{ "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -81.045, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 59.504, "chi2": -76.307, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.817, "C1C1_dist": 10.542, "N1N9_dist": 8.859, "C6C8_dist": 9.871, "CNNC_torsion": -5.806, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.58],N2(amino)-N3[2.88]", "interBase_angle": 12.018, "planarity": 0.139, "simple_Shear": 0.647, "simple_Stretch": -0.119, "simple_Buckle": -5.051, "simple_Propeller": -10.905, "bp_simpleParams": [ 0.647, -0.119, -0.227, -5.051, -10.905, 4.114 ], "bp_params": [ 0.637, -0.166, -0.227, -5.815, -10.517, 4.126 ], "frame": { "rmsd": null, "origin": [ -12.308, -1.687, 47.702 ], "x_axis": [ 0.297, 0.941, 0.161 ], "y_axis": [ 0.886, -0.334, 0.321 ], "z_axis": [ 0.356, 0.047, -0.933 ], "quaternion": [ 0.086, 0.801, 0.571, 0.162 ] } }, { "index": 2, "nt1": "///B/3", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.626, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.106, "chi2": -111.061, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.543, "C1C1_dist": 10.665, "N1N9_dist": 8.942, "C6C8_dist": 9.888, "CNNC_torsion": -16.297, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.28],N1(imino)-O2(carbonyl)[3.19],N1(imino)-N3[3.13],N2(amino)-O2(carbonyl)[3.02]", "interBase_angle": 16.968, "planarity": 0.218, "simple_Shear": -1.213, "simple_Stretch": -0.071, "simple_Buckle": -2.496, "simple_Propeller": -16.784, "bp_simpleParams": [ -1.213, -0.071, 0.281, -2.496, -16.784, 1.244 ], "bp_params": [ -1.196, -0.211, 0.281, -0.519, -16.960, 1.258 ], "frame": { "rmsd": null, "origin": [ -10.278, -2.220, 45.060 ], "x_axis": [ 0.692, 0.661, 0.291 ], "y_axis": [ 0.590, -0.750, 0.299 ], "z_axis": [ 0.415, -0.035, -0.909 ], "quaternion": [ 0.091, 0.915, 0.342, 0.193 ] } }, { "index": 3, "nt1": "///B/4", "nt2": "///C/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.221, "conf1": "anti", "pucker1": "----", "lambda1": 54.266, "chi2": -114.962, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.053, "C1C1_dist": 10.642, "N1N9_dist": 8.986, "C6C8_dist": 10.067, "CNNC_torsion": -24.090, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.02],O4(carbonyl)-N6(amino)[3.56]", "interBase_angle": 23.740, "planarity": 0.315, "simple_Shear": -0.263, "simple_Stretch": 0.117, "simple_Buckle": -4.577, "simple_Propeller": -23.294, "bp_simpleParams": [ -0.263, 0.117, 0.592, -4.577, -23.294, 4.842 ], "bp_params": [ -0.266, 0.109, 0.592, -3.864, -23.423, 4.943 ], "frame": { "rmsd": null, "origin": [ -8.921, -1.632, 42.032 ], "x_axis": [ 0.891, 0.081, 0.447 ], "y_axis": [ 0.060, -0.996, 0.061 ], "z_axis": [ 0.451, -0.028, -0.892 ], "quaternion": [ 0.023, 0.972, 0.036, 0.231 ] } }, { "index": 4, "nt1": "///B/5", "nt2": "///C/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.533, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.302, "chi2": -130.147, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.329, "C1C1_dist": 10.785, "N1N9_dist": 8.950, "C6C8_dist": 9.822, "CNNC_torsion": -24.508, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 25.223, "planarity": 0.315, "simple_Shear": 0.074, "simple_Stretch": -0.103, "simple_Buckle": -10.637, "simple_Propeller": -22.870, "bp_simpleParams": [ 0.074, -0.103, 0.577, -10.637, -22.870, -4.364 ], "bp_params": [ 0.073, -0.104, 0.577, -10.846, -22.772, -4.433 ], "frame": { "rmsd": null, "origin": [ -7.739, -1.184, 38.884 ], "x_axis": [ 0.755, -0.606, 0.251 ], "y_axis": [ -0.569, -0.795, -0.210 ], "z_axis": [ 0.327, 0.016, -0.945 ], "quaternion": [ -0.060, 0.935, -0.314, 0.155 ] } }, { "index": 5, "nt1": "///B/6", "nt2": "///C/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.333, "conf1": "anti", "pucker1": "----", "lambda1": 52.709, "chi2": -111.639, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.213, "C1C1_dist": 10.217, "N1N9_dist": 8.611, "C6C8_dist": 9.686, "CNNC_torsion": -4.991, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.69],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 14.315, "planarity": 0.167, "simple_Shear": -0.705, "simple_Stretch": -0.163, "simple_Buckle": -14.299, "simple_Propeller": -0.675, "bp_simpleParams": [ -0.705, -0.163, 0.332, -14.299, -0.675, 5.474 ], "bp_params": [ -0.691, -0.216, 0.332, -14.207, -1.751, 5.433 ], "frame": { "rmsd": null, "origin": [ -6.072, -1.583, 35.829 ], "x_axis": [ 0.347, -0.931, -0.116 ], "y_axis": [ -0.896, -0.292, -0.336 ], "z_axis": [ 0.279, 0.220, -0.935 ], "quaternion": [ -0.173, 0.802, -0.569, 0.051 ] } }, { "index": 6, "nt1": "///B/7", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.350, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.865, "chi2": -107.850, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.910, "C1C1_dist": 10.575, "N1N9_dist": 8.903, "C6C8_dist": 9.925, "CNNC_torsion": -9.992, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.57],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 10.953, "planarity": 0.148, "simple_Shear": -0.374, "simple_Stretch": -0.073, "simple_Buckle": -7.148, "simple_Propeller": -8.298, "bp_simpleParams": [ -0.374, -0.073, 0.298, -7.148, -8.298, 4.060 ], "bp_params": [ -0.371, -0.089, 0.298, -6.806, -8.581, 4.065 ], "frame": { "rmsd": null, "origin": [ -4.671, -0.725, 33.155 ], "x_axis": [ -0.147, -0.955, -0.258 ], "y_axis": [ -0.950, 0.209, -0.233 ], "z_axis": [ 0.277, 0.211, -0.938 ], "quaternion": [ 0.177, -0.629, 0.757, -0.007 ] } }, { "index": 7, "nt1": "///B/8", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.075, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.940, "chi2": -104.222, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.503, "C1C1_dist": 10.381, "N1N9_dist": 8.721, "C6C8_dist": 9.749, "CNNC_torsion": -2.127, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.45],N3-N1(imino)[2.77],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 6.439, "planarity": 0.092, "simple_Shear": 0.534, "simple_Stretch": -0.241, "simple_Buckle": 6.291, "simple_Propeller": -1.374, "bp_simpleParams": [ 0.534, -0.241, 0.045, 6.291, -1.374, 4.844 ], "bp_params": [ 0.522, -0.266, 0.045, 6.218, -1.671, 4.837 ], "frame": { "rmsd": null, "origin": [ -3.372, -0.267, 30.484 ], "x_axis": [ -0.651, -0.698, -0.299 ], "y_axis": [ -0.710, 0.699, -0.086 ], "z_axis": [ 0.269, 0.156, -0.951 ], "quaternion": [ 0.156, -0.388, 0.908, 0.019 ] } }, { "index": 8, "nt1": "///B/9", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.485, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.150, "chi2": -126.623, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.622, "C1C1_dist": 10.499, "N1N9_dist": 8.782, "C6C8_dist": 9.768, "CNNC_torsion": -4.533, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.81]", "interBase_angle": 8.211, "planarity": 0.096, "simple_Shear": -0.256, "simple_Stretch": -0.165, "simple_Buckle": 6.916, "simple_Propeller": -4.426, "bp_simpleParams": [ -0.256, -0.165, 0.126, 6.916, -4.426, 1.520 ], "bp_params": [ -0.253, -0.171, 0.126, 7.014, -4.269, 1.518 ], "frame": { "rmsd": null, "origin": [ -2.476, 0.190, 27.338 ], "x_axis": [ -0.950, -0.144, -0.276 ], "y_axis": [ -0.186, 0.973, 0.133 ], "z_axis": [ 0.250, 0.178, -0.952 ], "quaternion": [ 0.133, -0.084, 0.984, 0.079 ] } }, { "index": 9, "nt1": "///B/10", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.960, "conf1": "anti", "pucker1": "----", "lambda1": 59.719, "chi2": -140.832, "conf2": "anti", "pucker2": "----", "lambda2": 57.279, "C1C1_dist": 10.450, "N1N9_dist": 8.909, "C6C8_dist": 10.055, "CNNC_torsion": -3.940, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.47],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[3.39]", "interBase_angle": 5.371, "planarity": 0.071, "simple_Shear": 0.371, "simple_Stretch": 0.073, "simple_Buckle": -0.169, "simple_Propeller": -5.368, "bp_simpleParams": [ 0.371, 0.073, -0.000, -0.169, -5.368, 10.030 ], "bp_params": [ 0.373, 0.061, -0.000, -0.339, -5.360, 10.041 ], "frame": { "rmsd": null, "origin": [ -2.578, -0.427, 23.394 ], "x_axis": [ -0.907, 0.394, -0.151 ], "y_axis": [ 0.344, 0.898, 0.273 ], "z_axis": [ 0.243, 0.196, -0.950 ], "quaternion": [ 0.102, 0.190, 0.969, 0.121 ] } }, { "index": 10, "nt1": "///B/11", "nt2": "///C/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.042, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.949, "chi2": -124.902, "conf2": "anti", "pucker2": "----", "lambda2": 57.644, "C1C1_dist": 10.496, "N1N9_dist": 8.838, "C6C8_dist": 9.881, "CNNC_torsion": -3.451, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.12]", "interBase_angle": 6.297, "planarity": 0.073, "simple_Shear": -0.271, "simple_Stretch": -0.056, "simple_Buckle": -5.587, "simple_Propeller": -2.906, "bp_simpleParams": [ -0.271, -0.056, 0.126, -5.587, -2.906, 3.675 ], "bp_params": [ -0.269, -0.065, 0.126, -5.494, -3.079, 3.673 ], "frame": { "rmsd": null, "origin": [ -1.627, -1.506, 19.650 ], "x_axis": [ -0.662, 0.749, -0.029 ], "y_axis": [ 0.697, 0.629, 0.344 ], "z_axis": [ 0.276, 0.208, -0.938 ], "quaternion": [ 0.085, 0.402, 0.898, 0.154 ] } }, { "index": 11, "nt1": "///B/12", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.614, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.809, "chi2": -111.973, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.538, "C1C1_dist": 10.477, "N1N9_dist": 8.793, "C6C8_dist": 9.817, "CNNC_torsion": -6.356, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 6.955, "planarity": 0.089, "simple_Shear": 0.142, "simple_Stretch": -0.135, "simple_Buckle": -1.176, "simple_Propeller": -6.855, "bp_simpleParams": [ 0.142, -0.135, 0.024, -1.176, -6.855, 3.019 ], "bp_params": [ 0.141, -0.136, 0.024, -1.241, -6.843, 3.024 ], "frame": { "rmsd": null, "origin": [ -1.346, -1.554, 16.361 ], "x_axis": [ -0.239, 0.941, 0.238 ], "y_axis": [ 0.950, 0.177, 0.256 ], "z_axis": [ 0.199, 0.287, -0.937 ], "quaternion": [ -0.013, 0.617, 0.767, 0.177 ] } }, { "index": 12, "nt1": "///B/13", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.646, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.002, "chi2": -152.961, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.460, "C1C1_dist": 10.461, "N1N9_dist": 8.878, "C6C8_dist": 10.014, "CNNC_torsion": -25.138, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.68],N1-N3(imino)[3.02]", "interBase_angle": 25.202, "planarity": 0.317, "simple_Shear": -0.085, "simple_Stretch": 0.109, "simple_Buckle": 11.859, "simple_Propeller": -22.237, "bp_simpleParams": [ -0.085, 0.109, 0.861, 11.859, -22.237, 7.343 ], "bp_params": [ -0.086, 0.108, 0.861, 12.071, -22.123, 7.442 ], "frame": { "rmsd": null, "origin": [ 0.768, -1.162, 13.706 ], "x_axis": [ 0.417, 0.816, 0.400 ], "y_axis": [ 0.845, -0.510, 0.161 ], "z_axis": [ 0.336, 0.271, -0.902 ], "quaternion": [ -0.033, 0.841, 0.494, 0.219 ] } }, { "index": 13, "nt1": "///B/14", "nt2": "///C/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.378, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.622, "chi2": -91.651, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.948, "C1C1_dist": 10.524, "N1N9_dist": 8.883, "C6C8_dist": 9.949, "CNNC_torsion": -23.408, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.09],O4(carbonyl)-N6(amino)[3.59]", "interBase_angle": 23.508, "planarity": 0.326, "simple_Shear": 0.839, "simple_Stretch": 0.034, "simple_Buckle": 5.838, "simple_Propeller": -22.772, "bp_simpleParams": [ 0.839, 0.034, 0.485, 5.838, -22.772, 4.704 ], "bp_params": [ 0.839, -0.030, 0.485, 4.021, -23.162, 4.799 ], "frame": { "rmsd": null, "origin": [ 1.359, -0.654, 10.089 ], "x_axis": [ 0.872, 0.370, 0.320 ], "y_axis": [ 0.431, -0.891, -0.142 ], "z_axis": [ 0.232, 0.262, -0.937 ], "quaternion": [ -0.105, 0.962, 0.208, 0.143 ] } }, { "index": 14, "nt1": "///B/15", "nt2": "///C/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.201, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.054, "chi2": -100.048, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.336, "C1C1_dist": 10.248, "N1N9_dist": 8.649, "C6C8_dist": 9.791, "CNNC_torsion": -30.501, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[3.51]", "interBase_angle": 31.003, "planarity": 0.405, "simple_Shear": -0.331, "simple_Stretch": -0.145, "simple_Buckle": -6.294, "simple_Propeller": -30.358, "bp_simpleParams": [ -0.331, -0.145, 0.733, -6.294, -30.358, 7.292 ], "bp_params": [ -0.326, -0.155, 0.733, -5.166, -30.570, 7.552 ], "frame": { "rmsd": null, "origin": [ 1.823, -2.310, 5.942 ], "x_axis": [ 0.908, -0.333, -0.256 ], "y_axis": [ -0.382, -0.907, -0.177 ], "z_axis": [ -0.173, 0.259, -0.950 ], "quaternion": [ -0.112, 0.970, -0.184, -0.110 ] } }, { "index": 15, "nt1": "///B/16", "nt2": "///C/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.135, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.925, "chi2": -114.013, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.331, "C1C1_dist": 10.859, "N1N9_dist": 9.046, "C6C8_dist": 9.976, "CNNC_torsion": -33.629, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.15],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.38]", "interBase_angle": 35.307, "planarity": 0.454, "simple_Shear": 0.462, "simple_Stretch": -0.045, "simple_Buckle": -2.996, "simple_Propeller": -35.180, "bp_simpleParams": [ 0.462, -0.045, 0.502, -2.996, -35.180, 0.060 ], "bp_params": [ 0.459, -0.067, 0.502, -4.567, -35.010, 0.063 ], "frame": { "rmsd": null, "origin": [ 1.023, -1.472, 2.989 ], "x_axis": [ 0.489, -0.786, -0.378 ], "y_axis": [ -0.838, -0.543, 0.044 ], "z_axis": [ -0.240, 0.295, -0.925 ], "quaternion": [ -0.073, 0.860, -0.472, -0.180 ] } }, { "index": 16, "nt1": "///B/17", "nt2": "///C/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.838, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.417, "chi2": -111.350, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.229, "C1C1_dist": 10.673, "N1N9_dist": 8.933, "C6C8_dist": 9.887, "CNNC_torsion": -0.669, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.92]", "interBase_angle": 5.061, "planarity": 0.080, "simple_Shear": -0.093, "simple_Stretch": -0.071, "simple_Buckle": 3.631, "simple_Propeller": 3.527, "bp_simpleParams": [ -0.093, -0.071, 0.344, 3.631, 3.527, -0.049 ], "bp_params": [ -0.092, -0.071, 0.344, 3.615, 3.542, -0.049 ], "frame": { "rmsd": null, "origin": [ -0.410, -1.232, -0.251 ], "x_axis": [ -0.160, -0.912, -0.377 ], "y_axis": [ -0.973, 0.081, 0.218 ], "z_axis": [ -0.169, 0.402, -0.900 ], "quaternion": [ 0.071, -0.644, 0.732, 0.212 ] } }, { "index": 17, "nt1": "///B/18", "nt2": "///C/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.991, "conf1": "anti", "pucker1": "----", "lambda1": 56.435, "chi2": -139.318, "conf2": "anti", "pucker2": "----", "lambda2": 59.966, "C1C1_dist": 10.425, "N1N9_dist": 8.869, "C6C8_dist": 9.995, "CNNC_torsion": -1.570, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[3.42]", "interBase_angle": 15.839, "planarity": 0.200, "simple_Shear": -0.231, "simple_Stretch": 0.150, "simple_Buckle": 15.143, "simple_Propeller": -4.644, "bp_simpleParams": [ -0.231, 0.150, -0.158, 15.143, -4.644, 8.027 ], "bp_params": [ -0.235, 0.142, -0.158, 15.287, -4.145, 7.961 ], "frame": { "rmsd": null, "origin": [ -0.425, -1.030, -3.654 ], "x_axis": [ -0.563, -0.797, -0.217 ], "y_axis": [ -0.807, 0.474, 0.353 ], "z_axis": [ -0.179, 0.374, -0.910 ], "quaternion": [ 0.011, -0.467, 0.858, 0.212 ] } }, { "index": 18, "nt1": "///B/19", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.040, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.129, "chi2": -117.496, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.607, "C1C1_dist": 10.439, "N1N9_dist": 8.937, "C6C8_dist": 10.121, "CNNC_torsion": -5.252, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.49],N3-N1(imino)[3.06],N4(amino)-O6(carbonyl)[3.54]", "interBase_angle": 8.912, "planarity": 0.107, "simple_Shear": 0.506, "simple_Stretch": 0.162, "simple_Buckle": 3.608, "simple_Propeller": -8.149, "bp_simpleParams": [ 0.506, 0.162, -0.084, 3.608, -8.149, 11.958 ], "bp_params": [ 0.513, 0.139, -0.084, 3.242, -8.301, 11.985 ], "frame": { "rmsd": null, "origin": [ -0.154, -0.813, -7.576 ], "x_axis": [ -0.881, -0.471, 0.046 ], "y_axis": [ -0.406, 0.801, 0.440 ], "z_axis": [ -0.244, 0.369, -0.897 ], "quaternion": [ -0.077, -0.232, 0.946, 0.214 ] } }, { "index": 19, "nt1": "///B/20", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.341, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.543, "chi2": -134.338, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.017, "C1C1_dist": 10.383, "N1N9_dist": 8.788, "C6C8_dist": 9.895, "CNNC_torsion": -4.025, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.24],N1-N3(imino)[2.85]", "interBase_angle": 6.704, "planarity": 0.078, "simple_Shear": 0.151, "simple_Stretch": -0.031, "simple_Buckle": 6.533, "simple_Propeller": -1.503, "bp_simpleParams": [ 0.151, -0.031, 0.225, 6.533, -1.503, 6.628 ], "bp_params": [ 0.150, -0.034, 0.225, 6.502, -1.632, 6.618 ], "frame": { "rmsd": null, "origin": [ -0.692, -0.532, -10.803 ], "x_axis": [ -0.877, -0.182, 0.445 ], "y_axis": [ -0.026, 0.942, 0.334 ], "z_axis": [ -0.480, 0.281, -0.831 ], "quaternion": [ -0.242, -0.054, 0.955, 0.161 ] } }, { "index": 20, "nt1": "///B/21", "nt2": "///C/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.296, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.656, "chi2": -127.905, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.761, "C1C1_dist": 10.740, "N1N9_dist": 8.982, "C6C8_dist": 9.960, "CNNC_torsion": -23.856, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.33]", "interBase_angle": 27.012, "planarity": 0.358, "simple_Shear": 0.038, "simple_Stretch": 0.007, "simple_Buckle": 4.410, "simple_Propeller": -26.650, "bp_simpleParams": [ 0.038, 0.007, 0.284, 4.410, -26.650, 0.982 ], "bp_params": [ 0.038, 0.007, 0.284, 4.474, -26.639, 1.008 ], "frame": { "rmsd": null, "origin": [ -1.229, -0.184, -14.434 ], "x_axis": [ -0.810, 0.464, 0.359 ], "y_axis": [ 0.511, 0.859, 0.043 ], "z_axis": [ -0.288, 0.218, -0.932 ], "quaternion": [ -0.170, 0.257, 0.949, 0.069 ] } }, { "index": 21, "nt1": "///B/22", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.314, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.237, "chi2": -130.492, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.356, "C1C1_dist": 10.540, "N1N9_dist": 8.845, "C6C8_dist": 9.874, "CNNC_torsion": -20.140, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.24]", "interBase_angle": 18.578, "planarity": 0.250, "simple_Shear": -0.291, "simple_Stretch": -0.080, "simple_Buckle": -5.372, "simple_Propeller": -17.784, "bp_simpleParams": [ -0.291, -0.080, 0.560, -5.372, -17.784, 2.602 ], "bp_params": [ -0.288, -0.089, 0.560, -4.786, -17.951, 2.632 ], "frame": { "rmsd": null, "origin": [ -2.783, 0.228, -17.568 ], "x_axis": [ -0.361, 0.887, 0.288 ], "y_axis": [ 0.909, 0.404, -0.104 ], "z_axis": [ -0.208, 0.224, -0.952 ], "quaternion": [ -0.151, 0.545, 0.824, 0.037 ] } }, { "index": 22, "nt1": "///B/23", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.468, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.180, "chi2": -124.574, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.172, "C1C1_dist": 10.284, "N1N9_dist": 8.645, "C6C8_dist": 9.731, "CNNC_torsion": -16.089, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.69],O4(carbonyl)-N6(amino)[3.15]", "interBase_angle": 13.431, "planarity": 0.198, "simple_Shear": -0.160, "simple_Stretch": -0.222, "simple_Buckle": -2.344, "simple_Propeller": -13.225, "bp_simpleParams": [ -0.160, -0.222, 0.528, -2.344, -13.225, 5.312 ], "bp_params": [ -0.155, -0.225, 0.528, -2.066, -13.271, 5.347 ], "frame": { "rmsd": null, "origin": [ -4.194, 0.622, -20.716 ], "x_axis": [ 0.165, 0.986, 0.013 ], "y_axis": [ 0.972, -0.160, -0.172 ], "z_axis": [ -0.167, 0.041, -0.985 ], "quaternion": [ -0.070, 0.760, 0.644, -0.051 ] } }, { "index": 23, "nt1": "///B/24", "nt2": "///C/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.498, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.380, "chi2": -123.260, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.477, "C1C1_dist": 10.439, "N1N9_dist": 8.706, "C6C8_dist": 9.687, "CNNC_torsion": -9.991, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.71],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 10.078, "planarity": 0.138, "simple_Shear": 0.132, "simple_Stretch": -0.268, "simple_Buckle": 0.981, "simple_Propeller": -10.031, "bp_simpleParams": [ 0.132, -0.268, 0.190, 0.981, -10.031, 1.079 ], "bp_params": [ 0.130, -0.269, 0.190, 0.894, -10.039, 1.083 ], "frame": { "rmsd": null, "origin": [ -5.605, 0.752, -23.722 ], "x_axis": [ 0.682, 0.698, -0.220 ], "y_axis": [ 0.689, -0.713, -0.126 ], "z_axis": [ -0.245, -0.065, -0.967 ], "quaternion": [ -0.017, 0.917, 0.378, -0.127 ] } }, { "index": 24, "nt1": "///B/25", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.891, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.367, "chi2": -125.997, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.447, "C1C1_dist": 10.553, "N1N9_dist": 8.878, "C6C8_dist": 9.905, "CNNC_torsion": -4.840, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.18],N1-N3(imino)[2.91]", "interBase_angle": 10.849, "planarity": 0.162, "simple_Shear": 0.083, "simple_Stretch": -0.008, "simple_Buckle": -10.176, "simple_Propeller": -3.763, "bp_simpleParams": [ 0.083, -0.008, 0.143, -10.176, -3.763, 3.323 ], "bp_params": [ 0.083, -0.009, 0.143, -10.233, -3.605, 3.311 ], "frame": { "rmsd": null, "origin": [ -6.764, 1.194, -27.078 ], "x_axis": [ 0.941, 0.088, -0.327 ], "y_axis": [ 0.113, -0.992, 0.060 ], "z_axis": [ -0.319, -0.094, -0.943 ], "quaternion": [ 0.039, 0.984, 0.051, -0.164 ] } }, { "index": 25, "nt1": "///B/26", "nt2": "///C/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.451, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.498, "chi2": -126.533, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.509, "C1C1_dist": 10.626, "N1N9_dist": 8.834, "C6C8_dist": 9.718, "CNNC_torsion": 2.253, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.65],N1(imino)-N3[2.71],N2(amino)-O2(carbonyl)[2.65]", "interBase_angle": 11.108, "planarity": 0.129, "simple_Shear": 0.374, "simple_Stretch": -0.263, "simple_Buckle": 9.957, "simple_Propeller": 4.925, "bp_simpleParams": [ 0.374, -0.263, 0.113, 9.957, 4.925, -1.911 ], "bp_params": [ 0.362, -0.279, 0.113, 10.166, 4.477, -1.904 ], "frame": { "rmsd": null, "origin": [ -7.739, 1.585, -29.846 ], "x_axis": [ 0.845, -0.444, -0.299 ], "y_axis": [ -0.385, -0.892, 0.235 ], "z_axis": [ -0.372, -0.083, -0.925 ], "quaternion": [ 0.083, 0.957, -0.217, -0.175 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGTTTCCACTTATTCATCATTTTAG", "strand2": "CCAAAGGTGAATAAGTAGTAAAATC", "bp_type": "|||||||||||||||||||||||||", "helix_form": "BBB.BBB..B.B.B....BBBBBB", "helical_rise": 3.210, "helical_rise_std": 0.886, "helical_radius": 10.212, "helical_radius_std": 3.762, "helical_axis": [ 0.034, 0.198, -0.980 ], "point1": [ -5.646, -8.394, 46.931 ], "point2": [ -3.028, 6.884, -28.487 ], "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.637, -0.166, -0.227, -5.815, -10.517, 4.126 ], "step_params": [ 0.020, 1.015, 3.218, -5.687, -1.864, 29.056 ], "heli_params": [ 2.366, -1.207, 3.089, -3.666, 11.186, 29.653 ], "bp2_params": [ -1.196, -0.211, 0.281, -0.519, -16.960, 1.258 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 39.094, "simple_hRise": 3.135, "simple_hTwist": 39.532 }, { "index": 2, "nt1": "///B/3", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.196, -0.211, 0.281, -0.519, -16.960, 1.258 ], "step_params": [ 0.189, -0.671, 3.297, -0.472, 2.223, 36.789 ], "heli_params": [ -1.364, -0.363, 3.249, 3.518, 0.747, 36.857 ], "bp2_params": [ -0.266, 0.109, 0.592, -3.864, -23.423, 4.943 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.297, "simple_Twist": 31.643, "simple_hRise": 3.240, "simple_hTwist": 31.722 }, { "index": 3, "nt1": "///B/4", "nt2": "///C/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.266, 0.109, 0.592, -3.864, -23.423, 4.943 ], "step_params": [ -0.265, -0.411, 3.357, 0.198, -8.098, 41.940 ], "heli_params": [ 0.280, 0.385, 3.374, -11.189, -0.274, 42.681 ], "bp2_params": [ 0.073, -0.104, 0.577, -10.846, -22.772, -4.433 ], "groove_widths": [ 8.657, null, 17.988, null ], "simple_Rise": 3.357, "simple_Twist": 39.753, "simple_hRise": 3.372, "simple_hTwist": 40.537 }, { "index": 4, "nt1": "///B/5", "nt2": "///C/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.073, -0.104, 0.577, -10.846, -22.772, -4.433 ], "step_params": [ 1.030, -0.072, 3.348, 4.789, -11.086, 35.575 ], "heli_params": [ 1.411, -0.944, 3.329, -17.532, -7.575, 37.506 ], "bp2_params": [ -0.691, -0.216, 0.332, -14.207, -1.751, 5.433 ], "groove_widths": [ 9.216, 9.194, 20.554, 20.547 ], "simple_Rise": 3.348, "simple_Twist": 40.303, "simple_hRise": 3.349, "simple_hTwist": 42.001 }, { "index": 5, "nt1": "///B/6", "nt2": "///C/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.691, -0.216, 0.332, -14.207, -1.751, 5.433 ], "step_params": [ -0.174, -0.591, 3.077, -0.205, 0.535, 29.801 ], "heli_params": [ -1.253, 0.297, 3.068, 1.040, 0.399, 29.807 ], "bp2_params": [ -0.371, -0.089, 0.298, -6.806, -8.581, 4.065 ], "groove_widths": [ 11.425, 11.405, 19.025, 18.967 ], "simple_Rise": 3.077, "simple_Twist": 27.785, "simple_hRise": 3.067, "simple_hTwist": 27.791 }, { "index": 6, "nt1": "///B/7", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.089, 0.298, -6.806, -8.581, 4.065 ], "step_params": [ -0.168, -0.486, 2.961, 0.974, 3.114, 32.772 ], "heli_params": [ -1.334, 0.445, 2.897, 5.501, -1.721, 32.930 ], "bp2_params": [ 0.522, -0.266, 0.045, 6.218, -1.671, 4.837 ], "groove_widths": [ 13.128, 13.008, 19.941, 19.906 ], "simple_Rise": 2.961, "simple_Twist": 28.054, "simple_hRise": 2.883, "simple_hTwist": 28.239 }, { "index": 7, "nt1": "///B/8", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.522, -0.266, 0.045, 6.218, -1.671, 4.837 ], "step_params": [ 0.010, -0.103, 3.302, -1.618, 0.391, 36.759 ], "heli_params": [ -0.216, -0.237, 3.297, 0.620, 2.564, 36.795 ], "bp2_params": [ -0.253, -0.171, 0.126, 7.014, -4.269, 1.518 ], "groove_widths": [ 12.451, 12.212, 19.825, 19.825 ], "simple_Rise": 3.302, "simple_Twist": 41.024, "simple_hRise": 3.298, "simple_hTwist": 41.057 }, { "index": 8, "nt1": "///B/9", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.253, -0.171, 0.126, 7.014, -4.269, 1.518 ], "step_params": [ 0.904, -1.448, 3.610, -1.003, 0.460, 32.139 ], "heli_params": [ -2.704, -1.828, 3.560, 0.831, 1.811, 32.158 ], "bp2_params": [ 0.373, 0.061, -0.000, -0.339, -5.360, 10.041 ], "groove_widths": [ 11.698, 11.447, 23.097, 23.086 ], "simple_Rise": 3.610, "simple_Twist": 28.661, "simple_hRise": 3.553, "simple_hTwist": 28.682 }, { "index": 9, "nt1": "///B/10", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.373, 0.061, -0.000, -0.339, -5.360, 10.041 ], "step_params": [ -1.040, -1.516, 3.565, -1.740, -1.195, 25.911 ], "heli_params": [ -3.005, 1.781, 3.691, -2.660, 3.872, 25.995 ], "bp2_params": [ -0.269, -0.065, 0.126, -5.494, -3.079, 3.673 ], "groove_widths": [ 11.995, 11.807, 22.674, 22.613 ], "simple_Rise": 3.565, "simple_Twist": 29.466, "simple_hRise": 3.676, "simple_hTwist": 29.539 }, { "index": 10, "nt1": "///B/11", "nt2": "///C/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.269, -0.065, 0.126, -5.494, -3.079, 3.673 ], "step_params": [ -0.543, -0.850, 3.143, 1.827, 6.083, 30.468 ], "heli_params": [ -2.669, 1.338, 2.887, 11.420, -3.429, 31.108 ], "bp2_params": [ 0.141, -0.136, 0.024, -1.241, -6.843, 3.024 ], "groove_widths": [ 13.025, 12.951, 20.564, 20.140 ], "simple_Rise": 3.143, "simple_Twist": 28.291, "simple_hRise": 2.862, "simple_hTwist": 28.981 }, { "index": 11, "nt1": "///B/12", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.141, -0.136, 0.024, -1.241, -6.843, 3.024 ], "step_params": [ -0.254, 1.359, 3.124, -8.101, 0.522, 40.276 ], "heli_params": [ 1.883, -0.489, 3.132, 0.749, 11.623, 41.053 ], "bp2_params": [ -0.086, 0.108, 0.861, 12.071, -22.123, 7.442 ], "groove_widths": [ 11.991, 11.977, 16.527, 16.469 ], "simple_Rise": 3.124, "simple_Twist": 41.953, "simple_hRise": 3.134, "simple_hTwist": 42.697 }, { "index": 12, "nt1": "///B/13", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, 0.108, 0.861, 12.071, -22.123, 7.442 ], "step_params": [ -0.692, 0.040, 3.634, 3.643, -5.114, 37.174 ], "heli_params": [ 0.792, 1.591, 3.517, -7.952, -5.666, 37.682 ], "bp2_params": [ 0.839, -0.030, 0.485, 4.021, -23.162, 4.799 ], "groove_widths": [ 8.028, 7.758, 17.279, 16.962 ], "simple_Rise": 3.634, "simple_Twist": 31.907, "simple_hRise": 3.487, "simple_hTwist": 32.503 }, { "index": 13, "nt1": "///B/14", "nt2": "///C/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.839, -0.030, 0.485, 4.021, -23.162, 4.799 ], "step_params": [ 0.276, 2.708, 3.570, 0.306, -23.371, 49.093 ], "heli_params": [ 4.317, -0.286, 2.167, -26.467, -0.347, 54.060 ], "bp2_params": [ -0.326, -0.155, 0.733, -5.166, -30.570, 7.552 ], "groove_widths": [ 5.536, 4.963, 15.952, 14.957 ], "simple_Rise": 3.570, "simple_Twist": 54.900, "simple_hRise": 2.344, "simple_hTwist": 59.310 }, { "index": 14, "nt1": "///B/15", "nt2": "///C/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.326, -0.155, 0.733, -5.166, -30.570, 7.552 ], "step_params": [ -0.090, 0.123, 3.169, -0.765, -4.573, 36.370 ], "heli_params": [ 0.801, 0.041, 3.132, -7.290, 1.219, 36.654 ], "bp2_params": [ 0.459, -0.067, 0.502, -4.567, -35.010, 0.063 ], "groove_widths": [ 7.883, 7.558, 17.038, 15.894 ], "simple_Rise": 3.169, "simple_Twist": 32.091, "simple_hRise": 3.123, "simple_hTwist": 32.416 }, { "index": 15, "nt1": "///B/16", "nt2": "///C/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.459, -0.067, 0.502, -4.567, -35.010, 0.063 ], "step_params": [ 0.779, 0.921, 3.340, 5.232, -5.338, 38.336 ], "heli_params": [ 2.035, -0.523, 3.262, -8.036, -7.875, 39.031 ], "bp2_params": [ -0.092, -0.071, 0.344, 3.615, 3.542, -0.049 ], "groove_widths": [ 11.111, 11.089, 19.488, 19.051 ], "simple_Rise": 3.340, "simple_Twist": 41.473, "simple_hRise": 3.272, "simple_hTwist": 42.112 }, { "index": 16, "nt1": "///B/17", "nt2": "///C/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.071, 0.344, 3.615, 3.542, -0.049 ], "step_params": [ 0.865, -0.937, 3.161, 0.106, 1.792, 25.849 ], "heli_params": [ -2.564, -1.900, 3.094, 4.000, -0.236, 25.910 ], "bp2_params": [ -0.235, 0.142, -0.158, 15.287, -4.145, 7.961 ], "groove_widths": [ 12.982, 12.941, 23.658, 23.590 ], "simple_Rise": 3.161, "simple_Twist": 26.997, "simple_hRise": 3.097, "simple_hTwist": 27.056 }, { "index": 17, "nt1": "///B/18", "nt2": "///C/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, 0.142, -0.158, 15.287, -4.145, 7.961 ], "step_params": [ 0.024, -1.664, 3.569, -2.490, 2.909, 30.352 ], "heli_params": [ -3.769, -0.572, 3.386, 5.528, 4.731, 30.587 ], "bp2_params": [ 0.513, 0.139, -0.084, 3.242, -8.301, 11.985 ], "groove_widths": [ 14.114, 13.968, 24.436, 24.320 ], "simple_Rise": 3.569, "simple_Twist": 26.034, "simple_hRise": 3.350, "simple_hTwist": 26.309 }, { "index": 18, "nt1": "///B/19", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.513, 0.139, -0.084, 3.242, -8.301, 11.985 ], "step_params": [ -0.424, -0.995, 3.100, 0.013, 14.975, 24.405 ], "heli_params": [ -4.969, 0.861, 2.142, 31.873, -0.027, 28.573 ], "bp2_params": [ 0.150, -0.034, 0.225, 6.502, -1.632, 6.618 ], "groove_widths": [ 12.975, 12.800, 22.298, 22.296 ], "simple_Rise": 3.100, "simple_Twist": 26.365, "simple_hRise": 2.225, "simple_hTwist": 30.255 }, { "index": 19, "nt1": "///B/20", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.034, 0.225, 6.502, -1.632, 6.618 ], "step_params": [ -1.032, -0.399, 3.517, 1.764, -12.863, 36.061 ], "heli_params": [ 1.157, 1.816, 3.406, -19.998, -2.742, 38.253 ], "bp2_params": [ 0.038, 0.007, 0.284, 4.474, -26.639, 1.008 ], "groove_widths": [ 10.373, 10.292, 20.405, 20.403 ], "simple_Rise": 3.517, "simple_Twist": 37.036, "simple_hRise": 3.414, "simple_hTwist": 39.170 }, { "index": 20, "nt1": "///B/21", "nt2": "///C/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, 0.007, 0.284, 4.474, -26.639, 1.008 ], "step_params": [ 0.219, -0.758, 3.432, -3.675, -2.949, 36.096 ], "heli_params": [ -0.781, -0.891, 3.443, -4.734, 5.900, 36.392 ], "bp2_params": [ -0.288, -0.089, 0.560, -4.786, -17.951, 2.632 ], "groove_widths": [ 9.103, 9.092, 20.075, 20.048 ], "simple_Rise": 3.432, "simple_Twist": 37.396, "simple_hRise": 3.444, "simple_hTwist": 37.681 }, { "index": 21, "nt1": "///B/22", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.288, -0.089, 0.560, -4.786, -17.951, 2.632 ], "step_params": [ 0.047, -0.787, 3.382, -1.263, -10.889, 33.316 ], "heli_params": [ 0.451, -0.281, 3.458, -18.384, 2.133, 35.025 ], "bp2_params": [ -0.155, -0.225, 0.528, -2.066, -13.271, 5.347 ], "groove_widths": [ 9.092, 9.089, 17.785, 17.782 ], "simple_Rise": 3.382, "simple_Twist": 32.796, "simple_hRise": 3.457, "simple_hTwist": 34.532 }, { "index": 22, "nt1": "///B/23", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.225, 0.528, -2.066, -13.271, 5.347 ], "step_params": [ -0.199, -0.752, 3.230, 1.259, -7.507, 36.351 ], "heli_params": [ -0.168, 0.482, 3.307, -11.874, -1.991, 37.113 ], "bp2_params": [ 0.130, -0.269, 0.190, 0.894, -10.039, 1.083 ], "groove_widths": [ 9.112, null, 20.015, null ], "simple_Rise": 3.230, "simple_Twist": 34.835, "simple_hRise": 3.307, "simple_hTwist": 35.632 }, { "index": 23, "nt1": "///B/24", "nt2": "///C/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.269, 0.190, 0.894, -10.039, 1.083 ], "step_params": [ 0.156, -0.725, 3.500, 0.389, -4.758, 38.963 ], "heli_params": [ -0.464, -0.182, 3.562, -7.101, -0.581, 39.243 ], "bp2_params": [ 0.083, -0.009, 0.143, -10.233, -3.605, 3.311 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.500, "simple_Twist": 38.970, "simple_hRise": 3.562, "simple_hTwist": 39.250 }, { "index": 24, "nt1": "///B/25", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.083, -0.009, 0.143, -10.233, -3.605, 3.311 ], "step_params": [ -0.075, -0.647, 2.888, -0.006, -3.236, 31.222 ], "heli_params": [ -0.653, 0.137, 2.939, -5.992, 0.011, 31.386 ], "bp2_params": [ 0.362, -0.279, 0.113, 10.166, 4.477, -1.904 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.888, "simple_Twist": 29.872, "simple_hRise": 2.941, "simple_hTwist": 30.043 }, { "index": 25, "nt1": "///B/26", "nt2": "///C/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGTTTCCACTTATTCATCATTTTAG", "strand2": "CCAAAGGTGAATAAGTAGTAAAATC", "bp_type": "|||||||||||||||||||||||||", "helix_form": "BBB.BBB..B.B.B....BBBBBB", "helical_rise": 3.210, "helical_rise_std": 0.886, "helical_radius": 10.212, "helical_radius_std": 3.762, "helical_axis": [ 0.034, 0.198, -0.980 ], "point1": [ -5.646, -8.394, 46.931 ], "point2": [ -3.028, 6.884, -28.487 ], "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.637, -0.166, -0.227, -5.815, -10.517, 4.126 ], "step_params": [ 0.020, 1.015, 3.218, -5.687, -1.864, 29.056 ], "heli_params": [ 2.366, -1.207, 3.089, -3.666, 11.186, 29.653 ], "bp2_params": [ -1.196, -0.211, 0.281, -0.519, -16.960, 1.258 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 39.094, "simple_hRise": 3.135, "simple_hTwist": 39.532 }, { "index": 2, "nt1": "///B/3", "nt2": "///C/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.196, -0.211, 0.281, -0.519, -16.960, 1.258 ], "step_params": [ 0.189, -0.671, 3.297, -0.472, 2.223, 36.789 ], "heli_params": [ -1.364, -0.363, 3.249, 3.518, 0.747, 36.857 ], "bp2_params": [ -0.266, 0.109, 0.592, -3.864, -23.423, 4.943 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.297, "simple_Twist": 31.643, "simple_hRise": 3.240, "simple_hTwist": 31.722 }, { "index": 3, "nt1": "///B/4", "nt2": "///C/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.266, 0.109, 0.592, -3.864, -23.423, 4.943 ], "step_params": [ -0.265, -0.411, 3.357, 0.198, -8.098, 41.940 ], "heli_params": [ 0.280, 0.385, 3.374, -11.189, -0.274, 42.681 ], "bp2_params": [ 0.073, -0.104, 0.577, -10.846, -22.772, -4.433 ], "groove_widths": [ 8.657, null, 17.988, null ], "simple_Rise": 3.357, "simple_Twist": 39.753, "simple_hRise": 3.372, "simple_hTwist": 40.537 }, { "index": 4, "nt1": "///B/5", "nt2": "///C/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.073, -0.104, 0.577, -10.846, -22.772, -4.433 ], "step_params": [ 1.030, -0.072, 3.348, 4.789, -11.086, 35.575 ], "heli_params": [ 1.411, -0.944, 3.329, -17.532, -7.575, 37.506 ], "bp2_params": [ -0.691, -0.216, 0.332, -14.207, -1.751, 5.433 ], "groove_widths": [ 9.216, 9.194, 20.554, 20.547 ], "simple_Rise": 3.348, "simple_Twist": 40.303, "simple_hRise": 3.349, "simple_hTwist": 42.001 }, { "index": 5, "nt1": "///B/6", "nt2": "///C/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.691, -0.216, 0.332, -14.207, -1.751, 5.433 ], "step_params": [ -0.174, -0.591, 3.077, -0.205, 0.535, 29.801 ], "heli_params": [ -1.253, 0.297, 3.068, 1.040, 0.399, 29.807 ], "bp2_params": [ -0.371, -0.089, 0.298, -6.806, -8.581, 4.065 ], "groove_widths": [ 11.425, 11.405, 19.025, 18.967 ], "simple_Rise": 3.077, "simple_Twist": 27.785, "simple_hRise": 3.067, "simple_hTwist": 27.791 }, { "index": 6, "nt1": "///B/7", "nt2": "///C/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.089, 0.298, -6.806, -8.581, 4.065 ], "step_params": [ -0.168, -0.486, 2.961, 0.974, 3.114, 32.772 ], "heli_params": [ -1.334, 0.445, 2.897, 5.501, -1.721, 32.930 ], "bp2_params": [ 0.522, -0.266, 0.045, 6.218, -1.671, 4.837 ], "groove_widths": [ 13.128, 13.008, 19.941, 19.906 ], "simple_Rise": 2.961, "simple_Twist": 28.054, "simple_hRise": 2.883, "simple_hTwist": 28.239 }, { "index": 7, "nt1": "///B/8", "nt2": "///C/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.522, -0.266, 0.045, 6.218, -1.671, 4.837 ], "step_params": [ 0.010, -0.103, 3.302, -1.618, 0.391, 36.759 ], "heli_params": [ -0.216, -0.237, 3.297, 0.620, 2.564, 36.795 ], "bp2_params": [ -0.253, -0.171, 0.126, 7.014, -4.269, 1.518 ], "groove_widths": [ 12.451, 12.212, 19.825, 19.825 ], "simple_Rise": 3.302, "simple_Twist": 41.024, "simple_hRise": 3.298, "simple_hTwist": 41.057 }, { "index": 8, "nt1": "///B/9", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.253, -0.171, 0.126, 7.014, -4.269, 1.518 ], "step_params": [ 0.904, -1.448, 3.610, -1.003, 0.460, 32.139 ], "heli_params": [ -2.704, -1.828, 3.560, 0.831, 1.811, 32.158 ], "bp2_params": [ 0.373, 0.061, -0.000, -0.339, -5.360, 10.041 ], "groove_widths": [ 11.698, 11.447, 23.097, 23.086 ], "simple_Rise": 3.610, "simple_Twist": 28.661, "simple_hRise": 3.553, "simple_hTwist": 28.682 }, { "index": 9, "nt1": "///B/10", "nt2": "///C/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.373, 0.061, -0.000, -0.339, -5.360, 10.041 ], "step_params": [ -1.040, -1.516, 3.565, -1.740, -1.195, 25.911 ], "heli_params": [ -3.005, 1.781, 3.691, -2.660, 3.872, 25.995 ], "bp2_params": [ -0.269, -0.065, 0.126, -5.494, -3.079, 3.673 ], "groove_widths": [ 11.995, 11.807, 22.674, 22.613 ], "simple_Rise": 3.565, "simple_Twist": 29.466, "simple_hRise": 3.676, "simple_hTwist": 29.539 }, { "index": 10, "nt1": "///B/11", "nt2": "///C/17", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.269, -0.065, 0.126, -5.494, -3.079, 3.673 ], "step_params": [ -0.543, -0.850, 3.143, 1.827, 6.083, 30.468 ], "heli_params": [ -2.669, 1.338, 2.887, 11.420, -3.429, 31.108 ], "bp2_params": [ 0.141, -0.136, 0.024, -1.241, -6.843, 3.024 ], "groove_widths": [ 13.025, 12.951, 20.564, 20.140 ], "simple_Rise": 3.143, "simple_Twist": 28.291, "simple_hRise": 2.862, "simple_hTwist": 28.981 }, { "index": 11, "nt1": "///B/12", "nt2": "///C/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.141, -0.136, 0.024, -1.241, -6.843, 3.024 ], "step_params": [ -0.254, 1.359, 3.124, -8.101, 0.522, 40.276 ], "heli_params": [ 1.883, -0.489, 3.132, 0.749, 11.623, 41.053 ], "bp2_params": [ -0.086, 0.108, 0.861, 12.071, -22.123, 7.442 ], "groove_widths": [ 11.991, 11.977, 16.527, 16.469 ], "simple_Rise": 3.124, "simple_Twist": 41.953, "simple_hRise": 3.134, "simple_hTwist": 42.697 }, { "index": 12, "nt1": "///B/13", "nt2": "///C/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, 0.108, 0.861, 12.071, -22.123, 7.442 ], "step_params": [ -0.692, 0.040, 3.634, 3.643, -5.114, 37.174 ], "heli_params": [ 0.792, 1.591, 3.517, -7.952, -5.666, 37.682 ], "bp2_params": [ 0.839, -0.030, 0.485, 4.021, -23.162, 4.799 ], "groove_widths": [ 8.028, 7.758, 17.279, 16.962 ], "simple_Rise": 3.634, "simple_Twist": 31.907, "simple_hRise": 3.487, "simple_hTwist": 32.503 }, { "index": 13, "nt1": "///B/14", "nt2": "///C/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.839, -0.030, 0.485, 4.021, -23.162, 4.799 ], "step_params": [ 0.276, 2.708, 3.570, 0.306, -23.371, 49.093 ], "heli_params": [ 4.317, -0.286, 2.167, -26.467, -0.347, 54.060 ], "bp2_params": [ -0.326, -0.155, 0.733, -5.166, -30.570, 7.552 ], "groove_widths": [ 5.536, 4.963, 15.952, 14.957 ], "simple_Rise": 3.570, "simple_Twist": 54.900, "simple_hRise": 2.344, "simple_hTwist": 59.310 }, { "index": 14, "nt1": "///B/15", "nt2": "///C/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.326, -0.155, 0.733, -5.166, -30.570, 7.552 ], "step_params": [ -0.090, 0.123, 3.169, -0.765, -4.573, 36.370 ], "heli_params": [ 0.801, 0.041, 3.132, -7.290, 1.219, 36.654 ], "bp2_params": [ 0.459, -0.067, 0.502, -4.567, -35.010, 0.063 ], "groove_widths": [ 7.883, 7.558, 17.038, 15.894 ], "simple_Rise": 3.169, "simple_Twist": 32.091, "simple_hRise": 3.123, "simple_hTwist": 32.416 }, { "index": 15, "nt1": "///B/16", "nt2": "///C/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.459, -0.067, 0.502, -4.567, -35.010, 0.063 ], "step_params": [ 0.779, 0.921, 3.340, 5.232, -5.338, 38.336 ], "heli_params": [ 2.035, -0.523, 3.262, -8.036, -7.875, 39.031 ], "bp2_params": [ -0.092, -0.071, 0.344, 3.615, 3.542, -0.049 ], "groove_widths": [ 11.111, 11.089, 19.488, 19.051 ], "simple_Rise": 3.340, "simple_Twist": 41.473, "simple_hRise": 3.272, "simple_hTwist": 42.112 }, { "index": 16, "nt1": "///B/17", "nt2": "///C/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.071, 0.344, 3.615, 3.542, -0.049 ], "step_params": [ 0.865, -0.937, 3.161, 0.106, 1.792, 25.849 ], "heli_params": [ -2.564, -1.900, 3.094, 4.000, -0.236, 25.910 ], "bp2_params": [ -0.235, 0.142, -0.158, 15.287, -4.145, 7.961 ], "groove_widths": [ 12.982, 12.941, 23.658, 23.590 ], "simple_Rise": 3.161, "simple_Twist": 26.997, "simple_hRise": 3.097, "simple_hTwist": 27.056 }, { "index": 17, "nt1": "///B/18", "nt2": "///C/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, 0.142, -0.158, 15.287, -4.145, 7.961 ], "step_params": [ 0.024, -1.664, 3.569, -2.490, 2.909, 30.352 ], "heli_params": [ -3.769, -0.572, 3.386, 5.528, 4.731, 30.587 ], "bp2_params": [ 0.513, 0.139, -0.084, 3.242, -8.301, 11.985 ], "groove_widths": [ 14.114, 13.968, 24.436, 24.320 ], "simple_Rise": 3.569, "simple_Twist": 26.034, "simple_hRise": 3.350, "simple_hTwist": 26.309 }, { "index": 18, "nt1": "///B/19", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.513, 0.139, -0.084, 3.242, -8.301, 11.985 ], "step_params": [ -0.424, -0.995, 3.100, 0.013, 14.975, 24.405 ], "heli_params": [ -4.969, 0.861, 2.142, 31.873, -0.027, 28.573 ], "bp2_params": [ 0.150, -0.034, 0.225, 6.502, -1.632, 6.618 ], "groove_widths": [ 12.975, 12.800, 22.298, 22.296 ], "simple_Rise": 3.100, "simple_Twist": 26.365, "simple_hRise": 2.225, "simple_hTwist": 30.255 }, { "index": 19, "nt1": "///B/20", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.034, 0.225, 6.502, -1.632, 6.618 ], "step_params": [ -1.032, -0.399, 3.517, 1.764, -12.863, 36.061 ], "heli_params": [ 1.157, 1.816, 3.406, -19.998, -2.742, 38.253 ], "bp2_params": [ 0.038, 0.007, 0.284, 4.474, -26.639, 1.008 ], "groove_widths": [ 10.373, 10.292, 20.405, 20.403 ], "simple_Rise": 3.517, "simple_Twist": 37.036, "simple_hRise": 3.414, "simple_hTwist": 39.170 }, { "index": 20, "nt1": "///B/21", "nt2": "///C/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, 0.007, 0.284, 4.474, -26.639, 1.008 ], "step_params": [ 0.219, -0.758, 3.432, -3.675, -2.949, 36.096 ], "heli_params": [ -0.781, -0.891, 3.443, -4.734, 5.900, 36.392 ], "bp2_params": [ -0.288, -0.089, 0.560, -4.786, -17.951, 2.632 ], "groove_widths": [ 9.103, 9.092, 20.075, 20.048 ], "simple_Rise": 3.432, "simple_Twist": 37.396, "simple_hRise": 3.444, "simple_hTwist": 37.681 }, { "index": 21, "nt1": "///B/22", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.288, -0.089, 0.560, -4.786, -17.951, 2.632 ], "step_params": [ 0.047, -0.787, 3.382, -1.263, -10.889, 33.316 ], "heli_params": [ 0.451, -0.281, 3.458, -18.384, 2.133, 35.025 ], "bp2_params": [ -0.155, -0.225, 0.528, -2.066, -13.271, 5.347 ], "groove_widths": [ 9.092, 9.089, 17.785, 17.782 ], "simple_Rise": 3.382, "simple_Twist": 32.796, "simple_hRise": 3.457, "simple_hTwist": 34.532 }, { "index": 22, "nt1": "///B/23", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.225, 0.528, -2.066, -13.271, 5.347 ], "step_params": [ -0.199, -0.752, 3.230, 1.259, -7.507, 36.351 ], "heli_params": [ -0.168, 0.482, 3.307, -11.874, -1.991, 37.113 ], "bp2_params": [ 0.130, -0.269, 0.190, 0.894, -10.039, 1.083 ], "groove_widths": [ 9.112, null, 20.015, null ], "simple_Rise": 3.230, "simple_Twist": 34.835, "simple_hRise": 3.307, "simple_hTwist": 35.632 }, { "index": 23, "nt1": "///B/24", "nt2": "///C/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.269, 0.190, 0.894, -10.039, 1.083 ], "step_params": [ 0.156, -0.725, 3.500, 0.389, -4.758, 38.963 ], "heli_params": [ -0.464, -0.182, 3.562, -7.101, -0.581, 39.243 ], "bp2_params": [ 0.083, -0.009, 0.143, -10.233, -3.605, 3.311 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.500, "simple_Twist": 38.970, "simple_hRise": 3.562, "simple_hTwist": 39.250 }, { "index": 24, "nt1": "///B/25", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.083, -0.009, 0.143, -10.233, -3.605, 3.311 ], "step_params": [ -0.075, -0.647, 2.888, -0.006, -3.236, 31.222 ], "heli_params": [ -0.653, 0.137, 2.939, -5.992, 0.011, 31.386 ], "bp2_params": [ 0.362, -0.279, 0.113, 10.166, 4.477, -1.904 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.888, "simple_Twist": 29.872, "simple_hRise": 2.941, "simple_hTwist": 30.043 }, { "index": 25, "nt1": "///B/26", "nt2": "///C/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/1,///B/2" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///C/1,///C/2" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///B/1" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///C/1" } ], "dbn": { "all_chains": { "num_nts": 52, "num_chars": 53, "bseq": "GGGTTTCCACTTATTCATCATTTTAG&CCTAAAATGATGAATAAGTGGAAACC", "sstr": ".(((((((((((((((((((((((((&.)))))))))))))))))))))))))", "form": ".B.B..BB....B.BB...B..BB.-&.BBBBB.....B..B...BBB.B.B-" }, "chain_B": { "num_nts": 26, "num_chars": 26, "bseq": "GGGTTTCCACTTATTCATCATTTTAG", "sstr": ".(((((((((((((((((((((((((", "form": ".B.B..BB....B.BB...B..BB.-" }, "chain_C": { "num_nts": 26, "num_chars": 26, "bseq": "CCTAAAATGATGAATAAGTGGAAACC", "sstr": ".)))))))))))))))))))))))))", "form": ".BBBBB.....B..B...BBB.B.B-" } }, "chains": { "chain_B": { "num_nts": 26, "bseq": "GGGTTTCCACTTATTCATCATTTTAG", "sstr": ".(((((((((((((((((((((((((", "form": ".B.B..BB....B.BB...B..BB.-", "helical_rise": 3.211, "helical_rise_std": 0.791, "helical_axis": [ -0.039, 0.140, -0.989 ], "point1": [ -2.250, -6.450, 51.818 ], "point2": [ -5.418, 4.799, -27.799 ], "num_chars": 76, "suite": "G!!G!!G!!T!!T!!T!!C!!C!!A!!C1bT!!T4bA!!T4bT!!C!!A!!T&aC1bA!!T!!T!!T!!T!!A!!G" }, "chain_C": { "num_nts": 26, "bseq": "CCTAAAATGATGAATAAGTGGAAACC", "sstr": ".)))))))))))))))))))))))))", "form": ".BBBBB.....B..B...BBB.B.B-", "helical_rise": 3.236, "helical_rise_std": 0.930, "helical_axis": [ -0.105, -0.247, 0.963 ], "point1": [ 0.472, 11.013, -33.200 ], "point2": [ -8.082, -8.976, 44.918 ], "num_chars": 76, "suite": "C!!C!!T!!A!!A!!A!!A!!T!!G!!A1bT4bG!!A4bA!!T!!A!!A!!G!!T!!G!!G!!A4bA!!A!!C!!C" } }, "num_nts": 52, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 174.017, "delta": 161.494, "epsilon": -170.513, "zeta": -117.622, "epsilon_zeta": -52.891, "bb_type": "BI", "chi": -93.685, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 7.507, -2.055 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.284, "Dp": 1.649, "splay_angle": 23.599, "splay_distance": 4.064, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.792, "v1": 19.685, "v2": -35.118, "v3": 38.925, "v4": -27.742, "amplitude": 38.940, "phase_angle": 205.595, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -15.860, -2.109, 49.698 ], "x_axis": [ -0.304, 0.930, -0.207 ], "y_axis": [ 0.806, 0.367, 0.464 ], "z_axis": [ 0.507, -0.026, -0.861 ], "quaternion": [ 0.224, 0.546, 0.796, 0.138 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -58.606, "beta": 170.567, "gamma": 55.802, "delta": 152.217, "epsilon": -151.861, "zeta": -147.199, "epsilon_zeta": -4.662, "bb_type": "--", "chi": -81.045, "glyco_bond": "--", "C5prime_xyz": [ -2.268, 7.391, -2.687 ], "P_xyz": [ 0.297, 7.644, -3.138 ], "form": "B", "ssZp": 1.277, "Dp": 1.765, "splay_angle": 21.420, "splay_distance": 3.701, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 172.172, "theta": -151.781, "eta_prime": -155.487, "theta_prime": -178.153, "eta_base": -104.057, "theta_base": -139.708, "v0": -11.815, "v1": 30.716, "v2": -36.873, "v3": 31.020, "v4": -12.295, "amplitude": 36.874, "phase_angle": 180.396, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -12.327, -1.365, 47.833 ], "x_axis": [ 0.361, 0.928, 0.089 ], "y_axis": [ 0.855, -0.368, 0.366 ], "z_axis": [ 0.372, -0.056, -0.927 ], "quaternion": [ 0.129, 0.815, 0.547, 0.141 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.705, "beta": 125.062, "gamma": 77.688, "delta": 119.238, "epsilon": -171.309, "zeta": -91.251, "epsilon_zeta": -80.058, "bb_type": "BI", "chi": -130.626, "glyco_bond": "anti", "C5prime_xyz": [ -2.622, 8.778, -1.203 ], "P_xyz": [ -0.189, 9.114, -2.076 ], "form": ".", "ssZp": 2.485, "Dp": 2.518, "splay_angle": 20.082, "splay_distance": 3.606, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 166.758, "theta": -131.406, "eta_prime": -166.758, "theta_prime": -159.308, "eta_base": -127.144, "theta_base": -113.151, "v0": -37.652, "v1": 36.233, "v2": -21.592, "v3": 0.728, "v4": 22.955, "amplitude": 37.966, "phase_angle": 124.660, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -10.695, -2.541, 44.726 ], "x_axis": [ 0.752, 0.640, 0.157 ], "y_axis": [ 0.580, -0.757, 0.301 ], "z_axis": [ 0.311, -0.136, -0.941 ], "quaternion": [ 0.118, 0.929, 0.328, 0.126 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.276, "beta": 170.297, "gamma": 52.235, "delta": 107.563, "epsilon": 168.231, "zeta": -89.669, "epsilon_zeta": -102.099, "bb_type": "BI", "chi": -131.221, "glyco_bond": "anti", "C5prime_xyz": [ -2.700, 8.720, -1.349 ], "P_xyz": [ -0.649, 10.339, -1.393 ], "form": "B", "ssZp": 2.692, "Dp": 2.710, "splay_angle": 20.081, "splay_distance": 3.393, "splay_ratio": 0.177, "d22": 4.475, "d64": 4.359, "eta": 168.089, "theta": -165.284, "eta_prime": -168.146, "theta_prime": -170.238, "eta_base": -111.976, "theta_base": -126.437, "v0": -38.478, "v1": 29.609, "v2": -10.712, "v3": -10.899, "v4": 31.002, "amplitude": 37.308, "phase_angle": 106.686, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -8.902, -1.706, 41.712 ], "x_axis": [ 0.965, 0.028, 0.261 ], "y_axis": [ 0.007, -0.997, 0.081 ], "z_axis": [ 0.262, -0.077, -0.962 ], "quaternion": [ 0.040, 0.990, 0.009, 0.132 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.350, "beta": 177.152, "gamma": 58.819, "delta": 131.756, "epsilon": -169.146, "zeta": -99.624, "epsilon_zeta": -69.522, "bb_type": "BI", "chi": -124.533, "glyco_bond": "anti", "C5prime_xyz": [ -2.258, 8.678, -1.236 ], "P_xyz": [ 0.052, 9.842, -0.874 ], "form": ".", "ssZp": 2.297, "Dp": 2.324, "splay_angle": 18.441, "splay_distance": 3.267, "splay_ratio": 0.165, "d22": 4.194, "d64": 3.964, "eta": -178.801, "theta": -135.965, "eta_prime": -155.317, "theta_prime": -151.963, "eta_base": -107.418, "theta_base": -104.492, "v0": -30.296, "v1": 36.990, "v2": -29.449, "v3": 12.882, "v4": 10.677, "amplitude": 36.255, "phase_angle": 144.319, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -7.588, -1.160, 38.632 ], "x_axis": [ 0.821, -0.567, 0.062 ], "y_axis": [ -0.559, -0.821, -0.116 ], "z_axis": [ 0.117, 0.060, -0.991 ], "quaternion": [ -0.046, 0.953, -0.295, 0.047 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.159, "beta": 167.278, "gamma": 48.143, "delta": 101.510, "epsilon": 172.261, "zeta": -86.799, "epsilon_zeta": -100.940, "bb_type": "BI", "chi": -130.333, "glyco_bond": "anti", "C5prime_xyz": [ -2.537, 8.712, -1.406 ], "P_xyz": [ -0.371, 10.160, -1.561 ], "form": ".", "ssZp": 2.819, "Dp": 2.909, "splay_angle": 17.919, "splay_distance": 3.135, "splay_ratio": 0.158, "d22": 4.142, "d64": 4.247, "eta": 167.584, "theta": -164.018, "eta_prime": -172.704, "theta_prime": -169.849, "eta_base": -114.532, "theta_base": -135.862, "v0": -33.885, "v1": 20.984, "v2": -1.641, "v3": -17.645, "v4": 32.549, "amplitude": 34.176, "phase_angle": 92.752, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -6.049, -1.194, 35.750 ], "x_axis": [ 0.306, -0.942, -0.141 ], "y_axis": [ -0.938, -0.273, -0.212 ], "z_axis": [ 0.161, 0.197, -0.967 ], "quaternion": [ -0.128, 0.798, -0.589, 0.006 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.594, "beta": 165.431, "gamma": 61.160, "delta": 118.296, "epsilon": -160.132, "zeta": -93.034, "epsilon_zeta": -67.097, "bb_type": "BI", "chi": -137.350, "glyco_bond": "anti", "C5prime_xyz": [ -2.425, 8.908, -0.903 ], "P_xyz": [ -0.154, 10.165, -0.645 ], "form": "B", "ssZp": 2.444, "Dp": 2.478, "splay_angle": 16.278, "splay_distance": 2.901, "splay_ratio": 0.145, "d22": 4.159, "d64": 3.719, "eta": -175.687, "theta": -138.002, "eta_prime": -156.684, "theta_prime": -145.904, "eta_base": -117.668, "theta_base": -110.438, "v0": -37.387, "v1": 35.279, "v2": -20.395, "v3": -0.331, "v4": 23.487, "amplitude": 37.400, "phase_angle": 123.048, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -4.560, -0.526, 33.073 ], "x_axis": [ -0.162, -0.928, -0.334 ], "y_axis": [ -0.960, 0.227, -0.166 ], "z_axis": [ 0.230, 0.294, -0.928 ], "quaternion": [ 0.185, -0.620, 0.761, 0.042 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -59.767, "beta": 171.373, "gamma": 39.657, "delta": 127.071, "epsilon": -166.353, "zeta": -135.922, "epsilon_zeta": -30.431, "bb_type": "--", "chi": -110.075, "glyco_bond": "anti", "C5prime_xyz": [ -2.771, 8.397, -1.960 ], "P_xyz": [ -0.772, 10.063, -2.163 ], "form": "B", "ssZp": 2.359, "Dp": 2.385, "splay_angle": 20.242, "splay_distance": 3.359, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 158.992, "theta": -173.810, "eta_prime": -174.677, "theta_prime": -176.945, "eta_base": -130.498, "theta_base": -133.469, "v0": -36.175, "v1": 39.688, "v2": -28.125, "v3": 8.241, "v4": 17.258, "amplitude": 39.391, "phase_angle": 135.561, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -3.441, -0.538, 30.397 ], "x_axis": [ -0.675, -0.666, -0.318 ], "y_axis": [ -0.666, 0.735, -0.124 ], "z_axis": [ 0.316, 0.128, -0.940 ], "quaternion": [ 0.173, -0.364, 0.915, 0.001 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.796, "beta": 150.288, "gamma": 53.581, "delta": 134.075, "epsilon": -172.866, "zeta": -86.953, "epsilon_zeta": -85.914, "bb_type": "BI", "chi": -123.485, "glyco_bond": "anti", "C5prime_xyz": [ -2.065, 8.631, -1.202 ], "P_xyz": [ 0.486, 9.165, -0.999 ], "form": ".", "ssZp": 2.281, "Dp": 2.301, "splay_angle": 21.268, "splay_distance": 3.975, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 168.068, "theta": -116.134, "eta_prime": -167.029, "theta_prime": -142.144, "eta_base": -120.718, "theta_base": -101.063, "v0": -25.733, "v1": 34.302, "v2": -29.547, "v3": 15.538, "v4": 6.182, "amplitude": 33.825, "phase_angle": 150.869, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -2.324, 0.136, 27.301 ], "x_axis": [ -0.942, -0.125, -0.310 ], "y_axis": [ -0.157, 0.984, 0.079 ], "z_axis": [ 0.296, 0.123, -0.947 ], "quaternion": [ 0.154, -0.072, 0.984, 0.051 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.639, "beta": 173.060, "gamma": 38.602, "delta": 103.232, "epsilon": 178.240, "zeta": -95.992, "epsilon_zeta": -85.767, "bb_type": "BI", "chi": -136.960, "glyco_bond": "anti", "C5prime_xyz": [ -2.670, 8.863, -1.142 ], "P_xyz": [ -0.895, 10.745, -0.790 ], "form": ".", "ssZp": 2.832, "Dp": 2.835, "splay_angle": 24.202, "splay_distance": 4.178, "splay_ratio": 0.212, "d22": 4.797, "d64": 4.919, "eta": 166.948, "theta": -173.026, "eta_prime": -171.455, "theta_prime": -171.370, "eta_base": -116.042, "theta_base": -149.071, "v0": -39.252, "v1": 27.616, "v2": -6.846, "v3": -15.341, "v4": 34.334, "amplitude": 38.481, "phase_angle": 100.248, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -2.737, -0.326, 23.375 ], "x_axis": [ -0.861, 0.480, -0.170 ], "y_axis": [ 0.421, 0.859, 0.292 ], "z_axis": [ 0.286, 0.180, -0.941 ], "quaternion": [ 0.119, 0.235, 0.957, 0.123 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.766, "beta": -178.955, "gamma": 50.011, "delta": 130.083, "epsilon": -161.055, "zeta": -105.725, "epsilon_zeta": -55.330, "bb_type": "BI", "chi": -130.042, "glyco_bond": "anti", "C5prime_xyz": [ -2.299, 8.761, -1.009 ], "P_xyz": [ -0.232, 10.164, -0.247 ], "form": ".", "ssZp": 2.260, "Dp": 2.298, "splay_angle": 18.328, "splay_distance": 3.238, "splay_ratio": 0.164, "d22": 4.432, "d64": 4.135, "eta": -178.153, "theta": -140.518, "eta_prime": -162.720, "theta_prime": -147.065, "eta_base": -138.453, "theta_base": -119.820, "v0": -32.369, "v1": 37.911, "v2": -28.932, "v3": 11.204, "v4": 13.024, "amplitude": 37.227, "phase_angle": 141.002, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.013, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -1.543, -1.615, 19.583 ], "x_axis": [ -0.631, 0.774, -0.042 ], "y_axis": [ 0.703, 0.594, 0.390 ], "z_axis": [ 0.327, 0.217, -0.920 ], "quaternion": [ 0.104, 0.417, 0.887, 0.171 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -42.255, "beta": 177.209, "gamma": 20.106, "delta": 141.767, "epsilon": -142.190, "zeta": -160.157, "epsilon_zeta": 17.967, "bb_type": "--", "chi": -102.614, "glyco_bond": "anti", "C5prime_xyz": [ -2.559, 8.194, -2.042 ], "P_xyz": [ -0.760, 10.077, -1.855 ], "form": ".", "ssZp": 1.823, "Dp": 1.869, "splay_angle": 22.393, "splay_distance": 3.872, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 170.864, "theta": -179.020, "eta_prime": -168.650, "theta_prime": -174.769, "eta_base": -135.343, "theta_base": -118.886, "v0": -28.748, "v1": 40.865, "v2": -36.769, "v3": 21.264, "v4": 4.392, "amplitude": 40.567, "phase_angle": 155.012, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -1.425, -1.497, 16.349 ], "x_axis": [ -0.201, 0.961, 0.189 ], "y_axis": [ 0.954, 0.148, 0.262 ], "z_axis": [ 0.224, 0.233, -0.947 ], "quaternion": [ 0.012, 0.632, 0.758, 0.163 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.832, "beta": 143.493, "gamma": 53.853, "delta": 148.523, "epsilon": -169.006, "zeta": -115.913, "epsilon_zeta": -53.093, "bb_type": "BI", "chi": -103.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.863, 8.122, -1.887 ], "P_xyz": [ 0.745, 8.014, -1.887 ], "form": "B", "ssZp": 1.866, "Dp": 1.945, "splay_angle": 20.897, "splay_distance": 3.482, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.020, "theta": -122.159, "eta_prime": -162.733, "theta_prime": -153.995, "eta_base": -109.265, "theta_base": -115.733, "v0": -15.337, "v1": 32.450, "v2": -36.337, "v3": 28.389, "v4": -8.442, "amplitude": 36.511, "phase_angle": 174.405, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.108, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 0.940, -1.109, 13.309 ], "x_axis": [ 0.520, 0.825, 0.222 ], "y_axis": [ 0.839, -0.542, 0.048 ], "z_axis": [ 0.160, 0.161, -0.974 ], "quaternion": [ -0.033, 0.871, 0.477, 0.109 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -51.432, "beta": 168.519, "gamma": 46.977, "delta": 141.123, "epsilon": -85.869, "zeta": 164.865, "epsilon_zeta": 109.266, "bb_type": "BII", "chi": -99.378, "glyco_bond": "anti", "C5prime_xyz": [ -2.627, 8.091, -2.174 ], "P_xyz": [ -0.310, 9.253, -2.474 ], "form": ".", "ssZp": 0.596, "Dp": 0.659, "splay_angle": 26.904, "splay_distance": 4.661, "splay_ratio": 0.253, "d22": 6.265, "d64": 5.441, "eta": -158.649, "theta": 175.302, "eta_prime": -142.816, "theta_prime": 176.383, "eta_base": -105.121, "theta_base": -115.340, "v0": -28.642, "v1": 40.411, "v2": -36.159, "v3": 20.695, "v4": 4.686, "amplitude": 40.056, "phase_angle": 154.515, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 1.775, -0.422, 9.999 ], "x_axis": [ 0.917, 0.381, 0.118 ], "y_axis": [ 0.397, -0.900, -0.181 ], "z_axis": [ 0.037, 0.213, -0.976 ], "quaternion": [ -0.101, 0.974, 0.200, 0.040 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -79.994, "beta": 125.451, "gamma": 62.359, "delta": 143.626, "epsilon": -151.523, "zeta": -83.942, "epsilon_zeta": -67.580, "bb_type": "BI", "chi": -98.201, "glyco_bond": "anti", "C5prime_xyz": [ -2.441, 8.053, -2.225 ], "P_xyz": [ 0.094, 7.762, -2.834 ], "form": "B", "ssZp": 1.796, "Dp": 1.904, "splay_angle": 17.477, "splay_distance": 3.075, "splay_ratio": 0.153, "d22": 3.961, "d64": 3.896, "eta": 166.882, "theta": -114.370, "eta_prime": -153.975, "theta_prime": -165.577, "eta_base": -94.706, "theta_base": -117.350, "v0": -25.272, "v1": 38.956, "v2": -37.123, "v3": 23.596, "v4": 0.771, "amplitude": 39.486, "phase_angle": 160.081, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.084, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 1.641, -2.090, 5.649 ], "x_axis": [ 0.802, -0.318, -0.506 ], "y_axis": [ -0.422, -0.900, -0.103 ], "z_axis": [ -0.423, 0.297, -0.856 ], "quaternion": [ -0.106, 0.943, -0.196, -0.246 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -101.780, "beta": 77.235, "gamma": 162.487, "delta": 133.187, "epsilon": 178.947, "zeta": 40.346, "epsilon_zeta": 138.601, "bb_type": "--", "chi": -154.135, "glyco_bond": "anti", "C5prime_xyz": [ -2.072, 8.935, 0.310 ], "P_xyz": [ -1.495, 9.911, -2.066 ], "form": "B", "ssZp": 1.698, "Dp": 2.367, "splay_angle": 21.874, "splay_distance": 3.440, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": -104.720, "theta": -150.759, "eta_prime": -140.705, "theta_prime": -140.854, "eta_base": -94.697, "theta_base": -98.884, "v0": -30.521, "v1": 38.108, "v2": -30.905, "v3": 14.267, "v4": 9.922, "amplitude": 37.302, "phase_angle": 145.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 1.103, -1.560, 2.669 ], "x_axis": [ 0.389, -0.664, -0.638 ], "y_axis": [ -0.826, -0.559, 0.078 ], "z_axis": [ -0.409, 0.497, -0.766 ], "quaternion": [ -0.127, 0.824, -0.452, -0.318 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -93.484, "beta": -63.848, "gamma": -127.821, "delta": 156.278, "epsilon": -177.156, "zeta": -91.061, "epsilon_zeta": -86.095, "bb_type": "BI", "chi": -102.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 7.886, -1.774 ], "P_xyz": [ -2.035, 7.829, -4.329 ], "form": ".", "ssZp": 1.728, "Dp": 1.814, "splay_angle": 17.191, "splay_distance": 3.141, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 169.180, "theta": 128.159, "eta_prime": 178.788, "theta_prime": 165.048, "eta_base": -133.015, "theta_base": -147.055, "v0": -3.217, "v1": 24.836, "v2": -35.677, "v3": 34.770, "v4": -20.052, "amplitude": 36.722, "phase_angle": 193.701, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -0.397, -1.124, -0.396 ], "x_axis": [ -0.155, -0.924, -0.349 ], "y_axis": [ -0.978, 0.092, 0.189 ], "z_axis": [ -0.143, 0.371, -0.918 ], "quaternion": [ 0.070, -0.646, 0.736, 0.190 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.330, "beta": 168.344, "gamma": 49.952, "delta": 103.285, "epsilon": 176.890, "zeta": -87.003, "epsilon_zeta": -96.107, "bb_type": "BI", "chi": -123.991, "glyco_bond": "anti", "C5prime_xyz": [ -3.002, 8.516, -1.715 ], "P_xyz": [ -1.101, 10.231, -2.210 ], "form": ".", "ssZp": 2.723, "Dp": 2.788, "splay_angle": 21.957, "splay_distance": 3.966, "splay_ratio": 0.196, "d22": 3.987, "d64": 4.278, "eta": 163.947, "theta": -161.530, "eta_prime": -174.181, "theta_prime": -170.920, "eta_base": -126.943, "theta_base": -132.812, "v0": -40.509, "v1": 28.915, "v2": -7.720, "v3": -15.148, "v4": 34.998, "amplitude": 39.610, "phase_angle": 101.238, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -0.402, -0.932, -3.531 ], "x_axis": [ -0.623, -0.747, -0.234 ], "y_axis": [ -0.781, 0.574, 0.246 ], "z_axis": [ -0.049, 0.336, -0.941 ], "quaternion": [ 0.052, -0.431, 0.886, 0.164 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.782, "beta": 175.065, "gamma": 35.801, "delta": 85.286, "epsilon": -164.206, "zeta": -75.248, "epsilon_zeta": -88.958, "bb_type": "BI", "chi": -147.040, "glyco_bond": "anti", "C5prime_xyz": [ -2.192, 9.035, -0.547 ], "P_xyz": [ -0.134, 10.593, -0.107 ], "form": ".", "ssZp": 3.607, "Dp": 3.848, "splay_angle": 19.791, "splay_distance": 3.417, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 171.304, "theta": -158.531, "eta_prime": 177.222, "theta_prime": -149.970, "eta_base": -136.401, "theta_base": -133.856, "v0": -22.958, "v1": -0.092, "v2": 21.256, "v3": -35.227, "v4": 36.963, "amplitude": 37.493, "phase_angle": 55.463, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.075, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -0.398, -0.894, -7.496 ], "x_axis": [ -0.934, -0.357, 0.023 ], "y_axis": [ -0.316, 0.854, 0.414 ], "z_axis": [ -0.168, 0.379, -0.910 ], "quaternion": [ -0.050, -0.175, 0.961, 0.206 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.123, "beta": 177.610, "gamma": 50.219, "delta": 137.528, "epsilon": -153.418, "zeta": -157.231, "epsilon_zeta": 3.813, "bb_type": "--", "chi": -117.341, "glyco_bond": "anti", "C5prime_xyz": [ -2.498, 8.522, -1.492 ], "P_xyz": [ -0.364, 9.973, -1.139 ], "form": "B", "ssZp": 2.072, "Dp": 2.102, "splay_angle": 22.903, "splay_distance": 3.741, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 174.604, "theta": -172.867, "eta_prime": -158.027, "theta_prime": -179.267, "eta_base": -139.832, "theta_base": -139.029, "v0": -31.988, "v1": 41.493, "v2": -34.739, "v3": 17.391, "v4": 8.835, "amplitude": 40.642, "phase_angle": 148.731, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.656, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -0.812, -0.530, -10.869 ], "x_axis": [ -0.885, -0.123, 0.449 ], "y_axis": [ -0.002, 0.966, 0.260 ], "z_axis": [ -0.465, 0.230, -0.855 ], "quaternion": [ -0.238, -0.032, 0.962, 0.127 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.105, "beta": 137.420, "gamma": 55.294, "delta": 128.135, "epsilon": -175.271, "zeta": -94.123, "epsilon_zeta": -81.148, "bb_type": "BI", "chi": -126.296, "glyco_bond": "anti", "C5prime_xyz": [ -2.249, 8.707, -1.188 ], "P_xyz": [ 0.327, 9.128, -1.225 ], "form": ".", "ssZp": 2.457, "Dp": 2.447, "splay_angle": 21.074, "splay_distance": 3.666, "splay_ratio": 0.187, "d22": 4.101, "d64": 3.941, "eta": 174.150, "theta": -127.168, "eta_prime": -161.434, "theta_prime": -150.537, "eta_base": -119.491, "theta_base": -110.668, "v0": -30.276, "v1": 34.832, "v2": -26.151, "v3": 9.500, "v4": 12.844, "amplitude": 34.330, "phase_angle": 139.618, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -1.283, -0.141, -14.560 ], "x_axis": [ -0.852, 0.505, 0.134 ], "y_axis": [ 0.510, 0.860, 0.004 ], "z_axis": [ -0.113, 0.072, -0.991 ], "quaternion": [ -0.064, 0.264, 0.962, 0.020 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.483, "beta": 177.493, "gamma": 48.258, "delta": 124.557, "epsilon": -178.451, "zeta": -100.369, "epsilon_zeta": -78.083, "bb_type": "BI", "chi": -125.314, "glyco_bond": "anti", "C5prime_xyz": [ -2.380, 8.678, -1.332 ], "P_xyz": [ -0.264, 10.146, -0.908 ], "form": ".", "ssZp": 2.420, "Dp": 2.456, "splay_angle": 19.688, "splay_distance": 3.473, "splay_ratio": 0.177, "d22": 4.385, "d64": 4.453, "eta": 168.464, "theta": -150.195, "eta_prime": -166.560, "theta_prime": -160.548, "eta_base": -114.685, "theta_base": -120.660, "v0": -33.045, "v1": 35.275, "v2": -24.368, "v3": 6.184, "v4": 16.655, "amplitude": 35.344, "phase_angle": 133.587, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -2.829, 0.145, -17.871 ], "x_axis": [ -0.365, 0.921, 0.134 ], "y_axis": [ 0.924, 0.376, -0.066 ], "z_axis": [ -0.112, 0.100, -0.989 ], "quaternion": [ -0.074, 0.559, 0.826, 0.010 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.905, "beta": 168.607, "gamma": 54.549, "delta": 112.932, "epsilon": -176.992, "zeta": -96.664, "epsilon_zeta": -80.328, "bb_type": "BI", "chi": -133.468, "glyco_bond": "anti", "C5prime_xyz": [ -2.539, 8.781, -1.155 ], "P_xyz": [ -0.371, 10.219, -0.988 ], "form": "B", "ssZp": 2.609, "Dp": 2.636, "splay_angle": 18.196, "splay_distance": 3.157, "splay_ratio": 0.161, "d22": 4.379, "d64": 4.180, "eta": 178.458, "theta": -156.194, "eta_prime": -162.861, "theta_prime": -163.046, "eta_base": -115.581, "theta_base": -124.374, "v0": -36.876, "v1": 31.436, "v2": -14.981, "v3": -5.595, "v4": 26.599, "amplitude": 35.929, "phase_angle": 114.642, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -4.361, 0.574, -20.958 ], "x_axis": [ 0.191, 0.976, -0.108 ], "y_axis": [ 0.967, -0.205, -0.149 ], "z_axis": [ -0.168, -0.076, -0.983 ], "quaternion": [ -0.024, 0.771, 0.630, -0.089 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.340, "beta": 169.049, "gamma": 54.901, "delta": 121.076, "epsilon": 171.848, "zeta": -95.144, "epsilon_zeta": -93.008, "bb_type": "BI", "chi": -128.498, "glyco_bond": "anti", "C5prime_xyz": [ -2.458, 8.724, -1.245 ], "P_xyz": [ -0.220, 10.046, -1.072 ], "form": "B", "ssZp": 2.495, "Dp": 2.532, "splay_angle": 21.479, "splay_distance": 3.529, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 169.881, "theta": -154.449, "eta_prime": -164.601, "theta_prime": -163.369, "eta_base": -118.263, "theta_base": -117.114, "v0": -35.014, "v1": 34.879, "v2": -21.927, "v3": 2.579, "v4": 20.185, "amplitude": 35.903, "phase_angle": 127.641, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -5.677, 0.887, -23.811 ], "x_axis": [ 0.664, 0.683, -0.305 ], "y_axis": [ 0.681, -0.720, -0.131 ], "z_axis": [ -0.309, -0.121, -0.943 ], "quaternion": [ -0.003, 0.912, 0.374, -0.168 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.492, "beta": -170.108, "gamma": 42.548, "delta": 144.614, "epsilon": -167.262, "zeta": -100.578, "epsilon_zeta": -66.684, "bb_type": "BI", "chi": -116.891, "glyco_bond": "anti", "C5prime_xyz": [ -1.805, 8.452, -1.321 ], "P_xyz": [ 0.335, 9.602, -0.370 ], "form": ".", "ssZp": 1.980, "Dp": 2.026, "splay_angle": 16.677, "splay_distance": 2.970, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 178.216, "theta": -128.832, "eta_prime": -159.293, "theta_prime": -141.835, "eta_base": -107.551, "theta_base": -114.701, "v0": -18.727, "v1": 33.527, "v2": -34.862, "v3": 24.977, "v4": -4.177, "amplitude": 35.661, "phase_angle": 167.850, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -6.749, 1.196, -27.159 ], "x_axis": [ 0.934, 0.055, -0.352 ], "y_axis": [ 0.116, -0.981, 0.154 ], "z_axis": [ -0.337, -0.185, -0.923 ], "quaternion": [ 0.086, 0.980, 0.044, -0.176 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -55.700, "beta": 177.036, "gamma": 33.288, "delta": 131.418, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -101.451, "glyco_bond": "anti", "C5prime_xyz": [ -2.898, 8.127, -2.199 ], "P_xyz": [ -1.032, 9.934, -2.471 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -33.649, "v1": 39.721, "v2": -30.496, "v3": 12.114, "v4": 13.206, "amplitude": 38.927, "phase_angle": 141.573, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -7.553, 1.625, -29.985 ], "x_axis": [ 0.865, -0.427, -0.265 ], "y_axis": [ -0.401, -0.904, 0.148 ], "z_axis": [ -0.303, -0.021, -0.953 ], "quaternion": [ 0.044, 0.965, -0.215, -0.147 ] } }, { "index": 27, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 56.100, "delta": 145.941, "epsilon": -176.106, "zeta": -91.871, "epsilon_zeta": -84.235, "bb_type": "BI", "chi": -113.211, "glyco_bond": "anti", "C5prime_xyz": [ -1.807, 8.447, -1.491 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.173, "Dp": 2.150, "splay_angle": 27.575, "splay_distance": 4.707, "splay_ratio": 0.241, "d22": 3.823, "d64": 3.765, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -19.002, "v1": 34.243, "v2": -35.580, "v3": 25.548, "v4": -4.324, "amplitude": 36.382, "phase_angle": 167.951, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -9.268, 2.366, -34.143 ], "x_axis": [ 0.407, -0.912, 0.045 ], "y_axis": [ 0.909, 0.399, -0.122 ], "z_axis": [ 0.094, 0.091, 0.991 ], "quaternion": [ 0.836, -0.064, 0.014, -0.544 ] } }, { "index": 28, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -66.884, "beta": -172.465, "gamma": 44.060, "delta": 132.582, "epsilon": -168.765, "zeta": -104.620, "epsilon_zeta": -64.145, "bb_type": "BI", "chi": -126.533, "glyco_bond": "anti", "C5prime_xyz": [ -2.044, 8.758, -1.090 ], "P_xyz": [ 0.015, 10.114, -0.210 ], "form": "B", "ssZp": 2.369, "Dp": 2.356, "splay_angle": 17.248, "splay_distance": 2.963, "splay_ratio": 0.152, "d22": 4.519, "d64": 4.121, "eta": 164.787, "theta": -145.572, "eta_prime": -169.143, "theta_prime": -153.676, "eta_base": -114.695, "theta_base": -116.049, "v0": -28.140, "v1": 35.428, "v2": -29.002, "v3": 13.627, "v4": 8.890, "amplitude": 34.735, "phase_angle": 146.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -7.924, 1.546, -29.707 ], "x_axis": [ 0.823, -0.463, -0.330 ], "y_axis": [ 0.363, 0.874, -0.321 ], "z_axis": [ 0.437, 0.145, 0.888 ], "quaternion": [ 0.947, -0.123, 0.202, -0.218 ] } }, { "index": 29, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.571, "beta": 165.814, "gamma": 63.652, "delta": 117.584, "epsilon": 165.831, "zeta": -95.881, "epsilon_zeta": -98.288, "bb_type": "BI", "chi": -125.997, "glyco_bond": "anti", "C5prime_xyz": [ -2.531, 8.667, -1.425 ], "P_xyz": [ -0.215, 9.845, -1.705 ], "form": "B", "ssZp": 2.538, "Dp": 2.563, "splay_angle": 22.410, "splay_distance": 3.633, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 164.199, "theta": -160.699, "eta_prime": -167.868, "theta_prime": -172.634, "eta_base": -121.718, "theta_base": -128.569, "v0": -35.580, "v1": 33.318, "v2": -19.005, "v3": -0.741, "v4": 22.661, "amplitude": 35.505, "phase_angle": 122.364, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -6.780, 1.193, -26.997 ], "x_axis": [ 0.948, 0.118, -0.297 ], "y_axis": [ -0.113, 0.993, 0.033 ], "z_axis": [ 0.298, 0.002, 0.954 ], "quaternion": [ 0.987, 0.008, 0.151, 0.059 ] } }, { "index": 30, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.604, "beta": -172.870, "gamma": 55.136, "delta": 141.322, "epsilon": -175.523, "zeta": -97.101, "epsilon_zeta": -78.422, "bb_type": "BI", "chi": -123.260, "glyco_bond": "anti", "C5prime_xyz": [ -1.777, 8.571, -1.061 ], "P_xyz": [ 0.540, 9.437, -0.219 ], "form": "B", "ssZp": 2.116, "Dp": 2.149, "splay_angle": 20.272, "splay_distance": 3.499, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 177.517, "theta": -129.596, "eta_prime": -159.016, "theta_prime": -146.786, "eta_base": -110.074, "theta_base": -104.330, "v0": -19.732, "v1": 32.876, "v2": -32.796, "v3": 22.293, "v4": -1.843, "amplitude": 34.076, "phase_angle": 164.247, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -5.533, 0.617, -23.633 ], "x_axis": [ 0.694, 0.708, -0.133 ], "y_axis": [ -0.698, 0.706, 0.120 ], "z_axis": [ 0.179, 0.010, 0.984 ], "quaternion": [ 0.920, 0.030, 0.085, 0.382 ] } }, { "index": 31, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.870, "beta": 176.562, "gamma": 49.691, "delta": 115.869, "epsilon": -178.588, "zeta": -99.904, "epsilon_zeta": -78.684, "bb_type": "BI", "chi": -124.574, "glyco_bond": "anti", "C5prime_xyz": [ -2.346, 8.610, -1.484 ], "P_xyz": [ -0.151, 10.006, -1.320 ], "form": "B", "ssZp": 2.521, "Dp": 2.604, "splay_angle": 20.184, "splay_distance": 3.479, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 170.970, "theta": -156.311, "eta_prime": -166.862, "theta_prime": -163.623, "eta_base": -113.411, "theta_base": -125.990, "v0": -31.723, "v1": 28.356, "v2": -15.031, "v3": -2.626, "v4": 21.531, "amplitude": 31.226, "phase_angle": 118.775, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -4.028, 0.670, -20.474 ], "x_axis": [ 0.138, 0.981, 0.135 ], "y_axis": [ -0.977, 0.113, 0.183 ], "z_axis": [ 0.165, -0.157, 0.974 ], "quaternion": [ 0.746, 0.114, 0.010, 0.656 ] } }, { "index": 32, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -45.762, "beta": 159.488, "gamma": 61.604, "delta": 118.164, "epsilon": -165.504, "zeta": -109.823, "epsilon_zeta": -55.681, "bb_type": "BI", "chi": -130.492, "glyco_bond": "anti", "C5prime_xyz": [ -2.605, 8.724, -1.229 ], "P_xyz": [ -0.322, 9.974, -1.345 ], "form": "B", "ssZp": 2.447, "Dp": 2.480, "splay_angle": 19.591, "splay_distance": 3.386, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -175.625, "theta": -153.108, "eta_prime": -154.238, "theta_prime": -163.061, "eta_base": -112.066, "theta_base": -124.447, "v0": -37.541, "v1": 35.602, "v2": -20.719, "v3": -0.097, "v4": 23.435, "amplitude": 37.630, "phase_angle": 123.409, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -2.736, 0.311, -17.264 ], "x_axis": [ -0.341, 0.833, 0.436 ], "y_axis": [ -0.891, -0.435, 0.133 ], "z_axis": [ 0.300, -0.343, 0.890 ], "quaternion": [ 0.528, 0.225, -0.064, 0.816 ] } }, { "index": 33, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.546, "beta": 159.982, "gamma": 48.743, "delta": 112.189, "epsilon": 177.344, "zeta": -86.164, "epsilon_zeta": -96.491, "bb_type": "BI", "chi": -127.905, "glyco_bond": "anti", "C5prime_xyz": [ -2.572, 8.656, -1.405 ], "P_xyz": [ -0.332, 9.988, -1.433 ], "form": ".", "ssZp": 2.629, "Dp": 2.665, "splay_angle": 20.667, "splay_distance": 3.634, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 171.932, "theta": -147.351, "eta_prime": -167.278, "theta_prime": -157.034, "eta_base": -121.715, "theta_base": -108.635, "v0": -35.892, "v1": 29.881, "v2": -13.535, "v3": -6.496, "v4": 26.573, "amplitude": 34.851, "phase_angle": 112.853, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -1.175, -0.226, -14.308 ], "x_axis": [ -0.729, 0.390, 0.563 ], "y_axis": [ -0.519, -0.851, -0.083 ], "z_axis": [ 0.447, -0.352, 0.822 ], "quaternion": [ 0.246, 0.274, -0.118, 0.922 ] } }, { "index": 34, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.646, "beta": 170.640, "gamma": 50.478, "delta": 112.702, "epsilon": -165.695, "zeta": -88.007, "epsilon_zeta": -77.688, "bb_type": "BI", "chi": -134.338, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.792, -1.101 ], "P_xyz": [ -0.354, 10.255, -0.764 ], "form": ".", "ssZp": 2.608, "Dp": 2.643, "splay_angle": 16.959, "splay_distance": 3.157, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 179.609, "theta": -140.231, "eta_prime": -160.198, "theta_prime": -145.756, "eta_base": -103.693, "theta_base": -117.443, "v0": -36.095, "v1": 30.365, "v2": -14.050, "v3": -6.074, "v4": 26.404, "amplitude": 35.083, "phase_angle": 113.608, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -0.573, -0.535, -10.737 ], "x_axis": [ -0.869, -0.239, 0.434 ], "y_axis": [ 0.048, -0.913, -0.406 ], "z_axis": [ 0.493, -0.331, 0.804 ], "quaternion": [ -0.076, 0.245, -0.195, 0.947 ] } }, { "index": 35, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.668, "beta": 170.540, "gamma": 27.803, "delta": 121.915, "epsilon": 170.173, "zeta": -88.701, "epsilon_zeta": -101.126, "bb_type": "BI", "chi": -117.496, "glyco_bond": "anti", "C5prime_xyz": [ -2.931, 8.495, -1.706 ], "P_xyz": [ -1.264, 10.500, -1.563 ], "form": ".", "ssZp": 2.619, "Dp": 2.592, "splay_angle": 20.757, "splay_distance": 3.937, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 155.759, "theta": -155.003, "eta_prime": -176.772, "theta_prime": -165.480, "eta_base": -138.567, "theta_base": -134.050, "v0": -38.745, "v1": 38.919, "v2": -24.528, "v3": 3.104, "v4": 22.082, "amplitude": 39.845, "phase_angle": 127.994, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 0.090, -0.733, -7.657 ], "x_axis": [ -0.814, -0.577, 0.061 ], "y_axis": [ 0.486, -0.735, -0.474 ], "z_axis": [ 0.318, -0.357, 0.878 ], "quaternion": [ -0.287, 0.102, -0.224, 0.926 ] } }, { "index": 36, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.822, "beta": -171.569, "gamma": 48.500, "delta": 98.017, "epsilon": 179.230, "zeta": -86.626, "epsilon_zeta": -94.143, "bb_type": "BI", "chi": -139.318, "glyco_bond": "anti", "C5prime_xyz": [ -2.711, 8.804, -1.042 ], "P_xyz": [ -0.973, 10.721, -0.664 ], "form": ".", "ssZp": 3.038, "Dp": 3.041, "splay_angle": 21.271, "splay_distance": 3.676, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 176.491, "theta": -169.936, "eta_prime": -175.870, "theta_prime": -165.103, "eta_base": -137.158, "theta_base": -148.044, "v0": -36.560, "v1": 21.404, "v2": 0.271, "v3": -21.157, "v4": 36.448, "amplitude": 37.552, "phase_angle": 89.587, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -0.448, -1.128, -3.776 ], "x_axis": [ -0.499, -0.839, -0.217 ], "y_axis": [ 0.811, -0.364, -0.457 ], "z_axis": [ 0.304, -0.404, 0.862 ], "quaternion": [ -0.500, 0.026, -0.261, 0.825 ] } }, { "index": 37, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -59.697, "beta": -173.849, "gamma": 49.346, "delta": 142.359, "epsilon": -127.072, "zeta": 176.456, "epsilon_zeta": 56.471, "bb_type": "BII", "chi": -111.350, "glyco_bond": "anti", "C5prime_xyz": [ -2.599, 8.433, -1.673 ], "P_xyz": [ -0.553, 10.024, -1.344 ], "form": ".", "ssZp": 1.650, "Dp": 1.650, "splay_angle": 21.666, "splay_distance": 3.679, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -172.109, "theta": 175.264, "eta_prime": -154.888, "theta_prime": 174.606, "eta_base": -139.164, "theta_base": -133.287, "v0": -31.981, "v1": 43.937, "v2": -38.362, "v3": 21.122, "v4": 6.471, "amplitude": 43.219, "phase_angle": 152.574, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.182, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -0.423, -1.340, -0.106 ], "x_axis": [ -0.166, -0.899, -0.405 ], "y_axis": [ 0.967, -0.068, -0.246 ], "z_axis": [ 0.194, -0.432, 0.881 ], "quaternion": [ 0.642, 0.072, 0.233, -0.727 ] } }, { "index": 38, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.067, "beta": 130.986, "gamma": 50.237, "delta": 141.323, "epsilon": -170.814, "zeta": -98.585, "epsilon_zeta": -72.229, "bb_type": "BI", "chi": -114.013, "glyco_bond": "anti", "C5prime_xyz": [ -1.985, 8.491, -1.545 ], "P_xyz": [ 0.625, 8.448, -1.392 ], "form": "B", "ssZp": 2.079, "Dp": 2.122, "splay_angle": 19.447, "splay_distance": 3.317, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 165.440, "theta": -110.980, "eta_prime": -162.718, "theta_prime": -142.202, "eta_base": -112.145, "theta_base": -95.958, "v0": -22.029, "v1": 34.912, "v2": -33.964, "v3": 22.135, "v4": -0.302, "amplitude": 35.767, "phase_angle": 161.732, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.293, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 0.943, -1.384, 3.309 ], "x_axis": [ 0.534, -0.841, -0.082 ], "y_axis": [ 0.844, 0.537, -0.005 ], "z_axis": [ 0.049, -0.067, 0.997 ], "quaternion": [ 0.876, 0.017, 0.037, -0.481 ] } }, { "index": 39, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -56.226, "beta": 172.464, "gamma": 46.073, "delta": 137.815, "epsilon": -96.902, "zeta": 165.069, "epsilon_zeta": 98.029, "bb_type": "BII", "chi": -100.048, "glyco_bond": "anti", "C5prime_xyz": [ -2.899, 8.074, -2.179 ], "P_xyz": [ -0.797, 9.570, -2.612 ], "form": ".", "ssZp": 0.996, "Dp": 1.018, "splay_angle": 24.837, "splay_distance": 4.403, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": -167.204, "theta": 166.700, "eta_prime": -145.575, "theta_prime": 172.241, "eta_base": -95.000, "theta_base": -124.338, "v0": -33.303, "v1": 42.941, "v2": -35.678, "v3": 17.585, "v4": 9.529, "amplitude": 41.997, "phase_angle": 148.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 2.005, -2.529, 6.235 ], "x_axis": [ 0.942, -0.335, 0.017 ], "y_axis": [ 0.323, 0.920, 0.220 ], "z_axis": [ -0.090, -0.202, 0.975 ], "quaternion": [ 0.980, 0.108, -0.027, -0.168 ] } }, { "index": 40, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.529, "beta": 137.235, "gamma": 53.611, "delta": 152.210, "epsilon": -176.759, "zeta": -73.730, "epsilon_zeta": -103.028, "bb_type": "BI", "chi": -91.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.137, 7.770, -2.345 ], "P_xyz": [ 0.462, 7.525, -2.560 ], "form": ".", "ssZp": 1.845, "Dp": 1.940, "splay_angle": 22.682, "splay_distance": 3.952, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 156.724, "theta": -104.452, "eta_prime": -161.371, "theta_prime": -158.800, "eta_base": -104.601, "theta_base": -107.684, "v0": -15.696, "v1": 34.448, "v2": -39.119, "v3": 31.072, "v4": -9.912, "amplitude": 39.232, "phase_angle": 175.649, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.376, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 0.943, -0.886, 10.180 ], "x_axis": [ 0.788, 0.351, 0.506 ], "y_axis": [ -0.452, 0.887, 0.090 ], "z_axis": [ -0.417, -0.300, 0.858 ], "quaternion": [ 0.940, 0.104, -0.246, 0.214 ] } }, { "index": 41, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -116.351, "beta": 91.714, "gamma": 163.625, "delta": 149.616, "epsilon": -174.549, "zeta": 14.144, "epsilon_zeta": 171.307, "bb_type": "--", "chi": -152.961, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 8.604, 0.706 ], "P_xyz": [ -0.708, 10.156, -1.173 ], "form": "B", "ssZp": 1.446, "Dp": 2.068, "splay_angle": 19.199, "splay_distance": 2.963, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -114.693, "theta": -130.179, "eta_prime": -138.030, "theta_prime": -134.848, "eta_base": -83.206, "theta_base": -94.765, "v0": -17.845, "v1": 35.019, "v2": -37.968, "v3": 28.666, "v4": -7.026, "amplitude": 38.376, "phase_angle": 171.640, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 0.596, -1.216, 14.103 ], "x_axis": [ 0.283, 0.788, 0.546 ], "y_axis": [ -0.821, 0.494, -0.287 ], "z_axis": [ -0.496, -0.367, 0.787 ], "quaternion": [ 0.801, 0.025, -0.325, 0.502 ] } }, { "index": 42, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 177.471, "beta": 78.815, "gamma": 143.048, "delta": 135.148, "epsilon": -166.609, "zeta": -95.267, "epsilon_zeta": -71.342, "bb_type": "BI", "chi": -111.973, "glyco_bond": "anti", "C5prime_xyz": [ -2.166, 8.384, -1.736 ], "P_xyz": [ -1.940, 7.469, -4.183 ], "form": ".", "ssZp": 2.136, "Dp": 2.213, "splay_angle": 18.428, "splay_distance": 3.379, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 171.466, "theta": 131.782, "eta_prime": -178.464, "theta_prime": 170.752, "eta_base": -131.356, "theta_base": -142.190, "v0": -24.865, "v1": 34.109, "v2": -30.133, "v3": 16.634, "v4": 4.923, "amplitude": 33.820, "phase_angle": 152.995, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -1.267, -1.612, 16.373 ], "x_axis": [ -0.275, 0.918, 0.287 ], "y_axis": [ -0.945, -0.204, -0.254 ], "z_axis": [ -0.174, -0.341, 0.924 ], "quaternion": [ 0.601, 0.036, -0.192, 0.775 ] } }, { "index": 43, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.566, "beta": 165.279, "gamma": 35.258, "delta": 102.413, "epsilon": 170.062, "zeta": -80.937, "epsilon_zeta": -109.002, "bb_type": "BI", "chi": -124.902, "glyco_bond": "anti", "C5prime_xyz": [ -2.985, 8.516, -1.642 ], "P_xyz": [ -1.178, 10.385, -1.868 ], "form": ".", "ssZp": 2.833, "Dp": 2.859, "splay_angle": 21.089, "splay_distance": 3.864, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 159.483, "theta": -161.363, "eta_prime": -178.671, "theta_prime": -166.665, "eta_base": -131.277, "theta_base": -131.491, "v0": -39.357, "v1": 26.939, "v2": -5.688, "v3": -16.599, "v4": 35.206, "amplitude": 38.792, "phase_angle": 98.432, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -1.711, -1.398, 19.716 ], "x_axis": [ -0.691, 0.723, -0.013 ], "y_axis": [ -0.687, -0.662, -0.299 ], "z_axis": [ -0.225, -0.197, 0.954 ], "quaternion": [ 0.388, -0.065, -0.136, 0.909 ] } }, { "index": 44, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.640, "beta": 174.077, "gamma": 54.068, "delta": 106.563, "epsilon": -176.476, "zeta": -89.578, "epsilon_zeta": -86.898, "bb_type": "BI", "chi": -140.832, "glyco_bond": "anti", "C5prime_xyz": [ -2.752, 8.877, -0.918 ], "P_xyz": [ -0.830, 10.615, -0.596 ], "form": ".", "ssZp": 2.791, "Dp": 2.785, "splay_angle": 22.791, "splay_distance": 4.040, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": -175.384, "theta": -159.065, "eta_prime": -159.275, "theta_prime": -161.068, "eta_base": -118.083, "theta_base": -135.030, "v0": -39.809, "v1": 30.302, "v2": -10.449, "v3": -11.952, "v4": 32.471, "amplitude": 38.654, "phase_angle": 105.684, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -2.419, -0.528, 23.414 ], "x_axis": [ -0.944, 0.304, -0.130 ], "y_axis": [ -0.264, -0.929, -0.260 ], "z_axis": [ -0.200, -0.212, 0.957 ], "quaternion": [ 0.145, -0.084, -0.121, 0.978 ] } }, { "index": 45, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.714, "beta": -174.512, "gamma": 44.908, "delta": 124.745, "epsilon": 178.501, "zeta": -105.213, "epsilon_zeta": -76.286, "bb_type": "BI", "chi": -126.623, "glyco_bond": "anti", "C5prime_xyz": [ -2.447, 8.704, -1.269 ], "P_xyz": [ -0.536, 10.386, -0.676 ], "form": "B", "ssZp": 2.485, "Dp": 2.499, "splay_angle": 20.323, "splay_distance": 3.277, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 171.831, "theta": -163.612, "eta_prime": -168.680, "theta_prime": -163.761, "eta_base": -135.985, "theta_base": -123.809, "v0": -34.334, "v1": 36.628, "v2": -25.163, "v3": 6.256, "v4": 17.399, "amplitude": 36.673, "phase_angle": 133.327, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -2.627, 0.244, 27.374 ], "x_axis": [ -0.956, -0.164, -0.243 ], "y_axis": [ 0.213, -0.959, -0.188 ], "z_axis": [ -0.202, -0.232, 0.952 ], "quaternion": [ -0.096, -0.113, -0.107, 0.983 ] } }, { "index": 46, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.937, "beta": -165.129, "gamma": 40.121, "delta": 147.412, "epsilon": 178.465, "zeta": -94.891, "epsilon_zeta": -86.645, "bb_type": "BI", "chi": -104.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.691, 8.120, -1.853 ], "P_xyz": [ 0.578, 9.221, -1.180 ], "form": "B", "ssZp": 1.944, "Dp": 2.011, "splay_angle": 18.142, "splay_distance": 3.186, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 173.509, "theta": -129.473, "eta_prime": -165.507, "theta_prime": -145.582, "eta_base": -122.585, "theta_base": -106.660, "v0": -10.744, "v1": 27.743, "v2": -33.281, "v3": 27.951, "v4": -11.056, "amplitude": 33.281, "phase_angle": 180.291, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -3.302, 0.005, 30.572 ], "x_axis": [ -0.623, -0.729, -0.283 ], "y_axis": [ 0.750, -0.659, 0.046 ], "z_axis": [ -0.220, -0.184, 0.958 ], "quaternion": [ -0.411, -0.140, -0.038, 0.900 ] } }, { "index": 47, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.976, "beta": 178.584, "gamma": 39.770, "delta": 126.801, "epsilon": -172.171, "zeta": -110.323, "epsilon_zeta": -61.847, "bb_type": "BI", "chi": -107.850, "glyco_bond": "anti", "C5prime_xyz": [ -2.693, 8.295, -2.037 ], "P_xyz": [ -0.695, 9.960, -2.192 ], "form": "B", "ssZp": 2.346, "Dp": 2.426, "splay_angle": 18.301, "splay_distance": 3.156, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 169.358, "theta": -154.651, "eta_prime": -167.924, "theta_prime": -160.721, "eta_base": -120.901, "theta_base": -123.342, "v0": -32.535, "v1": 36.012, "v2": -25.907, "v3": 7.988, "v4": 15.197, "amplitude": 35.736, "phase_angle": 136.466, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -4.781, -0.925, 33.236 ], "x_axis": [ -0.136, -0.975, -0.178 ], "y_axis": [ 0.937, -0.185, 0.295 ], "z_axis": [ -0.321, -0.126, 0.939 ], "quaternion": [ 0.636, 0.166, -0.056, -0.752 ] } }, { "index": 48, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -46.370, "beta": 161.784, "gamma": 46.908, "delta": 134.128, "epsilon": -127.199, "zeta": 176.606, "epsilon_zeta": 56.195, "bb_type": "BII", "chi": -111.639, "glyco_bond": "anti", "C5prime_xyz": [ -2.882, 8.370, -1.771 ], "P_xyz": [ -0.720, 9.818, -1.960 ], "form": ".", "ssZp": 1.832, "Dp": 1.800, "splay_angle": 22.295, "splay_distance": 3.773, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -175.474, "theta": 170.907, "eta_prime": -157.524, "theta_prime": 168.336, "eta_base": -118.982, "theta_base": -144.800, "v0": -36.473, "v1": 43.786, "v2": -33.924, "v3": 14.001, "v4": 13.721, "amplitude": 42.733, "phase_angle": 142.547, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -6.095, -1.973, 35.908 ], "x_axis": [ 0.381, -0.921, -0.080 ], "y_axis": [ 0.837, 0.307, 0.453 ], "z_axis": [ -0.393, -0.240, 0.888 ], "quaternion": [ 0.803, 0.216, -0.097, -0.548 ] } }, { "index": 49, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.565, "beta": 122.604, "gamma": 54.525, "delta": 136.638, "epsilon": -168.146, "zeta": -103.741, "epsilon_zeta": -64.405, "bb_type": "BI", "chi": -130.147, "glyco_bond": "anti", "C5prime_xyz": [ -2.186, 8.745, -0.866 ], "P_xyz": [ 0.411, 8.792, -0.579 ], "form": "B", "ssZp": 2.153, "Dp": 2.267, "splay_angle": 20.765, "splay_distance": 3.400, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 162.152, "theta": -118.146, "eta_prime": -165.360, "theta_prime": -147.458, "eta_base": -118.106, "theta_base": -95.995, "v0": -29.434, "v1": 38.944, "v2": -33.256, "v3": 17.217, "v4": 7.389, "amplitude": 38.312, "phase_angle": 150.228, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.100, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -7.890, -1.207, 39.137 ], "x_axis": [ 0.649, -0.635, 0.419 ], "y_axis": [ 0.554, 0.772, 0.312 ], "z_axis": [ -0.521, 0.030, 0.853 ], "quaternion": [ 0.905, 0.078, -0.260, -0.329 ] } }, { "index": 50, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.881, "beta": 173.587, "gamma": 60.259, "delta": 137.245, "epsilon": -168.567, "zeta": -99.801, "epsilon_zeta": -68.766, "bb_type": "BI", "chi": -114.962, "glyco_bond": "anti", "C5prime_xyz": [ -2.230, 8.462, -1.584 ], "P_xyz": [ 0.199, 9.424, -1.512 ], "form": ".", "ssZp": 2.196, "Dp": 2.224, "splay_angle": 18.043, "splay_distance": 3.196, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 164.308, "theta": -130.016, "eta_prime": -164.313, "theta_prime": -147.712, "eta_base": -100.833, "theta_base": -107.530, "v0": -26.771, "v1": 36.830, "v2": -32.471, "v3": 17.971, "v4": 5.257, "amplitude": 36.439, "phase_angle": 153.014, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -8.939, -1.559, 42.352 ], "x_axis": [ 0.777, 0.125, 0.617 ], "y_axis": [ -0.112, 0.992, -0.059 ], "z_axis": [ -0.620, -0.023, 0.785 ], "quaternion": [ 0.943, -0.010, -0.328, 0.063 ] } }, { "index": 51, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -61.227, "beta": 170.352, "gamma": 47.529, "delta": 132.732, "epsilon": -108.418, "zeta": -164.837, "epsilon_zeta": 56.419, "bb_type": "BII", "chi": -111.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.847, 8.446, -1.836 ], "P_xyz": [ -0.788, 10.043, -2.042 ], "form": "B", "ssZp": 1.404, "Dp": 1.384, "splay_angle": 18.665, "splay_distance": 3.264, "splay_ratio": 0.169, "d22": 5.064, "d64": 3.832, "eta": -175.251, "theta": -159.501, "eta_prime": -156.562, "theta_prime": -156.939, "eta_base": -112.250, "theta_base": -123.834, "v0": -37.541, "v1": 43.982, "v2": -33.277, "v3": 12.772, "v4": 15.150, "amplitude": 43.018, "phase_angle": 140.675, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -9.860, -1.899, 45.393 ], "x_axis": [ 0.617, 0.667, 0.418 ], "y_axis": [ -0.599, 0.743, -0.299 ], "z_axis": [ -0.510, -0.066, 0.857 ], "quaternion": [ 0.897, -0.065, -0.259, 0.353 ] } }, { "index": 52, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/26", "linked_nts": [ "///C/25", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -34.858, "beta": 134.113, "gamma": 12.958, "delta": 138.082, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -76.307, "glyco_bond": "anti", "C5prime_xyz": [ -3.187, 7.334, -2.849 ], "P_xyz": [ -0.924, 8.487, -3.493 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -28.172, "v1": 38.589, "v2": -33.800, "v3": 18.510, "v4": 5.780, "amplitude": 38.087, "phase_angle": 152.553, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -12.288, -2.009, 47.572 ], "x_axis": [ 0.232, 0.944, 0.237 ], "y_axis": [ -0.913, 0.295, -0.283 ], "z_axis": [ -0.337, -0.150, 0.930 ], "quaternion": [ 0.784, -0.042, -0.183, 0.592 ] } } ], "num_hbonds": 380, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 8, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///A/8/N", "atom2_id": "///A/8/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 4, "atom2_serNum": 406, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/8/O", "atom2_id": "///A/59/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 13, "atom2_serNum": 15, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///A/9/O", "atom2_id": "///A/9/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 16, "atom2_serNum": 405, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/10/N", "atom2_id": "///A/59/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 16, "atom2_serNum": 435, "donAcc_type": "acceptable", "distance": 3.229, "atom1_id": "///A/10/N", "atom2_id": "///A/63/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 27, "atom2_serNum": 61, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 30, "atom2_serNum": 39, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/11/OD1", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 30, "atom2_serNum": 53, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/11/OD1", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 35, "atom2_serNum": 69, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 35, "atom2_serNum": 74, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///A/12/O", "atom2_id": "///A/16/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 35, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/12/O", "atom2_id": "///A/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 42, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 56, "atom2_serNum": 80, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 64, "atom2_serNum": 91, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 72, "atom2_serNum": 96, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 74, "atom2_serNum": 666, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///A/16/OG1", "atom2_id": "///A/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 74, "atom2_serNum": 699, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///A/16/OG1", "atom2_id": "///A/97/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 79, "atom2_serNum": 104, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 83, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 94, "atom2_serNum": 118, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 102, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/20/OD1", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 102, "atom2_serNum": 736, "donAcc_type": "acceptable", "distance": 2.390, "atom1_id": "///A/20/OD1", "atom2_id": "///A/101/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 103, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/20/OD2", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 103, "atom2_serNum": 1275, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/20/OD2", "atom2_id": "///A/170/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 107, "atom2_serNum": 3156, "donAcc_type": "questionable", "distance": 2.959, "atom1_id": "///A/21/O", "atom2_id": "///C/16/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 26, "atom1_serNum": 116, "atom2_serNum": 3156, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///A/22/OE1", "atom2_id": "///C/16/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 27, "atom1_serNum": 121, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/23/O", "atom2_id": "///A/103/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 121, "atom2_serNum": 3177, "donAcc_type": "questionable", "distance": 3.107, "atom1_id": "///A/23/O", "atom2_id": "///C/17/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 29, "atom1_serNum": 122, "atom2_serNum": 295, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/24/N", "atom2_id": "///A/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 125, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/24/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 127, "atom2_serNum": 3177, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///A/24/OG", "atom2_id": "///C/17/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 32, "atom1_serNum": 131, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 2.496, "atom1_id": "///A/25/O", "atom2_id": "///A/139/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 139, "atom2_serNum": 280, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/26/N", "atom2_id": "///A/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 142, "atom2_serNum": 277, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/26/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 150, "atom2_serNum": 1010, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///A/27/O", "atom2_id": "///A/135/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 155, "atom2_serNum": 263, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/28/N", "atom2_id": "///A/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 158, "atom2_serNum": 260, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/28/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 164, "atom2_serNum": 267, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/28/NH1", "atom2_id": "///A/42/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 164, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/28/NH1", "atom2_id": "///C/20/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 40, "atom1_serNum": 165, "atom2_serNum": 3251, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/28/NH2", "atom2_id": "///C/20/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 41, "atom1_serNum": 174, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/30/N", "atom2_id": "///A/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 177, "atom2_serNum": 247, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/30/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 183, "atom2_serNum": 3276, "donAcc_type": "standard", "distance": 2.358, "atom1_id": "///A/30/NH1", "atom2_id": "///C/21/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 44, "atom1_serNum": 184, "atom2_serNum": 3273, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/30/NH2", "atom2_id": "///C/21/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 45, "atom1_serNum": 188, "atom2_serNum": 3393, "donAcc_type": "acceptable", "distance": 3.430, "atom1_id": "///A/31/O", "atom2_id": "///C/101/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 46, "atom1_serNum": 196, "atom2_serNum": 214, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///A/32/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 199, "atom2_serNum": 201, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/32/OD1", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 200, "atom2_serNum": 252, "donAcc_type": "acceptable", "distance": 3.745, "atom1_id": "///A/32/ND2", "atom2_id": "///A/40/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 217, "atom2_serNum": 231, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/35/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 219, "atom2_serNum": 2387, "donAcc_type": "acceptable", "distance": 3.399, "atom1_id": "///A/35/OG", "atom2_id": "///B/4/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 51, "atom1_serNum": 220, "atom2_serNum": 2387, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/36/N", "atom2_id": "///B/4/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 225, "atom2_serNum": 2386, "donAcc_type": "acceptable", "distance": 3.422, "atom1_id": "///A/36/OG", "atom2_id": "///B/4/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 53, "atom1_serNum": 267, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/42/OE1", "atom2_id": "///B/7/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 54, "atom1_serNum": 268, "atom2_serNum": 568, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/42/OE2", "atom2_id": "///A/82/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 281, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/45/N", "atom2_id": "///A/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 284, "atom2_serNum": 556, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/45/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 299, "atom2_serNum": 555, "donAcc_type": "standard", "distance": 2.263, "atom1_id": "///A/46/OE1", "atom2_id": "///A/80/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 300, "atom2_serNum": 3209, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/46/NE2", "atom2_id": "///C/18/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 59, "atom1_serNum": 301, "atom2_serNum": 542, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/47/N", "atom2_id": "///A/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 304, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/47/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 314, "atom2_serNum": 3191, "donAcc_type": "acceptable", "distance": 3.940, "atom1_id": "///A/48/OG1", "atom2_id": "///C/17/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 62, "atom1_serNum": 316, "atom2_serNum": 529, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/49/N", "atom2_id": "///A/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 319, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/49/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 324, "atom2_serNum": 3136, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///A/50/N", "atom2_id": "///C/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 327, "atom2_serNum": 351, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/50/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 330, "atom2_serNum": 342, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/50/ND1", "atom2_id": "///A/52/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 334, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/51/N", "atom2_id": "///A/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 337, "atom2_serNum": 359, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/51/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 341, "atom2_serNum": 508, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/51/ND2", "atom2_id": "///A/74/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 354, "atom2_serNum": 374, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/53/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 358, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/53/OD2", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 362, "atom2_serNum": 390, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 371, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 377, "atom2_serNum": 407, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 385, "atom2_serNum": 415, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 393, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 402, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 402, "atom2_serNum": 435, "donAcc_type": "acceptable", "distance": 2.857, "atom1_id": "///A/59/O", "atom2_id": "///A/63/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 405, "atom2_serNum": 435, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///A/59/OD1", "atom2_id": "///A/63/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 410, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 418, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 418, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/61/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 423, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/61/NE2", "atom2_id": "///A/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 467, "atom2_serNum": 550, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/68/N", "atom2_id": "///A/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 470, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/68/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 482, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/70/N", "atom2_id": "///A/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 485, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/70/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 495, "atom2_serNum": 524, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///A/72/N", "atom2_id": "///A/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 500, "atom2_serNum": 2539, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///A/72/OG", "atom2_id": "///B/11/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 90, "atom1_serNum": 555, "atom2_serNum": 3212, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/80/NZ", "atom2_id": "///C/18/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 91, "atom1_serNum": 573, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/83/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 573, "atom2_serNum": 609, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 579, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/83/NH1", "atom2_id": "///B/6/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 94, "atom1_serNum": 581, "atom2_serNum": 2427, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/84/N", "atom2_id": "///B/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 95, "atom1_serNum": 584, "atom2_serNum": 609, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/84/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 595, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/85/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 599, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/85/OE1", "atom2_id": "///A/88/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 604, "atom2_serNum": 626, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 612, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 620, "atom2_serNum": 649, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 620, "atom2_serNum": 655, "donAcc_type": "questionable", "distance": 2.646, "atom1_id": "///A/88/O", "atom2_id": "///A/92/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 629, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 636, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 644, "atom2_serNum": 678, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 644, "atom2_serNum": 787, "donAcc_type": "acceptable", "distance": 3.274, "atom1_id": "///A/91/O", "atom2_id": "///A/107/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 652, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 660, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 686, "atom2_serNum": 787, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///A/95/OE2", "atom2_id": "///A/107/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 686, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.242, "atom1_id": "///A/95/OE2", "atom2_id": "///A/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 726, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///A/100/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 734, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/101/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 738, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/102/N", "atom2_id": "///A/208/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 741, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/102/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 741, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/102/O", "atom2_id": "///A/158/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 745, "atom2_serNum": 1191, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/102/OE1", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 746, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/102/NE2", "atom2_id": "///A/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 746, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/102/NE2", "atom2_id": "///A/208/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 750, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 755, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/103/NZ", "atom2_id": "///C/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 120, "atom1_serNum": 759, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 767, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 771, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 774, "atom2_serNum": 1033, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/106/OD1", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 774, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/106/OD1", "atom2_id": "///A/158/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 774, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/106/OD1", "atom2_id": "///A/158/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 779, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 791, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 800, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 808, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 819, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 828, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 832, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 3.820, "atom1_id": "///A/112/OE1", "atom2_id": "///A/133/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 837, "atom2_serNum": 863, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 842, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 859, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/116/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 866, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/117/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 891, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 900, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/121/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 906, "atom2_serNum": 912, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///A/122/N", "atom2_id": "///A/122/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 915, "atom2_serNum": 2406, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///A/122/NE2", "atom2_id": "///B/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 141, "atom1_serNum": 927, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 932, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 937, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 945, "atom2_serNum": 968, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 949, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 957, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 962, "atom2_serNum": 994, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 971, "atom2_serNum": 1002, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 979, "atom2_serNum": 1011, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 986, "atom2_serNum": 1155, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///A/133/O", "atom2_id": "///A/155/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 997, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/134/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1005, "atom2_serNum": 1025, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/135/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1019, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///A/137/O", "atom2_id": "///A/158/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1028, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/138/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1028, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/138/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1040, "atom2_serNum": 3198, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/139/ND2", "atom2_id": "///C/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 157, "atom1_serNum": 1041, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/140/N", "atom2_id": "///C/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 158, "atom1_serNum": 1070, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1072, "atom2_serNum": 1087, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///A/143/OG1", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1077, "atom2_serNum": 1104, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1085, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1090, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1117, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/150/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1143, "atom2_serNum": 1155, "donAcc_type": "acceptable", "distance": 3.602, "atom1_id": "///A/153/OD1", "atom2_id": "///A/155/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1216, "atom2_serNum": 1222, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///A/164/N", "atom2_id": "///A/164/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1242, "atom2_serNum": 1281, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1245, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/167/OD1", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1245, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/167/OD1", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1247, "atom2_serNum": 3390, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///A/168/N", "atom2_id": "///A/403/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 170, "atom1_serNum": 1250, "atom2_serNum": 1289, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1261, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1266, "atom2_serNum": 1948, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///A/169/NZ", "atom2_id": "///A/255/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1266, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/169/NZ", "atom2_id": "///A/256/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1270, "atom2_serNum": 1298, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1284, "atom2_serNum": 1309, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1284, "atom2_serNum": 1314, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///A/171/O", "atom2_id": "///A/175/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1292, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1292, "atom2_serNum": 1321, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///A/172/O", "atom2_id": "///A/176/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1301, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/174/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1301, "atom2_serNum": 1326, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1312, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1321, "atom2_serNum": 1973, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///A/176/OG", "atom2_id": "///A/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1325, "atom2_serNum": 2646, "donAcc_type": "questionable", "distance": 2.680, "atom1_id": "///A/177/O", "atom2_id": "///B/17/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 184, "atom1_serNum": 1326, "atom2_serNum": 1333, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/178/N", "atom2_id": "///A/178/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1329, "atom2_serNum": 1513, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///A/178/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1334, "atom2_serNum": 1527, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///A/178/OE2", "atom2_id": "///A/204/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1334, "atom2_serNum": 2625, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///A/178/OE2", "atom2_id": "///B/16/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 188, "atom1_serNum": 1338, "atom2_serNum": 2666, "donAcc_type": "questionable", "distance": 3.072, "atom1_id": "///A/179/O", "atom2_id": "///B/18/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 189, "atom1_serNum": 1339, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/180/N", "atom2_id": "///A/201/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1342, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/180/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1344, "atom2_serNum": 2666, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///A/180/OG", "atom2_id": "///B/18/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 192, "atom1_serNum": 1348, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/181/O", "atom2_id": "///A/298/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1356, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/182/N", "atom2_id": "///A/199/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1359, "atom2_serNum": 1475, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/182/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1359, "atom2_serNum": 2062, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/182/O", "atom2_id": "///A/269/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1367, "atom2_serNum": 1381, "donAcc_type": "acceptable", "distance": 3.889, "atom1_id": "///A/182/OH", "atom2_id": "///A/184/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1367, "atom2_serNum": 2705, "donAcc_type": "acceptable", "distance": 2.416, "atom1_id": "///A/182/OH", "atom2_id": "///B/20/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 198, "atom1_serNum": 1375, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/184/N", "atom2_id": "///A/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1378, "atom2_serNum": 1445, "donAcc_type": "questionable", "distance": 3.239, "atom1_id": "///A/184/O", "atom2_id": "///A/195/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1378, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/184/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1382, "atom2_serNum": 1465, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/184/ND2", "atom2_id": "///A/197/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1382, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/184/ND2", "atom2_id": "///B/21/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 203, "atom1_serNum": 1386, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/185/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1391, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/186/N", "atom2_id": "///A/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1394, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/186/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1404, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/188/N", "atom2_id": "///A/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1420, "atom2_serNum": 1431, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///A/190/OG", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1449, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/195/OE1", "atom2_id": "///C/5/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 209, "atom1_serNum": 1450, "atom2_serNum": 2937, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/195/NE2", "atom2_id": "///C/5/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 210, "atom1_serNum": 1465, "atom2_serNum": 2961, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///A/197/OE1", "atom2_id": "///C/6/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 211, "atom1_serNum": 1466, "atom2_serNum": 2958, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/197/NE2", "atom2_id": "///C/6/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 212, "atom1_serNum": 1482, "atom2_serNum": 1504, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///A/199/NE", "atom2_id": "///A/201/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1485, "atom2_serNum": 2716, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/199/NH2", "atom2_id": "///B/20/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 214, "atom1_serNum": 1486, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/200/N", "atom2_id": "///A/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1489, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/200/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1503, "atom2_serNum": 1810, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/201/OD1", "atom2_id": "///A/238/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1505, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/202/N", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1508, "atom2_serNum": 1792, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/202/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1516, "atom2_serNum": 1518, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///A/203/O", "atom2_id": "///A/203/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1520, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/204/N", "atom2_id": "///A/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1523, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/204/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1529, "atom2_serNum": 2626, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/205/N", "atom2_id": "///B/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 223, "atom1_serNum": 1532, "atom2_serNum": 1556, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/205/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1535, "atom2_serNum": 1547, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///A/205/ND1", "atom2_id": "///A/207/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1559, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/208/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1567, "atom2_serNum": 1593, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1572, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1580, "atom2_serNum": 1606, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///A/211/O", "atom2_id": "///A/214/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1588, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/212/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1604, "atom2_serNum": 1630, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1610, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1618, "atom2_serNum": 1650, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1618, "atom2_serNum": 1654, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/216/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1653, "atom2_serNum": 1894, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/220/O", "atom2_id": "///A/248/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1664, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/223/N", "atom2_id": "///A/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1667, "atom2_serNum": 1803, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/223/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1675, "atom2_serNum": 1826, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///A/223/OH", "atom2_id": "///A/240/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1684, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/225/N", "atom2_id": "///A/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1687, "atom2_serNum": 1784, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/225/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1701, "atom2_serNum": 1765, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/227/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1704, "atom2_serNum": 1762, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/227/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1712, "atom2_serNum": 1813, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///A/227/OH", "atom2_id": "///A/238/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1712, "atom2_serNum": 3003, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///A/227/OH", "atom2_id": "///C/8/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 244, "atom1_serNum": 1712, "atom2_serNum": 3023, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///A/227/OH", "atom2_id": "///C/9/O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 245, "atom1_serNum": 1721, "atom2_serNum": 1748, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/229/N", "atom2_id": "///A/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1724, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/229/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1736, "atom2_serNum": 1743, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/231/N", "atom2_id": "///A/231/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1812, "atom2_serNum": 2979, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///A/238/NH1", "atom2_id": "///C/7/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 249, "atom1_serNum": 1812, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/238/NH1", "atom2_id": "///C/8/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 250, "atom1_serNum": 1824, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/240/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1826, "atom2_serNum": 2947, "donAcc_type": "acceptable", "distance": 2.342, "atom1_id": "///A/240/OG1", "atom2_id": "///C/6/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 252, "atom1_serNum": 1831, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1837, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/242/N", "atom2_id": "///C/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 254, "atom1_serNum": 1840, "atom2_serNum": 1870, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1851, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1857, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1857, "atom2_serNum": 1895, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/244/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1860, "atom2_serNum": 1894, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/244/OD1", "atom2_id": "///A/248/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1865, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/245/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1898, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/249/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1906, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/250/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1914, "atom2_serNum": 1945, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/251/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1921, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/252/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1921, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/252/O", "atom2_id": "///A/256/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1984, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/260/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1988, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/261/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1988, "atom2_serNum": 2018, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///A/261/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1995, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/262/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2000, "atom2_serNum": 2666, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/262/NZ", "atom2_id": "///B/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 270, "atom1_serNum": 2004, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2012, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2021, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2024, "atom2_serNum": 2288, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/265/OD1", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2024, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/265/OD1", "atom2_id": "///A/301/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2024, "atom2_serNum": 2319, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/265/OD1", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2029, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2040, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2049, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2052, "atom2_serNum": 2319, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///A/268/OD1", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2057, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2071, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2077, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2086, "atom2_serNum": 2112, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2093, "atom2_serNum": 2120, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2098, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/274/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2103, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///A/274/NZ", "atom2_id": "///A/278/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2107, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/275/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2115, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/276/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2115, "atom2_serNum": 2162, "donAcc_type": "acceptable", "distance": 3.481, "atom1_id": "///A/276/O", "atom2_id": "///A/281/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2136, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/278/OE1", "atom2_id": "///A/280/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2141, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/279/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2150, "atom2_serNum": 2174, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/280/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2150, "atom2_serNum": 2179, "donAcc_type": "acceptable", "distance": 2.684, "atom1_id": "///A/280/O", "atom2_id": "///A/283/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2156, "atom2_serNum": 2162, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///A/281/N", "atom2_id": "///A/281/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2165, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///A/281/NE2", "atom2_id": "///C/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 296, "atom1_serNum": 2177, "atom2_serNum": 2200, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2179, "atom2_serNum": 2196, "donAcc_type": "acceptable", "distance": 3.222, "atom1_id": "///A/283/OG1", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2184, "atom2_serNum": 2208, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/284/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2193, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/285/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2199, "atom2_serNum": 2225, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/286/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2203, "atom2_serNum": 2233, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/287/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2211, "atom2_serNum": 2242, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/288/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2219, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2228, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2236, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/291/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2236, "atom2_serNum": 2264, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2245, "atom2_serNum": 2272, "donAcc_type": "standard", "distance": 3.753, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2258, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/294/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2263, "atom2_serNum": 2705, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/294/NZ", "atom2_id": "///B/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 310, "atom1_serNum": 2283, "atom2_serNum": 2305, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/297/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2291, "atom2_serNum": 2309, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/298/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2295, "atom2_serNum": 2686, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/298/ND2", "atom2_id": "///B/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 313, "atom1_serNum": 2296, "atom2_serNum": 2685, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/299/N", "atom2_id": "///B/19/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 314, "atom1_serNum": 2357, "atom2_serNum": 3380, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/2/O6", "atom2_id": "///C/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 2358, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/2/N1", "atom2_id": "///C/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 2360, "atom2_serNum": 3377, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///B/2/N2", "atom2_id": "///C/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 2360, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/2/N2", "atom2_id": "///C/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 2379, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/3/O6", "atom2_id": "///C/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 2379, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/3/O6", "atom2_id": "///C/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 2380, "atom2_serNum": 3358, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/3/N1", "atom2_id": "///C/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 2380, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/3/N1", "atom2_id": "///C/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 2382, "atom2_serNum": 3358, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/3/N2", "atom2_id": "///C/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 2398, "atom2_serNum": 2411, "donAcc_type": "questionable", "distance": 3.083, "atom1_id": "///B/4/O2", "atom2_id": "///B/5/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 2399, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/4/N3", "atom2_id": "///C/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 2401, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///B/4/O4", "atom2_id": "///C/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 2419, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/5/N3", "atom2_id": "///C/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 327, "atom1_serNum": 2421, "atom2_serNum": 3319, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/5/O4", "atom2_id": "///C/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 2439, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/6/N3", "atom2_id": "///C/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 2441, "atom2_serNum": 3298, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/6/O4", "atom2_id": "///C/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 330, "atom1_serNum": 2458, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///B/7/O2", "atom2_id": "///C/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 331, "atom1_serNum": 2459, "atom2_serNum": 3277, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/7/N3", "atom2_id": "///C/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 2461, "atom2_serNum": 3276, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/7/N4", "atom2_id": "///C/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 2477, "atom2_serNum": 3257, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///B/8/O2", "atom2_id": "///C/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 334, "atom1_serNum": 2478, "atom2_serNum": 3255, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/8/N3", "atom2_id": "///C/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 2480, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/8/N4", "atom2_id": "///C/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 2499, "atom2_serNum": 3234, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/9/N6", "atom2_id": "///C/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 2500, "atom2_serNum": 3232, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/9/N1", "atom2_id": "///C/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 338, "atom1_serNum": 2517, "atom2_serNum": 3215, "donAcc_type": "standard", "distance": 2.471, "atom1_id": "///B/10/O2", "atom2_id": "///C/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 339, "atom1_serNum": 2518, "atom2_serNum": 3213, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/10/N3", "atom2_id": "///C/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 2520, "atom2_serNum": 3212, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///B/10/N4", "atom2_id": "///C/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 2537, "atom2_serNum": 3192, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/11/N3", "atom2_id": "///C/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 342, "atom1_serNum": 2539, "atom2_serNum": 3191, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/11/O4", "atom2_id": "///C/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 2557, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/12/N3", "atom2_id": "///C/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 344, "atom1_serNum": 2559, "atom2_serNum": 3170, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/12/O4", "atom2_id": "///C/16/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 2579, "atom2_serNum": 3150, "donAcc_type": "standard", "distance": 3.684, "atom1_id": "///B/13/N6", "atom2_id": "///C/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 346, "atom1_serNum": 2580, "atom2_serNum": 3148, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/13/N1", "atom2_id": "///C/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 2598, "atom2_serNum": 3130, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/14/N3", "atom2_id": "///C/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 348, "atom1_serNum": 2600, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///B/14/O4", "atom2_id": "///C/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 349, "atom1_serNum": 2618, "atom2_serNum": 3109, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/15/N3", "atom2_id": "///C/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 350, "atom1_serNum": 2620, "atom2_serNum": 3086, "donAcc_type": "questionable", "distance": 2.795, "atom1_id": "///B/15/O4", "atom2_id": "///C/12/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 351, "atom1_serNum": 2620, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///B/15/O4", "atom2_id": "///C/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 2637, "atom2_serNum": 3089, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/16/O2", "atom2_id": "///C/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 2638, "atom2_serNum": 3087, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/16/N3", "atom2_id": "///C/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 354, "atom1_serNum": 2640, "atom2_serNum": 3086, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///B/16/N4", "atom2_id": "///C/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 355, "atom1_serNum": 2659, "atom2_serNum": 3066, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/17/N6", "atom2_id": "///C/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 356, "atom1_serNum": 2660, "atom2_serNum": 3064, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/17/N1", "atom2_id": "///C/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 357, "atom1_serNum": 2678, "atom2_serNum": 3046, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/18/N3", "atom2_id": "///C/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 358, "atom1_serNum": 2680, "atom2_serNum": 3045, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///B/18/O4", "atom2_id": "///C/10/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 2697, "atom2_serNum": 3026, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///B/19/O2", "atom2_id": "///C/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 2698, "atom2_serNum": 3024, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/19/N3", "atom2_id": "///C/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 361, "atom1_serNum": 2700, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///B/19/N4", "atom2_id": "///C/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 2719, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/20/N6", "atom2_id": "///C/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 363, "atom1_serNum": 2720, "atom2_serNum": 3001, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/20/N1", "atom2_id": "///C/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 364, "atom1_serNum": 2738, "atom2_serNum": 2983, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/21/N3", "atom2_id": "///C/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 2740, "atom2_serNum": 2982, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/21/O4", "atom2_id": "///C/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 2758, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/22/N3", "atom2_id": "///C/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 2760, "atom2_serNum": 2961, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///B/22/O4", "atom2_id": "///C/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 2778, "atom2_serNum": 2941, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/23/N3", "atom2_id": "///C/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 2780, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/23/O4", "atom2_id": "///C/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 370, "atom1_serNum": 2797, "atom2_serNum": 2810, "donAcc_type": "questionable", "distance": 3.169, "atom1_id": "///B/24/O2", "atom2_id": "///B/25/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 2798, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/24/N3", "atom2_id": "///C/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 372, "atom1_serNum": 2800, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/24/O4", "atom2_id": "///C/4/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 373, "atom1_serNum": 2820, "atom2_serNum": 2899, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/25/N6", "atom2_id": "///C/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 374, "atom1_serNum": 2821, "atom2_serNum": 2897, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/25/N1", "atom2_id": "///C/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 375, "atom1_serNum": 2841, "atom2_serNum": 2880, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///B/26/O6", "atom2_id": "///C/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 376, "atom1_serNum": 2842, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/26/N1", "atom2_id": "///C/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 2844, "atom2_serNum": 2877, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///B/26/N2", "atom2_id": "///C/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 2989, "atom2_serNum": 3400, "donAcc_type": "acceptable", "distance": 3.647, "atom1_id": "///C/8/OP2", "atom2_id": "///C/102/O2", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 379, "atom1_serNum": 3273, "atom2_serNum": 3396, "donAcc_type": "acceptable", "distance": 3.801, "atom1_id": "///C/21/N7", "atom2_id": "///C/101/O4", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 380, "atom1_serNum": 3295, "atom2_serNum": 3394, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///C/22/N7", "atom2_id": "///C/101/O2", "atom_pair": "N:O", "residue_pair": "nt:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9pz7", "num_aaChains": 1, "aaChains": "A=294", "num_naChains": 2, "naChains": "B=26,C=26", "num_atoms": 3446, "num_waters": 39, "num_metals": 2, "metals_desc": "Ca=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }