [ -1.711, 0.930, 3.341, 3.554, -3.846, 46.160 ], "bp2_params": [ 2.203, -0.300, 0.376, -22.761, -16.060, -6.528 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.451, "simple_Twist": 34.310, "simple_hRise": 3.294, "simple_hTwist": 34.547 }, { "index": 3, "nt1": "///B/4", "nt2": "///B/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.203, -0.300, 0.376, -22.761, -16.060, -6.528 ], "step_params": [ -3.432, -0.526, 2.896, 21.817, -3.180, 57.065 ], "heli_params": [ -0.409, 4.144, 1.630, -3.200, -21.955, 60.841 ], "bp2_params": [ -0.079, -0.075, -0.143, 14.565, -14.843, 2.628 ], "groove_widths": [ 16.382, null, 11.538, null ], "simple_Rise": 2.896, "simple_Twist": 70.273, "simple_hRise": 1.924, "simple_hTwist": 73.224 }, { "index": 4, "nt1": "///B/7", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.079, -0.075, -0.143, 14.565, -14.843, 2.628 ], "step_params": [ -0.137, -1.682, 3.581, -1.911, 3.575, 36.093 ], "heli_params": [ -3.235, -0.066, 3.407, 5.747, 3.072, 36.312 ], "bp2_params": [ 0.507, -0.046, 0.107, 3.465, -5.758, 5.172 ], "groove_widths": [ 15.982, 14.670, 12.026, 12.010 ], "simple_Rise": 3.581, "simple_Twist": 32.514, "simple_hRise": 3.384, "simple_hTwist": 32.759 }, { "index": 5, "nt1": "///B/8", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.507, -0.046, 0.107, 3.465, -5.758, 5.172 ], "step_params": [ -0.112, -1.465, 3.356, 4.459, 3.254, 39.497 ], "heli_params": [ -2.527, 0.683, 3.199, 4.786, -6.559, 39.865 ], "bp2_params": [ 2.367, -0.611, -0.027, 1.158, -9.269, -1.772 ], "groove_widths": [ 16.168, null, 14.542, null ], "simple_Rise": 3.356, "simple_Twist": 29.266, "simple_hRise": 3.127, "simple_hTwist": 29.771 }, { "index": 6, "nt1": "///B/9", "nt2": "///B/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.367, -0.611, -0.027, 1.158, -9.269, -1.772 ], "step_params": [ 0.266, -1.982, 3.323, 3.656, 2.723, 22.206 ], "heli_params": [ -6.018, 0.631, 3.064, 6.977, -9.365, 22.663 ], "bp2_params": [ -0.099, -0.197, -0.071, -2.080, -12.393, 3.001 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.323, "simple_Twist": 35.844, "simple_hRise": 3.180, "simple_hTwist": 36.123 }, { "index": 7, "nt1": "///B/10", "nt2": "///B/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.099, -0.197, -0.071, -2.080, -12.393, 3.001 ], "step_params": [ 0.278, -1.321, 3.037, -1.005, 7.185, 30.611 ], "heli_params": [ -3.626, -0.679, 2.656, 13.375, 1.870, 31.439 ], "bp2_params": [ -1.072, -0.081, 0.248, 5.935, -9.163, -12.629 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.037, "simple_Twist": 35.143, "simple_hRise": 2.714, "simple_hTwist": 35.861 }, { "index": 8, "nt1": "///B/11", "nt2": "///B/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "GCCUACAGGUUAC", "strand2": "CGGAUGUCCAAAG", "bp_type": "|||||||||...|", "helix_form": "xAAAAAAAxxxx", "helical_rise": 2.788, "helical_rise_std": 1.125, "helical_radius": 10.300, "helical_radius_std": 3.427, "helical_axis": [ -0.115, -0.640, 0.760 ], "point1": [ 14.559, 5.059, 10.432 ], "point2": [ 10.706, -16.300, 35.792 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///B/14", "nt2": "///B/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.308, -0.170, -0.685, 3.550, 0.156, 16.100 ], "step_params": [ 1.002, -2.994, 3.160, -5.267, 3.658, 11.696 ], "heli_params": [ -15.855, -8.578, 1.561, 16.430, 23.655, 13.334 ], "bp2_params": [ -0.519, -0.128, -0.251, 10.703, -10.903, -9.730 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.160, "simple_Twist": 7.415, "simple_hRise": 0.739, "simple_hTwist": 9.800 }, { "index": 2, "nt1": "///B/16", "nt2": "///B/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.519, -0.128, -0.251, 10.703, -10.903, -9.730 ], "step_params": [ 0.212, -1.929, 3.531, -3.223, 0.591, 36.379 ], "heli_params": [ -3.166, -0.815, 3.469, 0.944, 5.150, 36.522 ], "bp2_params": [ 0.610, 0.001, 0.245, 1.041, -15.017, -1.940 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.531, "simple_Twist": 30.002, "simple_hRise": 3.452, "simple_hTwist": 30.176 }, { "index": 3, "nt1": "///B/17", "nt2": "///B/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.610, 0.001, 0.245, 1.041, -15.017, -1.940 ], "step_params": [ -0.232, -1.448, 3.231, -0.727, 9.513, 32.547 ], "heli_params": [ -3.906, 0.290, 2.717, 16.536, 1.263, 33.880 ], "bp2_params": [ -0.040, -0.003, 0.425, -3.715, -9.190, -0.534 ], "groove_widths": [ 17.008, null, 18.176, null ], "simple_Rise": 3.231, "simple_Twist": 35.934, "simple_hRise": 2.775, "simple_hTwist": 37.139 }, { "index": 4, "nt1": "///B/18", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.003, 0.425, -3.715, -9.190, -0.534 ], "step_params": [ -0.636, -1.213, 2.923, -0.417, 11.098, 27.488 ], "heli_params": [ -4.314, 1.171, 2.280, 22.239, 0.835, 29.606 ], "bp2_params": [ -1.004, 0.120, 0.252, 1.918, -11.631, -6.596 ], "groove_widths": [ 17.768, 16.650, 15.693, 13.447 ], "simple_Rise": 2.923, "simple_Twist": 32.601, "simple_hRise": 2.401, "simple_hTwist": 34.392 }, { "index": 5, "nt1": "///B/19", "nt2": "///B/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.004, 0.120, 0.252, 1.918, -11.631, -6.596 ], "step_params": [ 0.011, -1.715, 3.269, -0.033, 7.474, 41.744 ], "heli_params": [ -3.101, -0.019, 2.934, 10.389, 0.046, 42.378 ], "bp2_params": [ 0.706, -0.306, 0.225, -0.056, -16.901, -11.168 ], "groove_widths": [ 17.535, 16.359, 16.555, 11.764 ], "simple_Rise": 3.269, "simple_Twist": 33.169, "simple_hRise": 2.827, "simple_hTwist": 33.978 }, { "index": 6, "nt1": "///B/20", "nt2": "///B/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.706, -0.306, 0.225, -0.056, -16.901, -11.168 ], "step_params": [ -0.031, -1.945, 3.077, -3.994, 10.521, 18.452 ], "heli_params": [ -8.512, -1.177, 1.700, 29.515, 11.205, 21.587 ], "bp2_params": [ -0.924, -0.125, 0.279, 0.029, -14.242, 1.419 ], "groove_widths": [ 17.365, 16.059, 16.970, 14.812 ], "simple_Rise": 3.077, "simple_Twist": 26.952, "simple_hRise": 2.163, "simple_hTwist": 29.167 }, { "index": 7, "nt1": "///B/21", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.924, -0.125, 0.279, 0.029, -14.242, 1.419 ], "step_params": [ -0.264, -1.506, 3.195, -1.797, 6.159, 33.632 ], "heli_params": [ -3.471, 0.182, 2.892, 10.526, 3.070, 34.221 ], "bp2_params": [ -0.467, 0.022, -0.035, -2.010, -6.129, 3.846 ], "groove_widths": [ 16.920, 15.615, 20.197, 13.167 ], "simple_Rise": 3.195, "simple_Twist": 31.181, "simple_hRise": 2.863, "simple_hTwist": 31.818 }, { "index": 8, "nt1": "///B/22", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.467, 0.022, -0.035, -2.010, -6.129, 3.846 ], "step_params": [ -0.227, -2.088, 3.475, 1.696, 7.235, 33.517 ], "heli_params": [ -4.670, 0.649, 2.958, 12.358, -2.896, 34.308 ], "bp2_params": [ 0.155, -0.163, -0.358, -11.139, -12.183, -3.944 ], "groove_widths": [ 16.312, 15.479, 14.177, 10.823 ], "simple_Rise": 3.475, "simple_Twist": 30.012, "simple_hRise": 2.888, "simple_hTwist": 30.898 }, { "index": 9, "nt1": "///B/23", "nt2": "///B/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.163, -0.358, -11.139, -12.183, -3.944 ], "step_params": [ -2.250, -1.152, 3.410, 1.071, 4.916, 105.675 ], "heli_params": [ -0.791, 1.426, 3.354, 3.083, -0.672, 105.759 ], "bp2_params": [ 0.250, -0.719, 0.054, -13.154, 12.922, -155.376 ], "groove_widths": [ 17.656, 13.890, 15.020, 14.044 ], "simple_Rise": 3.410, "simple_Twist": 37.132, "simple_hRise": 3.173, "simple_hTwist": 37.460 }, { "index": 10, "nt1": "///B/24", "nt2": "///B/31", "bp": "U+A", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ 0.250, -0.719, 0.054, -13.154, 12.922, -155.376 ], "step_params": [ -3.089, 0.327, 3.079, 9.044, 0.888, -2.522 ], "heli_params": [ -5.078, 12.657, 3.755, -7.280, 74.166, -9.430 ], "bp2_params": [ 4.062, -2.119, 0.397, -4.762, 12.623, -92.905 ], "groove_widths": [ 16.758, null, 25.375, null ], "simple_Rise": 3.079, "simple_Twist": 42.002, "simple_hRise": 2.401, "simple_hTwist": 42.931 }, { "index": 11, "nt1": "///B/25", "nt2": "///B/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.062, -2.119, 0.397, -4.762, 12.623, -92.905 ], "step_params": [ 0.306, 1.913, 2.736, 12.692, -1.980, 119.912 ], "heli_params": [ 1.118, -0.076, 2.731, -1.142, -7.321, 120.328 ], "bp2_params": [ -4.340, 1.123, 0.886, -6.983, 18.101, -109.785 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.736, "simple_Twist": 166.209, "simple_hRise": 2.736, "simple_hTwist": 166.296 }, { "index": 12, "nt1": "///B/5", "nt2": "///B/42", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.340, 1.123, 0.886, -6.983, 18.101, -109.785 ], "step_params": [ -0.045, 2.067, 7.002, -17.560, 30.660, -7.472 ], "heli_params": [ -10.916, -4.414, -0.303, -68.065, -38.983, -36.089 ], "bp2_params": [ 0.572, -0.089, 0.837, -18.617, 1.028, 1.999 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.002, "simple_Twist": -32.016, "simple_hRise": 3.490, "simple_hTwist": -47.334 }, { "index": 13, "nt1": "///B/6", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 6, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AGU", "strand2": "UCG", "bp_type": "|||", "helix_form": "..", "helical_rise": 1.706, "helical_rise_std": 0.246, "helical_radius": 8.099, "helical_radius_std": 1.118, "helical_axis": [ 0.087, 0.391, -0.916 ], "point1": [ 34.050, -6.558, 36.321 ], "point2": [ 34.319, -5.347, 33.482 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///A/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.336, -0.122, -0.037, -0.808, -8.484, -1.263 ], "step_params": [ 0.628, -1.417, 3.434, -0.229, 13.175, 37.939 ], "heli_params": [ -3.547, -0.941, 2.805, 19.558, 0.340, 40.083 ], "bp2_params": [ 0.117, -0.006, 0.425, -11.057, -26.604, 5.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.434, "simple_Twist": 34.842, "simple_hRise": 2.735, "simple_hTwist": 37.178 }, { "index": 2, "nt1": "///A/3", "nt2": "///A/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.006, 0.425, -11.057, -26.604, 5.559 ], "step_params": [ -0.840, -1.007, 3.406, 3.191, 2.880, 48.539 ], "heli_params": [ -1.446, 1.268, 3.287, 3.495, -3.873, 48.717 ], "bp2_params": [ 2.549, -0.613, 0.193, -20.285, -18.029, -9.088 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.406, "simple_Twist": 35.106, "simple_hRise": 3.230, "simple_hTwist": 35.360 }, { "index": 3, "nt1": "///A/4", "nt2": "///A/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CCUC", "strand2": "GGGG", "bp_type": "||||", "helix_form": "A..", "helical_rise": 2.985, "helical_rise_std": 0.224, "helical_radius": 8.982, "helical_radius_std": 0.397, "helical_axis": [ 0.667, 0.401, -0.628 ], "point1": [ 36.866, 1.962, 31.868 ], "point2": [ 42.792, 5.524, 26.294 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/7", "nt2": "///A/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.084, -0.082, 13.438, -16.820, 4.505 ], "step_params": [ -0.444, -1.744, 3.654, -2.550, 4.244, 36.003 ], "heli_params": [ -3.443, 0.323, 3.455, 6.827, 4.101, 36.331 ], "bp2_params": [ 0.493, -0.159, 0.230, -1.529, -6.847, 4.922 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.654, "simple_Twist": 33.620, "simple_hRise": 3.438, "simple_hTwist": 33.973 }, { "index": 2, "nt1": "///A/8", "nt2": "///A/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.493, -0.159, 0.230, -1.529, -6.847, 4.922 ], "step_params": [ -0.101, -1.399, 3.091, 4.995, 3.553, 37.603 ], "heli_params": [ -2.561, 0.741, 2.915, 5.467, -7.686, 38.081 ], "bp2_params": [ 2.277, -0.314, -0.034, 3.917, -8.039, -2.242 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 28.306, "simple_hRise": 2.839, "simple_hTwist": 28.949 }, { "index": 3, "nt1": "///A/9", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.277, -0.314, -0.034, 3.917, -8.039, -2.242 ], "step_params": [ 0.159, -2.143, 3.469, 0.280, 0.370, 24.418 ], "heli_params": [ -5.187, -0.284, 3.438, 0.875, -0.662, 24.423 ], "bp2_params": [ 0.183, -0.355, 0.151, -1.751, -9.492, -1.952 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.469, "simple_Twist": 35.551, "simple_hRise": 3.448, "simple_hTwist": 35.554 }, { "index": 4, "nt1": "///A/10", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCUACAGG", "strand2": "GGAUGUCC", "bp_type": "||||||||", "helix_form": "AAAA.AA", "helical_rise": 2.457, "helical_rise_std": 0.274, "helical_radius": 9.550, "helical_radius_std": 1.151, "helical_axis": [ -0.266, 0.691, 0.672 ], "point1": [ 40.151, 1.333, 2.563 ], "point2": [ 35.621, 13.091, 13.988 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///A/16", "nt2": "///A/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.308, 0.012, -0.534, 11.089, -15.550, -3.211 ], "step_params": [ -0.229, -2.073, 3.852, -8.354, 2.958, 34.886 ], "heli_params": [ -3.847, -1.012, 3.627, 4.838, 13.664, 35.960 ], "bp2_params": [ 0.547, 0.118, 0.647, -5.795, -12.415, -5.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.852, "simple_Twist": 33.257, "simple_hRise": 3.610, "simple_hTwist": 34.386 }, { "index": 2, "nt1": "///A/17", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.547, 0.118, 0.647, -5.795, -12.415, -5.541 ], "step_params": [ -0.101, -1.417, 2.931, 5.535, 0.115, 35.446 ], "heli_params": [ -2.316, 0.872, 2.879, 0.188, -9.023, 35.862 ], "bp2_params": [ 0.657, -0.103, 0.003, 1.628, -13.107, -6.147 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.931, "simple_Twist": 34.922, "simple_hRise": 2.877, "simple_hTwist": 35.345 }, { "index": 3, "nt1": "///A/18", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.657, -0.103, 0.003, 1.628, -13.107, -6.147 ], "step_params": [ -0.316, -1.099, 3.252, 0.954, 22.749, 27.689 ], "heli_params": [ -4.707, 0.638, 1.843, 40.045, -1.679, 35.706 ], "bp2_params": [ -0.543, 0.308, -0.011, -4.927, -12.236, -9.182 ], "groove_widths": [ 17.816, null, 15.086, null ], "simple_Rise": 3.252, "simple_Twist": 33.968, "simple_hRise": 2.128, "simple_hTwist": 40.706 }, { "index": 4, "nt1": "///A/19", "nt2": "///A/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.543, 0.308, -0.011, -4.927, -12.236, -9.182 ], "step_params": [ -0.403, -1.639, 3.129, -2.672, 4.771, 41.939 ], "heli_params": [ -2.728, 0.304, 2.952, 6.632, 3.714, 42.278 ], "bp2_params": [ 1.021, -0.356, 0.340, -2.506, -15.377, -18.275 ], "groove_widths": [ 17.639, 16.485, 16.532, 11.118 ], "simple_Rise": 3.129, "simple_Twist": 34.148, "simple_hRise": 2.902, "simple_hTwist": 34.570 }, { "index": 5, "nt1": "///A/20", "nt2": "///A/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.021, -0.356, 0.340, -2.506, -15.377, -18.275 ], "step_params": [ -0.021, -2.188, 2.821, -1.382, 9.588, 17.374 ], "heli_params": [ -9.480, -0.390, 1.423, 28.995, 4.178, 19.874 ], "bp2_params": [ -0.704, -0.081, 0.280, 4.553, -10.027, -5.127 ], "groove_widths": [ 17.478, null, 16.786, null ], "simple_Rise": 2.821, "simple_Twist": 26.008, "simple_hRise": 1.907, "simple_hTwist": 27.724 }, { "index": 6, "nt1": "///A/21", "nt2": "///A/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.704, -0.081, 0.280, 4.553, -10.027, -5.127 ], "step_params": [ -0.172, -1.733, 3.297, -1.129, 11.703, 34.002 ], "heli_params": [ -4.357, 0.130, 2.583, 19.310, 1.863, 35.921 ], "bp2_params": [ -0.503, 0.247, -0.179, -5.536, -5.698, 3.598 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.297, "simple_Twist": 33.189, "simple_hRise": 2.562, "simple_hTwist": 35.154 }, { "index": 7, "nt1": "///A/22", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.503, 0.247, -0.179, -5.536, -5.698, 3.598 ], "step_params": [ -0.521, -2.124, 3.479, 0.670, 4.964, 31.803 ], "heli_params": [ -4.730, 1.060, 3.109, 8.989, -1.213, 32.185 ], "bp2_params": [ -0.074, -0.146, -0.347, -11.912, -13.589, -5.972 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.479, "simple_Twist": 29.377, "simple_hRise": 3.074, "simple_hTwist": 29.791 }, { "index": 8, "nt1": "///A/23", "nt2": "///A/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 3, "strand1": "AGU", "strand2": "UCG", "bp_type": "|||", "helix_form": "..", "helical_rise": 1.304, "helical_rise_std": 0.245, "helical_radius": 7.657, "helical_radius_std": 1.145, "helical_axis": [ 0.440, -0.340, -0.831 ], "point1": [ 1.544, 9.374, 41.637 ], "point2": [ 2.516, 8.622, 39.802 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.445, -0.261, 0.055, 0.158, -12.077, -3.677 ], "step_params": [ 0.705, -1.401, 3.496, -0.334, 12.822, 40.508 ], "heli_params": [ -3.252, -1.009, 2.935, 17.982, 0.469, 42.408 ], "bp2_params": [ 0.049, -0.222, 0.361, -12.061, -27.331, 4.629 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.496, "simple_Twist": 37.403, "simple_hRise": 2.876, "simple_hTwist": 39.467 }, { "index": 2, "nt1": "///B/3", "nt2": "///B/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.222, 0.361, -12.061, -27.331, 4.629 ], "step_params": [ -0.520, -1.147, 3.451, 3.012, 2.783, 45.987 ], "heli_params": [ -1.711, 0.930, 3.341, 3.554, -3.846, 46.160 ], "bp2_params": [ 2.203, -0.300, 0.376, -22.761, -16.060, -6.528 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.451, "simple_Twist": 34.310, "simple_hRise": 3.294, "simple_hTwist": 34.547 }, { "index": 3, "nt1": "///B/4", "nt2": "///B/36", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "CCUC", "strand2": "GGGG", "bp_type": "||||", "helix_form": "A..", "helical_rise": 2.855, "helical_rise_std": 0.130, "helical_radius": 9.026, "helical_radius_std": 0.483, "helical_axis": [ -0.326, -0.429, -0.842 ], "point1": [ 1.173, 0.955, 36.428 ], "point2": [ -1.584, -2.672, 29.303 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/7", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.079, -0.075, -0.143, 14.565, -14.843, 2.628 ], "step_params": [ -0.137, -1.682, 3.581, -1.911, 3.575, 36.093 ], "heli_params": [ -3.235, -0.066, 3.407, 5.747, 3.072, 36.312 ], "bp2_params": [ 0.507, -0.046, 0.107, 3.465, -5.758, 5.172 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.581, "simple_Twist": 32.514, "simple_hRise": 3.384, "simple_hTwist": 32.759 }, { "index": 2, "nt1": "///B/8", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.507, -0.046, 0.107, 3.465, -5.758, 5.172 ], "step_params": [ -0.112, -1.465, 3.356, 4.459, 3.254, 39.497 ], "heli_params": [ -2.527, 0.683, 3.199, 4.786, -6.559, 39.865 ], "bp2_params": [ 2.367, -0.611, -0.027, 1.158, -9.269, -1.772 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.356, "simple_Twist": 29.266, "simple_hRise": 3.127, "simple_hTwist": 29.771 }, { "index": 3, "nt1": "///B/9", "nt2": "///B/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.367, -0.611, -0.027, 1.158, -9.269, -1.772 ], "step_params": [ 0.266, -1.982, 3.323, 3.656, 2.723, 22.206 ], "heli_params": [ -6.018, 0.631, 3.064, 6.977, -9.365, 22.663 ], "bp2_params": [ -0.099, -0.197, -0.071, -2.080, -12.393, 3.001 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.323, "simple_Twist": 35.844, "simple_hRise": 3.180, "simple_hTwist": 36.123 }, { "index": 4, "nt1": "///B/10", "nt2": "///B/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 4, "strand1": "CCUACAGG", "strand2": "GGAUGUCC", "bp_type": "||||||||", "helix_form": "AAAAAAA", "helical_rise": 2.509, "helical_rise_std": 0.260, "helical_radius": 9.575, "helical_radius_std": 1.089, "helical_axis": [ -0.084, -0.668, 0.740 ], "point1": [ 11.770, 1.241, 8.971 ], "point2": [ 10.313, -10.367, 21.827 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///B/16", "nt2": "///B/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.519, -0.128, -0.251, 10.703, -10.903, -9.730 ], "step_params": [ 0.212, -1.929, 3.531, -3.223, 0.591, 36.379 ], "heli_params": [ -3.166, -0.815, 3.469, 0.944, 5.150, 36.522 ], "bp2_params": [ 0.610, 0.001, 0.245, 1.041, -15.017, -1.940 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.531, "simple_Twist": 30.002, "simple_hRise": 3.452, "simple_hTwist": 30.176 }, { "index": 2, "nt1": "///B/17", "nt2": "///B/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.610, 0.001, 0.245, 1.041, -15.017, -1.940 ], "step_params": [ -0.232, -1.448, 3.231, -0.727, 9.513, 32.547 ], "heli_params": [ -3.906, 0.290, 2.717, 16.536, 1.263, 33.880 ], "bp2_params": [ -0.040, -0.003, 0.425, -3.715, -9.190, -0.534 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.231, "simple_Twist": 35.934, "simple_hRise": 2.775, "simple_hTwist": 37.139 }, { "index": 3, "nt1": "///B/18", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.003, 0.425, -3.715, -9.190, -0.534 ], "step_params": [ -0.636, -1.213, 2.923, -0.417, 11.098, 27.488 ], "heli_params": [ -4.314, 1.171, 2.280, 22.239, 0.835, 29.606 ], "bp2_params": [ -1.004, 0.120, 0.252, 1.918, -11.631, -6.596 ], "groove_widths": [ 17.768, null, 15.693, null ], "simple_Rise": 2.923, "simple_Twist": 32.601, "simple_hRise": 2.401, "simple_hTwist": 34.392 }, { "index": 4, "nt1": "///B/19", "nt2": "///B/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.004, 0.120, 0.252, 1.918, -11.631, -6.596 ], "step_params": [ 0.011, -1.715, 3.269, -0.033, 7.474, 41.744 ], "heli_params": [ -3.101, -0.019, 2.934, 10.389, 0.046, 42.378 ], "bp2_params": [ 0.706, -0.306, 0.225, -0.056, -16.901, -11.168 ], "groove_widths": [ 17.535, 16.359, 16.555, 11.764 ], "simple_Rise": 3.269, "simple_Twist": 33.169, "simple_hRise": 2.827, "simple_hTwist": 33.978 }, { "index": 5, "nt1": "///B/20", "nt2": "///B/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.706, -0.306, 0.225, -0.056, -16.901, -11.168 ], "step_params": [ -0.031, -1.945, 3.077, -3.994, 10.521, 18.452 ], "heli_params": [ -8.512, -1.177, 1.700, 29.515, 11.205, 21.587 ], "bp2_params": [ -0.924, -0.125, 0.279, 0.029, -14.242, 1.419 ], "groove_widths": [ 17.365, null, 16.970, null ], "simple_Rise": 3.077, "simple_Twist": 26.952, "simple_hRise": 2.163, "simple_hTwist": 29.167 }, { "index": 6, "nt1": "///B/21", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.924, -0.125, 0.279, 0.029, -14.242, 1.419 ], "step_params": [ -0.264, -1.506, 3.195, -1.797, 6.159, 33.632 ], "heli_params": [ -3.471, 0.182, 2.892, 10.526, 3.070, 34.221 ], "bp2_params": [ -0.467, 0.022, -0.035, -2.010, -6.129, 3.846 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.195, "simple_Twist": 31.181, "simple_hRise": 2.863, "simple_hTwist": 31.818 }, { "index": 7, "nt1": "///B/22", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.467, 0.022, -0.035, -2.010, -6.129, 3.846 ], "step_params": [ -0.227, -2.088, 3.475, 1.696, 7.235, 33.517 ], "heli_params": [ -4.670, 0.649, 2.958, 12.358, -2.896, 34.308 ], "bp2_params": [ 0.155, -0.163, -0.358, -11.139, -12.183, -3.944 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.475, "simple_Twist": 30.012, "simple_hRise": 2.888, "simple_hTwist": 30.898 }, { "index": 8, "nt1": "///B/23", "nt2": "///B/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 6, "isoCanonPairs": [ { "index": -1, "helix_index": 2, "nt1": "///A/6", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 1, "nt1": "///A/11", "nt2": "///A/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 2, "nt1": "///A/14", "nt2": "///A/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 4, "nt1": "///B/6", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -5, "helix_index": 3, "nt1": "///B/11", "nt2": "///B/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -6, "helix_index": 4, "nt1": "///B/14", "nt2": "///B/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 3, "num_stems": 2, "stem_indices": [ 4, 5 ] } ], "num_stacks": 21, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/1,///A/2" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/10,///A/11" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/12,///A/13" }, { "index": 4, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/14,///A/16" }, { "index": 5, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/30,///A/32" }, { "index": 6, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/35,///A/36" }, { "index": 7, "num_nts": 2, "nts_short": "AU", "nts_long": "///A/39,///A/40" }, { "index": 8, "num_nts": 2, "nts_short": "CC", "nts_long": "///B/10,///B/11" }, { "index": 9, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/12,///B/13" }, { "index": 10, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/14,///B/16" }, { "index": 11, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/30,///B/32" }, { "index": 12, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/35,///B/36" }, { "index": 13, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/39,///B/40" }, { "index": 14, "num_nts": 3, "nts_short": "AGU", "nts_long": "///A/42,///A/43,///A/44" }, { "index": 15, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/42,///B/43,///B/44" }, { "index": 16, "num_nts": 4, "nts_short": "GUUG", "nts_long": "///A/23,///A/24,///A/25,///A/26" }, { "index": 17, "num_nts": 4, "nts_short": "GCAG", "nts_long": "///A/52,///A/53,///A/54,///A/55" }, { "index": 18, "num_nts": 4, "nts_short": "GUUG", "nts_long": "///B/23,///B/24,///B/25,///B/26" }, { "index": 19, "num_nts": 4, "nts_short": "GCAG", "nts_long": "///B/52,///B/53,///B/54,///B/55" }, { "index": 20, "num_nts": 6, "nts_short": "GAAAAC", "nts_long": "///A/27,///A/28,///A/5,///A/29,///A/31,///A/45" }, { "index": 21, "num_nts": 6, "nts_short": "GAAAAC", "nts_long": "///B/27,///B/28,///B/5,///B/29,///B/31,///B/45" } ], "nonStack": { "num_nts": 6, "nts_short": "CCCCCC", "nts_long": "///A/6,///A/15,///A/41,///B/6,///B/15,///B/41" }, "num_atom2bases": 6, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/16/O4'", "nt": "///A/14", "vert_dist": 3.127 }, { "index": 2, "type": "phosphate", "atom": "///A/28/OP2", "nt": "///A/26", "vert_dist": 3.001 }, { "index": 3, "type": "sugar", "atom": "///A/45/O4'", "nt": "///A/31", "vert_dist": 3.469 }, { "index": 4, "type": "sugar", "atom": "///B/53/O4'", "nt": "///B/13", "vert_dist": 3.047 }, { "index": 5, "type": "sugar", "atom": "///B/16/O4'", "nt": "///B/14", "vert_dist": 3.100 }, { "index": 6, "type": "phosphate", "atom": "///B/28/OP2", "nt": "///B/26", "vert_dist": 2.976 } ], "num_hairpins": 6, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 20 ], "stem_indices": [ -1 ], "summary": "[1] 20 [A.6 A.27] 1", "num_nts": 22, "nts_short": "CCCUCCAAGCCCUACAGGUUGG", "nts_long": "///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 20, "nts_short": "CCUCCAAGCCCUACAGGUUG", "nts_long": "///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 18 ], "stem_indices": [ -2 ], "summary": "[1] 18 [A.11 A.30] 1", "num_nts": 20, "nts_short": "CAAGCCCUACAGGUUGGAAG", "nts_long": "///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27,///A/28,///A/29,///A/30", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 18, "nts_short": "AAGCCCUACAGGUUGGAA", "nts_long": "///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27,///A/28,///A/29" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 21 ], "stem_indices": [ 3 ], "summary": "[1] 21 [A.23 A.45] 8", "num_nts": 23, "nts_short": "GUUGGAAGAGGGGGCUAUCAGUC", "nts_long": "///A/23,///A/24,///A/25,///A/26,///A/27,///A/28,///A/29,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40,///A/41,///A/42,///A/43,///A/44,///A/45", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 21, "nts_short": "UUGGAAGAGGGGGCUAUCAGU", "nts_long": "///A/24,///A/25,///A/26,///A/27,///A/28,///A/29,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40,///A/41,///A/42,///A/43,///A/44" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 20 ], "stem_indices": [ -4 ], "summary": "[1] 20 [B.6 B.27] 1", "num_nts": 22, "nts_short": "CCCUCCAAGCCCUACAGGUUGG", "nts_long": "///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22,///B/23,///B/24,///B/25,///B/26,///B/27", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 20, "nts_short": "CCUCCAAGCCCUACAGGUUG", "nts_long": "///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22,///B/23,///B/24,///B/25,///B/26" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 18 ], "stem_indices": [ -5 ], "summary": "[1] 18 [B.11 B.30] 1", "num_nts": 20, "nts_short": "CAAGCCCUACAGGUUGGAAG", "nts_long": "///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22,///B/23,///B/24,///B/25,///B/26,///B/27,///B/28,///B/29,///B/30", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 18, "nts_short": "AAGCCCUACAGGUUGGAA", "nts_long": "///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22,///B/23,///B/24,///B/25,///B/26,///B/27,///B/28,///B/29" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 21 ], "stem_indices": [ 6 ], "summary": "[1] 21 [B.23 B.45] 8", "num_nts": 23, "nts_short": "GUUGGAAGAGGGGGCUAUCAGUC", "nts_long": "///B/23,///B/24,///B/25,///B/26,///B/27,///B/28,///B/29,///B/30,///B/31,///B/32,///B/33,///B/34,///B/35,///B/36,///B/37,///B/38,///B/39,///B/40,///B/41,///B/42,///B/43,///B/44,///B/45", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 21, "nts_short": "UUGGAAGAGGGGGCUAUCAGU", "nts_long": "///B/24,///B/25,///B/26,///B/27,///B/28,///B/29,///B/30,///B/31,///B/32,///B/33,///B/34,///B/35,///B/36,///B/37,///B/38,///B/39,///B/40,///B/41,///B/42,///B/43,///B/44" } ] } ], "num_bulges": 6, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 2, -2 ], "summary": "[2] 0 1 [A.10 A.32 A.11 A.30] 4 1", "num_nts": 5, "nts_short": "CCGAG", "nts_long": "///A/10,///A/11,///A/30,///A/31,///A/32", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///A/31" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ -3, 3 ], "summary": "[2] 1 0 [A.14 A.53 A.16 A.52] 1 8", "num_nts": 5, "nts_short": "GCCGC", "nts_long": "///A/14,///A/15,///A/16,///A/52,///A/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///A/15" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 3, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 5, -5 ], "summary": "[2] 0 1 [B.10 B.32 B.11 B.30] 4 1", "num_nts": 5, "nts_short": "CCGAG", "nts_long": "///B/10,///B/11,///B/30,///B/31,///B/32", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/31" } ] }, { "index": 4, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ -6, 6 ], "summary": "[2] 1 0 [B.14 B.53 B.16 B.52] 1 8", "num_nts": 5, "nts_short": "GCCGC", "nts_long": "///B/14,///B/15,///B/16,///B/52,///B/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///B/15" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 5, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 0 [A.4 A.36 A.7 A.35] 3 4", "num_nts": 6, "nts_short": "UACCGG", "nts_long": "///A/4,///A/5,///A/6,///A/7,///A/35,///A/36", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///A/5,///A/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 6, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ 4, 5 ], "summary": "[2] 2 0 [B.4 B.36 B.7 B.35] 3 4", "num_nts": 6, "nts_short": "UACCGG", "nts_long": "///B/4,///B/5,///B/6,///B/7,///B/35,///B/36", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///B/5,///B/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/1" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/54,///A/55" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/54,///B/55" } ], "num_kissingLoops": 4, "kissingLoops": [ { "index": 1, "stem_index": -5, "is_isoCanonPair": true, "hairpin_indices": [ 4, 6 ] }, { "index": 2, "stem_index": -2, "is_isoCanonPair": true, "hairpin_indices": [ 1, 3 ] }, { "index": 3, "stem_index": 2, "hairpin_indices": [ 1, 3 ] }, { "index": 4, "stem_index": 5, "hairpin_indices": [ 4, 6 ] } ], "num_Aminors": 4, "Aminors": [ { "index": 1, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///A/12 vs ///A/17,///A/51", "A_nt1": { "desc": "///A/12 vs ///A/17", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[3.13]" }, "A_nt2": { "desc": "///A/12 vs ///A/51", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 2, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///A/13 vs ///A/16,///A/52", "A_nt1": { "desc": "///A/13 vs ///A/16", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.58],O2'(hydroxyl)-O2(carbonyl)[2.63]" }, "A_nt2": { "desc": "///A/13 vs ///A/52", "face_type": "+", "hbonds_num": 3, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.33],N1-O2'(hydroxyl)[2.91],N3-N2(amino)[2.85]" } }, { "index": 3, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///B/12 vs ///B/17,///B/51", "A_nt1": { "desc": "///B/12 vs ///B/17", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O3'[2.88],O2'(hydroxyl)-O2'(hydroxyl)[3.02]" }, "A_nt2": { "desc": "///B/12 vs ///B/51", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 4, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///B/13 vs ///B/16,///B/52", "A_nt1": { "desc": "///B/13 vs ///B/16", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.56],O2'(hydroxyl)-O2(carbonyl)[2.46]" }, "A_nt2": { "desc": "///B/13 vs ///B/52", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.02],N3-N2(amino)[2.85]" } } ], "num_riboseZippers": 2, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "AACC", "nts_long": "///A/12,///A/13,///A/16,///A/17" }, { "index": 2, "num_nts": 4, "nts_short": "AACC", "nts_long": "///B/12,///B/13,///B/16,///B/17" } ], "num_splayUnits": 14, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/4,///A/5" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/6,///A/7" }, { "index": 3, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/11,///A/12" }, { "index": 4, "num_nts": 3, "nts_short": "GCC", "nts_long": "///A/14,///A/15,///A/16" }, { "index": 5, "num_nts": 4, "nts_short": "AGAG", "nts_long": "///A/29,///A/30,///A/31,///A/32" }, { "index": 6, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/38,///A/39" }, { "index": 7, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/44,///A/45" }, { "index": 8, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/4,///B/5" }, { "index": 9, "num_nts": 2, "nts_short": "CC", "nts_long": "///B/6,///B/7" }, { "index": 10, "num_nts": 2, "nts_short": "CA", "nts_long": "///B/11,///B/12" }, { "index": 11, "num_nts": 3, "nts_short": "GCC", "nts_long": "///B/14,///B/15,///B/16" }, { "index": 12, "num_nts": 4, "nts_short": "AGAG", "nts_long": "///B/29,///B/30,///B/31,///B/32" }, { "index": 13, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/38,///B/39" }, { "index": 14, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/44,///B/45" } ], "pseudoknot_order": 2, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 32, "nts_short": "AGUCCUCCGGGGGGCUAGUCCUCCGGGGGGCU", "nts_long": "///A/2,///A/3,///A/4,///A/7,///A/8,///A/9,///A/10,///A/11,///A/30,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///B/2,///B/3,///B/4,///B/7,///B/8,///B/9,///B/10,///B/11,///B/30,///B/32,///B/33,///B/34,///B/35,///B/36,///B/37,///B/38" }, { "index": 2, "symbols": "{}", "num_nts": 4, "nts_short": "CGCG", "nts_long": "///A/6,///A/27,///B/6,///B/27" } ], "dbn": { "all_chains": { "num_nts": 109, "num_chars": 110, "bseq": "AAGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG&AGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG", "sstr": ".[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..&[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..", "form": ".AA...AAAA.B....AAAAAAAA.......AAA..A.......AA.AAAA...-&AA...AAAA.B...AAAAAAAAA........AA..A.......AA.AAAA.AA-" }, "chain_A": { "num_nts": 55, "num_chars": 55, "bseq": "AAGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG", "sstr": ".[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..", "form": ".AA...AAAA.B....AAAAAAAA.......AAA..A.......AA.AAAA...-" }, "chain_B": { "num_nts": 54, "num_chars": 54, "bseq": "AGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG", "sstr": "[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..", "form": "AA...AAAA.B...AAAAAAAAA........AA..A.......AA.AAAA.AA-" } }, "chains": { "chain_A": { "num_nts": 55, "bseq": "AAGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG", "sstr": ".[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..", "form": ".AA...AAAA.B....AAAAAAAA.......AAA..A.......AA.AAAA...-", "helical_rise": 0.076, "helical_rise_std": 3.104, "helical_axis": [ -0.575, -0.749, -0.331 ], "point1": [ 28.473, -4.308, 17.009 ], "point2": [ 26.283, -7.161, 15.749 ], "num_chars": 163, "suite": "A1LA1aG1aU!!A2[C2aC1aC1aU1aC!!C!!A!!A!!G6pC2hC1aC!!U1LA1aC!!A1aG1aG1aU1aU1aG1gG1aA1bA4pG2uA!!G1aG1aG1aG1aG1aC1bU!!A1bU4aC1aA1aG1bU!!C1aC1aU1eG1aU1aA!!G1aG1aC!!A1cG" }, "chain_B": { "num_nts": 54, "bseq": "AGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGUAGGCAG", "sstr": "[[[.{[[[[[..(.((((((((...}..].]]]]]]]......)))))))))..", "form": "AA...AAAA.B...AAAAAAAAA........AA..A.......AA.AAAA.AA-", "helical_rise": 0.098, "helical_rise_std": 3.114, "helical_axis": [ 0.709, 0.704, -0.025 ], "point1": [ 14.859, 5.227, 27.399 ], "point2": [ 18.394, 8.736, 27.275 ], "num_chars": 160, "suite": "A1aG1aU!!A2[C2aC1aC1aU1aC!!C!!A!!A!!G6pC2hC1aC1aU!!A1aC1aA1aG1aG1aU1aU1cG!!G1aA1bA4pG!!A!!G1aG1aG1aG1aG1aC1bU!!A1bU4aC1aA!!G1bU!!C1aC1aU1eG1aU1aA1aG1cG1aC1aA1cG" } }, "num_nts": 109, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 170.262, "delta": 83.748, "epsilon": -113.278, "zeta": -79.668, "epsilon_zeta": -33.610, "bb_type": "--", "chi": 178.405, "glyco_bond": "anti", "C5prime_xyz": [ -1.753, 8.419, 1.737 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.521, "Dp": 4.579, "splay_angle": 23.643, "splay_distance": 3.724, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.786, "v1": -20.120, "v2": 32.103, "v3": -33.459, "v4": 21.613, "amplitude": 34.139, "phase_angle": 19.886, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 27.369, -7.809, 37.802 ], "x_axis": [ 0.758, 0.398, 0.517 ], "y_axis": [ 0.635, -0.631, -0.445 ], "z_axis": [ 0.149, 0.666, -0.731 ], "quaternion": [ -0.315, 0.883, 0.292, 0.189 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -67.927, "beta": 145.974, "gamma": 61.521, "delta": 78.969, "epsilon": -145.290, "zeta": -73.009, "epsilon_zeta": -72.281, "bb_type": "BI", "chi": -168.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 8.645, 0.993 ], "P_xyz": [ 0.970, 9.042, 0.507 ], "form": "A", "ssZp": 4.617, "Dp": 4.683, "splay_angle": 26.122, "splay_distance": 4.032, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 145.691, "theta": -140.397, "eta_prime": 172.262, "theta_prime": -142.567, "eta_base": -109.881, "theta_base": -108.900, "v0": 1.630, "v1": -24.716, "v2": 37.136, "v3": -37.204, "v4": 22.430, "amplitude": 38.679, "phase_angle": 16.238, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.801, "filter_rmsd": 0.035, "frame": { "rmsd": 0.006, "origin": [ 29.764, -5.185, 36.684 ], "x_axis": [ 0.969, -0.249, -0.005 ], "y_axis": [ -0.163, -0.620, -0.767 ], "z_axis": [ 0.188, 0.744, -0.641 ], "quaternion": [ -0.420, 0.899, -0.115, 0.051 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.244, "beta": 165.821, "gamma": 65.417, "delta": 83.029, "epsilon": -154.060, "zeta": -65.430, "epsilon_zeta": -88.631, "bb_type": "BI", "chi": -169.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 8.641, 1.059 ], "P_xyz": [ 1.280, 8.950, 1.005 ], "form": "A", "ssZp": 4.558, "Dp": 4.592, "splay_angle": 21.714, "splay_distance": 3.371, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 168.982, "theta": -138.729, "eta_prime": -172.386, "theta_prime": -139.958, "eta_base": -117.406, "theta_base": -105.271, "v0": 2.889, "v1": -24.215, "v2": 35.094, "v3": -34.411, "v4": 19.906, "amplitude": 36.191, "phase_angle": 14.141, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.731, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 32.438, -2.575, 35.171 ], "x_axis": [ 0.609, -0.626, -0.487 ], "y_axis": [ -0.758, -0.279, -0.589 ], "z_axis": [ 0.233, 0.728, -0.645 ], "quaternion": [ -0.414, 0.796, -0.435, -0.080 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": -76.143, "beta": 177.622, "gamma": 62.164, "delta": 84.577, "epsilon": -120.953, "zeta": -78.415, "epsilon_zeta": -42.538, "bb_type": "--", "chi": -157.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.699, 0.370 ], "P_xyz": [ 1.300, 8.984, 0.401 ], "form": ".", "ssZp": 4.147, "Dp": 4.686, "splay_angle": 123.300, "splay_distance": 16.347, "splay_ratio": 0.880, "d22": null, "d64": null, "eta": 175.344, "theta": -86.376, "eta_prime": -170.457, "theta_prime": -112.178, "eta_base": -121.350, "theta_base": -119.510, "v0": 2.662, "v1": -23.357, "v2": 33.995, "v3": -33.396, "v4": 19.408, "amplitude": 35.091, "phase_angle": 14.360, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.778, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 34.704, -1.120, 33.142 ], "x_axis": [ -0.015, -0.629, -0.777 ], "y_axis": [ -0.932, 0.291, -0.218 ], "z_axis": [ 0.363, 0.721, -0.590 ], "quaternion": [ 0.414, -0.567, 0.688, 0.183 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart", "alpha": 92.028, "beta": 149.211, "gamma": 43.989, "delta": 144.861, "epsilon": -119.073, "zeta": -78.097, "epsilon_zeta": -40.976, "bb_type": "--", "chi": -144.553, "glyco_bond": "anti", "C5prime_xyz": [ -2.017, 8.739, 0.077 ], "P_xyz": [ 0.238, 9.067, 1.387 ], "form": ".", "ssZp": 1.272, "Dp": 1.386, "splay_angle": 50.909, "splay_distance": 8.290, "splay_ratio": 0.430, "d22": null, "d64": null, "eta": -78.582, "theta": -69.375, "eta_prime": -27.839, "theta_prime": -87.296, "eta_base": -28.665, "theta_base": -60.139, "v0": -22.948, "v1": 36.128, "v2": -34.741, "v3": 22.443, "v4": 0.109, "amplitude": 36.735, "phase_angle": 161.035, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ 30.610, 12.236, 24.651 ], "x_axis": [ -0.984, 0.095, -0.153 ], "y_axis": [ -0.167, -0.800, 0.577 ], "z_axis": [ -0.068, 0.593, 0.802 ], "quaternion": [ 0.069, -0.058, 0.309, 0.947 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,bulge,kissing-loop,phosphate,splayed-apart", "alpha": -80.091, "beta": 177.089, "gamma": 49.338, "delta": 144.241, "epsilon": -85.832, "zeta": -74.545, "epsilon_zeta": -11.287, "bb_type": "--", "chi": -100.784, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.120, -2.143 ], "P_xyz": [ 0.105, 9.173, -2.271 ], "form": ".", "ssZp": 0.449, "Dp": 0.666, "splay_angle": 98.096, "splay_distance": 14.682, "splay_ratio": 0.756, "d22": 6.906, "d64": 7.947, "eta": 167.469, "theta": -44.135, "eta_prime": -145.388, "theta_prime": -66.792, "eta_base": -112.084, "theta_base": -29.254, "v0": -23.119, "v1": 35.875, "v2": -34.285, "v3": 21.851, "v4": 0.581, "amplitude": 36.410, "phase_angle": 160.327, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.437, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 28.989, 13.055, 32.740 ], "x_axis": [ -0.709, -0.703, -0.062 ], "y_axis": [ 0.701, -0.711, 0.048 ], "z_axis": [ -0.078, -0.010, 0.997 ], "quaternion": [ -0.380, -0.038, 0.010, 0.924 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": -82.656, "beta": -178.226, "gamma": 43.478, "delta": 83.036, "epsilon": -143.069, "zeta": -75.445, "epsilon_zeta": -67.624, "bb_type": "BI", "chi": -167.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.175, 8.646, 1.020 ], "P_xyz": [ 1.261, 8.856, 1.974 ], "form": "A", "ssZp": 4.540, "Dp": 4.632, "splay_angle": 26.668, "splay_distance": 4.161, "splay_ratio": 0.231, "d22": 4.495, "d64": 4.364, "eta": 127.815, "theta": -143.432, "eta_prime": 172.885, "theta_prime": -138.496, "eta_base": -165.309, "theta_base": -109.110, "v0": 3.277, "v1": -24.304, "v2": 34.927, "v3": -34.008, "v4": 19.389, "amplitude": 35.920, "phase_angle": 13.504, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.708, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 38.445, 1.937, 34.338 ], "x_axis": [ -0.545, 0.135, -0.828 ], "y_axis": [ -0.049, 0.980, 0.192 ], "z_axis": [ 0.837, 0.145, -0.527 ], "quaternion": [ 0.477, 0.025, 0.874, 0.096 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -66.506, "beta": 179.001, "gamma": 50.466, "delta": 81.998, "epsilon": -141.424, "zeta": -74.661, "epsilon_zeta": -66.763, "bb_type": "BI", "chi": -163.963, "glyco_bond": "anti", "C5prime_xyz": [ -1.174, 8.678, 0.773 ], "P_xyz": [ 1.394, 8.914, 1.247 ], "form": "A", "ssZp": 4.516, "Dp": 4.690, "splay_angle": 20.288, "splay_distance": 3.205, "splay_ratio": 0.177, "d22": 4.081, "d64": 4.020, "eta": 168.289, "theta": -141.238, "eta_prime": -179.918, "theta_prime": -138.344, "eta_base": -140.461, "theta_base": -105.706, "v0": 4.155, "v1": -25.908, "v2": 36.633, "v3": -35.245, "v4": 19.618, "amplitude": 37.509, "phase_angle": 12.405, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.958, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 41.258, 1.519, 31.302 ], "x_axis": [ -0.635, 0.642, -0.430 ], "y_axis": [ 0.259, 0.701, 0.664 ], "z_axis": [ 0.728, 0.310, -0.612 ], "quaternion": [ 0.337, 0.262, 0.859, 0.284 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -66.203, "beta": 159.572, "gamma": 65.039, "delta": 81.552, "epsilon": -158.064, "zeta": -75.780, "epsilon_zeta": -82.284, "bb_type": "BI", "chi": -160.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.746, 0.544 ], "P_xyz": [ 1.082, 9.147, 0.096 ], "form": "A", "ssZp": 4.435, "Dp": 4.561, "splay_angle": 25.683, "splay_distance": 4.111, "splay_ratio": 0.225, "d22": 4.658, "d64": 5.124, "eta": 163.956, "theta": -151.812, "eta_prime": -175.365, "theta_prime": -155.816, "eta_base": -124.660, "theta_base": -141.732, "v0": 1.681, "v1": -23.785, "v2": 35.577, "v3": -35.548, "v4": 21.364, "amplitude": 37.015, "phase_angle": 16.024, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 42.165, 2.621, 28.432 ], "x_axis": [ -0.388, 0.922, 0.012 ], "y_axis": [ 0.690, 0.282, 0.666 ], "z_axis": [ 0.610, 0.267, -0.746 ], "quaternion": [ 0.193, 0.518, 0.777, 0.300 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop", "alpha": -62.942, "beta": 165.713, "gamma": 66.771, "delta": 81.556, "epsilon": -114.703, "zeta": -109.214, "epsilon_zeta": -5.488, "bb_type": "--", "chi": -166.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.563, 8.813, 0.856 ], "P_xyz": [ 1.004, 9.359, 0.902 ], "form": "A", "ssZp": 4.297, "Dp": 4.582, "splay_angle": 19.127, "splay_distance": 3.349, "splay_ratio": 0.170, "d22": 4.106, "d64": 4.344, "eta": -173.689, "theta": -125.275, "eta_prime": -165.622, "theta_prime": -137.903, "eta_base": -141.738, "theta_base": -118.697, "v0": -2.221, "v1": -19.835, "v2": 33.016, "v3": -35.262, "v4": 23.663, "amplitude": 35.640, "phase_angle": 22.124, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.663, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 43.092, 2.987, 24.444 ], "x_axis": [ -0.066, 0.955, 0.288 ], "y_axis": [ 0.782, -0.129, 0.609 ], "z_axis": [ 0.619, 0.265, -0.739 ], "quaternion": [ 0.128, 0.671, 0.647, 0.338 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 90.970, "beta": -126.512, "gamma": -150.971, "delta": 82.934, "epsilon": 164.753, "zeta": -99.431, "epsilon_zeta": -95.816, "bb_type": "BI", "chi": -173.243, "glyco_bond": "anti", "C5prime_xyz": [ -0.857, 8.378, 1.355 ], "P_xyz": [ 0.235, 10.203, -0.163 ], "form": ".", "ssZp": 4.241, "Dp": 4.273, "splay_angle": 108.838, "splay_distance": 14.527, "splay_ratio": 0.814, "d22": null, "d64": null, "eta": 169.527, "theta": 151.643, "eta_prime": 179.555, "theta_prime": 166.833, "eta_base": -138.673, "theta_base": -167.607, "v0": 8.498, "v1": -28.750, "v2": 37.096, "v3": -33.188, "v4": 15.613, "amplitude": 37.286, "phase_angle": 5.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.007, "origin": [ 43.701, 4.789, 21.688 ], "x_axis": [ 0.216, 0.770, 0.601 ], "y_axis": [ 0.824, -0.474, 0.310 ], "z_axis": [ 0.523, 0.428, -0.737 ], "quaternion": [ -0.038, 0.779, 0.512, 0.361 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,kissing-loop,splayed-apart", "alpha": -161.692, "beta": -97.655, "gamma": -126.188, "delta": 84.694, "epsilon": 142.289, "zeta": 51.689, "epsilon_zeta": 90.600, "bb_type": "--", "chi": -97.940, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 7.419, -2.714 ], "P_xyz": [ -3.051, 7.399, -4.919 ], "form": "B", "ssZp": 1.523, "Dp": 3.913, "splay_angle": 20.582, "splay_distance": 3.549, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -10.276, "theta": -179.855, "eta_prime": -46.820, "theta_prime": -169.041, "eta_base": -82.125, "theta_base": -144.173, "v0": 10.599, "v1": -28.190, "v2": 34.109, "v3": -29.116, "v4": 11.814, "amplitude": 34.116, "phase_angle": 1.169, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 49.960, 2.216, 8.833 ], "x_axis": [ 0.682, -0.583, -0.441 ], "y_axis": [ -0.168, -0.712, 0.681 ], "z_axis": [ -0.712, -0.391, -0.584 ], "quaternion": [ 0.311, 0.863, -0.218, -0.334 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,kissing-loop,phosphate", "alpha": 177.436, "beta": 102.312, "gamma": 138.490, "delta": 91.460, "epsilon": -97.928, "zeta": 164.270, "epsilon_zeta": 97.802, "bb_type": "BII", "chi": -113.139, "glyco_bond": "anti", "C5prime_xyz": [ -1.568, 8.052, -2.013 ], "P_xyz": [ -2.094, 7.483, -4.498 ], "form": ".", "ssZp": 1.131, "Dp": 4.553, "splay_angle": 62.852, "splay_distance": 9.432, "splay_ratio": 0.556, "d22": null, "d64": null, "eta": 163.333, "theta": 106.629, "eta_prime": -179.803, "theta_prime": 135.326, "eta_base": -151.285, "theta_base": 153.736, "v0": 5.778, "v1": -22.424, "v2": 29.520, "v3": -27.100, "v4": 13.578, "amplitude": 29.797, "phase_angle": 7.819, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 49.218, -1.104, 7.823 ], "x_axis": [ 0.781, -0.615, -0.111 ], "y_axis": [ -0.498, -0.720, 0.484 ], "z_axis": [ -0.378, -0.323, -0.868 ], "quaternion": [ 0.220, 0.918, -0.303, -0.133 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "syn,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,cap-acceptor,phosphate,splayed-apart", "alpha": 13.411, "beta": 152.409, "gamma": -21.272, "delta": 151.305, "epsilon": -77.153, "zeta": 105.659, "epsilon_zeta": 177.188, "bb_type": "--", "chi": 69.407, "glyco_bond": "syn", "C5prime_xyz": [ -5.003, 3.934, 1.677 ], "P_xyz": [ -6.278, 1.814, 0.790 ], "form": ".", "ssZp": -0.069, "Dp": 0.442, "splay_angle": 112.238, "splay_distance": 15.983, "splay_ratio": 0.830, "d22": null, "d64": null, "eta": -130.219, "theta": 153.535, "eta_prime": -143.755, "theta_prime": 99.864, "eta_base": -161.449, "theta_base": 65.208, "v0": -16.564, "v1": 33.005, "v2": -35.921, "v3": 27.297, "v4": -6.909, "amplitude": 36.266, "phase_angle": 172.089, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 41.279, -5.748, 5.734 ], "x_axis": [ -0.423, 0.349, -0.836 ], "y_axis": [ -0.905, -0.216, 0.368 ], "z_axis": [ -0.052, 0.912, 0.407 ], "quaternion": [ 0.438, -0.310, 0.447, 0.715 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 54.969, "beta": -154.945, "gamma": 65.274, "delta": 146.385, "epsilon": -96.790, "zeta": -70.035, "epsilon_zeta": -26.756, "bb_type": "--", "chi": -118.390, "glyco_bond": "anti", "C5prime_xyz": [ -1.695, 8.519, -1.295 ], "P_xyz": [ 0.653, 9.266, -0.391 ], "form": ".", "ssZp": 0.782, "Dp": 0.956, "splay_angle": 108.005, "splay_distance": 17.500, "splay_ratio": 0.809, "d22": 11.810, "d64": 15.062, "eta": 33.376, "theta": -53.624, "eta_prime": 28.957, "theta_prime": -75.147, "eta_base": 57.079, "theta_base": -87.147, "v0": -19.516, "v1": 33.812, "v2": -34.429, "v3": 24.062, "v4": -3.055, "amplitude": 35.466, "phase_angle": 166.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.317, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 36.599, -3.652, 20.872 ], "x_axis": [ 0.648, -0.609, 0.457 ], "y_axis": [ 0.024, -0.583, -0.812 ], "z_axis": [ 0.761, 0.537, -0.363 ], "quaternion": [ -0.419, 0.805, -0.182, 0.378 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,bulge,A-minor,ribose-zipper,kissing-loop,cap-donor,splayed-apart", "alpha": -66.013, "beta": 131.079, "gamma": -173.681, "delta": 80.056, "epsilon": -153.491, "zeta": -74.169, "epsilon_zeta": -79.322, "bb_type": "BI", "chi": -161.823, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.790, 0.616 ], "P_xyz": [ -1.520, 11.185, -0.440 ], "form": ".", "ssZp": 4.467, "Dp": 4.602, "splay_angle": 31.128, "splay_distance": 4.812, "splay_ratio": 0.268, "d22": 4.367, "d64": 4.755, "eta": -89.417, "theta": 155.841, "eta_prime": -60.062, "theta_prime": 174.731, "eta_base": -30.880, "theta_base": -146.884, "v0": 1.394, "v1": -24.017, "v2": 36.283, "v3": -36.442, "v4": 22.108, "amplitude": 37.847, "phase_angle": 16.529, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.218, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 42.273, -1.360, 4.478 ], "x_axis": [ -0.546, 0.426, -0.721 ], "y_axis": [ -0.835, -0.215, 0.506 ], "z_axis": [ 0.060, 0.879, 0.473 ], "quaternion": [ 0.422, -0.221, 0.463, 0.747 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,A-minor,ribose-zipper,kissing-loop", "alpha": -55.634, "beta": 172.066, "gamma": 54.785, "delta": 81.801, "epsilon": -164.212, "zeta": -83.503, "epsilon_zeta": -80.709, "bb_type": "BI", "chi": -170.888, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.614, 1.187 ], "P_xyz": [ 1.306, 8.795, 1.695 ], "form": "A", "ssZp": 4.482, "Dp": 4.500, "splay_angle": 18.450, "splay_distance": 2.941, "splay_ratio": 0.164, "d22": 4.484, "d64": 4.258, "eta": 175.415, "theta": -132.997, "eta_prime": -169.103, "theta_prime": -139.464, "eta_base": -126.508, "theta_base": -114.052, "v0": 2.733, "v1": -24.218, "v2": 35.372, "v3": -34.773, "v4": 20.209, "amplitude": 36.526, "phase_angle": 14.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.905, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 42.802, 3.347, 5.329 ], "x_axis": [ -0.921, 0.102, -0.375 ], "y_axis": [ -0.363, -0.573, 0.735 ], "z_axis": [ -0.140, 0.813, 0.565 ], "quaternion": [ 0.133, -0.147, 0.442, 0.875 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": 177.166, "beta": -148.700, "gamma": 143.938, "delta": 79.509, "epsilon": -100.390, "zeta": -118.595, "epsilon_zeta": 18.205, "bb_type": "--", "chi": -170.795, "glyco_bond": "anti", "C5prime_xyz": [ -1.222, 8.516, 1.197 ], "P_xyz": [ 1.010, 9.218, 0.041 ], "form": "A", "ssZp": 4.472, "Dp": 4.790, "splay_angle": 22.291, "splay_distance": 3.484, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 163.043, "theta": -155.815, "eta_prime": 176.104, "theta_prime": -153.407, "eta_base": -142.114, "theta_base": -135.109, "v0": 5.354, "v1": -27.494, "v2": 38.099, "v3": -36.086, "v4": 19.327, "amplitude": 38.798, "phase_angle": 10.893, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 42.326, 6.249, 5.297 ], "x_axis": [ -0.975, -0.178, 0.136 ], "y_axis": [ 0.191, -0.344, 0.919 ], "z_axis": [ -0.117, 0.922, 0.369 ], "quaternion": [ -0.112, 0.006, 0.561, 0.820 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -42.520, "beta": 128.292, "gamma": 48.457, "delta": 76.905, "epsilon": -148.642, "zeta": -72.648, "epsilon_zeta": -75.994, "bb_type": "BI", "chi": -169.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 8.692, 1.043 ], "P_xyz": [ 0.763, 8.864, 0.797 ], "form": "A", "ssZp": 4.594, "Dp": 4.636, "splay_angle": 23.570, "splay_distance": 3.789, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 154.849, "theta": -137.632, "eta_prime": 169.451, "theta_prime": -142.421, "eta_base": -158.136, "theta_base": -115.327, "v0": -0.922, "v1": -23.223, "v2": 37.237, "v3": -38.801, "v4": 25.029, "amplitude": 39.606, "phase_angle": 19.920, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.337, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 41.375, 9.566, 5.779 ], "x_axis": [ -0.675, -0.642, 0.362 ], "y_axis": [ 0.582, -0.163, 0.797 ], "z_axis": [ -0.453, 0.749, 0.484 ], "quaternion": [ -0.402, -0.030, 0.507, 0.762 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -58.028, "beta": 171.799, "gamma": 52.704, "delta": 78.256, "epsilon": -149.601, "zeta": -57.878, "epsilon_zeta": -91.724, "bb_type": "BI", "chi": -162.691, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.810, 0.662 ], "P_xyz": [ 1.081, 9.370, 0.901 ], "form": "A", "ssZp": 4.485, "Dp": 4.627, "splay_angle": 20.834, "splay_distance": 3.537, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 170.614, "theta": -137.903, "eta_prime": -175.884, "theta_prime": -146.802, "eta_base": -128.664, "theta_base": -133.098, "v0": 0.544, "v1": -23.718, "v2": 36.622, "v3": -37.315, "v4": 23.180, "amplitude": 38.468, "phase_angle": 17.821, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.903, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 38.038, 11.140, 6.639 ], "x_axis": [ -0.172, -0.625, 0.762 ], "y_axis": [ 0.841, 0.309, 0.444 ], "z_axis": [ -0.513, 0.717, 0.472 ], "quaternion": [ 0.634, -0.108, -0.502, -0.578 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -136.824, "beta": 147.035, "gamma": 127.942, "delta": 80.700, "epsilon": -115.065, "zeta": -97.521, "epsilon_zeta": -17.544, "bb_type": "--", "chi": 176.142, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.234, 1.889 ], "P_xyz": [ 0.427, 9.842, 0.863 ], "form": "A", "ssZp": 4.789, "Dp": 4.799, "splay_angle": 23.466, "splay_distance": 3.589, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 161.163, "theta": -162.069, "eta_prime": 171.397, "theta_prime": -158.540, "eta_base": -158.089, "theta_base": -125.528, "v0": 5.471, "v1": -27.146, "v2": 37.428, "v3": -35.298, "v4": 18.780, "amplitude": 38.072, "phase_angle": 10.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 34.766, 12.250, 7.398 ], "x_axis": [ 0.291, -0.580, 0.761 ], "y_axis": [ 0.790, 0.594, 0.150 ], "z_axis": [ -0.539, 0.558, 0.631 ], "quaternion": [ 0.793, -0.128, -0.410, -0.432 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -49.266, "beta": 154.512, "gamma": 41.573, "delta": 78.162, "epsilon": -144.438, "zeta": -76.366, "epsilon_zeta": -68.071, "bb_type": "BI", "chi": -176.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.484, 8.526, 1.438 ], "P_xyz": [ 1.096, 8.720, 1.835 ], "form": "A", "ssZp": 4.729, "Dp": 4.725, "splay_angle": 26.043, "splay_distance": 4.175, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 156.521, "theta": -144.848, "eta_prime": 169.910, "theta_prime": -144.097, "eta_base": -142.927, "theta_base": -127.595, "v0": 4.394, "v1": -27.611, "v2": 39.179, "v3": -37.677, "v4": 20.940, "amplitude": 40.121, "phase_angle": 12.446, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.187, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 32.274, 12.544, 9.964 ], "x_axis": [ 0.831, -0.213, 0.513 ], "y_axis": [ 0.428, 0.835, -0.346 ], "z_axis": [ -0.355, 0.507, 0.786 ], "quaternion": [ 0.929, -0.229, -0.234, -0.172 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop", "alpha": -61.914, "beta": 167.439, "gamma": 64.596, "delta": 77.848, "epsilon": -151.538, "zeta": -73.980, "epsilon_zeta": -77.558, "bb_type": "BI", "chi": -175.025, "glyco_bond": "anti", "C5prime_xyz": [ -1.699, 8.641, 1.333 ], "P_xyz": [ 0.816, 9.346, 1.460 ], "form": "A", "ssZp": 4.660, "Dp": 4.648, "splay_angle": 26.192, "splay_distance": 4.193, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 173.660, "theta": -150.487, "eta_prime": -173.059, "theta_prime": -150.219, "eta_base": -139.716, "theta_base": -129.549, "v0": 0.810, "v1": -24.601, "v2": 37.673, "v3": -38.243, "v4": 23.606, "amplitude": 39.490, "phase_angle": 17.446, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.751, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 30.494, 11.944, 13.692 ], "x_axis": [ 0.927, 0.202, 0.316 ], "y_axis": [ 0.002, 0.840, -0.542 ], "z_axis": [ -0.375, 0.503, 0.779 ], "quaternion": [ 0.942, -0.277, -0.184, 0.053 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -56.942, "beta": 177.247, "gamma": 52.018, "delta": 79.065, "epsilon": -144.542, "zeta": -78.951, "epsilon_zeta": -65.591, "bb_type": "BI", "chi": -166.649, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.734, 0.895 ], "P_xyz": [ 0.938, 9.339, 1.442 ], "form": "A", "ssZp": 4.535, "Dp": 4.630, "splay_angle": 20.231, "splay_distance": 3.243, "splay_ratio": 0.178, "d22": 4.312, "d64": 4.056, "eta": 177.099, "theta": -150.021, "eta_prime": -172.890, "theta_prime": -147.265, "eta_base": -140.507, "theta_base": -123.111, "v0": 0.182, "v1": -23.163, "v2": 36.083, "v3": -36.959, "v4": 23.149, "amplitude": 38.009, "phase_angle": 18.317, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 29.767, 11.770, 17.818 ], "x_axis": [ 0.805, 0.594, -0.010 ], "y_axis": [ -0.461, 0.613, -0.642 ], "z_axis": [ -0.374, 0.521, 0.767 ], "quaternion": [ 0.892, -0.326, -0.102, 0.295 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": -58.299, "beta": 174.768, "gamma": 42.067, "delta": 80.384, "epsilon": -132.999, "zeta": -69.356, "epsilon_zeta": -63.643, "bb_type": "BI", "chi": -156.264, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.743, 0.300 ], "P_xyz": [ 1.124, 9.287, 0.649 ], "form": ".", "ssZp": 4.253, "Dp": 4.721, "splay_angle": 23.588, "splay_distance": 3.891, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 167.079, "theta": -130.555, "eta_prime": 175.413, "theta_prime": -126.230, "eta_base": -151.713, "theta_base": -84.575, "v0": 2.458, "v1": -24.823, "v2": 36.547, "v3": -36.098, "v4": 21.211, "amplitude": 37.826, "phase_angle": 14.947, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.733, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 29.930, 12.675, 20.927 ], "x_axis": [ 0.489, 0.715, -0.500 ], "y_axis": [ -0.857, 0.288, -0.428 ], "z_axis": [ -0.162, 0.637, 0.753 ], "quaternion": [ 0.795, -0.335, 0.106, 0.494 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -56.719, "beta": 162.044, "gamma": 53.986, "delta": 75.215, "epsilon": -147.332, "zeta": -64.380, "epsilon_zeta": -82.952, "bb_type": "BI", "chi": -150.948, "glyco_bond": "anti", "C5prime_xyz": [ -1.791, 8.909, -0.081 ], "P_xyz": [ 0.653, 9.663, -0.611 ], "form": ".", "ssZp": 4.128, "Dp": 4.656, "splay_angle": 76.021, "splay_distance": 11.056, "splay_ratio": 0.616, "d22": null, "d64": null, "eta": 161.439, "theta": -126.701, "eta_prime": -176.814, "theta_prime": -170.093, "eta_base": -118.425, "theta_base": 129.723, "v0": -1.751, "v1": -23.025, "v2": 37.703, "v3": -39.746, "v4": 26.108, "amplitude": 40.390, "phase_angle": 21.016, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 31.133, 16.357, 21.296 ], "x_axis": [ -0.150, 0.610, -0.778 ], "y_axis": [ -0.986, -0.034, 0.163 ], "z_axis": [ 0.073, 0.791, 0.607 ], "quaternion": [ 0.597, -0.263, 0.357, 0.669 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": "}", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop", "alpha": 172.993, "beta": 152.449, "gamma": 54.466, "delta": 86.143, "epsilon": -139.974, "zeta": -73.009, "epsilon_zeta": -66.965, "bb_type": "BI", "chi": -170.395, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.596, 1.187 ], "P_xyz": [ 1.258, 8.606, 1.384 ], "form": ".", "ssZp": 4.501, "Dp": 4.574, "splay_angle": 21.973, "splay_distance": 3.457, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 30.105, "theta": -129.269, "eta_prime": 50.610, "theta_prime": -130.083, "eta_base": 27.338, "theta_base": -90.311, "v0": 2.176, "v1": -21.880, "v2": 32.073, "v3": -31.735, "v4": 18.661, "amplitude": 33.195, "phase_angle": 14.941, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.869, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 29.541, 13.231, 31.781 ], "x_axis": [ -0.766, -0.642, -0.019 ], "y_axis": [ -0.574, 0.698, -0.428 ], "z_axis": [ 0.288, -0.317, -0.903 ], "quaternion": [ 0.084, -0.331, 0.918, -0.203 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -60.871, "beta": 168.231, "gamma": 50.804, "delta": 84.764, "epsilon": -119.145, "zeta": -78.831, "epsilon_zeta": -40.314, "bb_type": "--", "chi": -149.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.330, 8.741, -0.068 ], "P_xyz": [ 1.286, 9.026, -0.098 ], "form": ".", "ssZp": 3.812, "Dp": 4.662, "splay_angle": 39.044, "splay_distance": 6.440, "splay_ratio": 0.334, "d22": null, "d64": null, "eta": 172.232, "theta": -124.999, "eta_prime": -170.822, "theta_prime": -115.245, "eta_base": -114.997, "theta_base": -109.681, "v0": 1.929, "v1": -22.289, "v2": 32.988, "v3": -32.768, "v4": 19.473, "amplitude": 34.222, "phase_angle": 15.430, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 29.240, 10.960, 29.192 ], "x_axis": [ -0.935, 0.010, -0.355 ], "y_axis": [ 0.178, 0.879, -0.443 ], "z_axis": [ 0.307, -0.477, -0.823 ], "quaternion": [ 0.174, 0.049, 0.954, -0.241 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -50.813, "beta": -162.923, "gamma": 55.516, "delta": 147.675, "epsilon": -96.003, "zeta": -174.011, "epsilon_zeta": 78.008, "bb_type": "BII", "chi": -77.135, "glyco_bond": "anti", "C5prime_xyz": [ -3.462, 7.200, -2.722 ], "P_xyz": [ -1.584, 8.718, -3.749 ], "form": ".", "ssZp": 0.922, "Dp": 0.875, "splay_angle": 105.129, "splay_distance": 15.286, "splay_ratio": 0.794, "d22": null, "d64": null, "eta": -147.942, "theta": -144.656, "eta_prime": -125.366, "theta_prime": 166.551, "eta_base": -127.096, "theta_base": 138.308, "v0": -26.491, "v1": 40.541, "v2": -38.164, "v3": 23.915, "v4": 1.377, "amplitude": 40.810, "phase_angle": 159.253, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.530, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 28.972, 8.515, 23.240 ], "x_axis": [ -0.901, 0.379, -0.210 ], "y_axis": [ 0.433, 0.792, -0.430 ], "z_axis": [ 0.004, -0.479, -0.878 ], "quaternion": [ 0.057, 0.215, 0.945, -0.240 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 68.155, "beta": -175.863, "gamma": 83.316, "delta": 146.505, "epsilon": -88.287, "zeta": -56.904, "epsilon_zeta": -31.383, "bb_type": "--", "chi": -125.130, "glyco_bond": "anti", "C5prime_xyz": [ -1.951, 8.661, -0.940 ], "P_xyz": [ 0.591, 9.266, -0.679 ], "form": ".", "ssZp": 0.634, "Dp": 0.662, "splay_angle": 127.194, "splay_distance": 16.767, "splay_ratio": 0.896, "d22": null, "d64": null, "eta": 30.024, "theta": -50.077, "eta_prime": 55.386, "theta_prime": -66.748, "eta_base": 66.014, "theta_base": -35.511, "v0": -21.949, "v1": 36.050, "v2": -35.598, "v3": 23.870, "v4": -1.401, "amplitude": 37.152, "phase_angle": 163.368, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.057, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 43.917, 5.357, 22.667 ], "x_axis": [ 0.252, 0.590, 0.767 ], "y_axis": [ -0.722, 0.642, -0.258 ], "z_axis": [ -0.645, -0.489, 0.588 ], "quaternion": [ 0.788, 0.073, -0.448, 0.416 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,bulge,kissing-loop,cap-acceptor,splayed-apart", "alpha": -69.118, "beta": 116.066, "gamma": -178.307, "delta": 140.944, "epsilon": -150.828, "zeta": 47.423, "epsilon_zeta": 161.748, "bb_type": "--", "chi": -36.534, "glyco_bond": "--", "C5prime_xyz": [ -4.265, 5.537, -2.945 ], "P_xyz": [ -6.316, 4.251, -3.979 ], "form": ".", "ssZp": 0.095, "Dp": 2.040, "splay_angle": 133.791, "splay_distance": 18.038, "splay_ratio": 0.920, "d22": null, "d64": null, "eta": -82.721, "theta": -19.170, "eta_prime": -55.072, "theta_prime": 0.562, "eta_base": -52.736, "theta_base": 52.422, "v0": -23.363, "v1": 34.849, "v2": -32.447, "v3": 19.806, "v4": 2.066, "amplitude": 35.010, "phase_angle": 157.938, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.010, "filter_rmsd": 0.041, "frame": { "rmsd": 0.007, "origin": [ 29.010, 11.253, 17.753 ], "x_axis": [ -0.988, -0.154, -0.021 ], "y_axis": [ 0.127, -0.877, 0.463 ], "z_axis": [ -0.090, 0.455, 0.886 ], "quaternion": [ -0.073, -0.029, 0.237, 0.968 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,phosphate,splayed-apart", "alpha": 55.792, "beta": 144.493, "gamma": -45.985, "delta": 88.945, "epsilon": -157.483, "zeta": -64.830, "epsilon_zeta": -92.653, "bb_type": "BI", "chi": -171.387, "glyco_bond": "anti", "C5prime_xyz": [ -0.696, 8.224, 1.162 ], "P_xyz": [ 1.068, 8.673, 3.047 ], "form": "A", "ssZp": 4.674, "Dp": 4.676, "splay_angle": 27.695, "splay_distance": 4.284, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": -163.168, "theta": -158.837, "eta_prime": -150.702, "theta_prime": -148.721, "eta_base": -161.839, "theta_base": -127.042, "v0": 14.475, "v1": -32.574, "v2": 37.343, "v3": -29.997, "v4": 9.891, "amplitude": 37.416, "phase_angle": 356.435, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 43.302, 2.715, 24.698 ], "x_axis": [ -0.138, 0.893, 0.427 ], "y_axis": [ -0.804, 0.150, -0.575 ], "z_axis": [ -0.578, -0.423, 0.698 ], "quaternion": [ 0.654, -0.058, -0.384, 0.649 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -86.759, "beta": -176.864, "gamma": 72.933, "delta": 80.647, "epsilon": -147.936, "zeta": -66.380, "epsilon_zeta": -81.556, "bb_type": "BI", "chi": -173.223, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.580, 1.256 ], "P_xyz": [ 1.163, 9.030, 1.389 ], "form": "A", "ssZp": 4.689, "Dp": 4.688, "splay_angle": 24.731, "splay_distance": 3.849, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 171.532, "theta": -138.999, "eta_prime": -174.945, "theta_prime": -139.273, "eta_base": -149.343, "theta_base": -104.626, "v0": 3.527, "v1": -25.885, "v2": 37.095, "v3": -36.036, "v4": 20.519, "amplitude": 38.129, "phase_angle": 13.374, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.268, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 43.348, 0.650, 28.451 ], "x_axis": [ -0.447, 0.884, 0.140 ], "y_axis": [ -0.665, -0.224, -0.712 ], "z_axis": [ -0.598, -0.411, 0.688 ], "quaternion": [ 0.504, -0.149, -0.366, 0.768 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -75.822, "beta": 175.864, "gamma": 61.353, "delta": 79.738, "epsilon": -150.440, "zeta": -68.962, "epsilon_zeta": -81.478, "bb_type": "BI", "chi": -172.064, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.599, 1.197 ], "P_xyz": [ 1.226, 9.003, 1.415 ], "form": "A", "ssZp": 4.684, "Dp": 4.687, "splay_angle": 25.729, "splay_distance": 4.000, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 164.004, "theta": -143.469, "eta_prime": -179.129, "theta_prime": -141.764, "eta_base": -123.818, "theta_base": -112.317, "v0": 3.930, "v1": -26.531, "v2": 37.802, "v3": -36.534, "v4": 20.568, "amplitude": 38.780, "phase_angle": 12.897, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.819, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 41.479, 1.267, 31.759 ], "x_axis": [ -0.737, 0.539, -0.407 ], "y_axis": [ -0.219, -0.761, -0.611 ], "z_axis": [ -0.639, -0.361, 0.679 ], "quaternion": [ 0.213, -0.294, -0.273, 0.891 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,phosphate", "alpha": -64.965, "beta": 167.193, "gamma": 65.920, "delta": 82.340, "epsilon": -141.685, "zeta": -62.905, "epsilon_zeta": -78.780, "bb_type": "BI", "chi": -174.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.601, 1.351 ], "P_xyz": [ 1.085, 9.012, 1.535 ], "form": ".", "ssZp": 4.630, "Dp": 4.639, "splay_angle": 27.400, "splay_distance": 4.295, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 175.564, "theta": -128.859, "eta_prime": -167.119, "theta_prime": -128.346, "eta_base": -120.002, "theta_base": -82.990, "v0": 0.942, "v1": -22.776, "v2": 34.676, "v3": -35.108, "v4": 21.574, "amplitude": 36.292, "phase_angle": 17.165, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 38.589, 2.030, 34.417 ], "x_axis": [ -0.747, -0.019, -0.665 ], "y_axis": [ 0.271, -0.922, -0.278 ], "z_axis": [ -0.607, -0.388, 0.693 ], "quaternion": [ -0.079, -0.347, -0.181, 0.917 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop", "alpha": -71.840, "beta": 165.590, "gamma": 64.368, "delta": 81.089, "epsilon": -141.606, "zeta": -65.735, "epsilon_zeta": -75.871, "bb_type": "BI", "chi": -169.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.696, 1.078 ], "P_xyz": [ 1.101, 9.134, 1.100 ], "form": ".", "ssZp": 4.592, "Dp": 4.655, "splay_angle": 28.197, "splay_distance": 4.307, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": 163.839, "theta": -131.769, "eta_prime": -172.143, "theta_prime": -130.726, "eta_base": -102.530, "theta_base": -77.959, "v0": 1.431, "v1": -23.602, "v2": 35.528, "v3": -35.653, "v4": 21.593, "amplitude": 37.038, "phase_angle": 16.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.745, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 34.486, 0.846, 34.873 ], "x_axis": [ -0.304, -0.730, -0.612 ], "y_axis": [ 0.730, -0.591, 0.343 ], "z_axis": [ -0.612, -0.343, 0.712 ], "quaternion": [ -0.452, -0.379, 0.000, 0.807 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 37, "nt_name": "C", "nt_code": "C", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -70.932, "beta": 167.490, "gamma": 61.013, "delta": 85.127, "epsilon": -153.644, "zeta": -63.741, "epsilon_zeta": -89.903, "bb_type": "BI", "chi": -166.245, "glyco_bond": "anti", "C5prime_xyz": [ -1.113, 8.603, 0.938 ], "P_xyz": [ 1.517, 8.657, 1.022 ], "form": "A", "ssZp": 4.493, "Dp": 4.580, "splay_angle": 22.347, "splay_distance": 3.519, "splay_ratio": 0.195, "d22": 4.188, "d64": 3.771, "eta": 161.506, "theta": -134.612, "eta_prime": -173.966, "theta_prime": -128.769, "eta_base": -97.622, "theta_base": -109.344, "v0": 4.809, "v1": -24.936, "v2": 34.382, "v3": -32.541, "v4": 17.535, "amplitude": 35.011, "phase_angle": 10.876, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 32.180, -2.739, 35.487 ], "x_axis": [ 0.472, -0.874, -0.113 ], "y_axis": [ 0.621, 0.239, 0.747 ], "z_axis": [ -0.626, -0.423, 0.656 ], "quaternion": [ 0.769, 0.380, -0.167, -0.486 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 38, "nt_name": "U", "nt_code": "U", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -80.825, "beta": -168.164, "gamma": 72.831, "delta": 152.559, "epsilon": -60.755, "zeta": 97.396, "epsilon_zeta": 201.849, "bb_type": "--", "chi": -128.914, "glyco_bond": "anti", "C5prime_xyz": [ -1.916, 8.620, -0.662 ], "P_xyz": [ 0.486, 9.204, 0.265 ], "form": ".", "ssZp": -0.120, "Dp": 0.152, "splay_angle": 113.062, "splay_distance": 17.534, "splay_ratio": 0.835, "d22": null, "d64": null, "eta": -151.548, "theta": 129.479, "eta_prime": -122.252, "theta_prime": 101.345, "eta_base": -101.813, "theta_base": 91.946, "v0": -20.409, "v1": 36.809, "v2": -38.168, "v3": 27.375, "v4": -4.559, "amplitude": 39.042, "phase_angle": 167.853, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.394, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 30.072, -5.337, 36.577 ], "x_axis": [ 0.926, -0.370, 0.072 ], "y_axis": [ 0.181, 0.603, 0.777 ], "z_axis": [ -0.331, -0.707, 0.626 ], "quaternion": [ 0.888, 0.418, -0.113, -0.155 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -145.313, "beta": -110.961, "gamma": -87.146, "delta": 88.118, "epsilon": -157.712, "zeta": -70.484, "epsilon_zeta": -87.228, "bb_type": "BI", "chi": -148.901, "glyco_bond": "anti", "C5prime_xyz": [ -1.120, 8.646, -0.087 ], "P_xyz": [ -1.635, 11.092, -0.863 ], "form": ".", "ssZp": 4.063, "Dp": 4.481, "splay_angle": 14.896, "splay_distance": 2.415, "splay_ratio": 0.130, "d22": null, "d64": null, "eta": 74.956, "theta": 150.714, "eta_prime": 44.168, "theta_prime": 176.658, "eta_base": 43.560, "theta_base": -171.444, "v0": 4.539, "v1": -23.215, "v2": 31.883, "v3": -30.165, "v4": 16.264, "amplitude": 32.455, "phase_angle": 10.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 27.662, 11.969, 38.040 ], "x_axis": [ 0.986, 0.049, 0.159 ], "y_axis": [ -0.002, -0.951, 0.308 ], "z_axis": [ 0.166, -0.304, -0.938 ], "quaternion": [ 0.155, 0.984, 0.012, 0.083 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": -68.499, "beta": 175.202, "gamma": 70.074, "delta": 142.957, "epsilon": -110.842, "zeta": 169.247, "epsilon_zeta": 79.910, "bb_type": "BII", "chi": -107.767, "glyco_bond": "anti", "C5prime_xyz": [ -2.312, 8.282, -1.857 ], "P_xyz": [ 0.165, 9.049, -2.215 ], "form": ".", "ssZp": 1.153, "Dp": 1.254, "splay_angle": 47.664, "splay_distance": 7.820, "splay_ratio": 0.408, "d22": 6.683, "d64": 7.031, "eta": -164.416, "theta": 160.437, "eta_prime": -138.820, "theta_prime": 151.833, "eta_base": -138.553, "theta_base": -170.743, "v0": -23.968, "v1": 36.166, "v2": -33.970, "v3": 21.031, "v4": 1.678, "amplitude": 36.463, "phase_angle": 158.691, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.679, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 27.767, 12.117, 35.631 ], "x_axis": [ 0.898, -0.221, 0.380 ], "y_axis": [ -0.168, -0.972, -0.167 ], "z_axis": [ 0.406, 0.086, -0.910 ], "quaternion": [ -0.065, 0.972, -0.100, 0.202 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -80.157, "beta": 160.235, "gamma": 28.825, "delta": 83.608, "epsilon": -136.026, "zeta": -62.055, "epsilon_zeta": -73.971, "bb_type": "BI", "chi": -173.437, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.565, 1.341 ], "P_xyz": [ 1.082, 8.550, 2.514 ], "form": ".", "ssZp": 4.560, "Dp": 4.624, "splay_angle": 37.038, "splay_distance": 5.704, "splay_ratio": 0.318, "d22": null, "d64": null, "eta": 174.513, "theta": -120.504, "eta_prime": 161.643, "theta_prime": -115.739, "eta_base": -166.274, "theta_base": -77.148, "v0": 1.944, "v1": -22.498, "v2": 33.293, "v3": -33.127, "v4": 19.688, "amplitude": 34.546, "phase_angle": 15.477, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.234, "filter_rmsd": 0.066, "frame": { "rmsd": 0.006, "origin": [ 23.976, 13.831, 29.009 ], "x_axis": [ 0.912, -0.313, 0.265 ], "y_axis": [ -0.404, -0.795, 0.451 ], "z_axis": [ 0.070, -0.519, -0.852 ], "quaternion": [ 0.257, 0.943, -0.190, 0.089 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -83.092, "beta": -167.841, "gamma": 55.977, "delta": 84.317, "epsilon": -147.999, "zeta": -52.408, "epsilon_zeta": -95.591, "bb_type": "BI", "chi": -170.012, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.537, 1.133 ], "P_xyz": [ 1.163, 8.700, 1.987 ], "form": ".", "ssZp": 4.588, "Dp": 4.626, "splay_angle": 30.048, "splay_distance": 4.659, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 161.435, "theta": -122.431, "eta_prime": -178.104, "theta_prime": -119.340, "eta_base": -122.745, "theta_base": -70.372, "v0": 3.507, "v1": -24.509, "v2": 34.959, "v3": -33.851, "v4": 19.144, "amplitude": 35.888, "phase_angle": 13.070, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.611, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 26.696, 10.032, 25.734 ], "x_axis": [ 0.208, -0.548, 0.810 ], "y_axis": [ -0.977, -0.077, 0.199 ], "z_axis": [ -0.047, -0.833, -0.551 ], "quaternion": [ 0.381, 0.677, -0.563, 0.282 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -86.382, "beta": 173.727, "gamma": 68.998, "delta": 82.884, "epsilon": -135.136, "zeta": -77.834, "epsilon_zeta": -57.303, "bb_type": "BI", "chi": -170.402, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.651, 1.131 ], "P_xyz": [ 1.170, 9.021, 1.212 ], "form": ".", "ssZp": 4.612, "Dp": 4.687, "splay_angle": 21.104, "splay_distance": 3.241, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.436, "theta": -136.450, "eta_prime": -171.801, "theta_prime": -127.374, "eta_base": -99.467, "theta_base": -76.786, "v0": 2.668, "v1": -24.388, "v2": 35.554, "v3": -34.954, "v4": 20.375, "amplitude": 36.722, "phase_angle": 14.487, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.361, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 26.836, 5.476, 26.699 ], "x_axis": [ -0.672, -0.345, 0.655 ], "y_axis": [ -0.738, 0.385, -0.554 ], "z_axis": [ -0.061, -0.856, -0.513 ], "quaternion": [ -0.223, -0.338, 0.802, -0.440 ] } }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///A/44", "linked_nts": [ "///A/43", "///A/45" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -60.811, "beta": 159.341, "gamma": 77.666, "delta": 150.442, "epsilon": -119.017, "zeta": 100.362, "epsilon_zeta": 140.621, "bb_type": "--", "chi": -124.923, "glyco_bond": "anti", "C5prime_xyz": [ -1.803, 8.569, -0.917 ], "P_xyz": [ 0.825, 8.723, -0.929 ], "form": ".", "ssZp": 1.193, "Dp": 1.237, "splay_angle": 107.214, "splay_distance": 16.867, "splay_ratio": 0.805, "d22": 10.955, "d64": 13.927, "eta": -172.320, "theta": 73.837, "eta_prime": -130.438, "theta_prime": 40.297, "eta_base": -75.156, "theta_base": 52.089, "v0": -19.543, "v1": 35.032, "v2": -36.305, "v3": 25.962, "v4": -4.199, "amplitude": 37.162, "phase_angle": 167.675, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.367, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 24.875, 2.898, 26.820 ], "x_axis": [ -0.988, 0.126, 0.091 ], "y_axis": [ -0.070, 0.156, -0.985 ], "z_axis": [ -0.138, -0.980, -0.146 ], "quaternion": [ -0.076, 0.018, 0.757, -0.649 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 45, "nt_name": "C", "nt_code": "C", "nt_id": "///A/45", "linked_nts": [ "///A/44", "///A/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop,cap-donor,phosphate,splayed-apart", "alpha": -122.385, "beta": 85.468, "gamma": 177.980, "delta": 80.775, "epsilon": -133.014, "zeta": -82.768, "epsilon_zeta": -50.246, "bb_type": "BI", "chi": -166.749, "glyco_bond": "anti", "C5prime_xyz": [ -1.185, 8.653, 0.938 ], "P_xyz": [ -1.996, 10.751, -0.408 ], "form": "A", "ssZp": 4.577, "Dp": 4.746, "splay_angle": 25.557, "splay_distance": 4.070, "splay_ratio": 0.223, "d22": 4.080, "d64": 4.272, "eta": -138.849, "theta": 153.683, "eta_prime": -141.241, "theta_prime": 176.292, "eta_base": -140.616, "theta_base": -143.815, "v0": 4.235, "v1": -26.315, "v2": 37.220, "v3": -35.760, "v4": 19.893, "amplitude": 38.103, "phase_angle": 12.361, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 30.465, 12.239, 13.936 ], "x_axis": [ 0.980, 0.189, 0.065 ], "y_axis": [ 0.150, -0.911, 0.383 ], "z_axis": [ 0.131, -0.366, -0.921 ], "quaternion": [ 0.192, 0.976, 0.087, 0.050 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.226, "beta": 161.073, "gamma": 45.521, "delta": 78.779, "epsilon": -142.002, "zeta": -75.842, "epsilon_zeta": -66.160, "bb_type": "BI", "chi": -162.330, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.826, 0.649 ], "P_xyz": [ 1.084, 9.276, 0.945 ], "form": "A", "ssZp": 4.431, "Dp": 4.635, "splay_angle": 23.521, "splay_distance": 3.871, "splay_ratio": 0.206, "d22": 3.983, "d64": 4.324, "eta": 170.967, "theta": -142.418, "eta_prime": -173.429, "theta_prime": -140.968, "eta_base": -129.815, "theta_base": -116.798, "v0": -0.516, "v1": -22.272, "v2": 35.358, "v3": -36.654, "v4": 23.441, "amplitude": 37.488, "phase_angle": 19.408, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.498, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 32.526, 12.282, 10.427 ], "x_axis": [ 0.837, -0.312, 0.449 ], "y_axis": [ -0.448, -0.863, 0.236 ], "z_axis": [ 0.314, -0.399, -0.862 ], "quaternion": [ 0.168, 0.944, -0.201, 0.202 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.961, "beta": 162.836, "gamma": 54.816, "delta": 77.645, "epsilon": -126.456, "zeta": -38.668, "epsilon_zeta": -87.788, "bb_type": "--", "chi": -164.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.900, 8.822, 0.745 ], "P_xyz": [ 0.576, 9.628, 0.950 ], "form": ".", "ssZp": 4.383, "Dp": 4.626, "splay_angle": 20.186, "splay_distance": 3.781, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 173.272, "theta": -124.649, "eta_prime": -173.543, "theta_prime": -139.487, "eta_base": -136.909, "theta_base": -139.891, "v0": -3.660, "v1": -20.091, "v2": 34.824, "v3": -37.906, "v4": 26.221, "amplitude": 38.117, "phase_angle": 23.990, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 35.225, 11.726, 7.708 ], "x_axis": [ 0.445, -0.619, 0.647 ], "y_axis": [ -0.795, -0.605, -0.032 ], "z_axis": [ 0.411, -0.500, -0.762 ], "quaternion": [ 0.140, 0.839, -0.422, 0.315 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 48, "nt_name": "G", "nt_code": "G", "nt_id": "///A/48", "linked_nts": [ "///A/47", "///A/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -115.536, "beta": 88.242, "gamma": 163.485, "delta": 82.618, "epsilon": -121.531, "zeta": -75.034, "epsilon_zeta": -46.497, "bb_type": "--", "chi": 178.627, "glyco_bond": "anti", "C5prime_xyz": [ -1.588, 8.470, 1.730 ], "P_xyz": [ -1.622, 10.578, 0.176 ], "form": "A", "ssZp": 4.572, "Dp": 4.616, "splay_angle": 21.274, "splay_distance": 3.489, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -177.459, "theta": 176.670, "eta_prime": -178.078, "theta_prime": -166.419, "eta_base": -165.350, "theta_base": -113.990, "v0": -0.245, "v1": -21.030, "v2": 33.084, "v3": -34.184, "v4": 21.739, "amplitude": 34.998, "phase_angle": 19.039, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.066, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 38.486, 11.749, 5.794 ], "x_axis": [ 0.237, -0.657, 0.716 ], "y_axis": [ -0.807, -0.543, -0.231 ], "z_axis": [ 0.541, -0.523, -0.659 ], "quaternion": [ 0.093, 0.781, -0.469, 0.402 ] } }, { "index": 49, "index_chain": 49, "chain_name": "A", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///A/49", "linked_nts": [ "///A/48", "///A/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.377, "beta": 166.917, "gamma": 33.289, "delta": 77.507, "epsilon": -142.615, "zeta": -83.867, "epsilon_zeta": -58.748, "bb_type": "BI", "chi": -152.059, "glyco_bond": "anti", "C5prime_xyz": [ -1.602, 8.812, 0.029 ], "P_xyz": [ 0.885, 9.570, 0.266 ], "form": "A", "ssZp": 4.158, "Dp": 4.683, "splay_angle": 21.863, "splay_distance": 3.525, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 152.111, "theta": -153.052, "eta_prime": 172.303, "theta_prime": -149.983, "eta_base": -124.351, "theta_base": -124.532, "v0": 0.377, "v1": -23.910, "v2": 37.098, "v3": -37.926, "v4": 23.652, "amplitude": 39.026, "phase_angle": 18.088, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.240, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 40.869, 9.202, 5.745 ], "x_axis": [ -0.462, -0.800, 0.383 ], "y_axis": [ -0.626, -0.012, -0.779 ], "z_axis": [ 0.628, -0.600, -0.495 ], "quaternion": [ 0.088, -0.511, 0.697, -0.495 ] } }, { "index": 50, "index_chain": 50, "chain_name": "A", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///A/50", "linked_nts": [ "///A/49", "///A/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.993, "beta": 160.792, "gamma": 43.846, "delta": 78.479, "epsilon": -176.470, "zeta": -87.544, "epsilon_zeta": -88.926, "bb_type": "BI", "chi": -162.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.602, 8.758, 0.644 ], "P_xyz": [ 0.940, 9.319, 0.875 ], "form": "A", "ssZp": 4.381, "Dp": 4.409, "splay_angle": 23.293, "splay_distance": 3.576, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.116, "theta": -144.705, "eta_prime": 176.047, "theta_prime": -149.375, "eta_base": -144.616, "theta_base": -117.370, "v0": 0.235, "v1": -23.401, "v2": 36.435, "v3": -37.334, "v4": 23.388, "amplitude": 38.376, "phase_angle": 18.300, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.614, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 42.971, 6.407, 5.297 ], "x_axis": [ -0.898, -0.417, 0.142 ], "y_axis": [ -0.298, 0.338, -0.893 ], "z_axis": [ 0.325, -0.844, -0.427 ], "quaternion": [ 0.056, -0.219, 0.816, -0.532 ] } }, { "index": 51, "index_chain": 51, "chain_name": "A", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///A/51", "linked_nts": [ "///A/50", "///A/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor", "alpha": 177.083, "beta": -138.180, "gamma": 141.550, "delta": 78.378, "epsilon": -128.262, "zeta": -81.865, "epsilon_zeta": -46.397, "bb_type": "BI", "chi": 178.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.323, 8.311, 1.781 ], "P_xyz": [ 1.044, 8.905, 0.845 ], "form": "A", "ssZp": 4.807, "Dp": 4.802, "splay_angle": 25.057, "splay_distance": 3.994, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 158.006, "theta": -138.881, "eta_prime": 172.940, "theta_prime": -142.258, "eta_base": -135.863, "theta_base": -119.986, "v0": 6.638, "v1": -29.068, "v2": 39.444, "v3": -36.691, "v4": 18.906, "amplitude": 39.970, "phase_angle": 9.306, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 43.488, 2.873, 5.138 ], "x_axis": [ -0.905, -0.132, -0.405 ], "y_axis": [ 0.297, 0.487, -0.822 ], "z_axis": [ 0.306, -0.864, -0.401 ], "quaternion": [ 0.213, 0.049, 0.836, -0.504 ] } }, { "index": 52, "index_chain": 52, "chain_name": "A", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///A/52", "linked_nts": [ "///A/51", "///A/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor", "alpha": -48.775, "beta": 165.746, "gamma": 49.728, "delta": 76.929, "epsilon": -150.401, "zeta": -75.711, "epsilon_zeta": -74.690, "bb_type": "BI", "chi": -166.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.535, 8.731, 0.879 ], "P_xyz": [ 1.011, 9.302, 1.013 ], "form": ".", "ssZp": 4.606, "Dp": 4.683, "splay_angle": 25.629, "splay_distance": 4.399, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 168.599, "theta": -152.723, "eta_prime": -175.996, "theta_prime": -153.059, "eta_base": -132.249, "theta_base": -149.948, "v0": 2.521, "v1": -26.348, "v2": 38.908, "v3": -38.498, "v4": 22.668, "amplitude": 40.299, "phase_angle": 15.094, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.598, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 42.406, -0.967, 4.934 ], "x_axis": [ -0.566, 0.165, -0.808 ], "y_axis": [ 0.786, 0.405, -0.467 ], "z_axis": [ 0.251, -0.899, -0.359 ], "quaternion": [ 0.347, 0.311, 0.763, -0.448 ] } }, { "index": 53, "index_chain": 53, "chain_name": "A", "nt_resnum": 53, "nt_name": "C", "nt_code": "C", "nt_id": "///A/53", "linked_nts": [ "///A/52", "///A/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge", "alpha": -55.146, "beta": 179.418, "gamma": 49.401, "delta": 75.850, "epsilon": -154.363, "zeta": -78.483, "epsilon_zeta": -75.881, "bb_type": "BI", "chi": -158.164, "glyco_bond": "anti", "C5prime_xyz": [ -1.846, 8.958, 0.321 ], "P_xyz": [ 0.488, 10.053, 0.751 ], "form": ".", "ssZp": 4.293, "Dp": 4.494, "splay_angle": 26.587, "splay_distance": 4.743, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 175.792, "theta": -130.724, "eta_prime": -177.831, "theta_prime": -136.599, "eta_base": -166.525, "theta_base": -106.296, "v0": -5.299, "v1": -18.994, "v2": 34.669, "v3": -38.771, "v4": 27.801, "amplitude": 38.693, "phase_angle": 26.361, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.823, "filter_rmsd": 0.060, "frame": { "rmsd": 0.003, "origin": [ 41.053, -5.099, 5.600 ], "x_axis": [ -0.344, 0.447, -0.826 ], "y_axis": [ 0.933, 0.266, -0.244 ], "z_axis": [ 0.110, -0.854, -0.508 ], "quaternion": [ 0.322, 0.474, 0.728, -0.377 ] } }, { "index": 54, "index_chain": 54, "chain_name": "A", "nt_resnum": 54, "nt_name": "A", "nt_code": "A", "nt_id": "///A/54", "linked_nts": [ "///A/53", "///A/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 111.278, "beta": -151.280, "gamma": -136.073, "delta": 87.663, "epsilon": -136.110, "zeta": -76.551, "epsilon_zeta": -59.558, "bb_type": "BI", "chi": -173.518, "glyco_bond": "anti", "C5prime_xyz": [ -0.884, 8.288, 1.404 ], "P_xyz": [ 0.270, 10.541, 0.753 ], "form": ".", "ssZp": 4.645, "Dp": 4.698, "splay_angle": 24.567, "splay_distance": 4.018, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": -178.882, "theta": -143.227, "eta_prime": -167.374, "theta_prime": -141.988, "eta_base": -118.253, "theta_base": -92.252, "v0": 8.677, "v1": -26.757, "v2": 33.752, "v3": -29.714, "v4": 13.322, "amplitude": 33.843, "phase_angle": 4.185, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.008, "origin": [ 39.211, -7.423, 1.899 ], "x_axis": [ 0.247, 0.486, -0.838 ], "y_axis": [ 0.963, -0.022, 0.270 ], "z_axis": [ 0.113, -0.874, -0.473 ], "quaternion": [ 0.433, 0.660, 0.549, -0.275 ] } }, { "index": 55, "index_chain": 55, "chain_name": "A", "nt_resnum": 55, "nt_name": "G", "nt_code": "G", "nt_id": "///A/55", "linked_nts": [ "///A/54", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 159.563, "beta": -153.274, "gamma": 159.029, "delta": 82.440, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -169.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.555, 1.113 ], "P_xyz": [ 0.700, 9.632, -0.345 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.159, "v1": -27.069, "v2": 36.581, "v3": -34.037, "v4": 17.605, "amplitude": 37.067, "phase_angle": 9.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.235, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 39.900, -8.202, -1.982 ], "x_axis": [ 0.857, 0.372, -0.357 ], "y_axis": [ 0.514, -0.569, 0.642 ], "z_axis": [ 0.036, -0.733, -0.679 ], "quaternion": [ 0.390, 0.881, 0.251, -0.091 ] } }, { "index": 56, "index_chain": 1, "chain_name": "B", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///B/2", "linked_nts": [ null, "///B/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -148.619, "gamma": 151.838, "delta": 82.642, "epsilon": -130.989, "zeta": -73.031, "epsilon_zeta": -57.958, "bb_type": "BI", "chi": -177.066, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.374, 1.541 ], "P_xyz": [ 0.924, 9.285, 0.458 ], "form": "A", "ssZp": 4.721, "Dp": 4.752, "splay_angle": 26.330, "splay_distance": 4.082, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": null, "theta": -139.417, "eta_prime": null, "theta_prime": -141.367, "eta_base": null, "theta_base": -104.356, "v0": 5.901, "v1": -26.609, "v2": 36.107, "v3": -33.717, "v4": 17.543, "amplitude": 36.617, "phase_angle": 9.577, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 5.009, 8.088, 44.419 ], "x_axis": [ -0.863, 0.205, -0.461 ], "y_axis": [ 0.479, 0.620, -0.622 ], "z_axis": [ 0.158, -0.758, -0.633 ], "quaternion": [ 0.175, 0.194, 0.883, -0.391 ] } }, { "index": 57, "index_chain": 2, "chain_name": "B", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.259, "beta": 165.184, "gamma": 60.872, "delta": 81.681, "epsilon": -146.943, "zeta": -70.296, "epsilon_zeta": -76.647, "bb_type": "BI", "chi": -169.639, "glyco_bond": "anti", "C5prime_xyz": [ -1.436, 8.652, 1.069 ], "P_xyz": [ 1.163, 9.011, 1.133 ], "form": "A", "ssZp": 4.593, "Dp": 4.640, "splay_angle": 22.772, "splay_distance": 3.567, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 163.340, "theta": -139.200, "eta_prime": -175.441, "theta_prime": -138.716, "eta_base": -116.261, "theta_base": -103.511, "v0": 2.094, "v1": -23.973, "v2": 35.485, "v3": -35.246, "v4": 20.925, "amplitude": 36.808, "phase_angle": 15.411, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 3.229, 5.551, 41.764 ], "x_axis": [ -0.282, 0.622, -0.731 ], "y_axis": [ 0.953, 0.268, -0.140 ], "z_axis": [ 0.109, -0.736, -0.668 ], "quaternion": [ 0.282, 0.529, 0.745, -0.294 ] } }, { "index": 58, "index_chain": 3, "chain_name": "B", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -67.061, "beta": 169.313, "gamma": 61.891, "delta": 83.996, "epsilon": -122.934, "zeta": -78.156, "epsilon_zeta": -44.778, "bb_type": "--", "chi": -160.226, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.733, 0.541 ], "P_xyz": [ 1.162, 9.101, 0.528 ], "form": ".", "ssZp": 4.248, "Dp": 4.644, "splay_angle": 121.695, "splay_distance": 16.126, "splay_ratio": 0.873, "d22": null, "d64": null, "eta": 176.170, "theta": -88.348, "eta_prime": -168.593, "theta_prime": -112.895, "eta_base": -118.932, "theta_base": -119.976, "v0": 0.727, "v1": -21.796, "v2": 33.358, "v3": -33.861, "v4": 20.891, "amplitude": 34.963, "phase_angle": 17.428, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 2.204, 4.129, 38.657 ], "x_axis": [ 0.395, 0.636, -0.663 ], "y_axis": [ 0.919, -0.276, 0.283 ], "z_axis": [ -0.003, -0.721, -0.693 ], "quaternion": [ 0.326, 0.769, 0.506, -0.217 ] } }, { "index": 59, "index_chain": 4, "chain_name": "B", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart", "alpha": 85.506, "beta": 149.225, "gamma": 47.695, "delta": 145.814, "epsilon": -119.134, "zeta": -76.892, "epsilon_zeta": -42.242, "bb_type": "--", "chi": -144.819, "glyco_bond": "anti", "C5prime_xyz": [ -1.969, 8.737, 0.111 ], "P_xyz": [ 0.343, 8.985, 1.341 ], "form": ".", "ssZp": 1.232, "Dp": 1.350, "splay_angle": 49.348, "splay_distance": 8.043, "splay_ratio": 0.418, "d22": null, "d64": null, "eta": -80.860, "theta": -67.670, "eta_prime": -29.584, "theta_prime": -87.376, "eta_base": -29.025, "theta_base": -61.069, "v0": -22.349, "v1": 36.073, "v2": -35.241, "v3": 23.278, "v4": -0.822, "amplitude": 36.963, "phase_angle": 162.440, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 9.499, -9.277, 33.452 ], "x_axis": [ 0.932, -0.113, 0.346 ], "y_axis": [ -0.121, 0.800, 0.588 ], "z_axis": [ -0.343, -0.589, 0.731 ], "quaternion": [ 0.930, 0.316, -0.185, 0.002 ] } }, { "index": 60, "index_chain": 5, "chain_name": "B", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,bulge,kissing-loop,phosphate,splayed-apart", "alpha": -81.953, "beta": 177.284, "gamma": 50.241, "delta": 145.329, "epsilon": -84.580, "zeta": -75.200, "epsilon_zeta": -9.380, "bb_type": "--", "chi": -95.926, "glyco_bond": "anti", "C5prime_xyz": [ -2.474, 7.974, -2.299 ], "P_xyz": [ -0.102, 9.039, -2.639 ], "form": ".", "ssZp": 0.436, "Dp": 0.582, "splay_angle": 98.905, "splay_distance": 14.775, "splay_ratio": 0.761, "d22": 6.905, "d64": 8.028, "eta": 166.570, "theta": -44.059, "eta_prime": -145.285, "theta_prime": -67.395, "eta_base": -112.967, "theta_base": -29.282, "v0": -23.008, "v1": 36.356, "v2": -35.082, "v3": 22.758, "v4": -0.055, "amplitude": 37.038, "phase_angle": 161.298, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.434, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 6.990, -10.147, 41.044 ], "x_axis": [ 0.658, 0.669, 0.345 ], "y_axis": [ -0.632, 0.740, -0.230 ], "z_axis": [ -0.409, -0.067, 0.910 ], "quaternion": [ 0.909, -0.045, -0.207, 0.358 ] } }, { "index": 61, "index_chain": 6, "chain_name": "B", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": -81.190, "beta": 178.887, "gamma": 43.131, "delta": 82.195, "epsilon": -133.313, "zeta": -81.787, "epsilon_zeta": -51.525, "bb_type": "BI", "chi": -168.892, "glyco_bond": "anti", "C5prime_xyz": [ -1.250, 8.652, 1.079 ], "P_xyz": [ 1.182, 8.918, 2.029 ], "form": "A", "ssZp": 4.549, "Dp": 4.676, "splay_angle": 25.656, "splay_distance": 4.035, "splay_ratio": 0.222, "d22": 4.327, "d64": 4.194, "eta": 128.877, "theta": -142.048, "eta_prime": 173.534, "theta_prime": -136.648, "eta_base": -166.442, "theta_base": -104.381, "v0": 2.741, "v1": -23.947, "v2": 34.868, "v3": -34.264, "v4": 19.907, "amplitude": 35.994, "phase_angle": 14.365, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.685, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ -1.936, 1.295, 38.265 ], "x_axis": [ 0.877, -0.126, -0.463 ], "y_axis": [ -0.050, -0.983, 0.174 ], "z_axis": [ -0.477, -0.130, -0.869 ], "quaternion": [ 0.079, 0.966, -0.046, -0.244 ] } }, { "index": 62, "index_chain": 7, "chain_name": "B", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -60.581, "beta": 166.208, "gamma": 52.991, "delta": 81.644, "epsilon": -142.700, "zeta": -73.798, "epsilon_zeta": -68.902, "bb_type": "BI", "chi": -165.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.716, 0.862 ], "P_xyz": [ 1.290, 9.004, 1.088 ], "form": "A", "ssZp": 4.536, "Dp": 4.659, "splay_angle": 22.590, "splay_distance": 3.588, "splay_ratio": 0.197, "d22": 4.153, "d64": 4.193, "eta": 165.949, "theta": -139.500, "eta_prime": -179.400, "theta_prime": -138.243, "eta_base": -135.405, "theta_base": -106.522, "v0": 2.401, "v1": -24.212, "v2": 35.577, "v3": -35.153, "v4": 20.672, "amplitude": 36.821, "phase_angle": 14.938, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ -2.619, 1.576, 34.298 ], "x_axis": [ 0.750, -0.656, -0.086 ], "y_axis": [ -0.570, -0.707, 0.419 ], "z_axis": [ -0.336, -0.265, -0.904 ], "quaternion": [ 0.186, 0.917, -0.334, -0.115 ] } }, { "index": 63, "index_chain": 8, "chain_name": "B", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -62.488, "beta": 162.799, "gamma": 60.135, "delta": 80.317, "epsilon": -151.128, "zeta": -81.889, "epsilon_zeta": -69.239, "bb_type": "BI", "chi": -161.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.526, 8.758, 0.590 ], "P_xyz": [ 1.048, 9.228, 0.399 ], "form": "A", "ssZp": 4.449, "Dp": 4.603, "splay_angle": 23.271, "splay_distance": 3.712, "splay_ratio": 0.203, "d22": 4.640, "d64": 4.868, "eta": 166.412, "theta": -154.877, "eta_prime": -174.640, "theta_prime": -156.934, "eta_base": -124.633, "theta_base": -142.240, "v0": 0.972, "v1": -23.474, "v2": 35.761, "v3": -36.158, "v4": 22.182, "amplitude": 37.418, "phase_angle": 17.116, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.879, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ -2.017, 0.434, 30.951 ], "x_axis": [ 0.279, -0.943, 0.179 ], "y_axis": [ -0.932, -0.221, 0.288 ], "z_axis": [ -0.232, -0.248, -0.941 ], "quaternion": [ 0.172, 0.781, -0.600, -0.017 ] } }, { "index": 64, "index_chain": 9, "chain_name": "B", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop", "alpha": -64.611, "beta": 159.716, "gamma": 67.441, "delta": 80.679, "epsilon": -109.417, "zeta": -117.840, "epsilon_zeta": 8.422, "bb_type": "--", "chi": -164.693, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.806, 0.774 ], "P_xyz": [ 1.065, 9.294, 0.494 ], "form": "A", "ssZp": 4.270, "Dp": 4.653, "splay_angle": 20.559, "splay_distance": 3.536, "splay_ratio": 0.181, "d22": 4.118, "d64": 4.437, "eta": -177.922, "theta": -129.723, "eta_prime": -171.145, "theta_prime": -140.899, "eta_base": -148.088, "theta_base": -125.590, "v0": -0.685, "v1": -21.939, "v2": 34.891, "v3": -36.253, "v4": 23.313, "amplitude": 37.046, "phase_angle": 19.635, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.611, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ -1.188, 0.167, 27.342 ], "x_axis": [ -0.127, -0.950, 0.285 ], "y_axis": [ -0.979, 0.167, 0.119 ], "z_axis": [ -0.160, -0.264, -0.951 ], "quaternion": [ -0.149, -0.644, 0.749, -0.048 ] } }, { "index": 65, "index_chain": 10, "chain_name": "B", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 88.412, "beta": -116.909, "gamma": -151.563, "delta": 85.026, "epsilon": 177.428, "zeta": -107.613, "epsilon_zeta": -74.958, "bb_type": "BI", "chi": -175.519, "glyco_bond": "anti", "C5prime_xyz": [ -0.917, 8.335, 1.504 ], "P_xyz": [ 0.213, 10.065, -0.092 ], "form": ".", "ssZp": 4.282, "Dp": 4.344, "splay_angle": 110.228, "splay_distance": 15.006, "splay_ratio": 0.821, "d22": null, "d64": null, "eta": 172.029, "theta": 162.067, "eta_prime": -178.072, "theta_prime": 172.658, "eta_base": -141.486, "theta_base": -167.926, "v0": 7.777, "v1": -27.108, "v2": 35.185, "v3": -31.692, "v4": 15.136, "amplitude": 35.399, "phase_angle": 6.294, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.007, "origin": [ -0.413, -1.595, 24.377 ], "x_axis": [ -0.471, -0.763, 0.442 ], "y_axis": [ -0.873, 0.474, -0.113 ], "z_axis": [ -0.123, -0.439, -0.890 ], "quaternion": [ -0.168, -0.486, 0.842, -0.164 ] } }, { "index": 66, "index_chain": 11, "chain_name": "B", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,kissing-loop,splayed-apart", "alpha": -164.803, "beta": -93.104, "gamma": -112.843, "delta": 92.313, "epsilon": -157.202, "zeta": -18.671, "epsilon_zeta": -138.530, "bb_type": "BI", "chi": -98.281, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 7.483, -2.676 ], "P_xyz": [ -3.312, 7.868, -4.762 ], "form": "B", "ssZp": 1.170, "Dp": 4.406, "splay_angle": 19.847, "splay_distance": 3.466, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": -22.449, "theta": -174.529, "eta_prime": -49.574, "theta_prime": -167.140, "eta_base": -81.230, "theta_base": -147.639, "v0": 7.693, "v1": -23.302, "v2": 29.070, "v3": -25.599, "v4": 11.433, "amplitude": 29.136, "phase_angle": 3.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 0.196, 0.963, 9.604 ], "x_axis": [ -0.297, 0.676, -0.674 ], "y_axis": [ -0.137, 0.668, 0.731 ], "z_axis": [ 0.945, 0.310, -0.106 ], "quaternion": [ 0.562, 0.187, 0.720, 0.362 ] } }, { "index": 67, "index_chain": 12, "chain_name": "B", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,kissing-loop,cap-acceptor", "alpha": -152.676, "beta": 119.159, "gamma": 143.744, "delta": 88.643, "epsilon": -121.687, "zeta": 169.467, "epsilon_zeta": 68.845, "bb_type": "BII", "chi": -119.239, "glyco_bond": "anti", "C5prime_xyz": [ -1.507, 8.266, -1.728 ], "P_xyz": [ -1.769, 8.286, -4.325 ], "form": ".", "ssZp": 2.069, "Dp": 4.615, "splay_angle": 63.477, "splay_distance": 9.314, "splay_ratio": 0.556, "d22": null, "d64": null, "eta": 162.144, "theta": 100.974, "eta_prime": 179.623, "theta_prime": 130.992, "eta_base": -154.202, "theta_base": 149.937, "v0": 4.112, "v1": -22.349, "v2": 30.961, "v3": -29.533, "v4": 16.127, "amplitude": 31.583, "phase_angle": 11.391, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 1.462, 4.124, 8.956 ], "x_axis": [ -0.673, 0.603, -0.428 ], "y_axis": [ 0.124, 0.663, 0.738 ], "z_axis": [ 0.729, 0.444, -0.521 ], "quaternion": [ 0.342, 0.215, 0.845, 0.350 ] } }, { "index": 68, "index_chain": 13, "chain_name": "B", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": "(", "summary": "syn,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,cap-acceptor,phosphate,splayed-apart", "alpha": 23.794, "beta": 148.745, "gamma": -14.149, "delta": 149.787, "epsilon": -61.571, "zeta": 95.132, "epsilon_zeta": 203.297, "bb_type": "--", "chi": 73.211, "glyco_bond": "syn", "C5prime_xyz": [ -5.015, 4.192, 1.863 ], "P_xyz": [ -6.216, 1.989, 1.079 ], "form": ".", "ssZp": 0.176, "Dp": 0.176, "splay_angle": 112.302, "splay_distance": 15.874, "splay_ratio": 0.831, "d22": null, "d64": null, "eta": -123.187, "theta": 159.953, "eta_prime": -139.424, "theta_prime": 103.362, "eta_base": -163.715, "theta_base": 70.963, "v0": -18.759, "v1": 34.351, "v2": -35.926, "v3": 26.042, "v4": -4.748, "amplitude": 36.651, "phase_angle": 168.587, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 9.458, 8.399, 11.087 ], "x_axis": [ 0.803, -0.404, -0.438 ], "y_axis": [ 0.559, 0.257, 0.788 ], "z_axis": [ -0.206, -0.878, 0.433 ], "quaternion": [ 0.789, 0.528, 0.073, -0.305 ] } }, { "index": 69, "index_chain": 14, "chain_name": "B", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 52.155, "beta": -167.359, "gamma": 70.662, "delta": 147.063, "epsilon": -95.084, "zeta": -68.874, "epsilon_zeta": -26.210, "bb_type": "--", "chi": -124.932, "glyco_bond": "anti", "C5prime_xyz": [ -1.614, 8.613, -0.954 ], "P_xyz": [ 0.843, 9.114, -0.191 ], "form": ".", "ssZp": 0.776, "Dp": 0.887, "splay_angle": 105.559, "splay_distance": 17.188, "splay_ratio": 0.797, "d22": 11.757, "d64": 14.965, "eta": 32.280, "theta": -52.262, "eta_prime": 26.986, "theta_prime": -73.710, "eta_base": 52.489, "theta_base": -86.289, "v0": -19.669, "v1": 34.085, "v2": -34.703, "v3": 24.265, "v4": -3.096, "amplitude": 35.747, "phase_angle": 166.119, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.131, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 6.592, 6.841, 26.622 ], "x_axis": [ -0.773, 0.620, 0.130 ], "y_axis": [ 0.335, 0.575, -0.747 ], "z_axis": [ -0.538, -0.534, -0.652 ], "quaternion": [ -0.193, 0.276, 0.866, -0.370 ] } }, { "index": 70, "index_chain": 15, "chain_name": "B", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,bulge,A-minor,ribose-zipper,kissing-loop,cap-donor,splayed-apart", "alpha": -58.928, "beta": 127.704, "gamma": -176.734, "delta": 80.953, "epsilon": -154.961, "zeta": -64.882, "epsilon_zeta": -90.079, "bb_type": "BI", "chi": -166.514, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.771, 0.885 ], "P_xyz": [ -1.643, 11.176, -0.149 ], "form": "A", "ssZp": 4.504, "Dp": 4.555, "splay_angle": 27.214, "splay_distance": 4.275, "splay_ratio": 0.236, "d22": 4.152, "d64": 4.437, "eta": -88.130, "theta": 162.537, "eta_prime": -57.827, "theta_prime": -178.453, "eta_base": -28.428, "theta_base": -133.083, "v0": 0.023, "v1": -22.512, "v2": 35.129, "v3": -36.030, "v4": 22.719, "amplitude": 37.047, "phase_angle": 18.519, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.180, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 8.236, 3.943, 9.760 ], "x_axis": [ 0.788, -0.426, -0.445 ], "y_axis": [ 0.580, 0.267, 0.770 ], "z_axis": [ -0.209, -0.864, 0.457 ], "quaternion": [ 0.792, 0.516, 0.074, -0.317 ] } }, { "index": 71, "index_chain": 16, "chain_name": "B", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,A-minor,ribose-zipper,kissing-loop", "alpha": -65.733, "beta": 175.015, "gamma": 57.887, "delta": 82.096, "epsilon": -144.871, "zeta": -79.598, "epsilon_zeta": -65.274, "bb_type": "BI", "chi": -166.405, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.731, 0.902 ], "P_xyz": [ 1.205, 9.092, 1.287 ], "form": "A", "ssZp": 4.507, "Dp": 4.601, "splay_angle": 22.768, "splay_distance": 3.608, "splay_ratio": 0.198, "d22": 4.420, "d64": 4.130, "eta": 173.302, "theta": -145.892, "eta_prime": -169.763, "theta_prime": -144.276, "eta_base": -118.590, "theta_base": -120.234, "v0": 0.516, "v1": -22.199, "v2": 34.217, "v3": -34.831, "v4": 21.631, "amplitude": 35.931, "phase_angle": 17.768, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.928, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 8.282, -0.324, 10.018 ], "x_axis": [ 0.981, -0.126, 0.151 ], "y_axis": [ -0.062, 0.531, 0.845 ], "z_axis": [ -0.186, -0.838, 0.513 ], "quaternion": [ 0.870, 0.484, -0.097, -0.018 ] } }, { "index": 72, "index_chain": 17, "chain_name": "B", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -51.920, "beta": 176.571, "gamma": 36.135, "delta": 81.749, "epsilon": -176.691, "zeta": -91.005, "epsilon_zeta": -85.686, "bb_type": "BI", "chi": -155.916, "glyco_bond": "anti", "C5prime_xyz": [ -1.230, 8.697, 0.306 ], "P_xyz": [ 1.290, 9.128, 0.894 ], "form": "A", "ssZp": 4.282, "Dp": 4.411, "splay_angle": 21.354, "splay_distance": 3.337, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.171, "theta": -148.955, "eta_prime": 177.560, "theta_prime": -151.097, "eta_base": -143.797, "theta_base": -136.534, "v0": 3.668, "v1": -24.980, "v2": 35.698, "v3": -34.568, "v4": 19.478, "amplitude": 36.640, "phase_angle": 13.016, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.460, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 8.342, -3.869, 10.688 ], "x_axis": [ 0.802, 0.352, 0.483 ], "y_axis": [ -0.598, 0.459, 0.657 ], "z_axis": [ 0.010, -0.816, 0.579 ], "quaternion": [ 0.842, 0.437, -0.141, 0.282 ] } }, { "index": 73, "index_chain": 18, "chain_name": "B", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -179.596, "beta": -136.430, "gamma": 138.339, "delta": 78.175, "epsilon": -130.555, "zeta": -78.627, "epsilon_zeta": -51.929, "bb_type": "BI", "chi": -174.354, "glyco_bond": "anti", "C5prime_xyz": [ -1.547, 8.546, 1.355 ], "P_xyz": [ 0.837, 9.079, 0.436 ], "form": "A", "ssZp": 4.668, "Dp": 4.729, "splay_angle": 23.970, "splay_distance": 3.902, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 158.670, "theta": -135.653, "eta_prime": 170.628, "theta_prime": -139.884, "eta_base": -161.663, "theta_base": -109.901, "v0": 1.798, "v1": -24.694, "v2": 37.050, "v3": -37.082, "v4": 22.204, "amplitude": 38.552, "phase_angle": 16.045, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 9.094, -7.063, 11.296 ], "x_axis": [ 0.470, 0.629, 0.619 ], "y_axis": [ -0.864, 0.185, 0.468 ], "z_axis": [ 0.180, -0.755, 0.631 ], "quaternion": [ 0.756, 0.404, -0.145, 0.494 ] } }, { "index": 74, "index_chain": 19, "chain_name": "B", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -46.813, "beta": 163.297, "gamma": 44.778, "delta": 75.490, "epsilon": -146.880, "zeta": -79.694, "epsilon_zeta": -67.185, "bb_type": "BI", "chi": -162.323, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.854, 0.627 ], "P_xyz": [ 0.906, 9.524, 0.817 ], "form": "A", "ssZp": 4.492, "Dp": 4.665, "splay_angle": 23.069, "splay_distance": 3.722, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 164.329, "theta": -154.568, "eta_prime": -178.868, "theta_prime": -153.562, "eta_base": -127.016, "theta_base": -134.388, "v0": -0.172, "v1": -24.301, "v2": 38.238, "v3": -39.394, "v4": 24.899, "amplitude": 40.403, "phase_angle": 18.844, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.549, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 11.735, -8.273, 13.902 ], "x_axis": [ -0.196, 0.656, 0.729 ], "y_axis": [ -0.946, -0.321, 0.034 ], "z_axis": [ 0.256, -0.683, 0.684 ], "quaternion": [ 0.540, 0.332, -0.219, 0.742 ] } }, { "index": 75, "index_chain": 20, "chain_name": "B", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -60.155, "beta": 162.633, "gamma": 58.745, "delta": 77.028, "epsilon": -138.338, "zeta": -83.080, "epsilon_zeta": -55.258, "bb_type": "BI", "chi": -171.731, "glyco_bond": "anti", "C5prime_xyz": [ -1.808, 8.664, 1.157 ], "P_xyz": [ 0.703, 9.377, 1.316 ], "form": "A", "ssZp": 4.626, "Dp": 4.682, "splay_angle": 22.099, "splay_distance": 3.482, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 169.487, "theta": -150.335, "eta_prime": 179.483, "theta_prime": -150.070, "eta_base": -149.679, "theta_base": -120.876, "v0": -0.298, "v1": -23.609, "v2": 37.252, "v3": -38.490, "v4": 24.417, "amplitude": 39.411, "phase_angle": 19.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.804, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 14.152, -9.616, 16.393 ], "x_axis": [ -0.621, 0.588, 0.518 ], "y_axis": [ -0.771, -0.577, -0.270 ], "z_axis": [ 0.140, -0.567, 0.812 ], "quaternion": [ 0.392, 0.190, -0.241, 0.867 ] } }, { "index": 76, "index_chain": 21, "chain_name": "B", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,kissing-loop", "alpha": -66.845, "beta": 162.638, "gamma": 58.068, "delta": 78.390, "epsilon": -145.766, "zeta": -71.893, "epsilon_zeta": -73.873, "bb_type": "BI", "chi": -172.405, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.630, 1.214 ], "P_xyz": [ 1.030, 9.105, 1.284 ], "form": "A", "ssZp": 4.665, "Dp": 4.691, "splay_angle": 24.523, "splay_distance": 3.995, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 161.005, "theta": -143.544, "eta_prime": 173.044, "theta_prime": -144.383, "eta_base": -142.022, "theta_base": -123.708, "v0": 2.709, "v1": -26.057, "v2": 38.240, "v3": -37.700, "v4": 22.009, "amplitude": 39.539, "phase_angle": 14.731, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.802, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 15.127, -9.896, 19.724 ], "x_axis": [ -0.963, 0.235, 0.134 ], "y_axis": [ -0.270, -0.840, -0.470 ], "z_axis": [ 0.002, -0.488, 0.873 ], "quaternion": [ 0.132, 0.036, -0.250, 0.959 ] } }, { "index": 77, "index_chain": 22, "chain_name": "B", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop", "alpha": -69.371, "beta": 167.836, "gamma": 68.022, "delta": 77.457, "epsilon": -154.578, "zeta": -72.569, "epsilon_zeta": -82.009, "bb_type": "BI", "chi": -174.723, "glyco_bond": "anti", "C5prime_xyz": [ -1.813, 8.682, 1.305 ], "P_xyz": [ 0.679, 9.477, 1.410 ], "form": "A", "ssZp": 4.608, "Dp": 4.601, "splay_angle": 26.403, "splay_distance": 4.220, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 168.994, "theta": -152.654, "eta_prime": -175.421, "theta_prime": -152.753, "eta_base": -135.750, "theta_base": -132.694, "v0": -0.614, "v1": -23.267, "v2": 36.981, "v3": -38.309, "v4": 24.526, "amplitude": 39.218, "phase_angle": 19.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.620, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 14.734, -9.378, 23.666 ], "x_axis": [ -0.969, -0.194, -0.153 ], "y_axis": [ 0.244, -0.851, -0.465 ], "z_axis": [ -0.040, -0.488, 0.872 ], "quaternion": [ -0.114, -0.050, -0.248, 0.961 ] } }, { "index": 78, "index_chain": 23, "chain_name": "B", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -63.680, "beta": -175.769, "gamma": 52.545, "delta": 80.016, "epsilon": -149.540, "zeta": -72.859, "epsilon_zeta": -76.681, "bb_type": "BI", "chi": -164.365, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.739, 0.771 ], "P_xyz": [ 0.980, 9.337, 1.382 ], "form": "A", "ssZp": 4.502, "Dp": 4.610, "splay_angle": 20.593, "splay_distance": 3.374, "splay_ratio": 0.183, "d22": 4.361, "d64": 4.278, "eta": 175.877, "theta": -148.119, "eta_prime": -175.871, "theta_prime": -145.475, "eta_base": -145.362, "theta_base": -124.220, "v0": 0.994, "v1": -23.398, "v2": 35.675, "v3": -36.082, "v4": 22.138, "amplitude": 37.330, "phase_angle": 17.124, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.907, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 13.645, -9.061, 27.731 ], "x_axis": [ -0.709, -0.576, -0.407 ], "y_axis": [ 0.703, -0.626, -0.338 ], "z_axis": [ -0.060, -0.526, 0.849 ], "quaternion": [ -0.359, -0.131, -0.242, 0.892 ] } }, { "index": 79, "index_chain": 24, "chain_name": "B", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": -60.473, "beta": 179.594, "gamma": 43.377, "delta": 80.804, "epsilon": -146.430, "zeta": -82.780, "epsilon_zeta": -63.650, "bb_type": "BI", "chi": -152.546, "glyco_bond": "anti", "C5prime_xyz": [ -1.540, 8.800, 0.069 ], "P_xyz": [ 0.951, 9.528, 0.450 ], "form": ".", "ssZp": 4.163, "Dp": 4.602, "splay_angle": 22.856, "splay_distance": 3.933, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 167.775, "theta": -120.026, "eta_prime": 177.991, "theta_prime": -126.680, "eta_base": -151.166, "theta_base": -87.877, "v0": 0.386, "v1": -22.571, "v2": 34.955, "v3": -35.716, "v4": 22.279, "amplitude": 36.762, "phase_angle": 18.040, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.799, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 11.815, -9.848, 30.454 ], "x_axis": [ -0.233, -0.707, -0.667 ], "y_axis": [ 0.940, -0.339, 0.030 ], "z_axis": [ -0.247, -0.621, 0.744 ], "quaternion": [ 0.541, 0.301, 0.194, -0.761 ] } }, { "index": 80, "index_chain": 25, "chain_name": "B", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,cap-acceptor", "alpha": 136.498, "beta": -147.358, "gamma": -177.242, "delta": 79.927, "epsilon": -88.652, "zeta": -113.391, "epsilon_zeta": 24.739, "bb_type": "--", "chi": -167.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.063, 8.602, 0.968 ], "P_xyz": [ 0.267, 10.092, -0.724 ], "form": ".", "ssZp": 4.280, "Dp": 4.808, "splay_angle": 72.849, "splay_distance": 10.778, "splay_ratio": 0.594, "d22": null, "d64": null, "eta": 164.487, "theta": -133.137, "eta_prime": -179.555, "theta_prime": -171.986, "eta_base": -123.788, "theta_base": 129.051, "v0": 6.355, "v1": -28.685, "v2": 38.985, "v3": -36.327, "v4": 18.877, "amplitude": 39.532, "phase_angle": 9.540, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.563, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 10.093, -13.380, 30.263 ], "x_axis": [ 0.414, -0.681, -0.604 ], "y_axis": [ 0.816, -0.018, 0.578 ], "z_axis": [ -0.405, -0.732, 0.548 ], "quaternion": [ 0.697, 0.470, 0.072, -0.537 ] } }, { "index": 81, "index_chain": 26, "chain_name": "B", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": "}", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": 95.851, "beta": -144.876, "gamma": 100.711, "delta": 85.105, "epsilon": -142.303, "zeta": -71.479, "epsilon_zeta": -70.824, "bb_type": "BI", "chi": -170.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.510, 8.662, 1.152 ], "P_xyz": [ 1.103, 8.701, 1.367 ], "form": ".", "ssZp": 4.450, "Dp": 4.524, "splay_angle": 22.258, "splay_distance": 3.494, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 22.020, "theta": -129.733, "eta_prime": 50.811, "theta_prime": -131.286, "eta_base": 26.629, "theta_base": -88.310, "v0": 0.278, "v1": -20.607, "v2": 31.907, "v3": -32.645, "v4": 20.413, "amplitude": 33.576, "phase_angle": 18.140, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 6.807, -10.295, 40.054 ], "x_axis": [ 0.676, 0.641, 0.364 ], "y_axis": [ 0.709, -0.700, -0.084 ], "z_axis": [ 0.201, 0.315, -0.927 ], "quaternion": [ -0.110, 0.909, 0.371, 0.156 ] } }, { "index": 82, "index_chain": 27, "chain_name": "B", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -67.246, "beta": 168.045, "gamma": 56.372, "delta": 86.009, "epsilon": -119.001, "zeta": -79.201, "epsilon_zeta": -39.800, "bb_type": "--", "chi": -153.312, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.738, 0.159 ], "P_xyz": [ 1.295, 8.975, 0.127 ], "form": ".", "ssZp": 3.949, "Dp": 4.622, "splay_angle": 39.650, "splay_distance": 6.491, "splay_ratio": 0.339, "d22": null, "d64": null, "eta": 171.635, "theta": -123.931, "eta_prime": -171.184, "theta_prime": -114.433, "eta_base": -111.598, "theta_base": -108.556, "v0": 1.397, "v1": -21.362, "v2": 31.999, "v3": -32.108, "v4": 19.440, "amplitude": 33.339, "phase_angle": 16.294, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.892, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 8.533, -8.113, 37.940 ], "x_axis": [ 0.985, -0.050, 0.163 ], "y_axis": [ 0.029, -0.892, -0.451 ], "z_axis": [ 0.167, 0.449, -0.877 ], "quaternion": [ -0.232, 0.969, -0.005, 0.085 ] } }, { "index": 83, "index_chain": 28, "chain_name": "B", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -55.637, "beta": -162.143, "gamma": 59.897, "delta": 148.215, "epsilon": -96.837, "zeta": -170.365, "epsilon_zeta": 73.529, "bb_type": "BII", "chi": -76.553, "glyco_bond": "anti", "C5prime_xyz": [ -3.482, 7.162, -2.734 ], "P_xyz": [ -1.539, 8.597, -3.773 ], "form": ".", "ssZp": 0.934, "Dp": 0.893, "splay_angle": 106.220, "splay_distance": 15.251, "splay_ratio": 0.800, "d22": null, "d64": null, "eta": -149.126, "theta": -139.839, "eta_prime": -125.706, "theta_prime": 168.368, "eta_base": -126.409, "theta_base": 139.567, "v0": -26.347, "v1": 40.687, "v2": -38.521, "v3": 24.360, "v4": 1.007, "amplitude": 41.053, "phase_angle": 159.774, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.529, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 11.669, -5.852, 32.726 ], "x_axis": [ 0.880, -0.418, 0.226 ], "y_axis": [ -0.220, -0.779, -0.587 ], "z_axis": [ 0.422, 0.466, -0.778 ], "quaternion": [ -0.284, 0.927, -0.172, 0.175 ] } }, { "index": 84, "index_chain": 29, "chain_name": "B", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": 65.903, "beta": -173.551, "gamma": 82.947, "delta": 149.557, "epsilon": -90.333, "zeta": -58.525, "epsilon_zeta": -31.808, "bb_type": "--", "chi": -121.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.932, 8.579, -1.064 ], "P_xyz": [ 0.633, 9.090, -0.753 ], "form": ".", "ssZp": 0.575, "Dp": 0.630, "splay_angle": 126.693, "splay_distance": 16.707, "splay_ratio": 0.894, "d22": null, "d64": null, "eta": 23.533, "theta": -47.512, "eta_prime": 53.862, "theta_prime": -67.320, "eta_base": 65.118, "theta_base": -35.909, "v0": -20.155, "v1": 35.630, "v2": -36.611, "v3": 25.953, "v4": -3.858, "amplitude": 37.571, "phase_angle": 167.019, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.085, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -1.017, -2.151, 25.114 ], "x_axis": [ -0.615, -0.562, 0.553 ], "y_axis": [ 0.731, -0.669, 0.133 ], "z_axis": [ 0.295, 0.486, 0.822 ], "quaternion": [ -0.367, 0.241, 0.176, 0.881 ] } }, { "index": 85, "index_chain": 30, "chain_name": "B", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,bulge,kissing-loop,splayed-apart", "alpha": -68.186, "beta": 113.770, "gamma": -178.883, "delta": 141.001, "epsilon": -150.274, "zeta": 44.965, "epsilon_zeta": 164.761, "bb_type": "--", "chi": -37.626, "glyco_bond": "--", "C5prime_xyz": [ -4.216, 5.561, -2.984 ], "P_xyz": [ -6.260, 4.265, -4.012 ], "form": ".", "ssZp": 0.122, "Dp": 2.021, "splay_angle": 132.787, "splay_distance": 17.784, "splay_ratio": 0.917, "d22": null, "d64": null, "eta": -80.847, "theta": -21.643, "eta_prime": -54.100, "theta_prime": 0.750, "eta_base": -51.500, "theta_base": 56.171, "v0": -23.229, "v1": 34.756, "v2": -32.473, "v3": 19.893, "v4": 1.918, "amplitude": 34.979, "phase_angle": 158.182, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 14.121, -8.570, 28.070 ], "x_axis": [ 0.879, 0.132, 0.459 ], "y_axis": [ -0.307, 0.892, 0.332 ], "z_axis": [ -0.366, -0.433, 0.824 ], "quaternion": [ 0.948, 0.202, -0.217, 0.116 ] } }, { "index": 86, "index_chain": 31, "chain_name": "B", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,phosphate,splayed-apart", "alpha": 55.331, "beta": 139.505, "gamma": -37.741, "delta": 88.985, "epsilon": -159.212, "zeta": -63.697, "epsilon_zeta": -95.514, "bb_type": "BI", "chi": -165.359, "glyco_bond": "anti", "C5prime_xyz": [ -0.614, 8.307, 0.827 ], "P_xyz": [ 1.344, 8.579, 2.559 ], "form": ".", "ssZp": 4.605, "Dp": 4.668, "splay_angle": 27.832, "splay_distance": 4.386, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": -160.092, "theta": -154.519, "eta_prime": -147.699, "theta_prime": -146.606, "eta_base": -164.039, "theta_base": -131.338, "v0": 14.481, "v1": -32.271, "v2": 36.839, "v3": -29.480, "v4": 9.595, "amplitude": 36.923, "phase_angle": 356.127, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -1.401, 0.077, 27.337 ], "x_axis": [ -0.043, -0.878, 0.477 ], "y_axis": [ 0.989, -0.105, -0.105 ], "z_axis": [ 0.143, 0.467, 0.872 ], "quaternion": [ 0.657, -0.218, -0.127, -0.711 ] } }, { "index": 87, "index_chain": 32, "chain_name": "B", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -81.741, "beta": -179.590, "gamma": 69.446, "delta": 80.193, "epsilon": -151.438, "zeta": -63.090, "epsilon_zeta": -88.348, "bb_type": "BI", "chi": -172.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.569, 8.643, 1.198 ], "P_xyz": [ 0.981, 9.216, 1.451 ], "form": "A", "ssZp": 4.620, "Dp": 4.633, "splay_angle": 25.646, "splay_distance": 4.005, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 171.752, "theta": -139.141, "eta_prime": -174.442, "theta_prime": -139.202, "eta_base": -152.567, "theta_base": -101.753, "v0": 1.797, "v1": -24.312, "v2": 36.272, "v3": -36.267, "v4": 21.748, "amplitude": 37.725, "phase_angle": 15.950, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.432, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -3.263, 2.486, 30.493 ], "x_axis": [ 0.286, -0.897, 0.337 ], "y_axis": [ 0.936, 0.186, -0.299 ], "z_axis": [ 0.206, 0.401, 0.893 ], "quaternion": [ 0.769, -0.228, -0.043, -0.596 ] } }, { "index": 88, "index_chain": 33, "chain_name": "B", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -79.832, "beta": 179.344, "gamma": 61.173, "delta": 80.383, "epsilon": -153.286, "zeta": -67.352, "epsilon_zeta": -85.933, "bb_type": "BI", "chi": -172.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.426, 8.609, 1.212 ], "P_xyz": [ 1.145, 9.027, 1.574 ], "form": "A", "ssZp": 4.648, "Dp": 4.650, "splay_angle": 25.012, "splay_distance": 3.910, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 162.675, "theta": -144.531, "eta_prime": -179.766, "theta_prime": -143.478, "eta_base": -121.731, "theta_base": -115.085, "v0": 3.829, "v1": -26.236, "v2": 37.437, "v3": -36.229, "v4": 20.410, "amplitude": 38.420, "phase_angle": 12.987, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -3.011, 1.885, 34.444 ], "x_axis": [ 0.829, -0.559, -0.036 ], "y_axis": [ 0.480, 0.742, -0.467 ], "z_axis": [ 0.288, 0.370, 0.883 ], "quaternion": [ 0.929, -0.225, 0.087, -0.279 ] } }, { "index": 89, "index_chain": 34, "chain_name": "B", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,phosphate", "alpha": -72.247, "beta": 169.341, "gamma": 69.463, "delta": 81.644, "epsilon": -140.738, "zeta": -66.148, "epsilon_zeta": -74.589, "bb_type": "BI", "chi": -174.951, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.601, 1.374 ], "P_xyz": [ 1.089, 9.059, 1.489 ], "form": ".", "ssZp": 4.666, "Dp": 4.670, "splay_angle": 27.985, "splay_distance": 4.263, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 173.895, "theta": -132.039, "eta_prime": -170.039, "theta_prime": -130.841, "eta_base": -124.394, "theta_base": -80.063, "v0": 1.864, "v1": -23.830, "v2": 35.445, "v3": -35.301, "v4": 21.101, "amplitude": 36.823, "phase_angle": 15.722, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.560, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -1.912, 1.179, 38.130 ], "x_axis": [ 0.969, -0.014, -0.245 ], "y_axis": [ -0.084, 0.920, -0.384 ], "z_axis": [ 0.231, 0.393, 0.890 ], "quaternion": [ 0.972, -0.200, 0.123, 0.018 ] } }, { "index": 90, "index_chain": 35, "chain_name": "B", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge,kissing-loop,phosphate", "alpha": -71.578, "beta": 161.753, "gamma": 65.828, "delta": 83.984, "epsilon": -135.411, "zeta": -71.170, "epsilon_zeta": -64.241, "bb_type": "BI", "chi": -172.636, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.554, 1.278 ], "P_xyz": [ 1.335, 8.719, 1.240 ], "form": ".", "ssZp": 4.631, "Dp": 4.685, "splay_angle": 26.829, "splay_distance": 4.124, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 164.591, "theta": -128.327, "eta_prime": -171.569, "theta_prime": -128.496, "eta_base": -97.030, "theta_base": -82.559, "v0": 3.925, "v1": -24.670, "v2": 34.867, "v3": -33.537, "v4": 18.701, "amplitude": 35.703, "phase_angle": 12.425, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.686, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 1.511, 2.644, 40.205 ], "x_axis": [ 0.527, 0.741, -0.416 ], "y_axis": [ -0.820, 0.572, -0.019 ], "z_axis": [ 0.224, 0.352, 0.909 ], "quaternion": [ 0.867, -0.107, 0.185, 0.450 ] } }, { "index": 91, "index_chain": 36, "chain_name": "B", "nt_resnum": 37, "nt_name": "C", "nt_code": "C", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -62.709, "beta": 162.608, "gamma": 57.630, "delta": 83.821, "epsilon": -151.455, "zeta": -65.996, "epsilon_zeta": -85.459, "bb_type": "BI", "chi": -168.046, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.647, 1.019 ], "P_xyz": [ 1.426, 8.755, 1.175 ], "form": "A", "ssZp": 4.508, "Dp": 4.574, "splay_angle": 23.041, "splay_distance": 3.605, "splay_ratio": 0.200, "d22": 4.282, "d64": 3.794, "eta": 162.231, "theta": -136.124, "eta_prime": -173.782, "theta_prime": -129.479, "eta_base": -102.986, "theta_base": -106.845, "v0": 2.916, "v1": -23.632, "v2": 34.137, "v3": -33.396, "v4": 19.250, "amplitude": 35.174, "phase_angle": 13.950, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.065, "frame": { "rmsd": 0.004, "origin": [ 3.479, 5.778, 42.024 ], "x_axis": [ -0.325, 0.885, -0.334 ], "y_axis": [ -0.915, -0.204, 0.349 ], "z_axis": [ 0.241, 0.419, 0.876 ], "quaternion": [ 0.580, -0.030, 0.248, 0.775 ] } }, { "index": 92, "index_chain": 37, "chain_name": "B", "nt_resnum": 38, "nt_name": "U", "nt_code": "U", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -78.613, "beta": -168.858, "gamma": 72.363, "delta": 151.253, "epsilon": -62.051, "zeta": 95.706, "epsilon_zeta": 202.243, "bb_type": "--", "chi": -129.422, "glyco_bond": "anti", "C5prime_xyz": [ -1.814, 8.608, -0.660 ], "P_xyz": [ 0.614, 9.120, 0.228 ], "form": ".", "ssZp": -0.013, "Dp": 0.063, "splay_angle": 113.342, "splay_distance": 17.572, "splay_ratio": 0.836, "d22": null, "d64": null, "eta": -150.138, "theta": 129.055, "eta_prime": -122.650, "theta_prime": 103.457, "eta_base": -99.943, "theta_base": 91.639, "v0": -19.591, "v1": 35.456, "v2": -36.787, "v3": 26.475, "v4": -4.511, "amplitude": 37.609, "phase_angle": 168.002, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.467, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 4.755, 8.423, 44.115 ], "x_axis": [ -0.845, 0.398, -0.357 ], "y_axis": [ -0.534, -0.603, 0.593 ], "z_axis": [ 0.021, 0.692, 0.722 ], "quaternion": [ 0.262, -0.094, 0.361, 0.890 ] } }, { "index": 93, "index_chain": 38, "chain_name": "B", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -152.028, "beta": -109.040, "gamma": -84.040, "delta": 89.416, "epsilon": -157.067, "zeta": -69.131, "epsilon_zeta": -87.935, "bb_type": "BI", "chi": -149.507, "glyco_bond": "anti", "C5prime_xyz": [ -0.905, 8.560, -0.023 ], "P_xyz": [ -1.257, 11.074, -0.645 ], "form": ".", "ssZp": 4.082, "Dp": 4.508, "splay_angle": 15.431, "splay_distance": 2.502, "splay_ratio": 0.134, "d22": null, "d64": null, "eta": 71.449, "theta": 153.287, "eta_prime": 40.977, "theta_prime": 178.915, "eta_base": 44.039, "theta_base": -170.306, "v0": 7.095, "v1": -24.777, "v2": 31.954, "v3": -28.801, "v4": 13.809, "amplitude": 32.144, "phase_angle": 6.231, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 5.674, -8.958, 46.529 ], "x_axis": [ -0.955, -0.002, -0.296 ], "y_axis": [ -0.098, 0.947, 0.307 ], "z_axis": [ 0.279, 0.322, -0.905 ], "quaternion": [ 0.147, -0.026, 0.976, 0.161 ] } }, { "index": 94, "index_chain": 39, "chain_name": "B", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": -68.491, "beta": 174.616, "gamma": 70.835, "delta": 141.766, "epsilon": -117.942, "zeta": 167.626, "epsilon_zeta": 74.432, "bb_type": "BII", "chi": -110.100, "glyco_bond": "anti", "C5prime_xyz": [ -2.258, 8.345, -1.773 ], "P_xyz": [ 0.225, 9.107, -2.082 ], "form": ".", "ssZp": 1.337, "Dp": 1.418, "splay_angle": 48.792, "splay_distance": 7.971, "splay_ratio": 0.417, "d22": 6.666, "d64": 7.145, "eta": -167.318, "theta": 161.342, "eta_prime": -140.010, "theta_prime": 151.824, "eta_base": -140.239, "theta_base": -170.851, "v0": -24.621, "v1": 36.499, "v2": -33.877, "v3": 20.542, "v4": 2.377, "amplitude": 36.639, "phase_angle": 157.609, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.644, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 6.748, -9.145, 44.276 ], "x_axis": [ -0.966, 0.250, -0.067 ], "y_axis": [ 0.253, 0.967, -0.029 ], "z_axis": [ 0.058, -0.045, -0.997 ], "quaternion": [ 0.032, 0.127, 0.991, -0.018 ] } }, { "index": 95, "index_chain": 40, "chain_name": "B", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -62.275, "beta": 155.890, "gamma": 21.470, "delta": 83.844, "epsilon": -144.497, "zeta": -56.149, "epsilon_zeta": -88.348, "bb_type": "BI", "chi": -173.577, "glyco_bond": "anti", "C5prime_xyz": [ -1.249, 8.558, 1.347 ], "P_xyz": [ 1.041, 8.487, 2.627 ], "form": ".", "ssZp": 4.553, "Dp": 4.597, "splay_angle": 35.239, "splay_distance": 5.369, "splay_ratio": 0.303, "d22": null, "d64": null, "eta": 176.615, "theta": -121.996, "eta_prime": 164.723, "theta_prime": -116.932, "eta_base": -163.273, "theta_base": -74.554, "v0": 1.995, "v1": -22.612, "v2": 33.429, "v3": -33.227, "v4": 19.714, "amplitude": 34.674, "phase_angle": 15.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.049, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 13.227, -10.871, 39.966 ], "x_axis": [ -0.919, 0.334, -0.208 ], "y_axis": [ 0.138, 0.768, 0.626 ], "z_axis": [ 0.369, 0.547, -0.752 ], "quaternion": [ 0.155, 0.127, 0.927, 0.316 ] } }, { "index": 96, "index_chain": 41, "chain_name": "B", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -79.944, "beta": -164.540, "gamma": 49.731, "delta": 84.807, "epsilon": -162.944, "zeta": -72.968, "epsilon_zeta": -89.976, "bb_type": "BI", "chi": -167.960, "glyco_bond": "anti", "C5prime_xyz": [ -1.142, 8.509, 1.040 ], "P_xyz": [ 1.270, 8.559, 2.073 ], "form": ".", "ssZp": 4.498, "Dp": 4.525, "splay_angle": 27.813, "splay_distance": 4.320, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 161.475, "theta": -116.672, "eta_prime": -176.637, "theta_prime": -118.028, "eta_base": -115.629, "theta_base": -70.278, "v0": 5.051, "v1": -25.154, "v2": 34.583, "v3": -32.644, "v4": 17.443, "amplitude": 35.181, "phase_angle": 10.581, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.607, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 12.428, -7.114, 36.213 ], "x_axis": [ -0.529, 0.593, 0.607 ], "y_axis": [ 0.769, 0.032, 0.639 ], "z_axis": [ 0.359, 0.805, -0.473 ], "quaternion": [ -0.087, 0.477, 0.713, 0.506 ] } }, { "index": 97, "index_chain": 42, "chain_name": "B", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": 170.586, "beta": -137.491, "gamma": 143.081, "delta": 80.637, "epsilon": -118.007, "zeta": -86.804, "epsilon_zeta": -31.203, "bb_type": "--", "chi": -178.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.561, 8.490, 1.611 ], "P_xyz": [ 0.830, 9.123, 0.770 ], "form": ".", "ssZp": 4.683, "Dp": 4.733, "splay_angle": 22.512, "splay_distance": 3.542, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 156.776, "theta": -133.714, "eta_prime": -176.106, "theta_prime": -127.666, "eta_base": -104.631, "theta_base": -85.807, "v0": 2.512, "v1": -24.358, "v2": 35.774, "v3": -35.374, "v4": 20.717, "amplitude": 37.012, "phase_angle": 14.864, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 12.040, -2.838, 36.696 ], "x_axis": [ 0.248, 0.379, 0.892 ], "y_axis": [ 0.922, -0.376, -0.096 ], "z_axis": [ 0.298, 0.846, -0.442 ], "quaternion": [ -0.328, 0.719, 0.452, 0.414 ] } }, { "index": 98, "index_chain": 43, "chain_name": "B", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///B/44", "linked_nts": [ "///B/43", "///B/45" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -45.607, "beta": 151.386, "gamma": 66.649, "delta": 147.001, "epsilon": -109.024, "zeta": 86.326, "epsilon_zeta": 164.650, "bb_type": "--", "chi": -134.008, "glyco_bond": "anti", "C5prime_xyz": [ -2.149, 8.719, -0.505 ], "P_xyz": [ 0.405, 9.192, -0.134 ], "form": ".", "ssZp": 1.054, "Dp": 1.114, "splay_angle": 110.067, "splay_distance": 17.099, "splay_ratio": 0.820, "d22": 10.903, "d64": 13.854, "eta": -171.739, "theta": 66.110, "eta_prime": -132.310, "theta_prime": 38.462, "eta_base": -81.097, "theta_base": 52.006, "v0": -24.286, "v1": 38.173, "v2": -36.665, "v3": 23.634, "v4": 0.160, "amplitude": 38.792, "phase_angle": 160.941, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.364, "filter_rmsd": 0.101, "frame": { "rmsd": 0.004, "origin": [ 13.413, 0.212, 37.860 ], "x_axis": [ 0.745, -0.230, 0.627 ], "y_axis": [ 0.562, -0.290, -0.774 ], "z_axis": [ 0.360, 0.929, -0.087 ], "quaternion": [ 0.585, -0.728, -0.114, -0.339 ] } }, { "index": 99, "index_chain": 44, "chain_name": "B", "nt_resnum": 45, "nt_name": "C", "nt_code": "C", "nt_id": "///B/45", "linked_nts": [ "///B/44", "///B/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -130.081, "beta": 99.805, "gamma": 174.741, "delta": 80.986, "epsilon": -142.380, "zeta": -71.223, "epsilon_zeta": -71.156, "bb_type": "BI", "chi": -165.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.241, 8.682, 0.886 ], "P_xyz": [ -1.732, 10.858, -0.492 ], "form": "A", "ssZp": 4.553, "Dp": 4.678, "splay_angle": 26.044, "splay_distance": 4.157, "splay_ratio": 0.228, "d22": 4.168, "d64": 4.313, "eta": -142.182, "theta": 159.381, "eta_prime": -141.103, "theta_prime": 179.245, "eta_base": -140.623, "theta_base": -141.867, "v0": 3.272, "v1": -25.154, "v2": 36.324, "v3": -35.452, "v4": 20.285, "amplitude": 37.393, "phase_angle": 13.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 14.864, -9.647, 23.964 ], "x_axis": [ -0.916, -0.165, -0.367 ], "y_axis": [ -0.276, 0.921, 0.275 ], "z_axis": [ 0.293, 0.353, -0.889 ], "quaternion": [ 0.171, -0.114, 0.965, 0.163 ] } }, { "index": 100, "index_chain": 45, "chain_name": "B", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///B/46", "linked_nts": [ "///B/45", "///B/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -60.330, "beta": 175.897, "gamma": 50.435, "delta": 79.295, "epsilon": -147.028, "zeta": -72.605, "epsilon_zeta": -74.423, "bb_type": "BI", "chi": -162.702, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.796, 0.679 ], "P_xyz": [ 1.144, 9.293, 1.137 ], "form": "A", "ssZp": 4.458, "Dp": 4.627, "splay_angle": 22.642, "splay_distance": 3.625, "splay_ratio": 0.198, "d22": 4.124, "d64": 4.303, "eta": 168.757, "theta": -145.792, "eta_prime": -176.525, "theta_prime": -143.126, "eta_base": -132.736, "theta_base": -113.497, "v0": 0.656, "v1": -23.244, "v2": 35.791, "v3": -36.395, "v4": 22.532, "amplitude": 37.556, "phase_angle": 17.640, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 14.688, -9.759, 19.813 ], "x_axis": [ -0.938, 0.340, 0.069 ], "y_axis": [ 0.335, 0.837, 0.432 ], "z_axis": [ 0.089, 0.428, -0.899 ], "quaternion": [ 0.005, 0.176, 0.958, 0.224 ] } }, { "index": 101, "index_chain": 46, "chain_name": "B", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///B/47", "linked_nts": [ "///B/46", "///B/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -61.968, "beta": 164.626, "gamma": 59.930, "delta": 79.125, "epsilon": -117.914, "zeta": -50.958, "epsilon_zeta": -66.956, "bb_type": "--", "chi": -162.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.754, 0.668 ], "P_xyz": [ 0.952, 9.321, 0.556 ], "form": ".", "ssZp": 4.339, "Dp": 4.729, "splay_angle": 20.744, "splay_distance": 3.711, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 175.446, "theta": -126.560, "eta_prime": -171.571, "theta_prime": -139.833, "eta_base": -130.877, "theta_base": -138.916, "v0": 0.685, "v1": -23.729, "v2": 36.491, "v3": -37.092, "v4": 22.970, "amplitude": 38.285, "phase_angle": 17.610, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 13.460, -8.940, 16.502 ], "x_axis": [ -0.618, 0.723, 0.309 ], "y_axis": [ 0.786, 0.560, 0.260 ], "z_axis": [ 0.015, 0.404, -0.915 ], "quaternion": [ -0.084, 0.429, 0.879, 0.189 ] } }, { "index": 102, "index_chain": 47, "chain_name": "B", "nt_resnum": 48, "nt_name": "G", "nt_code": "G", "nt_id": "///B/48", "linked_nts": [ "///B/47", "///B/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -110.578, "beta": 92.462, "gamma": 150.836, "delta": 82.487, "epsilon": -120.836, "zeta": -81.956, "epsilon_zeta": -38.880, "bb_type": "--", "chi": -179.862, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.413, 1.680 ], "P_xyz": [ -1.002, 10.340, -0.064 ], "form": "A", "ssZp": 4.700, "Dp": 4.729, "splay_angle": 23.124, "splay_distance": 3.687, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 175.652, "theta": -178.457, "eta_prime": 178.662, "theta_prime": -165.583, "eta_base": -165.241, "theta_base": -120.967, "v0": 3.615, "v1": -24.671, "v2": 35.210, "v3": -34.138, "v4": 19.289, "amplitude": 36.145, "phase_angle": 13.062, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.062, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 11.633, -8.764, 13.277 ], "x_axis": [ -0.438, 0.752, 0.492 ], "y_axis": [ 0.884, 0.459, 0.085 ], "z_axis": [ -0.163, 0.472, -0.866 ], "quaternion": [ -0.197, 0.492, 0.831, 0.167 ] } }, { "index": 103, "index_chain": 48, "chain_name": "B", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///B/49", "linked_nts": [ "///B/48", "///B/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.610, "beta": 164.942, "gamma": 31.341, "delta": 77.024, "epsilon": -140.876, "zeta": -86.500, "epsilon_zeta": -54.376, "bb_type": "BI", "chi": -158.309, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.742, 0.407 ], "P_xyz": [ 1.139, 9.269, 0.799 ], "form": "A", "ssZp": 4.381, "Dp": 4.732, "splay_angle": 20.317, "splay_distance": 3.179, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 156.406, "theta": -153.125, "eta_prime": 173.864, "theta_prime": -148.960, "eta_base": -129.558, "theta_base": -119.790, "v0": 2.842, "v1": -26.285, "v2": 38.605, "v3": -37.981, "v4": 22.105, "amplitude": 39.894, "phase_angle": 14.605, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.137, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 9.550, -6.195, 11.648 ], "x_axis": [ 0.325, 0.786, 0.526 ], "y_axis": [ 0.917, -0.126, -0.378 ], "z_axis": [ -0.231, 0.605, -0.762 ], "quaternion": [ -0.331, 0.744, 0.572, 0.099 ] } }, { "index": 104, "index_chain": 49, "chain_name": "B", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///B/50", "linked_nts": [ "///B/49", "///B/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.833, "beta": 155.693, "gamma": 47.402, "delta": 78.381, "epsilon": -148.324, "zeta": -78.746, "epsilon_zeta": -69.578, "bb_type": "BI", "chi": -161.827, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.708, 0.609 ], "P_xyz": [ 1.191, 9.026, 0.505 ], "form": "A", "ssZp": 4.492, "Dp": 4.684, "splay_angle": 22.527, "splay_distance": 3.513, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 166.132, "theta": -148.876, "eta_prime": 178.932, "theta_prime": -149.695, "eta_base": -139.810, "theta_base": -125.131, "v0": 3.221, "v1": -26.341, "v2": 38.281, "v3": -37.449, "v4": 21.585, "amplitude": 39.460, "phase_angle": 14.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.537, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 8.333, -3.511, 10.455 ], "x_axis": [ 0.781, 0.484, 0.394 ], "y_axis": [ 0.599, -0.403, -0.691 ], "z_axis": [ -0.176, 0.776, -0.605 ], "quaternion": [ -0.439, 0.835, 0.324, 0.065 ] } }, { "index": 105, "index_chain": 50, "chain_name": "B", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///B/51", "linked_nts": [ "///B/50", "///B/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor", "alpha": -54.427, "beta": 165.320, "gamma": 49.346, "delta": 78.976, "epsilon": -164.819, "zeta": -86.339, "epsilon_zeta": -78.480, "bb_type": "BI", "chi": -166.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 8.666, 0.865 ], "P_xyz": [ 1.297, 8.998, 0.948 ], "form": "A", "ssZp": 4.558, "Dp": 4.585, "splay_angle": 23.918, "splay_distance": 3.865, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 164.685, "theta": -134.247, "eta_prime": 179.015, "theta_prime": -140.647, "eta_base": -137.569, "theta_base": -116.688, "v0": 5.023, "v1": -27.787, "v2": 38.847, "v3": -36.987, "v4": 20.121, "amplitude": 39.642, "phase_angle": 11.487, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 7.690, -0.115, 9.827 ], "x_axis": [ 0.993, 0.112, 0.039 ], "y_axis": [ 0.094, -0.547, -0.832 ], "z_axis": [ -0.072, 0.830, -0.553 ], "quaternion": [ -0.473, 0.879, 0.059, -0.010 ] } }, { "index": 106, "index_chain": 51, "chain_name": "B", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///B/52", "linked_nts": [ "///B/51", "///B/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor", "alpha": 161.486, "beta": -143.357, "gamma": 164.926, "delta": 80.207, "epsilon": -124.966, "zeta": -80.510, "epsilon_zeta": -44.456, "bb_type": "--", "chi": 173.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.279, 8.152, 2.026 ], "P_xyz": [ 0.798, 9.414, 1.057 ], "form": ".", "ssZp": 4.816, "Dp": 4.812, "splay_angle": 23.501, "splay_distance": 4.153, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 164.312, "theta": -148.066, "eta_prime": -178.991, "theta_prime": -150.261, "eta_base": -132.046, "theta_base": -144.624, "v0": 7.826, "v1": -29.496, "v2": 38.964, "v3": -35.503, "v4": 17.419, "amplitude": 39.293, "phase_angle": 7.411, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.474, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 8.723, 3.608, 9.761 ], "x_axis": [ 0.891, -0.197, -0.409 ], "y_axis": [ -0.452, -0.482, -0.751 ], "z_axis": [ -0.049, 0.854, -0.518 ], "quaternion": [ -0.472, 0.850, -0.191, -0.135 ] } }, { "index": 107, "index_chain": 52, "chain_name": "B", "nt_resnum": 53, "nt_name": "C", "nt_code": "C", "nt_id": "///B/53", "linked_nts": [ "///B/52", "///B/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge,cap-donor", "alpha": -52.487, "beta": 179.159, "gamma": 42.611, "delta": 76.123, "epsilon": -153.903, "zeta": -69.676, "epsilon_zeta": -84.226, "bb_type": "BI", "chi": -154.188, "glyco_bond": "anti", "C5prime_xyz": [ -1.809, 8.946, 0.104 ], "P_xyz": [ 0.525, 10.071, 0.439 ], "form": "A", "ssZp": 4.254, "Dp": 4.558, "splay_angle": 25.090, "splay_distance": 4.021, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 167.680, "theta": -154.514, "eta_prime": 178.466, "theta_prime": -150.069, "eta_base": -163.270, "theta_base": -112.280, "v0": -3.780, "v1": -20.589, "v2": 35.686, "v3": -38.891, "v4": 26.926, "amplitude": 39.078, "phase_angle": 24.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.528, "filter_rmsd": 0.060, "frame": { "rmsd": 0.004, "origin": [ 10.382, 7.269, 10.808 ], "x_axis": [ 0.614, -0.470, -0.634 ], "y_axis": [ -0.771, -0.188, -0.608 ], "z_axis": [ 0.167, 0.863, -0.478 ], "quaternion": [ -0.487, 0.755, -0.411, -0.155 ] } }, { "index": 108, "index_chain": 53, "chain_name": "B", "nt_resnum": 54, "nt_name": "A", "nt_code": "A", "nt_id": "///B/54", "linked_nts": [ "///B/53", "///B/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -67.793, "beta": 165.912, "gamma": 63.921, "delta": 78.912, "epsilon": -157.906, "zeta": -80.667, "epsilon_zeta": -77.239, "bb_type": "BI", "chi": -162.785, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.732, 0.654 ], "P_xyz": [ 1.026, 9.292, 0.380 ], "form": "A", "ssZp": 4.489, "Dp": 4.591, "splay_angle": 25.234, "splay_distance": 4.012, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 166.706, "theta": -127.237, "eta_prime": -175.783, "theta_prime": -134.264, "eta_base": -124.412, "theta_base": -95.584, "v0": 1.818, "v1": -24.839, "v2": 37.183, "v3": -37.136, "v4": 22.255, "amplitude": 38.674, "phase_angle": 15.963, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.753, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 12.506, 9.562, 8.279 ], "x_axis": [ 0.025, -0.568, -0.823 ], "y_axis": [ -0.976, 0.163, -0.143 ], "z_axis": [ 0.215, 0.807, -0.550 ], "quaternion": [ 0.400, -0.594, 0.650, 0.256 ] } }, { "index": 109, "index_chain": 54, "chain_name": "B", "nt_resnum": 55, "nt_name": "G", "nt_code": "G", "nt_id": "///B/55", "linked_nts": [ "///B/54", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 174.198, "beta": -149.626, "gamma": 150.338, "delta": 82.626, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -171.990, "glyco_bond": "anti", "C5prime_xyz": [ -1.203, 8.528, 1.255 ], "P_xyz": [ 0.951, 9.354, 0.010 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 5.697, "v1": -26.367, "v2": 35.922, "v3": -33.642, "v4": 17.653, "amplitude": 36.461, "phase_angle": 9.868, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.043, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 13.730, 10.296, 4.530 ], "x_axis": [ -0.688, -0.382, -0.617 ], "y_axis": [ -0.677, 0.644, 0.355 ], "z_axis": [ 0.262, 0.662, -0.702 ], "quaternion": [ 0.252, -0.304, 0.871, 0.292 ] } } ], "num_hbonds": 310, "hbonds": [ { "index": 1, "atom1_serNum": 22, "atom2_serNum": 2337, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/2/OP2", "atom2_id": "///A/101/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 2, "atom1_serNum": 34, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/2/N7", "atom2_id": "///A/109/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 3, "atom1_serNum": 37, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/2/N6", "atom2_id": "///A/38/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 38, "atom2_serNum": 809, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/2/N1", "atom2_id": "///A/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 44, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/3/OP2", "atom2_id": "///A/101/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 6, "atom1_serNum": 44, "atom2_serNum": 2339, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/3/OP2", "atom2_id": "///A/101/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 7, "atom1_serNum": 44, "atom2_serNum": 2342, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/3/OP2", "atom2_id": "///A/101/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 8, "atom1_serNum": 52, "atom2_serNum": 837, "donAcc_type": "acceptable", "distance": 3.490, "atom1_id": "///A/3/O2'", "atom2_id": "///A/40/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 56, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/3/N7", "atom2_id": "///A/109/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 10, "atom1_serNum": 59, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///A/3/O6", "atom2_id": "///A/37/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 59, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/3/O6", "atom2_id": "///A/109/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 12, "atom1_serNum": 59, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/3/O6", "atom2_id": "///A/109/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 13, "atom1_serNum": 59, "atom2_serNum": 2398, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/3/O6", "atom2_id": "///A/109/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 14, "atom1_serNum": 60, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/3/N1", "atom2_id": "///A/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 62, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/3/N2", "atom2_id": "///A/37/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 71, "atom2_serNum": 838, "donAcc_type": "questionable", "distance": 3.144, "atom1_id": "///A/4/O4'", "atom2_id": "///A/40/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 79, "atom2_serNum": 769, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/4/O2", "atom2_id": "///A/36/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 80, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/4/N3", "atom2_id": "///A/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 82, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/4/O4", "atom2_id": "///A/109/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 20, "atom1_serNum": 86, "atom2_serNum": 124, "donAcc_type": "standard", "distance": 3.644, "atom1_id": "///A/5/OP1", "atom2_id": "///A/6/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 86, "atom2_serNum": 846, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/5/OP1", "atom2_id": "///A/40/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 95, "atom2_serNum": 113, "donAcc_type": "acceptable", "distance": 3.234, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 99, "atom2_serNum": 893, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/5/N7", "atom2_id": "///A/42/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 102, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///A/5/N6", "atom2_id": "///A/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 102, "atom2_serNum": 894, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/5/N6", "atom2_id": "///A/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 103, "atom2_serNum": 544, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/5/N1", "atom2_id": "///A/26/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 108, "atom2_serNum": 2359, "donAcc_type": "standard", "distance": 2.443, "atom1_id": "///A/6/OP1", "atom2_id": "///A/104/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 28, "atom1_serNum": 109, "atom2_serNum": 144, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/6/OP2", "atom2_id": "///A/7/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 121, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/6/O2", "atom2_id": "///A/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 122, "atom2_serNum": 565, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/6/N3", "atom2_id": "///A/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 124, "atom2_serNum": 564, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/6/N4", "atom2_id": "///A/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 135, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/7/O3'", "atom2_id": "///A/102/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 33, "atom1_serNum": 141, "atom2_serNum": 748, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/7/O2", "atom2_id": "///A/35/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 142, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/7/N3", "atom2_id": "///A/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 144, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/7/N4", "atom2_id": "///A/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 148, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///A/8/OP1", "atom2_id": "///A/102/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 37, "atom1_serNum": 148, "atom2_serNum": 2351, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/8/OP1", "atom2_id": "///A/103/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 38, "atom1_serNum": 149, "atom2_serNum": 2354, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/8/OP2", "atom2_id": "///A/103/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 39, "atom1_serNum": 161, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///A/8/O2", "atom2_id": "///A/34/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 162, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/8/N3", "atom2_id": "///A/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 164, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/8/N4", "atom2_id": "///A/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 169, "atom2_serNum": 2354, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///A/9/OP2", "atom2_id": "///A/103/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 43, "atom1_serNum": 177, "atom2_serNum": 193, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///A/9/O2'", "atom2_id": "///A/10/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 181, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/9/O2", "atom2_id": "///A/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 182, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/9/N3", "atom2_id": "///A/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 184, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/9/O4", "atom2_id": "///A/104/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 47, "atom1_serNum": 201, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/10/O2", "atom2_id": "///A/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 202, "atom2_serNum": 677, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/10/N3", "atom2_id": "///A/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 204, "atom2_serNum": 676, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/10/N4", "atom2_id": "///A/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 217, "atom2_serNum": 230, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 221, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/11/O2", "atom2_id": "///A/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 222, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/11/N3", "atom2_id": "///A/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 222, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/11/N3", "atom2_id": "///A/30/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 224, "atom2_serNum": 631, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/11/N4", "atom2_id": "///A/30/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 237, "atom2_serNum": 250, "donAcc_type": "acceptable", "distance": 2.289, "atom1_id": "///A/12/O2'", "atom2_id": "///A/13/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 237, "atom2_serNum": 344, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///A/12/O2'", "atom2_id": "///A/17/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 247, "atom2_serNum": 360, "donAcc_type": "questionable", "distance": 3.234, "atom1_id": "///A/12/N3", "atom2_id": "///A/18/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 257, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/13/O3'", "atom2_id": "///A/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 259, "atom2_serNum": 324, "donAcc_type": "acceptable", "distance": 2.578, "atom1_id": "///A/13/O2'", "atom2_id": "///A/16/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 259, "atom2_serNum": 328, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///A/13/O2'", "atom2_id": "///A/16/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 259, "atom2_serNum": 340, "donAcc_type": "acceptable", "distance": 2.976, "atom1_id": "///A/13/O2'", "atom2_id": "///A/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 266, "atom2_serNum": 1099, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///A/13/N6", "atom2_id": "///A/52/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 267, "atom2_serNum": 1099, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///A/13/N1", "atom2_id": "///A/52/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 269, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/13/N3", "atom2_id": "///A/52/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 273, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/14/OP2", "atom2_id": "///A/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 277, "atom2_serNum": 320, "donAcc_type": "questionable", "distance": 3.158, "atom1_id": "///A/14/O4'", "atom2_id": "///A/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 288, "atom2_serNum": 1129, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/14/O6", "atom2_id": "///A/53/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 289, "atom2_serNum": 1127, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/14/N1", "atom2_id": "///A/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 291, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/14/N2", "atom2_id": "///A/53/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 304, "atom2_serNum": 322, "donAcc_type": "acceptable", "distance": 3.277, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 328, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/16/O2", "atom2_id": "///A/52/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 329, "atom2_serNum": 1107, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/16/N3", "atom2_id": "///A/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 331, "atom2_serNum": 1106, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/16/N4", "atom2_id": "///A/52/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 348, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/17/O2", "atom2_id": "///A/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 349, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/17/N3", "atom2_id": "///A/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 351, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/17/N4", "atom2_id": "///A/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 369, "atom2_serNum": 1062, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/18/N3", "atom2_id": "///A/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 371, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/18/O4", "atom2_id": "///A/50/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 371, "atom2_serNum": 2370, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/18/O4", "atom2_id": "///A/105/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 80, "atom1_serNum": 391, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/19/N6", "atom2_id": "///A/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 392, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/19/N1", "atom2_id": "///A/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 411, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/20/N3", "atom2_id": "///A/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 413, "atom2_serNum": 1018, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/20/N4", "atom2_id": "///A/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 433, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/21/N6", "atom2_id": "///A/47/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 434, "atom2_serNum": 996, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/21/N1", "atom2_id": "///A/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 452, "atom2_serNum": 2382, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/22/N7", "atom2_id": "///A/107/N4", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 87, "atom1_serNum": 455, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/22/O6", "atom2_id": "///A/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 456, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/22/N1", "atom2_id": "///A/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 458, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/22/N2", "atom2_id": "///A/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 475, "atom2_serNum": 2381, "donAcc_type": "standard", "distance": 2.388, "atom1_id": "///A/23/N7", "atom2_id": "///A/107/N3", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 91, "atom1_serNum": 478, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/23/O6", "atom2_id": "///A/45/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 478, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 2.381, "atom1_id": "///A/23/O6", "atom2_id": "///A/107/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 93, "atom1_serNum": 479, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/23/N1", "atom2_id": "///A/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 481, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/23/N2", "atom2_id": "///A/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 498, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/24/O2", "atom2_id": "///A/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 499, "atom2_serNum": 655, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/24/N3", "atom2_id": "///A/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 506, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 3.604, "atom1_id": "///A/25/OP2", "atom2_id": "///A/112/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 98, "atom1_serNum": 514, "atom2_serNum": 886, "donAcc_type": "acceptable", "distance": 2.610, "atom1_id": "///A/25/O2'", "atom2_id": "///A/42/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 514, "atom2_serNum": 896, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///A/25/O2'", "atom2_id": "///A/42/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 514, "atom2_serNum": 904, "donAcc_type": "acceptable", "distance": 3.066, "atom1_id": "///A/25/O2'", "atom2_id": "///A/43/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 518, "atom2_serNum": 609, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/25/O2", "atom2_id": "///A/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 519, "atom2_serNum": 606, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/25/N3", "atom2_id": "///A/29/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 534, "atom2_serNum": 584, "donAcc_type": "acceptable", "distance": 2.935, "atom1_id": "///A/26/O2'", "atom2_id": "///A/28/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 538, "atom2_serNum": 2414, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///A/26/N7", "atom2_id": "///A/112/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 105, "atom1_serNum": 541, "atom2_serNum": 2414, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/26/O6", "atom2_id": "///A/112/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 106, "atom1_serNum": 542, "atom2_serNum": 594, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/26/N1", "atom2_id": "///A/29/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 544, "atom2_serNum": 594, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/26/N2", "atom2_id": "///A/29/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 544, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/26/N2", "atom2_id": "///A/29/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 564, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/27/O6", "atom2_id": "///A/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 572, "atom2_serNum": 2415, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/28/OP2", "atom2_id": "///A/112/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 111, "atom1_serNum": 602, "atom2_serNum": 657, "donAcc_type": "acceptable", "distance": 3.613, "atom1_id": "///A/29/O2'", "atom2_id": "///A/31/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 609, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/29/N6", "atom2_id": "///A/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 610, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/29/N1", "atom2_id": "///A/43/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 647, "atom2_serNum": 660, "donAcc_type": "acceptable", "distance": 2.606, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 647, "atom2_serNum": 2402, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/31/O2'", "atom2_id": "///A/110/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 116, "atom1_serNum": 651, "atom2_serNum": 908, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///A/31/N7", "atom2_id": "///A/43/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 654, "atom2_serNum": 908, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///A/31/N6", "atom2_id": "///A/43/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 660, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/32/OP1", "atom2_id": "///A/110/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 119, "atom1_serNum": 660, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/32/OP1", "atom2_id": "///A/110/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 120, "atom1_serNum": 660, "atom2_serNum": 2405, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///A/32/OP1", "atom2_id": "///A/110/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 121, "atom1_serNum": 661, "atom2_serNum": 2362, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///A/32/OP2", "atom2_id": "///A/104/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 122, "atom1_serNum": 662, "atom2_serNum": 2405, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/32/O5'", "atom2_id": "///A/110/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 123, "atom1_serNum": 683, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///A/33/OP1", "atom2_id": "///A/110/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 124, "atom1_serNum": 696, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/33/N7", "atom2_id": "///A/104/N4", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 125, "atom1_serNum": 699, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 2.337, "atom1_id": "///A/33/O6", "atom2_id": "///A/104/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 126, "atom1_serNum": 707, "atom2_serNum": 2395, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/34/OP2", "atom2_id": "///A/109/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 127, "atom1_serNum": 719, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/34/N7", "atom2_id": "///A/104/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 128, "atom1_serNum": 722, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/34/O6", "atom2_id": "///A/104/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 129, "atom1_serNum": 730, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 2.199, "atom1_id": "///A/35/OP2", "atom2_id": "///A/109/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 130, "atom1_serNum": 768, "atom2_serNum": 2398, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/36/O6", "atom2_id": "///A/109/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 131, "atom1_serNum": 802, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/38/O3'", "atom2_id": "///A/113/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 132, "atom1_serNum": 808, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///A/38/O2", "atom2_id": "///A/113/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 133, "atom1_serNum": 816, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///A/39/OP2", "atom2_id": "///A/113/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 134, "atom1_serNum": 817, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/39/O5'", "atom2_id": "///A/113/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 135, "atom1_serNum": 837, "atom2_serNum": 2424, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///A/40/OP1", "atom2_id": "///A/113/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 136, "atom1_serNum": 877, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/42/OP1", "atom2_id": "///A/111/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 137, "atom1_serNum": 878, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/42/OP2", "atom2_id": "///A/111/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 138, "atom1_serNum": 878, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/42/OP2", "atom2_id": "///A/111/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 139, "atom1_serNum": 900, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/43/OP2", "atom2_id": "///A/111/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 140, "atom1_serNum": 931, "atom2_serNum": 2403, "donAcc_type": "acceptable", "distance": 2.645, "atom1_id": "///A/44/O2'", "atom2_id": "///A/110/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 141, "atom1_serNum": 935, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/44/O2", "atom2_id": "///A/110/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 142, "atom1_serNum": 938, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/44/O4", "atom2_id": "///A/111/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 143, "atom1_serNum": 938, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/44/O4", "atom2_id": "///A/111/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 144, "atom1_serNum": 943, "atom2_serNum": 2405, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/45/OP2", "atom2_id": "///A/110/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 145, "atom1_serNum": 1015, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/48/N7", "atom2_id": "///A/105/N3", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 146, "atom1_serNum": 1018, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/48/O6", "atom2_id": "///A/105/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 147, "atom1_serNum": 1041, "atom2_serNum": 2368, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/49/O4", "atom2_id": "///A/105/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 148, "atom1_serNum": 1046, "atom2_serNum": 2376, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/50/OP2", "atom2_id": "///A/106/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 149, "atom1_serNum": 1080, "atom2_serNum": 2373, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/51/N7", "atom2_id": "///A/106/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 150, "atom1_serNum": 1083, "atom2_serNum": 2373, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/51/O6", "atom2_id": "///A/106/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 151, "atom1_serNum": 1106, "atom2_serNum": 2377, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/52/O6", "atom2_id": "///A/106/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 152, "atom1_serNum": 1146, "atom2_serNum": 2387, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/54/N7", "atom2_id": "///A/108/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 153, "atom1_serNum": 1168, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/55/N7", "atom2_id": "///A/108/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 154, "atom1_serNum": 1168, "atom2_serNum": 2387, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/55/N7", "atom2_id": "///A/108/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 155, "atom1_serNum": 1171, "atom2_serNum": 2390, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/55/O6", "atom2_id": "///A/108/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 156, "atom1_serNum": 1192, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/2/N7", "atom2_id": "///B/110/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 157, "atom1_serNum": 1195, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/2/N6", "atom2_id": "///B/38/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1196, "atom2_serNum": 1967, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/2/N1", "atom2_id": "///B/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1208, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///B/3/O3'", "atom2_id": "///B/105/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 160, "atom1_serNum": 1210, "atom2_serNum": 1995, "donAcc_type": "acceptable", "distance": 3.439, "atom1_id": "///B/3/O2'", "atom2_id": "///B/40/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1214, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///B/3/N7", "atom2_id": "///B/110/N2", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 162, "atom1_serNum": 1217, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/3/O6", "atom2_id": "///B/37/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1217, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/3/O6", "atom2_id": "///B/110/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 164, "atom1_serNum": 1217, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/3/O6", "atom2_id": "///B/110/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 165, "atom1_serNum": 1218, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/3/N1", "atom2_id": "///B/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1220, "atom2_serNum": 1946, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///B/3/N2", "atom2_id": "///B/37/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1224, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/4/OP1", "atom2_id": "///B/105/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 168, "atom1_serNum": 1237, "atom2_serNum": 1927, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/4/O2", "atom2_id": "///B/36/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1238, "atom2_serNum": 1926, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/4/N3", "atom2_id": "///B/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1240, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///B/4/O4", "atom2_id": "///B/110/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 171, "atom1_serNum": 1240, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/4/O4", "atom2_id": "///B/110/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 172, "atom1_serNum": 1244, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.711, "atom1_id": "///B/5/OP1", "atom2_id": "///B/6/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1244, "atom2_serNum": 2004, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///B/5/OP1", "atom2_id": "///B/40/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1253, "atom2_serNum": 1271, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///B/5/O2'", "atom2_id": "///B/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1257, "atom2_serNum": 2051, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/5/N7", "atom2_id": "///B/42/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1260, "atom2_serNum": 1703, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///B/5/N6", "atom2_id": "///B/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1260, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/5/N6", "atom2_id": "///B/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 1261, "atom2_serNum": 1702, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/5/N1", "atom2_id": "///B/26/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1266, "atom2_serNum": 2489, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///B/6/OP1", "atom2_id": "///B/109/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 180, "atom1_serNum": 1267, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/6/OP2", "atom2_id": "///B/7/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1279, "atom2_serNum": 1725, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/6/O2", "atom2_id": "///B/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1280, "atom2_serNum": 1723, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/6/N3", "atom2_id": "///B/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1282, "atom2_serNum": 1722, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/6/N4", "atom2_id": "///B/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1299, "atom2_serNum": 1906, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///B/7/O2", "atom2_id": "///B/35/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 1300, "atom2_serNum": 1904, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/7/N3", "atom2_id": "///B/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1302, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/7/N4", "atom2_id": "///B/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1319, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///B/8/O2", "atom2_id": "///B/34/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1320, "atom2_serNum": 1881, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/8/N3", "atom2_id": "///B/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1322, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/8/N4", "atom2_id": "///B/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1335, "atom2_serNum": 1351, "donAcc_type": "acceptable", "distance": 2.988, "atom1_id": "///B/9/O2'", "atom2_id": "///B/10/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1339, "atom2_serNum": 1858, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/9/O2", "atom2_id": "///B/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1340, "atom2_serNum": 1857, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/9/N3", "atom2_id": "///B/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1342, "atom2_serNum": 2488, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/9/O4", "atom2_id": "///B/109/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 194, "atom1_serNum": 1359, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///B/10/O2", "atom2_id": "///B/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1360, "atom2_serNum": 1835, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/10/N3", "atom2_id": "///B/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1362, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/10/N4", "atom2_id": "///B/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1375, "atom2_serNum": 1388, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///B/11/O2'", "atom2_id": "///B/12/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1379, "atom2_serNum": 1792, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///B/11/O2", "atom2_id": "///B/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1380, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/11/N3", "atom2_id": "///B/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1380, "atom2_serNum": 1792, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/11/N3", "atom2_id": "///B/30/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1382, "atom2_serNum": 1789, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///B/11/N4", "atom2_id": "///B/30/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1395, "atom2_serNum": 1500, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///B/12/O2'", "atom2_id": "///B/17/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1395, "atom2_serNum": 1502, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///B/12/O2'", "atom2_id": "///B/17/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1402, "atom2_serNum": 2257, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///B/12/N6", "atom2_id": "///B/52/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1405, "atom2_serNum": 1518, "donAcc_type": "questionable", "distance": 3.066, "atom1_id": "///B/12/N3", "atom2_id": "///B/18/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1417, "atom2_serNum": 1482, "donAcc_type": "acceptable", "distance": 2.558, "atom1_id": "///B/13/O2'", "atom2_id": "///B/16/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1417, "atom2_serNum": 1486, "donAcc_type": "acceptable", "distance": 2.459, "atom1_id": "///B/13/O2'", "atom2_id": "///B/16/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1417, "atom2_serNum": 1498, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///B/13/O2'", "atom2_id": "///B/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1425, "atom2_serNum": 2257, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///B/13/N1", "atom2_id": "///B/52/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1427, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/13/N3", "atom2_id": "///B/52/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1431, "atom2_serNum": 1449, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/14/OP2", "atom2_id": "///B/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1447, "atom2_serNum": 2284, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/14/N1", "atom2_id": "///B/53/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1447, "atom2_serNum": 2285, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/14/N1", "atom2_id": "///B/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1449, "atom2_serNum": 2284, "donAcc_type": "standard", "distance": 2.381, "atom1_id": "///B/14/N2", "atom2_id": "///B/53/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1462, "atom2_serNum": 1480, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///B/15/O2'", "atom2_id": "///B/16/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1486, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///B/16/O2", "atom2_id": "///B/52/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1487, "atom2_serNum": 2265, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/16/N3", "atom2_id": "///B/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1489, "atom2_serNum": 2264, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///B/16/N4", "atom2_id": "///B/52/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1506, "atom2_serNum": 2244, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/17/O2", "atom2_id": "///B/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1507, "atom2_serNum": 2242, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/17/N3", "atom2_id": "///B/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1509, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/17/N4", "atom2_id": "///B/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 1522, "atom2_serNum": 1535, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///B/18/O2'", "atom2_id": "///B/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 1527, "atom2_serNum": 2220, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/18/N3", "atom2_id": "///B/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 1529, "atom2_serNum": 2219, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/18/O4", "atom2_id": "///B/50/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 1529, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/18/O4", "atom2_id": "///B/104/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 226, "atom1_serNum": 1549, "atom2_serNum": 2199, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/19/N6", "atom2_id": "///B/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 1550, "atom2_serNum": 2197, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///B/19/N1", "atom2_id": "///B/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 1568, "atom2_serNum": 2179, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///B/20/O2", "atom2_id": "///B/48/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 1569, "atom2_serNum": 2177, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/20/N3", "atom2_id": "///B/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 1571, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/20/N4", "atom2_id": "///B/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 1591, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/21/N6", "atom2_id": "///B/47/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 1592, "atom2_serNum": 2154, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/21/N1", "atom2_id": "///B/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 1610, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/22/N7", "atom2_id": "///B/111/N3", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 234, "atom1_serNum": 1613, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/22/O6", "atom2_id": "///B/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 1613, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/22/O6", "atom2_id": "///B/111/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 236, "atom1_serNum": 1614, "atom2_serNum": 2134, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/22/N1", "atom2_id": "///B/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 1616, "atom2_serNum": 2133, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/22/N2", "atom2_id": "///B/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 1633, "atom2_serNum": 2504, "donAcc_type": "standard", "distance": 2.406, "atom1_id": "///B/23/N7", "atom2_id": "///B/111/N6", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 239, "atom1_serNum": 1636, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/23/O6", "atom2_id": "///B/45/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 1636, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/23/O6", "atom2_id": "///B/111/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 241, "atom1_serNum": 1636, "atom2_serNum": 2504, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/23/O6", "atom2_id": "///B/111/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 242, "atom1_serNum": 1637, "atom2_serNum": 2114, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/23/N1", "atom2_id": "///B/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 1639, "atom2_serNum": 2113, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/23/N2", "atom2_id": "///B/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 1656, "atom2_serNum": 1812, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/24/O2", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 1657, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/24/N3", "atom2_id": "///B/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 1672, "atom2_serNum": 2044, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///B/25/O2'", "atom2_id": "///B/42/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 1672, "atom2_serNum": 2054, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///B/25/O2'", "atom2_id": "///B/42/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 1672, "atom2_serNum": 2062, "donAcc_type": "acceptable", "distance": 3.317, "atom1_id": "///B/25/O2'", "atom2_id": "///B/43/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 1676, "atom2_serNum": 1767, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///B/25/O2", "atom2_id": "///B/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 1677, "atom2_serNum": 1764, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/25/N3", "atom2_id": "///B/29/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 1692, "atom2_serNum": 1742, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///B/26/O2'", "atom2_id": "///B/28/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 1696, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 2.433, "atom1_id": "///B/26/N7", "atom2_id": "///B/101/N3", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 253, "atom1_serNum": 1699, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/26/O6", "atom2_id": "///B/101/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 254, "atom1_serNum": 1700, "atom2_serNum": 1752, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///B/26/N1", "atom2_id": "///B/29/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 1702, "atom2_serNum": 1753, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/26/N2", "atom2_id": "///B/29/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 1706, "atom2_serNum": 2446, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/27/OP1", "atom2_id": "///B/103/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 257, "atom1_serNum": 1706, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///B/27/OP1", "atom2_id": "///B/103/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 258, "atom1_serNum": 1722, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///B/27/O6", "atom2_id": "///B/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 1729, "atom2_serNum": 2430, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///B/28/OP1", "atom2_id": "///B/101/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 260, "atom1_serNum": 1760, "atom2_serNum": 1815, "donAcc_type": "acceptable", "distance": 3.750, "atom1_id": "///B/29/O2'", "atom2_id": "///B/31/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 1767, "atom2_serNum": 2077, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/29/N6", "atom2_id": "///B/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 1768, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/29/N1", "atom2_id": "///B/43/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 1782, "atom2_serNum": 1803, "donAcc_type": "acceptable", "distance": 3.565, "atom1_id": "///B/30/O2'", "atom2_id": "///B/31/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 1805, "atom2_serNum": 1818, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///B/31/O2'", "atom2_id": "///B/32/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 1805, "atom2_serNum": 2471, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///B/31/O2'", "atom2_id": "///B/107/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 266, "atom1_serNum": 1809, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///B/31/N7", "atom2_id": "///B/43/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 1812, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///B/31/N6", "atom2_id": "///B/43/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 1818, "atom2_serNum": 2471, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/32/OP1", "atom2_id": "///B/107/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 269, "atom1_serNum": 1818, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.379, "atom1_id": "///B/32/OP1", "atom2_id": "///B/107/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 270, "atom1_serNum": 1841, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///B/33/OP1", "atom2_id": "///B/107/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 271, "atom1_serNum": 1842, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/33/OP2", "atom2_id": "///B/107/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 272, "atom1_serNum": 1854, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///B/33/N7", "atom2_id": "///B/109/N6", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 273, "atom1_serNum": 1857, "atom2_serNum": 2488, "donAcc_type": "standard", "distance": 2.311, "atom1_id": "///B/33/O6", "atom2_id": "///B/109/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 274, "atom1_serNum": 1865, "atom2_serNum": 2495, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/34/OP2", "atom2_id": "///B/110/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 275, "atom1_serNum": 1877, "atom2_serNum": 2485, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/34/N7", "atom2_id": "///B/109/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 276, "atom1_serNum": 1880, "atom2_serNum": 2485, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/34/O6", "atom2_id": "///B/109/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 277, "atom1_serNum": 1888, "atom2_serNum": 2494, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/35/OP2", "atom2_id": "///B/110/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 278, "atom1_serNum": 1910, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/36/OP1", "atom2_id": "///B/102/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 279, "atom1_serNum": 1912, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///B/36/O5'", "atom2_id": "///B/102/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 280, "atom1_serNum": 1926, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/36/O6", "atom2_id": "///B/110/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 281, "atom1_serNum": 1934, "atom2_serNum": 2436, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/37/OP2", "atom2_id": "///B/102/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 282, "atom1_serNum": 1934, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/37/OP2", "atom2_id": "///B/102/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 283, "atom1_serNum": 1960, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///B/38/O3'", "atom2_id": "///B/106/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 284, "atom1_serNum": 1962, "atom2_serNum": 2466, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///B/38/O2'", "atom2_id": "///B/106/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 285, "atom1_serNum": 1966, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/38/O2", "atom2_id": "///B/106/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 286, "atom1_serNum": 1974, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/39/OP2", "atom2_id": "///B/106/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 287, "atom1_serNum": 1974, "atom2_serNum": 2468, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/39/OP2", "atom2_id": "///B/106/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 288, "atom1_serNum": 1975, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///B/39/O5'", "atom2_id": "///B/106/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 289, "atom1_serNum": 1995, "atom2_serNum": 2467, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///B/40/OP1", "atom2_id": "///B/106/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 290, "atom1_serNum": 2015, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/41/OP1", "atom2_id": "///B/105/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 291, "atom1_serNum": 2015, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 2.222, "atom1_id": "///B/41/OP1", "atom2_id": "///B/105/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 292, "atom1_serNum": 2016, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/41/OP2", "atom2_id": "///B/105/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 293, "atom1_serNum": 2028, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/41/O2", "atom2_id": "///B/103/N3", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 294, "atom1_serNum": 2035, "atom2_serNum": 2425, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///B/42/OP1", "atom2_id": "///A/113/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 295, "atom1_serNum": 2058, "atom2_serNum": 2425, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/43/OP2", "atom2_id": "///A/113/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 296, "atom1_serNum": 2089, "atom2_serNum": 2476, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///B/44/O2'", "atom2_id": "///B/107/N6", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 297, "atom1_serNum": 2093, "atom2_serNum": 2471, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/44/O2", "atom2_id": "///B/107/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 298, "atom1_serNum": 2101, "atom2_serNum": 2474, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///B/45/OP2", "atom2_id": "///B/107/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 299, "atom1_serNum": 2107, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/45/O3'", "atom2_id": "///A/111/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 300, "atom1_serNum": 2120, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/46/OP1", "atom2_id": "///A/111/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 301, "atom1_serNum": 2120, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///B/46/OP1", "atom2_id": "///A/111/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 302, "atom1_serNum": 2173, "atom2_serNum": 2450, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/48/N7", "atom2_id": "///B/104/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 303, "atom1_serNum": 2176, "atom2_serNum": 2450, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/48/O6", "atom2_id": "///B/104/N1", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 304, "atom1_serNum": 2199, "atom2_serNum": 2453, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/49/O4", "atom2_id": "///B/104/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 305, "atom1_serNum": 2238, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/51/N7", "atom2_id": "///B/108/N1", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 306, "atom1_serNum": 2241, "atom2_serNum": 2479, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/51/O6", "atom2_id": "///B/108/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 307, "atom1_serNum": 2261, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/52/N7", "atom2_id": "///B/108/N5", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 308, "atom1_serNum": 2264, "atom2_serNum": 2479, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/52/O6", "atom2_id": "///B/108/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 309, "atom1_serNum": 2264, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/52/O6", "atom2_id": "///B/108/N5", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 310, "atom1_serNum": 2340, "atom2_serNum": 2397, "donAcc_type": "questionable", "distance": 2.926, "atom1_id": "///A/101/N4", "atom2_id": "///A/109/N5", "atom_pair": "N:N", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9cfn", "num_naChains": 2, "naChains": "A=55,B=54", "num_atoms": 2503, "num_waters": 0, "num_metals": 26, "metals_desc": "Mg=2,Ir=24", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }